RU2701498C1 - Recombinant yeast strain pichia pastoris - phytase producer - Google Patents
Recombinant yeast strain pichia pastoris - phytase producer Download PDFInfo
- Publication number
- RU2701498C1 RU2701498C1 RU2018145931A RU2018145931A RU2701498C1 RU 2701498 C1 RU2701498 C1 RU 2701498C1 RU 2018145931 A RU2018145931 A RU 2018145931A RU 2018145931 A RU2018145931 A RU 2018145931A RU 2701498 C1 RU2701498 C1 RU 2701498C1
- Authority
- RU
- Russia
- Prior art keywords
- phytase
- pichia pastoris
- recombinant yeast
- yeast strain
- strain
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/16—Yeasts; Culture media therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/03—Phosphoric monoester hydrolases (3.1.3)
Abstract
Description
Изобретение относится к микробиологии и биотехнологии и касается получения штаммов дрожжей Pichia pastoris, способных продуцировать фитазу.The invention relates to microbiology and biotechnology and for the production of strains of Pichia pastoris yeast capable of producing phytase.
Фосфор является важным минеральным питательным веществом для роста и развития животных. В большинстве источников сырья, используемого в животноводстве, такого, например, как зерновые и бобовые культуры, фосфор, в основном, содержится в форме фитата (мио-инозитол гексакисфосфат) [Advanced Food Research, 1982, 28, 1-92.]. Однако моногастричные животные не способны усваивать фитатный фосфор из-за отсутствия необходимого фермента в пищеварительном тракте [Can J Anim Sci., 2013, 93, 9-21.]. Кроме того, фитаты препятствуют эффективному усвоению кальция, магния, цинка, железа и других минеральных веществ комбикормов, а также связывают белки в недоступные для переваривания комплексы [Current Topics In Nutraceutical Research, 2008, 6(3), 131-144.].Phosphorus is an important mineral nutrient for the growth and development of animals. In most sources of raw materials used in animal husbandry, such as, for example, grains and legumes, phosphorus is mainly contained in the form of phytate (myo-inositol hexakisphosphate) [Advanced Food Research, 1982, 28, 1-92.]. However, monogastric animals are not able to absorb phytate phosphorus due to the lack of the necessary enzyme in the digestive tract [Can J Anim Sci., 2013, 93, 9-21.]. In addition, phytates interfere with the efficient assimilation of calcium, magnesium, zinc, iron, and other minerals of compound feeds, as well as bind proteins to complexes inaccessible for digestion [Current Topics In Nutraceutical Research, 2008, 6 (3), 131-144.].
Ферменты фитазы (мио-инозитол гексакисфосфат фосфогидролазы) гидролизуют фитат с отщеплением фосфатных групп и с успехом используются в качестве кормовой добавки, значительно повышая усвоение фосфора [J. Sci. Food Agric., 2015, 95, 878-896.]. Они обеспечивают высвобождение не только фитат-связанного фосфора, но также белков, макро- и микроэлементов, повышая питательные свойства кормов [British Poultry Science, 2004, 45(1), 101-108.].Phytase enzymes (myo-inositol hexakisphosphate phosphohydrolase) hydrolyze phytate with the removal of phosphate groups and are successfully used as a feed additive, significantly increasing the absorption of phosphorus [J. Sci. Food Agric., 2015, 95, 878-896.]. They provide the release of not only phytate-bound phosphorus, but also proteins, macro- and micronutrients, increasing the nutritional properties of feed [British Poultry Science, 2004, 45 (1), 101-108.].
