RU2725210C1 - Test system for identification of dna tissue of common quail (coturnix coturnix) in dry fodder and semi-finished meat products - Google Patents
Test system for identification of dna tissue of common quail (coturnix coturnix) in dry fodder and semi-finished meat products Download PDFInfo
- Publication number
- RU2725210C1 RU2725210C1 RU2019133079A RU2019133079A RU2725210C1 RU 2725210 C1 RU2725210 C1 RU 2725210C1 RU 2019133079 A RU2019133079 A RU 2019133079A RU 2019133079 A RU2019133079 A RU 2019133079A RU 2725210 C1 RU2725210 C1 RU 2725210C1
- Authority
- RU
- Russia
- Prior art keywords
- coturnix
- bacteriophage
- control sample
- dna
- genome
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Изобретение относится к ветеринарной микробиологии, в частности к методам определения видовой принадлежности мяса с помощью полимеразной цепной реакции.The invention relates to veterinary microbiology, in particular to methods for determining the species of meat using polymerase chain reaction.
Известно использование тест- системы при проведении ПНР в реальном времени для определения ДНК тканей животных в мясном продукте (CN 108624659A, кл C12G 1/6851, 2018 г.).It is known to use a test system in real-time PNR for determining the DNA of animal tissues in a meat product (CN 108624659A,
Также известен набор (патент CN 106435008, C12N 15/11, 2017 г.) содержащий специфичные для участка генома ДНК перепелов олигонуклеотидных праймеров и зондов. Однако известный набор используют для обнаружения полов перепелов (cotuenix coturnix).A kit is also known (patent CN 106435008, C12N 15/11, 2017) containing quail-specific oligonucleotide primers and probes specific for the DNA genome region. However, the known kit is used to detect quail sexes (cotuenix coturnix).
Наиболее близким по технической сущности является техническое решение (патент РФ №2680094, кл. C12Q 1/68, G01N 33/569, 2019 г.) включающее буфер для проведения полимеразной цепной реакции, смесь для ее проведения состоящая из дезоксинуклеозидтрифосфатов, олигонуклеотидных праймеров и флуоресцентных зондов специфичные для участка генома животного и для внутреннего контрольного образца; смесь ферментов из ДНК полимеразы с антителами, ингибирующих активность фермента, TAQ POLYMERASE, внутренний контрольный образец в виде суспензии бактериофага Т4 с концентрацией 5×103 фаговых частиц на 1 мкл, отрицательный контрольный образец, представляющий собой смесь рекомбинантных плазмидных ДНК, содержащую фрагмент генома животного и фрагмент генома бактериофага Т4 с нуклеотидной последовательностью:The closest in technical essence is the technical solution (RF patent No. 2680094,
- прямой праймер - direct primer
- обратный праймер - reverse primer
- зонд, - probe
взятых в объемном соотношении 1:1.taken in a volume ratio of 1: 1.
Недостатком известного технического решения является отсутствие возможности выявления ДНК ткани перепелки в кормах и пищевых продуктах, недостаточная точность из-за использования суспензии бактериофага, которая требует предварительную обработку, включая центрифугирование, концентрирование и перевод в определенный буферный раствор, что влечет за собой значительную трудоемкость и финансовые затраты, а также использование генома бактериофага Т4 с возможными повреждениями, после исследования, что также влияет на точность выявления объекта.A disadvantage of the known technical solution is the inability to detect quail tissue DNA in feed and food products, lack of accuracy due to the use of a bacteriophage suspension, which requires pre-treatment, including centrifugation, concentration and transfer to a specific buffer solution, which entails considerable laboriousness and financial costs, as well as the use of the genome of the bacteriophage T4 with possible damage, after the study, which also affects the accuracy of identification of the object.
Техническим результатом является расширение функциональных возможностей и повышение точности идентификации видовой принадлежности ткани перепелки, упрощение процесса подготовки внутреннего контроля и уменьшение стоимости этого процесса.The technical result is to expand the functionality and increase the accuracy of identification of the species affiliation of quail tissue, simplifying the process of preparing internal control and reducing the cost of this process.
