RU2708446C1 - Pichia pastoris yeast transformer producing phytase - Google Patents

Abstract

FIELD: microbiology; biotechnology.

SUBSTANCE: invention relates to microbiology and biotechnology. Produced is Pichia pastoris yeast transformer producing phytase from Citrobacter freundii, carrying an optimized synthetic gene in the chromosome that codes said phytase, the nucleotide sequence of which is given in sequence listing under number SEQ ID NO: 1.

EFFECT: present invention extends the range of phytase-producing recombinant microorganisms.

1 cl, 1 tbl, 2 ex, 2 dwg

Description

The invention relates to microbiology and biotechnology and for the production of transformants of the yeast Pichia pastoris capable of producing phytase.

Phosphorus is an important mineral nutrient for the growth and development of animals. In most sources of raw materials used in animal husbandry, such as, for example, grains and legumes, phosphorus is mainly contained in the form of phytate (myo-inositol hexakisphosphate) [Advanced Food Research, 1982, 28, 1-92.]. However, monogastric animals are not able to absorb phytate phosphorus due to the lack of the necessary enzyme in the digestive tract [Can J Anim Sci., 2013, 93, 9-21.]. In addition, phytates interfere with the efficient absorption of calcium, magnesium, zinc, iron, and other minerals of compound feeds, as well as bind proteins to inaccessible complexes for digestion [Current Topics In Nutraceutical Research, 2008, 6 (3), 131-144.].

Phytase enzymes (myo-inositol hexakisphosphate phosphohydrolase) hydrolyze phytate with the removal of phosphate groups and are successfully used as a feed additive, significantly increasing phosphorus uptake [J. Sci. Food Agric., 2015, 95, 878-896.]. They provide the release of not only phytate-bound phosphorus, but also proteins, macro- and micronutrients, increasing the nutritional properties of feed [British Poultry Science, 2004, 45 (1), 101-108.].

Currently, phytases are obtained microbiologically using recombinant producer strains and the need for industry for efficient producers is constantly increasing Afr. J. Biotechnol., 2009, 8 (17), 4229-4232.]. Most often, methylotrophic yeast Pichia pastoris is used for highly efficient production of heterologous proteins [J. Mol. Recognit., 2005, 18 (2), 119-138. doi: 10.1002 / jmr.687], which have powerful systems for the expression and secretion of recombinant proteins (including phytases) and for which nutrient media have been developed and a fermentation process using a high-density culture has been developed.

One of the ways to ensure highly efficient production of target proteins is to optimize the codon composition of the nucleotide sequences of genes encoding heterologous enzymes [Appl Microbiol Biotechnol., 2007, 74, 1074-1083, Appl Microbiol Biotechnol., 2006, 72 (5), 1039-47 .]. The essence of the method is as follows. Due to the degeneracy of the genetic code, the same amino acid can be encoded by several codons, and often it corresponds to several isoceptor tRNAs. The frequency of occurrence of different tRNAs in the cells of different organisms is not the same. Moreover, studies have shown that these frequencies positively correlate with the frequencies of codon use in the cells of the same organisms [Mol Biol Evol, 1985. 2 (1): p. 13-34.]. This circumstance is a definite obstacle to the translation process in the case of heterologous gene expression, since tRNA may be lacking for some codons of a foreign gene in recipient cells.

For the cells of many types of microorganisms, the frequencies of codons were found (http://www.kazusa.or.jp/codon/P.html). These data are used to optimize the nucleotide sequences of heterologous genes in order to increase expression efficiency.

Examples of using optimized synthetic nucleotide sequences to create producers of heterologous phytases based on Pichia pastoris yeast are known.

Synthetic phytase genes Citrobacter amalonaticus optimized for codon composition were obtained [Naval Forces Biotechnology, 2015, 15, 88.], Escherichia coli [J. Agric. Food Chem., 2013, 61 (25), 6007-6015., CN 102586294, CN 102943083], Peniophora lycii [Appl Microbiol Biotechnol., 2006, 72 (5), 1039-47.], Citrobacter braakii [Acta Microbiologica Sinica , 46 (6), 945-950.], Upon expression of which in P. pastoris, the productivity of some strains increased 2.0–2.9 times.

Using well-known optimization rules [Biotechnoi Annu Rev, 2007. 13: p. 27-42., Https://eu.idtdna.com/CodonOpt, https://www.genscript.com/tools/rare-codon-analysis] you can get different variants of the nucleotide sequences encoding the same enzyme, with this, integration into the chromosome of these sequences leads to significant differences in the level of their expression and production of the target heterologous enzyme. It has been shown [Microbial Cell Factories, 2012, 11, 61.] that the level of protein production when using two different variants of optimized cellobiohydrolase 2 gene sequences from Trichoderma reesei is 4 times different.

