RU2751595C2 - Recombinant strain of pichia pastoris yeast - producer of escherichia coli phytase - Google Patents

Abstract

FIELD: biotechnology.SUBSTANCE: invention relates to a recombinant phytase-producing strain of the Pichia pastoris VKPM Y-4466 yeast. The proposed strain contains the HAC1 gene from Saccharomyces cerevisiae and multiple copies of an optimised sequence of the gene encoding Escherichia coli phytase in the chromosome.EFFECT: invention allows to expand the range of recombinant phytase-producing microorganisms.1 cl, 1 ex, 2 dwg

Description

The invention relates to microbiology and biotechnology and relates to the production of Pichia pastoris yeast strains capable of producing phytase.

Phosphorus is an essential mineral nutrient for the growth and development of animals. In most sources of raw materials used in livestock, such as cereals and legumes, phosphorus is mainly found in the form of phytate (myo-inositol hexakisphosphate) [Advanced Food Research, 1982, 28, 1-92.]. However, monogastric animals are unable to assimilate phytate phosphorus due to the lack of the necessary enzyme in the digestive tract [Can J Anim Sci., 2013, 93, 9-21.]. In addition, phytates interfere with the effective assimilation of calcium, magnesium, zinc, iron and other minerals in compound feed, and also bind proteins into complexes that are inaccessible for digestion [Current Topics In Nutraceutical Research, 2008, 6 (3), 131-144.].

Phytase enzymes (myo-inositol hexakisphosphate phosphohydrolase) hydrolyze phytate with the elimination of phosphate groups and are successfully used as a feed additive, significantly increasing the absorption of phosphorus [J. Sci. Food Agric., 2015, 95, 878-896.]. They provide the release of not only phytate-bound phosphorus, but also proteins, macro- and micronutrients, increasing the nutritional properties of feed [British Poultry Science, 2004, 45 (1), 101-108.].

Currently, phytases are obtained microbiologically using recombinant producer strains, the industry demand for which is constantly growing [Afr. J. Biotechnol., 2009,8 (17), 4229-4232.]. The methylotrophic yeast Pichia pastoris [J. Mol. Recognit., 2005, 18 (2), 119-138. doi: 10.1002 / jmr.687], which have powerful systems for the expression and secretion of recombinant proteins (including phytases) and for which culture media have been developed and the fermentation process has been developed using a high-density culture.

Various approaches are used to construct highly productive strains.

One of the ways to ensure effective production of target enzymes is to optimize the codon composition of the nucleotide sequences of genes encoding heterologous enzymes [Appl Microbiol Biotechnol., 2007, 74, 1074-1083, Appl Microbiol Biotechnol., 2006, 72 (5), 1039- 47.]. For the cells of microorganisms of many species, the frequencies of codon occurrence have been identified (http://www.kazusa.or.jp/codon/P.html), and these data are used to optimize the nucleotide sequences of heterologous genes in order to increase the expression efficiency.

Known examples of the use of optimized synthetic nucleotide sequences to create producers of heterologous phytases based on the yeast Pichia pastoris. Codon-optimized synthetic genes of Citrobacter amalonaticus phytases [BMC Biotechnology, 2015, 15, 88.], Escherichia coli [J. Agric. Food Chem., 2013, 61 (25), 6007-6015., CN 102586294, CN 102943083], Peniophora lycii [Appl Microbiol Biotechnol., 2006, 72 (5), 1039-47.], Citrobacter braakii [Acta Microbiologica Sinica , 46 (6), 945-950.], When expressed in P. pastoris, the productivity of some strains increased 2.0-2.9 times.

Different variants of optimization of the gene encoding phytase from Citrobacter freundii were carried out in [Appl Biochem Biotechnol., 2010, 162, 2157-2165, Journal of Microbiological Methods, 2010, 81 (2), 147-152.], Where the strains were obtained with a productivity of 193.2 U / ml and 450 U / ml of culture fluid.

Integration of the optimized gene encoding phytase from Escherichia coli into the P. pastoris chromosome resulted in a strain with a productivity of 237.2 U / ml of culture fluid, while the production of the P. pastoris strain carrying a similar native gene in the chromosome was 100 U / ml [J Microbiol. 2015; 8 (12): e27553].

Another way to obtain highly productive strains of P. pastoris is the introduction into the chromosome of multiple copies of genes in the composition of expression cassettes. It is known to obtain multi-copy strains of P. pastoris by sequential repeated introduction of DNA fragments into the chromosome of cells using the Cre-lox system [Scientific Reports, 2017, 7 (1), 1-10; FEMS Yeasts Research, 2011, 11 (3), 292-298]. The Cre-lox system is known as a site-specific recombinant technology, which allows multiple introduction of DNA fragments into the chromosome of microorganisms, and is widely used to introduce deletions, insertions, translocations and inversions into specific sites of cellular DNA [Journal of Biotechnology 131 (2007) p. 20-26; Nucleic Acids Research, 2002, V. 30, No. 6, p. 2-8].