Технический результат достигается тем, что в тест-системе для идентицикации ДНК ткани перепелки обыкновенной Coturnix coturnix) в сухих кормах и мясных полуфабрикатах, включающей буфер для проведения полимеразной цепной реакции, смесь для ее проведения, состоящая из дезоксинуклеозидтрифосфатов, олигонуклеотидных праймеров и флуоресцентных зондов специфичные для участка генома животного и для внутреннего контрольного образца; смесь ферментов из ДНК полимеразы с антителами, ингибирующих активность фермента, TAQ POLYMERASE, внутренний контрольный образец в виде суспензии бактериофага Т4 с концентрацией 5×103 фаговых частиц на 1 мкл, отрицательный контрольный образец представляющий собой смесь рекомбинантных плазмидных ДНК, содержащую фрагмент генома животного и фрагмент генома бактериофага Т4 с нуклеотидной последовательностью:The technical result is achieved by the fact that in a test system for identifying DNA of quail tissue of ordinary Coturnix coturnix) in dry feed and meat products, including a buffer for polymerase chain reaction, a mixture for its conduct, consisting of deoxynucleoside triphosphates, oligonucleotide primers and fluorescent zones for specific plot of the genome of the animal and for the internal control sample; a mixture of enzymes from DNA polymerase with antibodies that inhibit the activity of the enzyme, TAQ POLYMERASE, an internal control sample in the form of a suspension of T4 bacteriophage with a concentration of 5 × 10 3 phage particles per 1 μl, a negative control sample is a mixture of recombinant plasmid DNA containing a fragment of the animal’s genome and a fragment of the genome of the bacteriophage T4 with the nucleotide sequence:
- прямой праймер - direct primer
- обратный праймер - reverse primer
- зонд, - probe
взятых в объемном соотношении 1:1, согласно изобретению для внутреннего контрольного образца используют фаголизат бактериофага Т4, а для положительного контрольного образца - фрагменты геномов нативного бактериофага Т4 и ткани перепелки обыкновенной Coturnix coturnix) со следующей нуклеотидной последовательностью:taken in a volume ratio of 1: 1, according to the invention, the bacteriophage T4 phagolysate is used for the internal control sample, and fragments of the native bacteriophage T4 genomes and ordinary quail tissue Coturnix coturnix) are used for the positive control sample with the following nucleotide sequence:
- прямой праймер - direct primer
- обратный праймер - reverse primer
- зонд. - probe.
Новизна заявляемой тест-системы состоит в идентификации видовой принадлежности ткани птиц семейства дятловых с помощью полимеразной цепной реакции (ПЦР) с флуоресцентной детекцией в режиме реального времени, что в свою очередь позволяет с высокой точностью определить наличие их ингредиентов в продовольственном сырье, кормах и пищевых продуктах.The novelty of the claimed test system consists in identifying the species of tissue of birds of the woodpecker family using polymerase chain reaction (PCR) with fluorescence detection in real time, which in turn allows you to accurately determine the presence of their ingredients in food raw materials, feed and food products .
Признаки, отличающие заявляемое техническое решение от прототипа, направлены на достижение технического результата и не выявлены при изучении данной и смежной областей науки и техники и, следовательно, соответствуют критерию «изобретательский уровень».The features that distinguish the claimed technical solution from the prototype are aimed at achieving a technical result and have not been identified in the study of this and related fields of science and technology and, therefore, meet the criterion of "inventive step".
Заявляемую тест-систему рекомендовано использовать в специализированных ветеринарных, санитарно-эпидемиологических, животноводческих, сельскохозяйственных предприятиях, что соответствует критерию «промышленная применимость».The inventive test system is recommended for use in specialized veterinary, sanitary-epidemiological, livestock, agricultural enterprises, which meets the criterion of "industrial applicability".
Тест-система для идентификации ДНК ткани перепелки обыкновенной Coturnix coturnix) в сухих кормах и мясных полуфабрикатах реализуется следующим образом.The test system for the identification of DNA of quail tissue of ordinary Coturnix coturnix) in dry feed and meat semi-finished products is implemented as follows.
Для исследования сухих кормов и мясных полуфабрикатов на содержание ДНК ткани перепелки проводят полимеразную цепную реакцию с флуоресцентной детекцией с применением термоциклера типа Rotor-Gene Q при соответствующих температурно-временных режимах амплификации и измеряют накопление флуоресцентных сигналов по каналам соответствующих флуоресцентных красителей: JOE/Yellow для специфического сигнала для ДНК ткани перепелки обыкновенной Coturnix coturnix) и Cy5/Red - для внутреннего контрольного образца. Интерпретацию результатов проводят на основании наличия или отсутствия пересечения кривой флуоресценции с пороговой линией, если кривые накопления флуоресцентного сигнала выходят до 35 цикла, то результат реакции считается положительным, а если кривые не пересекают пороговую линию или пересекают ее после 35 цикла, то результат реакции - отрицательный.To study dry feed and meat products for the DNA content of quail tissue, a polymerase chain reaction is carried out with fluorescence detection using a Rotor-Gene Q thermocycler at appropriate temperature-time amplification modes and the accumulation of fluorescent signals is measured through the channels of the corresponding fluorescent dyes: JOE / Yellow for a specific signal for DNA of the quail tissue of ordinary Coturnix coturnix) and Cy5 / Red for the internal control sample. Interpretation of the results is carried out on the basis of the presence or absence of intersection of the fluorescence curve with the threshold line, if the fluorescence signal accumulation curves go out before the 35th cycle, then the reaction result is considered positive, and if the curves do not cross the threshold line or cross it after the 35th cycle, the reaction result is negative .