Different optimization options for the gene encoding the phytase from Citrobacter freundii were carried out in [Appl Biochem Biotechnol., 2010, 162, 2157-2165, Journal of Microbiological Methods, 2010, 81 (2), 147-152.], Which led to transformants with a productivity of 193.2 u / ml and 450 u / ml of culture fluid, respectively.

Thus, an important task is the creation of such a variant of the optimized nucleotide sequence of the heterologous gene, which will lead to an increase in the efficiency of its expression in the host strain.

The task of the invention is the expansion of the arsenal of recombinant microorganisms producing phytase.

The problem was solved by obtaining the yeast transformant P. pastoris, producing a phytase from Citrobacter freundii, carrying an optimized synthetic gene encoding the indicated phytase in the chromosome composition, the nucleotide sequence of which is listed in the sequence list under the number SEQ ID N0: 1.

Obtaining the inventive transformant involves the synthesis of an optimized synthetic phyCf-mod gene encoding phytase from C.freundii [AAR89622.1, GenBank], and its transformation into P. pastoris yeast cells using an expression cassette that includes an optimized gene promoter that works in yeast P pastoris, a signal peptide for secreting an enzyme into a culture fluid, a terminator, a marker gene, and preferably a site for homologous integration into a chromosome. Integration is carried out by both homologous and non-homologous recombination. The transformation of the expression cassette into P. pastoris yeast cells is carried out by any suitable method, for example, by electroporation [http://tools.thermofisher.com/content/sfs/manuals/pich_man.pfd] or by using polyethylene glycol or protoplasts [http: / /www.thermofisher.com/order/catalog/product/K173001].

The construction of expression cassettes is carried out by standard methods of genetic engineering [Rybchin V.N. Fundamentals of Genetic Engineering. - SPb .: SPbSTU, 1999, Sambrook J., Maniatis T., Fritsch E. Molecular cloning: a laboratory manual. - N.Y .: Cold Spring Harbor Laboratory, 1989.] using genetic elements suitable for work with Pichia pastoris yeast. As promoters, AOX1, DAS, FLD1, ICL1, PHO89, THI11, ADH1, ENO1, GUT1, GAP, TEF1, PGK1, GCW14, G1, G6 or others can be used [Appl Microbiol Biotechnoi (2014) 98: 5301-5317] . As signal peptides, the α-factor, PHO1, SUC2, PHA-E, KILM1, pGKL, CLY, CLY-L8, K28 pre-pro-toxin or others are used [Appl Microbiol Biotechnol (2014) 98: 5301-5317]. As selective markers, any suitable markers are used, for example, antibiotic resistance genes Zeocin, Geneticin (G418) or Blasticidin C, as well as complementary auxotrophic mutations in the Pichia pastoris genome, for example, HIS4, MET2, ADE1, ARG4, URA3, URA5, URA5, URA5 GUT1 [Yeast 2005; 22: 249-270]. As shoulders for homologous integration, for example, gene sequences AOX1, HIS4 [http://www.thermofisher.com/order/catalog/product/V17520] or other sequences homologous to regions of the Pichia pastoris yeast chromosome are used.

The invention is illustrated by the following figures.

FIG. 1 Expression cassette 1

FIG. 2 Expression cassette 2

Example 1. Construction of transformants of the yeast Pichia pastoris. containing optimized gene. encoding phytase from C. freundii

When designing an integrative expression cassette using the method of "fusion-PCR" [Gene. 1989 Apr 15; 77 (1): 61-8.].

The sequence of the gene encoding the phytase from C. freundii optimized using the above optimization rules is synthesized by the method described in [Journal of Microbiological Methods, 2010, 81 (2), 147-152.] And get the DNA sequence listed in the sequence listing under number SEQ ID NO: 1.

The resulting DNA sequence is integrated into the expression cassette 1 (Fig. 1), which includes the following genetic elements:

1. A gene integrated into a single reading frame with the nucleotide sequence of the α-factor signal peptide, under the control of the AOX1 promoter

2. Transcriptional terminator TTAOX1

3. Yeast selective marker HIS4, flanked by lox 66 and lox 71 sites, complementing the mutation in the HIS4 gene in Pichia pastoris yeast.