Another approach to increasing the production of target proteins is the integration into the chromosome of P. pastoris of expression cassettes containing genes included in the cell response to unfolded protein (UPR - unfolded protein response) [Ecological Genetics, 2017, 15 (2), 21-30 ]. As such genes, in particular, a gene encoding protein disulfide isomerase (Pdi), which acts as a chaperone, inhibiting the aggregation of misfolded proteins; the HAC1 gene from Saccharomyces cerevisiae, encoding the UPR gene transcriptional activator, and others. Thus, in the work [BMC Biotechnology, 2015, 15:88], the HAC1 gene from S. cerevisiae was integrated into the chromosome of the recombinant P. pastoris strain producing phytase from Citrobacter amalonaticus, which led to an increase in productivity by 40% compared to the initial strain.

An important task is to create a highly efficient phytase-producing strain based on the P. pastoris yeast using all the approaches described above.

The objective of the claimed invention is to expand the arsenal of recombinant microorganisms that produce phytases.

The problem was solved by constructing a phytase-producing P. pastoris yeast strain containing in the chromosome the HAC1 gene from S. cerevisiae and multiple copies of the optimized sequence of the gene encoding E. coli phytase.

Recombinant strain obtained

- sequential integration into the chromosome of the Pichia pastoris (HIS4) VKPM Y-4334 strain of expression cassette 1, which includes an optimized sequence of the phyEc-mod gene encoding E. coli phytase;

- cleavage of the marker gene using the Cre-lox system;

- integration of an expression cassette 2 containing the HAC1 gene from S. cerevisiae.

The strain is a phytase producer and deposited at the Bioresource Center All-Russian Collection of Industrial Microorganisms (BRC VKPM) NRC "Kurchatov Institute" - GosNIIgenetics as Pichia pastoris F12H VKPM Y-4466.

Cultural and morphological characteristics of the inventive strain.

When cultivated at a temperature of 28 ° C for 48 hours on agar YP medium of the following composition (wt%): peptone-2, yeast extract -1, agar -2, water - the rest with the addition of glucose (2 wt%), cells have an oval shape, 3-4 µm in diameter. The cells bud, while budding is true, versatile. True mycelium is not formed. Sporulation occurs when the culture is incubated on an agar medium of the following composition (wt%): potassium chloride - 1.0, sodium acetate - 0.5, glucose -1.0, agar - 2.0, water - the rest. Asci have a tetrahedral shape, include 4 ascospores.

On agar medium YP with the addition of glucose (2 wt%), colonies of light beige color with a smooth edge, matte surface, lenticular profile, and pasty consistency. When growing in a liquid YP medium of the following composition (wt%): peptone-2, yeast extract -1, water - the rest with the addition of glucose (2 wt%), at 28 ° C for 24 h of cultivation - a cloudy liquid, sediment white, no coagulation, no parietal films.

Physiological and biochemical signs:

The strain is capable of growing in both aerobic and anaerobic conditions.

It is capable of using methanol, ethanol, glucose, glycerin, lactate, succinate as the only source of carbon; it is unable to assimilate maltose, sucrose, acetate, starch, lactose.

When cultivated in the presence of methanol, the strain is able to synthesize phytase.

The invention is illustrated by the following figures:

Fig. 1 Expression Cassette 1

FIG. 2 Expression Cassette 2

Example 1. Construction of a Pichia pastoris yeast strain. containing an optimized phyEc-mod gene encoding E. coli phytase

When constructing an integrative expression cassette using the method "fusion-PCR" [Gene. 1989 Apr 15; 77 (1): 61-8.].

The sequence of the phyEc-mod gene encoding E. coli phytase, optimized using the above optimization rules, is synthesized by a known method [Journal of Microbiological Methods, 2010, 81 (2), 147-152.].

The resulting DNA sequence was inserted into the 8830 bp expression cassette 1. (Fig. 1), which includes the following genetic elements:

1. Gene phyEc-mod, built into a single reading frame with the nucleotide sequence of the signal peptide α-factor, under the control of the modified AOX1 promoter [BMC Biotechnology. - 2015, - V. 15, - P. 88.].

2. TTAOX1 transcription terminator

3. Yeast selection marker HIS4, complementing a mutation in the HIS4 gene in the yeast Pichia pastoris, Cre-recombinase under the control of the AOX1 promoter, flanked by lox 66 and lox 71 sites

4. NS integration region - a fragment of the gene encoding 18S rRNA

Integrative expression cassette 1 is transformed into cells of the Pichia pastoris (HIS4 ^- ) VKPM Y-4334 strain, which are preliminarily grown in liquid YP nutrient medium supplemented with glucose (2 wt%) to a concentration of 1 × 10 ⁸ cells per 1 ml. The cells are separated by centrifugation, washed in ice-cold sterile water, and then in ice-cold 1M sorbitol solution. The cells are then incubated in 25 mM dithiothreitol solution for 15 minutes and washed in ice-cold 1 M sorbitol solution. Then the cells are resuspended in an ice-cold solution of 1 M sorbitol at a concentration of 1-5 × 10 ⁹ cells per ml. An aliquot of 40 μl of the cell suspension is transferred into a chilled Eppendorf, 400 ng of DNA expression integration cassette is added, and incubated on ice for 5 minutes. The mixture of cells and DNA is transferred to a pre-cooled electroporation cuvette. Electroporation is carried out under the following conditions: 1.5 kV, 400 Ohm, 25uF. After poration add 1 ml of ice-cold solution of 1M sorbitol.