В настоящее время фитазы получают микробиологическим путем с использованием рекомбинантных штаммов-продуцентов, потребность промышленности в которых постоянно растет [Afr. J. Biotechnol, 2009, 8(17), 4229-4232.]. Наиболее часто для высокоэффективной продукции гетерологичных белков используются метилотрофные дрожжи Pichia pastoris [J. Mol. Recognit., 2005, 18(2), 119-138. doi: 10.1002/jmr.687], которые обладают мощными системами экспрессии и секреции рекомбинантных белков (в том числе, фитаз) и для которых разработаны питательные среды и отработан процесс ферментации с использованием культуры высокой плотности.Currently, phytases are obtained microbiologically using recombinant producer strains, the demand for which is constantly growing [Afr. J. Biotechnol, 2009, 8 (17), 4229-4232.]. Most often, methylotrophic yeast Pichia pastoris is used for highly efficient production of heterologous proteins [J. Mol. Recognit., 2005, 18 (2), 119-138. doi: 10.1002 / jmr.687], which have powerful systems for the expression and secretion of recombinant proteins (including phytases) and for which nutrient media have been developed and a fermentation process using a high-density culture has been developed.
Одним из способов, позволяющих обеспечить эффективную продукцию целевых ферментов является оптимизация кодонового состава нуклеотидных последовательностей генов, кодирующих гетерологичные ферменты [Appl Microbiol Biotechnol, 2007, 74, 1074-1083, Appl Microbiol Biotechnol, 2006, 72(5), 1039-47.]. Суть способа заключается в следующем. Из-за вырожденности генетического кода одна и та же аминокислота может кодироваться несколькими кодонами, и зачастую ей соответствует несколько изоакцепторных тРНК. Частоты встречаемости разных тРНК в клетках различных организмов неодинаковы. Эти частоты положительно коррелируют с частотами использования кодонов в клетках тех же организмов [Mol Biol Evol, 1985. 2(1): p. 13-34.], что является определенным препятствием для процесса трансляции в случае гетерологичной экспрессии генов, поскольку в реципиентных клетках для некоторых кодонов чужеродного гена может не хватать тРНК.One of the ways to ensure efficient production of target enzymes is optimization of the codon composition of the nucleotide sequences of genes encoding heterologous enzymes [Appl Microbiol Biotechnol, 2007, 74, 1074-1083, Appl Microbiol Biotechnol, 2006, 72 (5), 1039-47.] . The essence of the method is as follows. Due to the degeneracy of the genetic code, the same amino acid can be encoded by several codons, and often it corresponds to several isoceptor tRNAs. The frequency of occurrence of different tRNAs in the cells of different organisms is not the same. These frequencies positively correlate with the frequencies of codon use in the cells of the same organisms [Mol Biol Evol, 1985. 2 (1): p. 13-34.], Which is a definite obstacle to the translation process in the case of heterologous gene expression, since tRNA may be lacking for some codons of a foreign gene in recipient cells.
Для клеток микроорганизмов многих видов выявлены частоты встречаемости кодонов (http://www.kazusa.or.jp/codon/P.html), и эти данные используют для оптимизации нуклеотидных последовательностей гетерологичных генов с целью увеличения эффективности экспрессии.For cells of microorganisms of many species, the frequencies of codons were found (http://www.kazusa.or.jp/codon/P.html), and these data are used to optimize the nucleotide sequences of heterologous genes in order to increase the efficiency of expression.
Известны примеры использования оптимизированных синтетических нуклеотидных последовательностей для создания продуцентов гетерологичных фитаз на основе дрожжей Pichia pastoris.Examples of using optimized synthetic nucleotide sequences to create producers of heterologous phytases based on Pichia pastoris yeast are known.
Получены оптимизированные по кодоновому составу синтетические гены фитаз Citrobacter amalonaticus [ВМС Biotechnology, 2015, 15, 88.], Escherichia coli [J. Agric. Food Chem., 2013, 61(25), 6007-6015., CN 102586294, CN 102943083], Peniophora lycii [Appl Microbiol Biotechnol, 2006, 72(5), 1039-47.], Citrobacter braakii [Acta Microbiologica Sinica, 46(6), 945-950.], при экспрессировании которых в P. pastoris продуктивность некоторых штаммов возросла в 2,0-2,9 раз.Synthetic phytase genes Citrobacter amalonaticus optimized for codon composition were obtained [Naval Forces Biotechnology, 2015, 15, 88.], Escherichia coli [J. Agric. Food Chem., 2013, 61 (25), 6007-6015., CN 102586294, CN 102943083], Peniophora lycii [Appl Microbiol Biotechnol, 2006, 72 (5), 1039-47.], Citrobacter braakii [Acta Microbiologica Sinica, 46 (6), 945-950.], When expressed in P. pastoris, the productivity of some strains increased 2.0–2.9 times.