Для повышения точности идентификации ткани перепелки для внутреннего контрольного образца используют фаголизат бактериофага Т4 с концентрацией 5×103 фаговых частиц на 1 мкл, если концентрация фаговых частиц отклоняется в большую или меньшую сторону, то наблюдаются повторности сомнительных образцов. Для положительного контрольного образца используют смесь, содержащую фрагменты геномов ДНК ткани перепелки обыкновенной Coturnix coturnix) и бактериофага Т4 взятых в соотношении 1:1 со следующими нуклеотидными последовательностями:To increase the accuracy of identification of quail tissue for the internal control sample, use a T4 bacteriophage phagolysate with a concentration of 5 × 10 3 phage particles per 1 μl, if the concentration of phage particles deviates up or down, then duplicate samples are observed. For a positive control sample, a mixture containing fragments of DNA genomes of quail tissue of ordinary Coturnix coturnix) and bacteriophage T4 taken in a 1: 1 ratio with the following nucleotide sequences is used:
- прямой праймер - direct primer
- обратный праймер - reverse primer
- зонд. - probe.
- прямой праймер - direct primer
- обратный праймер - reverse primer
- зонд. - probe.
Использование для разных видов контроля различные формы материала бактериофага Т4: фаголизата и фрагмента генома нативного бактериофага Т4 со специфическими к нему праймерами и зондом обусловлено тем, что это позволяет контролировать корректное прохождение реакции в каждой пробирки, а также контролируется этап выделения ДНК из образцов. Кроме того, использование фаголизата бактериофага Т4, представляющего собой суспензию бактериофага, полученную после лизиса зараженных фагом клеток ткани, повышает чувствительность и упрощает процесс идентификации ткани перепелок в продуктах. Использование нативного бактериофага, т.е. неповрежденного при исследовании, улучшает синтез ДНК, что также улучшает качество процесса идентификации.The use of different forms of T4 bacteriophage material for different types of control: the phagolysate and the genome fragment of the native T4 bacteriophage with specific primers and a probe, is due to the fact that this allows you to control the correct passage of the reaction in each tube, and also controls the stage of DNA extraction from samples. In addition, the use of the T4 bacteriophage phagolysate, which is a suspension of the bacteriophage obtained after lysis of tissue cells infected with the phage, increases the sensitivity and simplifies the process of identifying quail tissue in products. Use of a native bacteriophage, i.e. intact during the study, improves DNA synthesis, which also improves the quality of the identification process.
При конструировании праймеров и зонда основными требованиями были: степень гомологии (комплементарность) с выбранным участком гена; отсутствие самокоплементарных участков внутри олигонуклеотидов и комплементарности друг другу, чтобы не допускать возникновения устойчивых вторичных структур (димеров); близость значений температуры отжига праймеров.When designing the primers and probe, the main requirements were: the degree of homology (complementarity) with the selected gene region; the absence of self-complementary regions within the oligonucleotides and complementarity to each other in order to prevent the emergence of stable secondary structures (dimers); the proximity of the annealing temperature of the primers.
Конструирование специфических праймеров и зонда осуществляли с помощью компьютерных программ на основании анализа нуклеотидных последовательностей референтных штаммов и изолятов, опубликованных на ресурсе GenBank и подбора условий для проведения ПЦР в реальном времени с применением разработанных праймеров и зонда, несущего флуорофор и тушитель, и комплементарного части амплифицируемого со специфическими праймерами фрагмента.Specific primers and probes were constructed using computer programs based on analysis of the nucleotide sequences of reference strains and isolates published on the GenBank resource and selection of conditions for real-time PCR using the developed primers and probe carrying a fluorophore and quencher, and a complementary part of the amplified specific fragment primers.
Праймеры, специфичные для перепелки обыкновенной (Coturnix coturnix) были отобраны на основе последовательности гена b митохондри-альной ДНК генома (Coturnix coturnix mitochondrion cytochrome b gene, complete cds Sequence ID: L08377. 1Length: 1143)Primers specific for common quail (Coturnix coturnix) were selected based on the mitochondrial DNA gene b sequence of the genome (Coturnix coturnix mitochondrion cytochrome b gene, complete cds Sequence ID: L08377. 1Length: 1143)
Дизайн олигонуклеотидных праймеров разработан с использованием специализированного программного обеспечения Primer Express Software v3.0 (Applied Biosystems). В результате анализа выбран участок между 800 и 1100 нуклеотидами, содержащий уникальные нуклеотидные последовательности. С помощью программы «Oligo 6.0» рассчитаны первичные структуры олигонуклеотидных праймеров, фланкирующих выбранный участок генома.Design of oligonucleotide primers was developed using specialized software Primer Express Software v3.0 (Applied Biosystems). As a result of the analysis, a region between 800 and 1100 nucleotides containing unique nucleotide sequences was selected. Using the Oligo 6.0 program, the primary structures of oligonucleotide primers flanking a selected part of the genome were calculated.
