RU2726248C1 - Method for detection of dna of donkey (equus asinus) tissue in dry fodder and semi-finished meat products - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention represents a method for DNA identification of donkey tissue (Equus asinus) in dry fodder and semi-finished meat products, involving DNA recovery from animal tissue by sorption method, polymerase chain reaction with fluorescent detection is carried out with 45 cycles of real-time amplification using oligonucleotide primers, probes, fluorescent dyes specific for the DNA genome region: for a specific signal for an animal and Cy5 / Red for an internal control sample in form of a suspension of bacteriophage T4 with concentration of 5×10³ phage particles per 1 mcl, a positive control sample in the form of a mixture containing fragments of animal genomes and bacteriophage T4 with a nucleotide sequence: T4F TACATATAAATCACGCAAAGC – forward primer; T4R TAGTATGGCTAATCTTATTGG – reverse primer; T4P CY5 ACATTGGCACTGACCGAGTTC – probe, taken in ratio of 1:1, measurement of accumulation of fluorescent signals via channels of corresponding fluorescent dyes, interpretation of results based on presence or absence of intersection of fluorescence curve with threshold line, if fluorescence signal accumulation curves are up to 35 cycles, the reaction result is considered to be positive, and if the curves do not cross the threshold line or cross it after 35 cycles, the result of the reaction is negative, according to the invention, DNA is recovered from donkey tissue (Equus asinus), and the internal control sample is used with phagolysate of bacteriophage T4, and for a positive control sample – fragments of genomes of native bacteriophage T4 and donkey tissue (Equus asinus) with the following nucleotide sequence: Donk F: 5'- CATATCTTAATCCCAATAATAGAC-3' – forward primer; Donk R: 5'- AGTATTCGTTCTGATATAGGC-3' – reverse primer; Donk P: PAM-5'- ATCTTATACTGGACTATTCTATCGAC-3 -BHQ1 – probe, wherein DNA detection of donkey tissue (Equus asinus) employs fluorescent dye FAM / Green.

EFFECT: invention increases accuracy of identification of species identity and simplifies the process of preparing samples.

1 cl, 5 tbl

Description

The invention relates to veterinary microbiology, in particular to methods for determining the species of meat using polymerase chain reaction.

It is known to use real-time PCR to determine the DNA of the following animals - horse, cow, pig, donkey, chicken, turkey, cat, dog and rabbit (https://stylab.ru/netcat_files/userfiles/Files/Articles/Meat/Meat_1_04_2013. pdf.).

The closest in technical essence is a method for identifying the species of animal tissues in food raw materials, feed and food products (RF patent No. 2694713, CL C12Q 1/68, 2019), including the extraction of DNA from animal tissue by the sorption method, polymerase chain reaction with fluorescence detection with 45 cycles of amplification in real time using specific oligonucleotide primers, probes, fluorescent dyes specific for the genome of the animal’s DNA: JOE / Yellow for the specific signal for the animal and Cy5 / Red for the internal control sample in the form of a bacteriophage suspension T4 with a concentration of 5 × 10 ³ phage particles per 1 μl, a positive control sample in the form of a mixture containing fragments of the genomes of the animal and bacteriophage T4 with the nucleotide sequence:

T4F TACATATAAATCACGCAAAGC - direct primer

T4R TAGTATGGCTAATCTTATTGG - reverse primer

T4P CY5 ACATTGGCACTGACCGAGTTC - a probe taken in a 1: 1 ratio and measuring the accumulation of fluorescent signals through the channels of the corresponding fluorescent dyes, interpreting the results based on the presence or absence of the intersection of the fluorescence curve with a threshold line, if the fluorescence signal accumulation curves, the result is up to 35 the reaction is considered positive, and if the curves do not cross the threshold line or cross it after the 35th cycle, then the reaction result is negative.

A disadvantage of the known technical solution is the lack of accuracy due to the use of a suspension of the bacteriophage, which requires pre-treatment, including centrifugation, concentration and transfer to a specific buffer solution, which entails considerable labor and financial costs.

The technical result is to increase the accuracy of identification of species, simplifying the preparation process and reducing its cost.