Используя известные правила оптимизации [Biotechnol Annu Rev, 2007. 13: p. 27-42., https://eu.idtdna.com/CodonOpt, https://www.genscript.com/tools/rare-codon-analysis] получают различные варианты нуклеотидных последовательностей, кодирующих один и тот же фермент, при этом, интеграция в хромосому этих последовательностей приводит к существенным различиям в уровне их экспрессии и продукции целевого гетерологичного фермента. Так, в работе [Microbial Cell Factories, 2012, 11, 61.] показано, что уровень продукции белка при использовании двух различных вариантов оптимизированных последовательностей гена целлобиогидролазы 2 из Trichoderma reesei различается в 4 раза.Using well-known optimization rules [Biotechnol Annu Rev, 2007. 13: p. 27-42., Https://eu.idtdna.com/CodonOpt, https://www.genscript.com/tools/rare-codon-analysis] get different variants of the nucleotide sequences encoding the same enzyme, while , integration into the chromosome of these sequences leads to significant differences in the level of their expression and production of the target heterologous enzyme. Thus, it was shown in [Microbial Cell Factories, 2012, 11, 61.] that the level of protein production when using two different variants of optimized cellobiohydrolase 2 gene sequences from Trichoderma reesei differs by 4 times.
Разные варианты оптимизации гена, кодирующего фитазу из Citrobacter freundii, осуществлены в работах [Appl Biochem Biotechnol., 2010, 162, 2157-2165, Journal of Microbiological Methods, 2010, 81(2), 147-152.], что привело к получению трансформантов с продуктивностью 193,2 ед/мл и 450 ед/мл культуральной жидкости, соответственно.Different optimization options for the gene encoding the phytase from Citrobacter freundii were carried out in [Appl Biochem Biotechnol., 2010, 162, 2157-2165, Journal of Microbiological Methods, 2010, 81 (2), 147-152.], Which led to transformants with a productivity of 193.2 u / ml and 450 u / ml of culture fluid, respectively.
Таким образом, важной задачей является создание такого варианта оптимизированной нуклеотидной последовательности гетерологичного гена, который приведет к повышению эффективности ее экспрессии в штамме-хозяине.Thus, an important task is the creation of such a variant of the optimized nucleotide sequence of the heterologous gene, which will lead to an increase in the efficiency of its expression in the host strain.
Задачей заявляемого изобретения является расширение арсенала рекомбинантных микроорганизмов, продуцирующих фитазы.The task of the invention is the expansion of the arsenal of recombinant microorganisms producing phytase.
Задача решена путем получения штамма дрожжей P. pastoris, продуцирующего фитазу, содержащего в составе хромосомы оптимизированную последовательность гена, кодирующего фитазу С. freundii.The problem was solved by obtaining a strain of yeast P. pastoris producing phytase containing the optimized sequence of a gene encoding phytase C. freundii on the chromosome.
Рекомбинантный штамм получен путем интеграции в состав хромосомы штамма Pichia pastoris (HIS4-) Y-4334 экспрессионной кассеты, в состав которой входит оптимизированная последовательность гена, кодирующего фитазу С. freundii.The recombinant strain was obtained by integration into the chromosome of the strain Pichia pastoris (HIS4 - ) Y-4334 expression cassette, which includes an optimized sequence of a gene encoding phytase C. freundii.
Штамм является продуцентом фитазы и депонирован во Всероссийской Коллекции Промышленных Микроорганизмов (ВКПМ) НИЦ «Курчатовский институт» - ГосНИИгенетика как Pichia pastoris BCf9 ВКПМ Y-4484.The strain is a producer of phytase and is deposited in the All-Russian Collection of Industrial Microorganisms (VKPM) SIC "Kurchatov Institute" - GosNIIgenetika as Pichia pastoris BCf9 VKPM Y-4484.
Культурально-морфологические характеристики заявляемого штамма.Cultural and morphological characteristics of the claimed strain.