Специфичность праймеров (C.cot-F и C.cot-R) оценивали на сервере NCBI с использованием программы BLAST.The specificity of the primers (C.cot-F and C.cot-R) was evaluated on the NCBI server using the BLAST program.
Для детекции продуктов амплификации был подобран олигонуклео-тидный флуоресцентно-меченный зонд C.cot-Z (гомологичный участку нук-леотидной последовательности, ограниченной позициями отжига праймеров C.cot-F и C.cot-R). 3`-конец олигонуклеотидного зонда был помечен флуоресцентным красителем HEX, а 5`-конец зонда содержит гаситель флуоресценции BHQ1. Используя программу "Oligo 6.0" описаны основные свойства рассчитанных олигонуклеотидов, определившие возможность их использования в ПЦР в качестве праймеров и зонда. Ни одна из выбранных последовательностей не обнаружена в геноме любых видов растений и животных, которые потенциально встречаются вблизи тех, которые определены в кормах и пищевых продуктах.To detect amplification products, an oligonucleotide fluorescently labeled C.cot-Z probe was selected (homologous to the nucleotide sequence region limited by the annealing positions of C.cot-F and C.cot-R primers). The 3`-end of the oligonucleotide probe was labeled with HEX fluorescent dye, and the 5`-end of the probe contains a BHQ1 fluorescence quencher. Using the program "Oligo 6.0" describes the basic properties of the calculated oligonucleotides, which determined the possibility of their use in PCR as primers and probes. None of the selected sequences were found in the genome of any species of plants and animals that are potentially found close to those defined in feed and food products.
В качестве внутреннего контроля использовался бактериофаг Т4, имеющий геномную ДНК порядка 170 тысяч пар нуклеотидов (Enterobacteria phage Т4, complete genome GenBank: HM137666.1). В результате анализа был выбран участок между 400 и 600 нуклеотидами, содержащий уникальные нуклеотидные последовательности, рассчитаны первичные структуры олиго-нуклеотидных праймеров, фланкирующих выбранный участок генома. Праймеры были спроектированы с использованием Primer Express Software v3.0 (Applied Biosystems) и исследованы на специфичность с использованием программы BLAST на сервере NCBI.Bacteriophage T4 having genomic DNA of the order of 170 thousand pairs of nucleotides (Enterobacteria phage T4, complete genome GenBank: HM137666.1) was used as an internal control. As a result of the analysis, a region between 400 and 600 nucleotides containing unique nucleotide sequences was selected; primary structures of oligonucleotide primers flanking the selected genome region were calculated. Primers were designed using Primer Express Software v3.0 (Applied Biosystems) and tested for specificity using the BLAST program on the NCBI server.
- прямой праймер - direct primer
- обратный праймер - reverse primer
- зонд - probe
Для детекции продуктов амплификации подобран олигонуклеотидный флуоресцентно-меченный зонд Т4Р, комплементарный участку нуклеотидной последовательности, ограниченной позициями отжига праймеров T4F и T4R. Зонд был помечен красителем HEX. Используя программу "Oligo 6.0" описаны основные свойства рассчитанных олигонуклеотидов, определившие возможность их использования в ПЦР.To detect amplification products, an oligonucleotide fluorescently labeled T4P probe was selected that is complementary to the portion of the nucleotide sequence limited to the annealing positions of the T4F and T4R primers. The probe was labeled with HEX dye. Using the program "Oligo 6.0" describes the basic properties of the calculated oligonucleotides, which determined the possibility of their use in PCR.
Пример конкретного использования тест-системы для идентификации ДНК ткани перепелки обыкновенной (Coturnix coturnix) в сухих кормах и мясных продуктахAn example of a specific use of a test system for the identification of DNA of quail tissue (Coturnix coturnix) in dry feed and meat products
Для подтверждения эффективности тест-системы были использованы сухие корма в виде рыбной и мясной муки; сырые и термически обработанные мясные продукты, т.е. мясные полуфабрикаты.To confirm the effectiveness of the test system, dry feeds in the form of fish and meat flour were used; raw and thermally processed meat products, i.e. semi-finished meat products.
От пробы плотной консистенции отбирают на исследование общую пробу весом 10-50 г. Гранулированную или консервированную продукцию перед исследованием (10-20 г) растирают в ступке до гомогенного состояния.From a sample of dense consistency, a total sample weighing 10-50 g is taken for examination. Granulated or canned products before testing (10-20 g) are ground in a mortar to a homogeneous state.