The technical result is achieved by the fact that in the method for detecting DNA of donkey tissue tissue (Equus asinus) in dry feed and meat products, including the extraction of DNA from animal tissue by the sorption method, the production of a polymerase chain reaction with fluorescence detection using 45 amplification cycles in real time using oligonucleotide primers, probes, fluorescent dyes specific for the DNA genome region of the animal: for the specific signal for the animal and Cy5 / Red, for the internal control sample in the form of a suspension of bacteriophage T4 with a concentration of 5 × 10 ³ phage particles per 1 μl, the positive control sample in the form a mixture containing fragments of the genomes of an animal and bacteriophage T4 with a nucleotide sequence:

T4F TACATATAAATCACGCAAAGC - direct primer

T4R TAGTATGGCTAATCTTATTGG - reverse primer

T4P CY5 ACATTGGCACTGACCGAGTTC - a probe taken in a 1: 1 ratio and measuring the accumulation of fluorescent signals through the channels of the corresponding fluorescent dyes, interpreting the results based on the presence or absence of the intersection of the fluorescence curve with the threshold line, if the fluorescence signal accumulation curves go up to 35, the reaction is considered positive, and if the curves do not cross the threshold line or cross it after the 35th cycle, then the reaction result is negative, according to the invention, DNA is extracted from donkey tissue (Equus asinus) and the bacteriophage T4 phagolysate is used for the internal control sample, and for the positive control sample - fragments of the genomes of the native bacteriophage T4 and donkey tissue (Equus asinus) with the following nucleotide sequence:

Donk F: 5'- CATATCTTAATCCCAATAATAGAC-3 'direct primer

Donk R: 5'- AGTATTCGTTCTGATATAGGC -3 'reverse primer

Donk P: FAM-5'-ATCTTATACTGGACTATTCTATCGAC-3-BHQ1 probe, using FAM / Green fluorescent dye to detect donkey tissue DNA (Equus asinus).

The novelty of the proposed method consists in identifying the species of tissue of domestic donkey using polymerase chain reaction (PCR) with fluorescence detection in real time using different types of bacteriophage T4 in control samples, which in turn makes it possible to accurately determine the presence of their ingredients in the food raw materials, feed and food products.

The features that distinguish the claimed technical solution from the prototype are aimed at achieving a technical result and have not been identified in the study of this and related fields of science and technology and, therefore, meet the criterion of "inventive step".

The inventive method is recommended for use in specialized veterinary, sanitary-epidemiological, livestock, agricultural enterprises, which meets the criterion of "industrial applicability".

A method for detecting donkey tissue DNA (Equus asinus) in dry feed and meat products is as follows.

To study dry feed and meat products for DNA content of donkey tissue, a polymerase chain reaction is carried out with fluorescence detection using a Rotor-Gene Q thermocycler at appropriate temperature-time amplification modes and the accumulation of fluorescent signals is measured through the channels of the corresponding fluorescent dyes: FAM / Green for a specific signal for donkey tissue DNA (Equus asinus) and Cy5 / Red for the internal control sample. Interpretation of the results is carried out on the basis of the presence or absence of intersection of the fluorescence curve with the threshold line, if the fluorescence signal accumulation curves go out before the 35th cycle, then the reaction result is considered positive, and if the curves do not cross the threshold line or cross it after the 35th cycle, the reaction result is negative .

To increase the accuracy of identification of donkey tissue for the internal control sample, use a T4 bacteriophage phagolysate with a concentration of 5 × 10 ³ phage particles per 1 μl, if the concentration of phage particles deviates up or down, then duplicate samples are observed. For a positive control sample, a mixture containing fragments of genome DNA from donkey tissue (Equus asinus) and native T4 bacteriophage taken in a 1: 1 ratio with the following nucleotide sequences is used:

Donk F: 5'- CATATCTTAATCCCAATAATAGAC-3 '- direct primer

Donk R: 5'- AGTATTCGTTCTGATATAGGC -3 '- reverse primer

Donk P: FAM-5'- ATCTTATACTGGACTATTCTATCGAC-3 -BHQ1 - probe

T4F TACATATAAATCACGCAAAGC - direct primer

T4R TAGTATGGCTAATCTTATTGG - reverse primer

T4P CY5 ACATTGGCACTGACCGAGTTC - probe.