При культивировании при температуре 28°С в течение 48 часов на агаризованной среде YP следующего состава (мас. %: пептон - 2, дрожжевой экстракт - 1, агар - 2, вода - остальное) с добавлением глюкозы (2 мас. %), клетки имеют овальную форму, 3-4 мкм в диаметре. Клетки почкуются, при этом почкование истинное, многостороннее. Истинного мицелия не образуют. Споруляция происходит при инкубации культуры на агаризованной среде следующего состава (мас. %): хлорид калия - 1.0, ацетат натрия - 0.5, глюкоза - 1.0, агар - 2.0, вода - остальное. Аски имеют тетраэдрическую форму, включают 4 аскоспоры.When cultured at a temperature of 28 ° C for 48 hours on an agarized YP medium of the following composition (wt.%: Peptone - 2, yeast extract - 1, agar - 2, water - the rest) with the addition of glucose (2 wt.%), Cells have an oval shape, 3-4 microns in diameter. Cells are budded, while budding is true, versatile. True mycelium is not formed. Sporulation occurs when the culture is incubated on an agar medium of the following composition (wt.%): Potassium chloride - 1.0, sodium acetate - 0.5, glucose - 1.0, agar - 2.0, water - the rest. Askeys have a tetrahedral shape, include 4 ascospores.
На агаризованной среде YP с добавлением глюкозы (2 мас. %) колонии светло-бежевого цвета с ровным краем, матовой поверхностью, линзовидным профилем и пастообразной консистенцией. При росте в жидкой среде YP следующего состава (мас. %: пептон - 2, дрожжевой экстракт - 1, вода - остальное) с добавлением глюкозы (2 мас. %), при 28°С в течение 24 ч культивирования - жидкость мутная, осадок белый, коагуляции не наблюдается, пристеночных пленок не образует.On a YP agar medium supplemented with glucose (2 wt.%), The colonies are light beige with a smooth edge, a matte surface, a lenticular profile and a pasty consistency. When growing in a liquid medium YP of the following composition (wt.%: Peptone - 2, yeast extract - 1, water - the rest) with the addition of glucose (2 wt.%), At 28 ° C for 24 hours of cultivation, the liquid is cloudy, the precipitate white, coagulation is not observed, does not form parietal films.
Физиолого-биохимические признаки:Physiological and biochemical signs:
Трансформант способен к росту как в аэробных, так и в анаэробных условиях.The transformant is capable of growth in both aerobic and anaerobic conditions.
В качестве единственного источника углерода способен использовать метанол, этанол, глюкозу, глицерин, лактат, сукцинат, не способен ассимилировать мальтозу, сахарозу, ацетат, крахмал, лактозу.It is capable of using methanol, ethanol, glucose, glycerin, lactate, succinate as the sole carbon source; it is not able to assimilate maltose, sucrose, acetate, starch, and lactose.
При культивировании в присутствии метанола трансформанты способны синтезировать фитазу.When cultured in the presence of methanol, transformants are able to synthesize phytase.
Изобретение проиллюстрировано следующей фигурой.The invention is illustrated by the following figure.
Фиг. 1 Экспрессионная кассета 1FIG. 1 Expression cassette 1
Пример 1. Конструирование штамма дрожжей Pichia pastoris, содержащего оптимизированный ген, кодирующий фитазу С. freundiiExample 1. Construction of a strain of Pichia pastoris yeast containing an optimized gene encoding phytase C. freundii
При конструировании интегративной экспрессионной кассеты используют метод "фьюжн-ПЦР" [Gene. 1989 Apr 15;77(1):61-8.].When designing an integrative expression cassette using the method of "fusion-PCR" [Gene. 1989 Apr 15; 77 (1): 61-8.].
Последовательность гена, кодирующего фитазу С. freundii, оптимизированную с использованием вышеупомянутых правил оптимизации, синтезируют известным методом [Journal of Microbiological Methods, 2010, 81(2), 147-152.].The sequence of the gene encoding the C. freundii phytase, optimized using the above optimization rules, is synthesized by the known method [Journal of Microbiological Methods, 2010, 81 (2), 147-152.].