Лабораторные пробы (20-40 мг) отбирают на исследование в одноразовые микропробирки вместимостью 1,5 мл в двух повторах. Отобранные лабораторные пробы направляют на выделения ДНК.Laboratory samples (20-40 mg) are taken for study in single use microtubes with a capacity of 1.5 ml in duplicate. Selected laboratory samples are sent for DNA isolation.
Исследование проводят с помощью набора реагентов «ПЦР-ПЕРЕПЕЛ-ФАКТОР». Набор состоит из комплекта реагентов для проведения мультиплексной ПЦР (комплект №1) и комплекта контрольных образцов (комплект №2). Набор выпускается в двух вариантах: 1) Для анализа 55 образцов (включая контрольные образцы)The study is carried out using a set of reagents "PCR-Perepel-FACTOR". The kit consists of a kit of reagents for conducting multiplex PCR (kit No. 1) and a set of control samples (kit No. 2). The kit is available in two versions: 1) For analysis of 55 samples (including control samples)
2) Для анализа 110 образцов (включая контрольные образцы). Наборы используют в соответствии с инструкцией по применению набора реагентов «ПЦР-ПЕРЕПЕЛ-ФАКТОР» для определения ДНК ткани перепелки обыкновенной (Coturnix coturnix) методом полимеразной цепной реакции (ПЦР) с флуоресцентной детекцией в РВ ТУ 21.10.60-163-51062356-2018, для диагностики in vitro, http://www.vetfaktor.ru/.2) For analysis of 110 samples (including control samples). The kits are used in accordance with the instructions for use of the PCR-PEREPEL-FACTOR reagent kit for DNA determination of common quail tissue (Coturnix coturnix) by polymerase chain reaction (PCR) with fluorescence detection in RV TU 21.10.60-163-51062356-2018, for in vitro diagnostics, http://www.vetfaktor.ru/.
Состав набора приведен в Таблицах 1 и 2.The composition of the kit is shown in Tables 1 and 2.
Исследования состоит из трех этапов:Research consists of three stages:
• экстракция нуклеиновая кислота (НК);• extraction of nucleic acid (NK);
• проведение реакции ПЦР РВ;• carrying out the reaction of PCR;
• учет результатов анализа.• accounting of analysis results.
Для экстракции (выделение) НК из исследуемых проб отбирают необходимое количество одноразовых пробирок объемом 1,5 мл, включая отрицательный контроль выделения. Во все пробирки с исследуемыми образцами, включая пробирку для отрицательного контрольного образца (ОКО), вносят по 10 мкл внутреннего контрольного образца (ВКО) для ткани перепелки обыкновенной (Coturnix coturnix), в качестве которого, используют фаголизат бактериофага Т4 с концентрацией 5×103 фаговых частиц на 1 мкл.For extraction (isolation) of NK from the test samples, the required number of 1.5 ml disposable tubes is selected, including a negative selection control. 10 μl of the internal control sample (CTP) for common quail tissue (Coturnix coturnix) is used in all test tubes with test samples, including a test tube for negative control (OKO), using 5 × 10 3 bacteriophage phagolysate phage particles per 1 μl.
Следующий этап это подготовка образцов к проведению ПЦР.The next step is the preparation of samples for PCR.
Общий объем реакционной смеси - 25 мкл, объем ДНК-пробы - 10 мкл.The total volume of the reaction mixture is 25 μl, the volume of the DNA sample is 10 μl.
Успешное прохождение реакции контролируют использованием положительного контрольного образца (ПКО) ПЕРЕПЕЛ, ВКО ПЕРЕПЕЛ и ДНК буфера. В качестве ПКО используют смесь содержащую фрагменты геномов ткани перепелки обыкновенной (Coturnix coturnix) и нативного бактериофага Т4 взятых в соотношении 1:1.Successful completion of the reaction is monitored using a positive control sample (FFP) Perepel, VKO Perepel and DNA buffer. A mixture containing fragments of the genomes of common quail tissue (Coturnix coturnix) and native bacteriophage T4 taken in a 1: 1 ratio is used as a FFP.
В отдельной пробирке смешивают компоненты набора из расчета на каждую реакцию:In a separate tube mix the components of the kit based on each reaction:
5 мкл ПЦР СМЕСЬ ПЕРЕПЕЛ;5 μl PCR MIXING QUICK;
10 мкл ПЦР БУФЕР ПЕРЕПЕЛ;10 μl PCR BUFFER QUICK;
0,5 мкл TAQ POLYMERASE0.5 μl TAQ POLYMERASE
Перемешивают смесь на вортексе и сбросывают капли кратковременным центрифугированием.Vortex the mixture and mix the droplets by brief centrifugation.
Отбирают необходимое количество пробирок для амплификации ДНК исследуемых и контрольных проб. Вносят по 15 мкл приготовленной реакционной смеси.Select the required number of tubes for amplification of the DNA of the investigated and control samples. Add 15 μl of the prepared reaction mixture.