4. The area of integration is the nucleotide sequence of the AOX1 gene

The resulting integrative expression cassette is transformed into a strain of Pichia pastoris GS115 (his4 ^- ), which is previously grown in a liquid nutrient medium YP (wt.%: Yeast extract - 1, peptone - 2, water - the rest) with the addition of glucose (2 wt.%) to a concentration of 1 × 10 ⁸ cells per 1 ml. The cells are centrifuged, washed in ice-cold sterile water, and then in an ice-cold solution of 1M sorbitol. Then the cells are incubated in a 25 mm solution of dithiothreitol for 15 minutes and washed in an ice-cold solution of 1M sorbitol. Next, the cells are resuspended in an ice-cold solution of 1 M sorbitol at a concentration of 1-5 × 10 ⁹ cells per 1 ml. An aliquot of 40 μl of the cell suspension was transferred to chilled eppendorf, 400 ng of DNA of the expression integration cassette was added, and incubated in ice for 5 minutes. The mixture of cells and DNA is transferred to a pre-cooled cell for electroporation. Electroporation is carried out under the following conditions: 1.5 kV, 400 Ohms, 25 uF. After poreing, add 1 ml of ice-cold 1M sorbitol solution.

The selection of transformants is carried out for 5 days at a temperature of 30 ° C on an agar medium of the following composition (wt.%): Na ₂ HPO ₄ - 0.6; KH ₂ PO ₄ 0.3; NaCl - 0.05; NH ₄ Cl - 0.1; MgSO ₄ 7H ₂ O - 0.065; agar - 2; glucose - 2; CaCl ₂ - 0.07; biotin, mg - 0.0002; calcium pantothenate - 0.04; folic acid - 0,0002; niacin - 0.04; p-aminobenzoic acid - 0.02; pyridoxine hydrochloride - 0.04; riboflavin - 0.02; thiamine hydrochloride - 0.04; boric acid - 0.05; CuSO ₄ - 0.004; KJ - 0.01; FeCl ₃ - 0.02; sodium molybdate - 0.02; ZnSO ₄ - 0.04, water - the rest.

The presence of the target gene in the chromosomal DNA of the obtained transformants is determined by PCR using primers PhyCf-m-F gaagagcagaaeggtatgaaact, PhyCf-m-R ttattccgtaactgcacactc.

The presence of PCR fragments 1236 bp in size confirms the presence of a synthetic gene in the chromosome of the obtained transformants.

As a control sample, transformants using the native gene encoding phytase from C. freundii are used.

A DNA fragment containing the coding region of a native bacterial phytase gene from C. freundii is synthesized by PCR using the PhyCf-F gaggctgaagcttacgtagaattcgaagagcagaacggtatgaa and PhyCf-R aggcgaattaattcgcggccggccgcttctccccta gctg primers. As the matrix using the total DNA of the bacteria C. freundii.

The resulting DNA sequence is inserted into the expression cassette 2 (Fig. 2), which consists of the genetic elements indicated in the cassette 1.

The transformation of the expression cassette 2 and the selection of the obtained transformants is carried out as described above.

The presence of a native gene in the chromosomal DNA of the obtained transformants is determined by PCR using primers PhyCf-m-F gaagagcagaacggtatgaaact, PhyCf-m-R ttattccgtaactgcacactc.

The presence of PCR fragments 1236 bp in size confirms the presence of the native gene in the chromosome of the obtained transformants.

Example 2. Evaluation of the productivity of transformants of Pichia pastoris with optimized phytase gene from C. freundii

To assess the effect of optimization of the nucleotide composition of the gene on the phytase production level, ten Pichia pastoris transformants with optimized and native phytase genes from C. freundii are randomly selected and fermented.

The seed culture is grown in test tubes (50 ml) with 10 ml of YP liquid nutrient medium with the addition of glucose (2 wt.%) At 30 ° C for 24 hours on a shaker (250 rpm). Sowing the fermentation medium is carried out in a ratio of 1/10.

Fermentation is carried out at 30 ° C on a shaker (250 rpm) in YP medium supplemented with 1% glucose for 24 hours, then phytase gene expression is induced by adding methanol to a final concentration of 1% every 24 hours for 5 days.

The productivity of Pichia pastoris transformants is assessed by the level of phytase activity from C. freundii in the culture fluid. For this, at the end of fermentation, transformant cells are precipitated by centrifugation, and phytase activity is determined in the separated supernatant by the modified Fiske-Subarrow method [.J Microbiol Methods, 1999, 39 (1), 17-22.]. The results of measuring the productivity of transformants with an optimized phytase gene are presented in table. 1, from which it follows that the average productivity of Pichia pastoris transformants with an optimized phytase gene from C. freundii is 59% higher than that for Pichia pastoris transformants with a native C. freundii phytase gene.

Thus, the claimed invention allows to obtain transformants of Pichia pastoris with increased phytase productivity from C. freundii.

Claims (1)

The yeast transformant Pichia pastoris, producing a phytase from Citrobacter freundii, carrying an optimized synthetic gene encoding the indicated phytase in the chromosome composition, the nucleotide sequence of which is shown in the sequence listing under the number SEQ ID NO: 1.

Images