Полученную последовательность ДНК встраивают в экспрессионную кассету 1 (фиг. 1), в состав которой входят следующие генетические элементы:The resulting DNA sequence is inserted into the expression cassette 1 (Fig. 1), which includes the following genetic elements:
1. Ген, встроенный в единую рамку считывания с нуклеотидной последовательностью сигнального пептида α-фактора, под контролем модифицированного АОХ1 промотора [ВМС Biotechnology. - 2015, - V. 15, - Р. 88.].1. A gene integrated into a single reading frame with the nucleotide sequence of the α-factor signal peptide, under the control of a modified AOX1 promoter [Navy Biotechnology. - 2015, - V. 15, - R. 88.].
2. Терминатор транскрипции ТТАОХ12. Transcriptional terminator TTAOX1
3. Дрожжевой селективный маркер HIS4, фланкированный сайтами lox 66 и lox 71, комплементирующий у дрожжей Pichia pastoris мутацию в гене HIS4.3. Yeast selective marker HIS4, flanked by sites lox 66 and lox 71, complementing the mutation in the HIS4 gene in Pichia pastoris yeast.
4. Область интеграции - нуклеотидную последовательность гена АОХ14. The area of integration is the nucleotide sequence of the AOX1 gene
Интегративную экспрессионную кассету трансформируют в клетки штамма Pichia pastoris (HIS4-) Y-4334, которые предварительно выращивают в жидкой питательной среде YP с добавлением глюкозы (2 мас. %) до концентрации 1×108 клеток на 1 мл. Клетки отделяют центрифугированием, промывают в ледяной стерильной воде, а затем в ледяном растворе 1М сорбитола. Затем клетки инкубируют в 25 мМ растворе дитиотрейтола в течение 15 минут и промывают в ледяном растворе 1М сорбитола. Далее клетки ресуспендируют в ледяном растворе 1М сорбитола в концентрации 1-5×109 клеток на 1 мл. Аликвоту, объемом 40 мкл клеточной суспензии, переносят в охлажденный эппендорф, добавляют 400 нг ДНК экспрессионной интеграционной кассеты, и инкубируют во льду 5 минут. Смесь клеток и ДНК переносят в предварительно охлажденную кювету для электропорации. Электропорацию проводят при следующих условиях: 1,5 кВ, 400 Ом, 25uF. После порации добавляют 1 мл ледяного раствора 1М сорбитола.The integrative expression cassette is transformed into cells of the Pichia pastoris (HIS4 - ) Y-4334 strain, which are pre-grown in YP liquid medium supplemented with glucose (2 wt.%) To a concentration of 1 × 10 8 cells per 1 ml. Cells are separated by centrifugation, washed in ice-cold sterile water, and then in an ice-cold solution of 1M sorbitol. Then the cells are incubated in a 25 mm solution of dithiothreitol for 15 minutes and washed in an ice-cold solution of 1M sorbitol. Then the cells are resuspended in an ice-cold solution of 1M sorbitol at a concentration of 1-5 × 10 9 cells per 1 ml. An aliquot of 40 μl of the cell suspension was transferred to chilled eppendorf, 400 ng of DNA of the expression integration cassette was added, and incubated in ice for 5 minutes. The mixture of cells and DNA is transferred to a pre-cooled cell for electroporation. Electroporation is carried out under the following conditions: 1.5 kV, 400 Ohms, 25uF. After poreing, add 1 ml of ice-cold 1M sorbitol solution.