Помещают подготовленные для проведения ПЦР пробирки в ячейки амплификатора и используют программное обеспечение прибора. Далее проводят ПЦР РВ с флуоресцентной детекцией.Prepare the tubes prepared for PCR in the amplifier cells and use the instrument software. Next, carry out PCR RV with fluorescence detection.
Параметры температурно-временного режима амплификации на приборе «Rotor-Gene Q» представлены в таблице 3.The parameters of the temperature-time mode of amplification on the device "Rotor-Gene Q" are presented in table 3.
Интерпретация результатов анализа.Interpretation of analysis results.
Полученные данные - кривые накопления флуоресцентного сигнала анализируются с помощью программного обеспечения используемого прибора для проведения ПЦР в соответствии с инструкцией производителя к прибору.The data obtained - the fluorescence signal accumulation curves are analyzed using the software of the device used for PCR in accordance with the manufacturer's instructions for the device.
Учет результатов ПЦР РВ проводится по наличию или отсутствию пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линией (что соответствует наличию или отсутствию значения порогового цикла «Ct» для исследуемого образца).The results of RT PCR are taken into account by the presence or absence of the intersection of the fluorescence curve with the threshold line set at the appropriate level (which corresponds to the presence or absence of the threshold cycle value “Ct” for the test sample).
Результат считается достоверным в случае корректного прохождения положительных и отрицательных контролей амплификации и экстракции ДНК в соответствии с таблицей 4.The result is considered reliable if the positive and negative DNA amplification and extraction controls are correctly passed in accordance with table 4.
Появление любого значения Ct в таблице 4 результатов для отрицательного контроля этапа экстракции ВК - на канале JOE/Yellow и для отрицательного контроля этапа ПЦР К - на любом из каналов свидетельствует о наличии контаминации реактивов или образцов. В этом случае результаты анализа для всех проб считаются недействительными. Требуется повторить анализ всех проб, а также предпринять меры по выявлению и ликвидации источника контаминации.The appearance of any Ct value in table 4 of the results for the negative control of the VK extraction step - on the JOE / Yellow channel and for the negative control of the PCR K step - on any of the channels indicates the presence of contamination of reagents or samples. In this case, the analysis results for all samples are considered invalid. It is required to repeat the analysis of all samples, as well as take measures to identify and eliminate the source of contamination.
Образцы, для которых значение Ct по каналу Cy5/Red отсутствует или превышает 35 цикл (и при этом не получен положительный результат на канале JOE/Yellow) требуют повторного проведения исследования с этапа экстракции ДНК. Задержка в значениях пороговых циклов для исследуемых образцов указывает на присутствие ингибиторов в пробе(ах) или на ошибки при экстракции ДНК или при постановке реакции ПЦР РВ. В образце обнаружена ДНК ткани перепелки обыкновенной (Coturnix coturnix), если наблюдается экспоненциальный рост сигнала на канале JOE/Yellow, при этом значения Ct контрольных образцов находятся в пределах нормы (Табл. 4).Samples for which the Ct value for the Cy5 / Red channel is absent or exceeds the 35th cycle (and a positive result on the JOE / Yellow channel is not obtained) require repeated testing from the DNA extraction stage. A delay in the threshold cycle values for the test samples indicates the presence of inhibitors in the sample (s) or errors in DNA extraction or in the formulation of the PCR reaction. DNA of common quail tissue (Coturnix coturnix) was detected in the sample if an exponential signal growth was observed on the JOE / Yellow channel, while the Ct values of the control samples were within normal limits (Table 4).
Если для исследуемого образца по каналам JOE/Yellow значение Ct определяется позднее 37 цикла при корректном прохождении положительных и отрицательных контролей, образец исследуется повторно с этапа экстракция ДНК. Если при повторной постановке Ct более 37 результат считается отрицательным. Образец считается отрицательным ДНК ткани перепелки обыкновенной (Coturnix coturnix) не обнаружена), если не определяется значение Ct (не наблюдается рост специфического сигнала) на канале JOE/Yellow при этом значения Ct контрольных образцов находятся в пределах нормы (Табл. 4), а значение Ct по каналу Cy5/Red менее 35.If the Ct value is determined after the 37th cycle for the test sample through JOE / Yellow channels with the correct passage of the positive and negative controls, the sample is re-examined from the DNA extraction step. If when re-setting Ct more than 37, the result is considered negative. A sample is considered negative DNA of ordinary quail tissue (Coturnix coturnix) is not detected) if the Ct value is not determined (no growth of a specific signal is observed) on the JOE / Yellow channel, while the Ct values of the control samples are within normal limits (Table 4), and the value Ct channel Cy5 / Red less than 35.