The use of different forms of T4 bacteriophage material for different types of control: the phagolysate and the genome fragment of the native T4 bacteriophage with specific primers and a probe, is due to the fact that this allows you to control the correct passage of the reaction in each tube, and also controls the stage of DNA extraction from samples. In addition, the use of the T4 bacteriophage phagolysate, which is a suspension of the bacteriophage obtained after lysis of tissue cells infected with the phage, increases the sensitivity and simplifies the process of identifying donkey tissue in products. Use of a native bacteriophage, i.e. intact during the study, improves DNA synthesis, which also improves the quality of the identification process.

When designing the primers and probe, the main requirements were: the degree of homology (complementarity) with the selected gene region; the absence of self-complementary regions within the oligonucleotides and complementarity to each other in order to prevent the emergence of stable secondary structures (dimers); the proximity of the annealing temperature of the primers.

Specific primers and probes were constructed using computer programs based on analysis of the nucleotide sequences of reference strains and isolates published on the GenBank resource and selection of conditions for real-time PCR using the developed primers and probe carrying a fluorophore and quencher, and a complementary part of the amplified specific fragment primers.

Primers specific for donkey DNA (Equus asinus) were selected based on the nucleotide sequence of the mitochondrial gene (Equus asinus mitochondrion, complete genome Sequence ID: Length: 16813) in the region between 8500 and 8800 nucleotides. Nucleotide sequence access code in GeneBank NCBI: KT182635.1.

Primers were designed using Primer Express Software v3.0 (Applied Biosystems) and tested for specificity using the BLAST program on the NCBI server. To detect amplification products, an Pic P oligonucleotide fluorescently labeled probe (complementary to the nucleotide sequence flanked by positions for the Donk F and Donk R primers) was selected. A fluorescent dye carboxyfluorescein (FAM) was added to the 5'-end of the Donk P probe.

Donk F: 5'- CATATCTTAATCCCAATAATAGAC-3 '- direct primer

Donk R: 5'- AGTATTCGTTCTGATATAGGC-3 '- reverse primer

Donk P: FAM-5'- ATCTTATACTGGACTATTCTATCGAC-3 -BHQ1 - probe.

Using the program "Oligo 6.0", the basic properties of the calculated oligonucleotides are described, which determined the possibility of their use in PCR. None of the selected sequences was found in the genomes of any animals and birds (excluding Equus asinus) and any plant species that could potentially be used in the production of feed and food products.

Bacteriophage T4 having genomic DNA of the order of 170 thousand pairs of nucleotides (Enterobacteria phage T4T, complete genome GenBank: HM137666.1) was used as an internal control. As a result of the analysis, a region between 400 and 600 nucleotides containing unique nucleotide sequences was selected; primary structures of oligonucleotide primers flanking the selected genome region were calculated. Primers were designed using Primer Express Software v3.0 (Applied Biosystems) and tested for specificity using the BLAST program on the NCBI server.

T4F: 5'-TACATATAAATCACGCAAAGC -3 '- direct primer

T4R: 5'- TAGTATGGCTAATCTTATTGG -3 '- reverse primer

T4P: HEX-5'- ACATTGGCACTGACCGAGTTC -3'-BHQ1 probe.

To detect amplification products, an oligonucleotide fluorescently labeled T4P probe was selected that is complementary to the portion of the nucleotide sequence limited to the annealing positions of the T4F and T4R primers. The probe was labeled with HEX dye. Using the program "Oligo 6.0" describes the basic properties of the calculated oligonucleotides, which determined the possibility of their use in PCR.

An example of a specific implementation of the method for identifying donkey tissue.

To confirm the effectiveness of the method were used dry feed in the form of fish and meat meal; raw and thermally processed meat products, i.e. semi-finished meat products.

From a sample of dense consistency, a total sample weighing 10-50 g is taken for examination. Granulated or canned products before testing (10-20 g) are ground in a mortar to a homogeneous state.

Laboratory samples (20-40 mg) are taken for study in single use microtubes with a capacity of 1.5 ml in duplicate. Selected laboratory samples are sent for DNA isolation.