Селекцию трансформантов ведут в течение 5 суток при температуре 30°С на агаризованной среде следующего состава (мас. %): Na2HPO4 - 0,6; KH2PO4 - 0,3; NaCl - 0,05; NH4Cl - 0,1; MgSO4 7H2O - 0,065; агар - 2; глюкоза - 2; CaCl2 - 0,07; биотин, мг - 0,0002; кальций пантотенат - 0,04; фолиевая кислота - 0,0002; ниацин - 0,04; р-аминобензойная к-та - 0,02; пиридоксин гидрохлорид - 0,04; рибофлавин - 0,02; тиамин гидрохлорид - 0,04; борная кислота - 0,05; CuSO4 - 0,004; KJ - 0,01; FeCl3 - 0,02; натрий молибдат - 0,02; ZnSO4 - 0,04, вода - остальное.The selection of transformants is carried out for 5 days at a temperature of 30 ° C on an agar medium of the following composition (wt.%): Na 2 HPO 4 - 0.6; KH 2 PO 4 0.3; NaCl - 0.05; NH 4 Cl - 0.1; MgSO 4 7H 2 O - 0.065; agar - 2; glucose - 2; CaCl 2 - 0.07; biotin, mg - 0.0002; calcium pantothenate - 0.04; folic acid - 0,0002; niacin - 0.04; p-aminobenzoic acid - 0.02; pyridoxine hydrochloride - 0.04; riboflavin - 0.02; thiamine hydrochloride - 0.04; boric acid - 0.05; CuSO 4 - 0.004; KJ - 0.01; FeCl 3 - 0.02; sodium molybdate - 0.02; ZnSO 4 - 0.04, water - the rest.
Наличие целевого гена в составе хромосомной ДНК полученных трансформантов определяют методом ПЦР с использованием праймеров PhyCf-m-F gaagagcagaacggtatgaaact, PhyCf-m-R ttattccgtaactgcacactc.The presence of the target gene in the chromosomal DNA of the obtained transformants is determined by PCR using primers PhyCf-m-F gaagagcagaacggtatgaaact, PhyCf-m-R ttattccgtaactgcacactc.
Наличие ПЦР-фрагментов размером 1236 п.н. подтверждает присутствие синтетического гена в составе хромосомы полученных трансформантов.The presence of PCR fragments 1236 bp in size confirms the presence of a synthetic gene in the chromosome of the obtained transformants.
Для отбора наиболее продуктивных трансформантов проводят их культивирование в жидкой ферментационной питательной среде.To select the most productive transformants, they are cultured in a liquid fermentation nutrient medium.
Посевную культуру выращивают в пробирках (50 мл) с 10 мл жидкой питательной среды YP с добавлением глюкозы (2 мас. %) при 28°С в течение 24 ч на качалке (250 об/мин). Посев ферментационной среды осуществляют в соотношении 1/10.The seed culture is grown in test tubes (50 ml) with 10 ml of YP liquid nutrient medium with the addition of glucose (2 wt.%) At 28 ° C for 24 hours on a shaker (250 rpm). Sowing the fermentation medium is carried out in a ratio of 1/10.
Ферментацию проводят в колбах при 28°С на качалке (250 об/мин) в питательной среде YP с добавлением 2% глицерина в течение 24 ч. Экспрессию гена фитазы индуцируют путем добавления 0,5% метанола, через три часа 0,5% метанола, далее 1% метанола каждые 24 часа в течение 4 дней.Fermentation is carried out in flasks at 28 ° C on a shaker (250 rpm) in YP medium supplemented with 2% glycerol for 24 hours. Phytase gene expression is induced by adding 0.5% methanol, after three hours 0.5% methanol , then 1% methanol every 24 hours for 4 days.
Продуктивность трансформантов Pichia pastoris оценивают по активности фитазы, образовавшейся в культуральной жидкости. Для этого клетки трансформанта осаждают центрифугированием, а супернатант используют для определения фитазной активности модифицированным методом Фиске-Субарроу [. J Microbiol Methods, 1999, 39(1), 17-22.].The productivity of Pichia pastoris transformants is evaluated by the activity of phytase formed in the culture fluid. For this, transformant cells are precipitated by centrifugation, and the supernatant is used to determine the phytase activity by the modified Fiske-Subarrow method [. J Microbiol Methods, 1999, 39 (1), 17-22.].
По результатам ферментации отбирают наиболее продуктивный трансформант, который в указанных условиях синтезирует фитазу С. freundii в концентрации 1403 ед./мл культуральной жидкости.According to the results of fermentation, the most productive transformant is selected, which under these conditions synthesizes the phytase C. freundii at a concentration of 1403 units / ml of culture fluid.