Для исследуемых образцов (сухой корм и мясные полуфабрикаты) предел точности содержания ткани перепелки представлен в таблице 5.For the studied samples (dry food and meat semi-finished products), the accuracy limit of the content of quail tissue is presented in table 5.
Для доказательства эффективности использования ПЦР с флуоресцентной детекцией в режиме реального времени проводился сравнительный анализ чувствительности заявляемого с прототипом, в котором использовался метод ПЦР с использованием внутреннего контроля в виде суспензии бактериофага, а в заявляемом - использовался фаголизат бактериофага и геном нативного бактериофага. Оказалось, что чувствительность ПЦР при обнаружении примеси ткани перепелки обыкновенной (Coturnix coturnix) в кормах и в мясных фаршах примерно в 1,5 раза выше. Трудоемкость и стоимость процесса определения ДНК ткани перепелки в кормах и фаршах снизилась на 3-5%.To prove the effectiveness of the use of PCR with fluorescence detection in real time, a comparative analysis of the sensitivity of the claimed with the prototype was carried out, in which the PCR method was used using internal control in the form of a suspension of a bacteriophage, and in the claimed method, the bacteriophage phagolysate and the native bacteriophage genome were used. It turned out that the sensitivity of PCR when detecting impurities of ordinary quail tissue (Coturnix coturnix) in feed and minced meat is about 1.5 times higher. The complexity and cost of the process of determining the DNA of quail tissue in feed and minced meat decreased by 3-5%.
--->--->
Перечень последовательностейSequence listing
<110> Федеральное государственное бюджетное образовательное учреждение высшего образования «Кубанский государственный аграрный университет имени И.Т. Трубилина». <110> Federal State Budgetary Educational Institution of Higher Education "Kuban State Agrarian University named after I.T. Trubilin. "
<120> Способ определения ДНК вируса нодулярного дерматита (LSDV) в биологическом материале животных методом ПЦР с электрофоретической детекцией продуктов амплификации в агарозном геле <120> Method for determining DNA of nodular dermatitis virus (LSDV) in biological material of animals by PCR with electrophoretic detection of amplification products in agarose gel
<140> 2019133079 <140> 2019133079
< 160> 7 <160> 7
< 210> 1 <210> 1
< 211> 23 <211> 23
< 212> ДНК <212> DNA
< 213> LSDV <213> LSDV
< 400> 1 <400> 1
cccattctaacacgcctaactcc 23cccattctaacacgcctaactcc 23
< 210> 2 <210> 2
< 211> 22 <211> 22
< 212> ДНК <212> DNA
< 213> LSDV <213> LSDV
< 400> 2 <400> 2
ccactagaacacgacactgtac 22ccactagaacacgacactgtac 22
< 210> 3 <210> 3
< 211> 24 <211> 24
< 212> ДНК <212> DNA
< 213> LSDV <213> LSDV
< 400> 3 <400> 3
ctgtaatgaactaaccatattagc 24
< 210> 4 <210> 4
< 211> 23 <211> 23
< 212> ДНК <212> DNA
< 213> LSDV <213> LSDV
< 400> 4 <400> 4
cctcgtcctaaagctgctacagc 23cctcgtcctaaagctgctacagc 23
< 210> 5 <210> 5
< 211> 21 <211> 21
< 212> ДНК <212> DNA
< 213> Бактериофаг Т4 <213> Bacteriophage T4
< 400> 4 <400> 4
tacatataaatcacgcaaagc 21
< 210> 6 <210> 6
< 211> 21 <211> 21
< 212> ДНК <212> DNA
< 213> Бактериофаг Т4 <213> Bacteriophage T4
< 400> 6 <400> 6
tagtatggctaatcttattgg 21
< 210> 7 <210> 7
< 211> 21 <211> 21
< 212> ДНК <212> DNA
< 213> Бактериофаг Т4 <213> Bacteriophage T4
< 400> 7 <400> 7
acattggcactgaccgagttc 21
<---<---
Claims (8)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
RU2019133079A RU2725210C1 (en) | 2019-10-16 | 2019-10-16 | Test system for identification of dna tissue of common quail (coturnix coturnix) in dry fodder and semi-finished meat products |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
RU2019133079A RU2725210C1 (en) | 2019-10-16 | 2019-10-16 | Test system for identification of dna tissue of common quail (coturnix coturnix) in dry fodder and semi-finished meat products |
Publications (1)
Publication Number | Publication Date |
---|---|
RU2725210C1 true RU2725210C1 (en) | 2020-06-30 |
Family
ID=71509882
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
RU2019133079A RU2725210C1 (en) | 2019-10-16 | 2019-10-16 | Test system for identification of dna tissue of common quail (coturnix coturnix) in dry fodder and semi-finished meat products |
Country Status (1)
Country | Link |
---|---|
RU (1) | RU2725210C1 (en) |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106435008A (en) * | 2016-12-26 | 2017-02-22 | 河南科技大学 | Primers, kit and detection method for detecting genders of cotuenix coturnix |
CN108624659A (en) * | 2018-06-22 | 2018-10-09 | 武汉轻工大学 | A kind of real time quantitative PCR method of detection meat product ingredient |