The selection of transformants is carried out for 5 days at a temperature of 30 ° C on agar medium M9 of the following composition (wt.%): Na ₂ HPO ₄ - 0.6; KN ₂ PO ₄ - 0.3; NaCl - 0.05; NH ₄ Cl - 0.1; MgSO ₄ 7H ₂ O 0.065; agar - 2; glucose - 2; CaCl ₂ - 0.07; biotin, mg - 0.0002; calcium pantothenate - 0.04; folic acid - 0.0002; niacin - 0.04; p-aminobenzoic acid - 0.02; pyridoxine hydrochloride - 0.04; riboflavin - 0.02; thiamine hydrochloride - 0.04; boric acid - 0.05; CuSO ₄ 0.004; KJ 0.01; FeCl ₃ - 0.02; sodium molybdate - 0.02; ZnSO ₄ - 0.04, water - the rest.

The presence of the phyEc-mod gene in the chromosomal DNA of the obtained transformants is determined by PCR using the checking primers PhyEc-m-F catggcgtaagagcaccaac, PhyEc-m-R gcaggtattctagcctcgtt.

The presence of a PCR fragment with a size of 1172 bp. confirms the presence of a synthetic gene in the chromosome of the obtained transformants.

To select the most productive transformants, they are cultivated in a liquid fermentation nutrient medium according to the following scheme.

The inoculum culture is grown on schools with a dense YP nutrient medium supplemented with glucose (2 wt%) at 28 ° C for 48 hours. The fermentation medium is inoculated by washing (1 ml of YP medium) of the culture from the school into a flask (500 ml), containing 50 ml of YP medium containing 1% glucose.

Fermentation is carried out at 28 ° C on a shaker (250 rpm) for 24 hours. Then, phytase gene expression is induced by adding 1% methanol every 24 hours for 3 days.

The productivity of Pichia pastoris transformants is assessed by the activity of the phytase formed in the culture fluid. For this, the cells of the transformant are precipitated by centrifugation, and the supernatant is used to determine the phytase activity by the modified Fiske-Subarrow method [. J Microbiol Methods 1999,39 (1) 17-22.].

According to the results of fermentation, the most productive transformant Pichia pastoris is selected, and the cells are seeded to single colonies on complete YP medium with the addition of glucose (2 wt.%). The resulting colonies are then tested for HIS4 gene cleavage. To do this, each colony is subcultured on minimal M9 medium without and with the addition of histidine to a final concentration of 1 mg / ml. A colony is selected that grows on the medium with the addition of histidine and does not grow on the medium without its addition. Next, expression cassette 1 is again transformed into the selected cell colony as described above and all actions are repeated, selecting the most productive transformant that has lost the ability to grow on minimal M9 medium without the addition of histidine. The procedure is repeated several times.

An expression cassette 2, 5558 bp in size, containing the following genetic elements is transformed into the selected most productive transformant, as described above:

1. The HAC1 gene encoding HAC1 from S. cerevisiae under the control of the GAP promoter

2. TTAOX1 transcription terminator

3. Yeast selection marker HIS4, complementing the mutation in the HIS4 gene in the yeast Pichia pastoris

4. Integration area - 3 'fragment of the AOX1 gene

The presence of the HAC1 gene in the chromosomal DNA of the obtained transformants is determined by PCR using the checking primers HACprF atggaaatgactgattttgaactaacta, Prov-r tctaaggcgaattaattcgcggc.

The presence of a 743 bp PCR fragment confirms the presence of the HAC1 gene in the chromosome of the obtained transformants.

To select the most productive transformants, they are cultivated in a liquid fermentation nutrient medium according to the scheme described above.

According to the results of fermentation, the most productive transformant Pichia pastoris is selected, which, under the indicated conditions, synthesizes E. coli phytase at a concentration of 1020 U / ml of culture fluid.

The transformant was deposited at the Bioresource Center All-Russian Collection of Industrial Microorganisms (BRC VKPM) NRC "Kurchatov Institute" - GosNIIgenetics as Pichia pastoris F12H VKPM Y-4466.

Claims (1)

The recombinant strain of the yeast Pichia pastoris VKPM Y-4466 is a phytase producer containing the HAC1 gene from Saccharomyces cerevisiae in the chromosome and multiple copies of the optimized sequence of the gene encoding Escherichia coli phytase.

Images