Трансформант депонирован во Всероссийской Коллекции Промышленных Микроорганизмов (ВКПМ) НИЦ «Курчатовский институт» - ГосНИИгенетика как Pichia pastoris BCf9 ВКПМ Y-4484.The transformant was deposited in the All-Russian Collection of Industrial Microorganisms (VKPM) SIC "Kurchatov Institute" - GosNIIgenetika as Pichia pastoris BCf9 VKPM Y-4484.
Claims (1)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2018145931A RU2701498C1 (en) | 2018-12-24 | 2018-12-24 | Recombinant yeast strain pichia pastoris - phytase producer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2018145931A RU2701498C1 (en) | 2018-12-24 | 2018-12-24 | Recombinant yeast strain pichia pastoris - phytase producer |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| RU2701498C1 true RU2701498C1 (en) | 2019-09-26 |
Family
ID=68063482
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| RU2018145931A RU2701498C1 (en) | 2018-12-24 | 2018-12-24 | Recombinant yeast strain pichia pastoris - phytase producer |
Country Status (1)
| Country | Link |
|---|---|
| RU (1) | RU2701498C1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2737623C1 (en) * | 2019-12-03 | 2020-12-01 | Акционерное Общество "Биоамид" | Recombinant pichia pastoris yeast strain with increased production of escherichia coli phytase |
| RU2737621C1 (en) * | 2019-12-03 | 2020-12-01 | Акционерное Общество "Биоамид" | Pichia pastoris yeast transformer, producing escherichia coli phytase |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2409670C1 (en) * | 2009-07-10 | 2011-01-20 | Федеральное государственное унитарное предприятие "Государственный научно-исследовательский институт генетики и селекции промышленных микроорганизмов" (ФГУП ГосНИИгенетика) | Recombinant plasmid for phytase gene expression in pichia pastoris yeast (versions), pichia pastoris yeast strain -phytase producer (versions) |
| CN102586294A (en) * | 2011-01-12 | 2012-07-18 | 上海市农业科学院 | High-specific activity phytase gene suitable for pichia pastoris expression as well as preparation method and expression thereof |
| RU2472855C2 (en) * | 2009-12-15 | 2013-01-20 | Федеральное государственное унитарное предприятие "Государственный научно-исследовательский институт генетики и селекции промышленных микроорганизмов" (ФГУП ГосНИИгенетика) | MUTANT RECOMBINANT THERMALLY STABLE PHYTASE (VERSIONS), DNA FRAGMENT CODING SAID PHYTASE (VERSIONS) Pichia pastoris STRAIN - PRODUCER OF SAID PHYTASE (VERSIONS) |
-
2018
- 2018-12-24 RU RU2018145931A patent/RU2701498C1/en active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2409670C1 (en) * | 2009-07-10 | 2011-01-20 | Федеральное государственное унитарное предприятие "Государственный научно-исследовательский институт генетики и селекции промышленных микроорганизмов" (ФГУП ГосНИИгенетика) | Recombinant plasmid for phytase gene expression in pichia pastoris yeast (versions), pichia pastoris yeast strain -phytase producer (versions) |
| RU2472855C2 (en) * | 2009-12-15 | 2013-01-20 | Федеральное государственное унитарное предприятие "Государственный научно-исследовательский институт генетики и селекции промышленных микроорганизмов" (ФГУП ГосНИИгенетика) | MUTANT RECOMBINANT THERMALLY STABLE PHYTASE (VERSIONS), DNA FRAGMENT CODING SAID PHYTASE (VERSIONS) Pichia pastoris STRAIN - PRODUCER OF SAID PHYTASE (VERSIONS) |
| CN102586294A (en) * | 2011-01-12 | 2012-07-18 | 上海市农业科学院 | High-specific activity phytase gene suitable for pichia pastoris expression as well as preparation method and expression thereof |
Non-Patent Citations (3)
| Title |
|---|
| ГОРДЕЕВА Т.Л. И ДР. Рекомбинантный продуцент кормового фермента фитазы на основе дрожжей Pichia pastoris. Актуальная биотехнология, 2018, N/3(26), с. 117. * |