RU2680094C1 (en) * | 2018-10-01 | 2019-02-15 | Федеральное государственное бюджетное образовательное учреждение высшего образования "Кубанский государственный аграрный университет имени И.Т. Трубилина" | Test system for detection of dna of leptospirosis causative agent (leptospira speciales) in agricultural animals |
-
2019
- 2019-10-16 RU RU2019133079A patent/RU2725210C1/en active
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN106435008A (en) * | 2016-12-26 | 2017-02-22 | 河南科技大学 | Primers, kit and detection method for detecting genders of cotuenix coturnix |
CN108624659A (en) * | 2018-06-22 | 2018-10-09 | 武汉轻工大学 | A kind of real time quantitative PCR method of detection meat product ingredient |
RU2680094C1 (en) * | 2018-10-01 | 2019-02-15 | Федеральное государственное бюджетное образовательное учреждение высшего образования "Кубанский государственный аграрный университет имени И.Т. Трубилина" | Test system for detection of dna of leptospirosis causative agent (leptospira speciales) in agricultural animals |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN112522429B (en) | Method and reagent set for detecting bacillus anthracis by RPA (reverse transcriptase polymerase chain reaction) combined CRISPR (clustered regularly interspaced short palindromic repeats) technology | |
RU2700480C1 (en) | Test system for determining species affiliation of tissues of chickens and pigs in food raw materials, fodder and food products | |
RU2694713C1 (en) | Method for identification of species identity of mutton and beef in food raw materials, fodder and food products | |
RU2645263C1 (en) | Test system of detecting dna of african swine fever virus by real-time polymerase chain reaction | |
RU2726555C1 (en) | Test system for detecting dna of donkey (equus asinus) tissue in dry fodder and semi-finished meat products | |
CN113046484B (en) | Primer probe, kit and method for detecting African swine fever virus p72 gene | |
RU2725539C1 (en) | Test system for identification of dna tissues of rats and mice in dry fodder and meat semi-products | |
CN113186312A (en) | Molecular marker for distinguishing Brucella A19 vaccine strain and wild strain | |
CN116814857A (en) | Cat parvovirus and kit thereof and fluorescent recombinase polymerase amplification method | |
RU2725210C1 (en) | Test system for identification of dna tissue of common quail (coturnix coturnix) in dry fodder and semi-finished meat products | |
RU2700479C1 (en) | Method for determining species identity of tissues of chickens and pigs in food raw materials, fodder and food products | |
RU2726242C1 (en) | Test system for detecting dna of lumpy skin disease virus (lsdv) in biological material of animals using a polymerase chain reaction in real time | |
RU2725216C1 (en) | Test system for determination of woodpecker (picidae) dna in dry fodder and semi-finished meat products | |
RU2725215C1 (en) | Test system for identification of common hedgehog (erinaceus europaeus) tissue dna in dry fodder and semi-finished meat products | |
RU2714287C1 (en) | Method for woodpecker (picidae) tissue dna determination in dry feed and semi-finished meat products | |
RU2728382C1 (en) | Test system for identification of dna of domestic dog tissue (canis lupus familiaris) in dry fodder and semi-finished meat products | |
RU2726248C1 (en) | Method for detection of dna of donkey (equus asinus) tissue in dry fodder and semi-finished meat products | |
RU2734035C1 (en) | Method for identification of dna tissue of common quail (coturnix coturnix) in dry fodder and semi-finished meat products | |
RU2726429C1 (en) | Test system for identification of bear tissue (ursus) in dry fodder and semi-finished meat products | |
RU2728612C1 (en) | Method for identification of dna of domestic dog tissue (canis lupus familiaris) in dry fodder and meat semi-products | |
RU2726433C1 (en) | Method for identification of common hedgehog (erinaceus europaeus) dna tissue in dry fodder and semi-finished meat | |
RU2822748C1 (en) | Test system for identification of dna tissue of pacific saury (cololabis saira) in fish products, in meat-and-bone fish meal and fodders using real-time polymerase chain reaction | |
RU2742952C1 (en) | Method for identification of rat and mouse tissue species in dry feed and semi-fenished meat products | |
RU2726427C1 (en) | Method for identification of bear tissue (ursus) in dry fodder and semi-finished meat products | |
RU2814552C1 (en) | Method of identifying dna tissue of japanese mackerel (scomber japonicus) in fish products, meat and bone fish meal and feed using real-time polymerase chain reaction |