| ГОРДЕЕВА Т.Л. И ДР. Рекомбинантный продуцент кормового фермента фитазы на основе дрожжей Pichia pastoris. Актуальная биотехнология, 2018, N/3(26), с. 117. ГОРДЕЕВА Т.Л. И ДР. Сравнительный анализ эффективности экспрессии генов бактериальных фитаз в дрожжах Pichia pastoris с помощью чашечного теста. Биотехнология, 2017, Т.33, N. 6, с. 83-88. * |
| ГОРДЕЕВА Т.Л. И ДР. Сравнительный анализ эффективности экспрессии генов бактериальных фитаз в дрожжах Pichia pastoris с помощью чашечного теста. Биотехнология, 2017, Т.33, N. 6, с. 83-88. * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2737623C1 (en) * | 2019-12-03 | 2020-12-01 | Акционерное Общество "Биоамид" | Recombinant pichia pastoris yeast strain with increased production of escherichia coli phytase |
| RU2737621C1 (en) * | 2019-12-03 | 2020-12-01 | Акционерное Общество "Биоамид" | Pichia pastoris yeast transformer, producing escherichia coli phytase |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP2000514286A (en) | DNA sequence encoding phytase of rumen microorganism | |
| AU2018202269A1 (en) | Endogenous dnase activity to reduce dna content | |
| JP2022515531A (en) | Pichia pastoris mutant strain for expressing foreign genes | |
| RU2701498C1 (en) | Recombinant yeast strain pichia pastoris - phytase producer | |
| US11339397B2 (en) | Expression of phytase in Aspergillus niger | |
| CN102392002A (en) | Improved escherichia coli phytase HTP6M and gene and application thereof | |
| CN107257851A (en) | Positive influences are natural or combination of bacterial chaperonin of physiology of eukaryotic of engineering | |
| RU2737623C1 (en) | Recombinant pichia pastoris yeast strain with increased production of escherichia coli phytase | |
| Selvamohan et al. | Optimization of phytase production by Pseudomonas Sp. Isolated from poultry faces | |
| KR102100650B1 (en) | Novel microalgal strain of Thraustochytrium genus, and producing polyunsaturated fatty acids using the same | |
| Ajith et al. | Immobilised phytase production from Aspergillus foetidus MTCC 11682 using an optimized media | |
| RU2751595C2 (en) | Recombinant strain of pichia pastoris yeast - producer of escherichia coli phytase | |
| RU2708446C1 (en) | Pichia pastoris yeast transformer producing phytase | |
| RU2756330C1 (en) | Komagataella phaffii yeast transformant that produces cronobacter turicensis phytase | |
| RU2785901C1 (en) | Recombinant strain of ogataea haglerorum yeast - producer of escherichia coli phytase | |
| RU2737621C1 (en) | Pichia pastoris yeast transformer, producing escherichia coli phytase | |
| CN113122461A (en) | Single cell protein producing strain and its application | |
| RU2771079C1 (en) | Yeast transformant ogataea haglerorum - producer of phytase escherichia coli | |
| RU2771582C1 (en) | Komagataella phaffi yeast transformant - citrobacter gillenii phytase producer | |
| Xuan et al. | Cloning and over Expression of an Aspergillus niger XP Phytase Gene (phyA) in Pichia pastoris | |
| KR20210003007A (en) | Novel promoter HASP1 of Phaeodactylum tricornutum and signal peptide thereof and uses thereof | |
| US7550281B2 (en) | Method for production of alpha-amylase in recombinant Bacillus | |
| KR102202504B1 (en) | A modified Pseudomonas fluorescens producing phospholipase A1 and use thereof | |
| Ries et al. | Progressive screening of thermostable yeasts for phytase production | |
| RU2764793C1 (en) | Yeast transformant ogataea haglerorum producing beta-mannanase, containing synthetic mans gene in chromosome |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PC41 | Official registration of the transfer of exclusive right |
Effective date: 20200731 |
|
| QB4A | Licence on use of patent |
Free format text: LICENCE FORMERLY AGREED ON 20200924 Effective date: 20200924 |