The study is carried out using a set of reagents "PCR-OSEL-FACTOR". The kit consists of a kit of reagents for conducting multiplex PCR (kit No. 1) and a set of control samples (kit No. 2). The kit is available in two versions: 1) For analysis of 55 samples (including control samples)

2) For analysis of 110 samples (including control samples). The kits are used in accordance with the instructions for use of the PCR-OSEL-FACTOR reagent kit for DNA determination of donkey tissue (Equus asinus) by polymerase chain reaction (PCR) with fluorescence detection in RV TU 21.10.60-163-51062356-2018, for in vitro diagnostics, http://www.vetfaktor.ru/.

The composition of the kit is shown in Tables 1 and 2.

Research consists of three stages:

• extraction of nucleic acid (NK);

• carrying out the reaction of PCR;

• accounting of analysis results.

For extraction (isolation) of NK from the test samples, the required number of 1.5 ml disposable tubes is selected, including a negative selection control. 10 μl of the internal control sample (EKD) for donkey tissue was added to all tubes with test samples, including a test tube for negative control (OKO), using T4 bacteriophage phagolizate with a concentration of 5 × 10 ³ phage particles for 1 μl.

The next step is the preparation of samples for PCR.

The total volume of the reaction mixture is 25 μl, the volume of the DNA sample is 10 μl.

Successful completion of the reaction is monitored using the positive control sample (PEC) of the donkey, the donkey of the donkey and DNA buffer. A mixture containing fragments of genomes of donkey tissue and native T4 bacteriophage taken in a 1: 1 ratio is used as a FFP.

In a separate tube, mix the kit components based on each reaction:

5 μl PCR MIX OF DONKEY;

10 μl PCR Buffer Donkey;

0.5 μl TAQ POLYMERASE

Vortex the mixture and mix the droplets by brief centrifugation.

Select the required number of tubes for amplification of the DNA of the investigated and control samples. Add 15 μl of the prepared reaction mixture.

Prepare the tubes prepared for PCR in the amplifier cells and use the instrument software. Next, carry out PCR RV with fluorescence detection.

The parameters of the temperature-time mode of amplification on the device "Rotor-Gene Q" are presented in table 3.

Interpretation of analysis results.

The data obtained - the fluorescence signal accumulation curves are analyzed using the software of the device used for PCR in accordance with the manufacturer's instructions for the device.

The results of RT PCR are taken into account by the presence or absence of the intersection of the fluorescence curve with the threshold line set at the appropriate level (which corresponds to the presence or absence of the threshold cycle value “Ct” for the test sample).

The result is considered reliable if the positive and negative DNA amplification and extraction controls are correctly passed in accordance with table 4.

The appearance of any Ct value in table 4 of the results for the negative control of the BK- extraction stage on the FAM / Green channel and for the negative control of the K- PCR stage on any channel indicates the presence of contamination of reagents or samples. In this case, the analysis results for all samples are considered invalid. It is required to repeat the analysis of all samples, as well as take measures to identify and eliminate the source of contamination. Samples for which the Ct value for the Cy5 / Red channel is absent or exceeds the 35th cycle (and a positive result on the FAM / Green channel is not obtained) require repeated testing from the DNA extraction stage. A delay in the threshold cycle values for the test samples indicates the presence of inhibitors in the sample (s) or errors in DNA extraction or in the formulation of the PCR reaction. DNA of donkey tissue (Equus asinus) was detected in the sample if an exponential signal growth was observed on the FAM / Green channel, while the Ct values of the control samples were within normal limits (Table 4).

If the Ct value is determined after the 37th cycle for the test sample via FAM / Green channels with the correct passage of the positive and negative controls, the sample is re-examined from the DNA extraction step. If the re-setting Ct is more than 37, the result is considered negative. A sample is considered negative DNA (Equus asinus) is not detected) if the Ct value is not determined (no specific signal growth is observed) on the FAM / Green channel, while the Ct values of the control samples are within normal limits (Table 4) and the Ct value is Cy5 / Red less than 35.

For the studied samples (dry food and meat semi-finished products) the accuracy limit of the tissue content of domestic donkey is presented in table 5.

To prove the effectiveness of using PCR with fluorescence detection in real time, a comparative analysis of the sensitivity of the proposed method was carried out with the prototype, in which the PCR method was used using internal control in the form of a suspension of a bacteriophage, and in the claimed method, the phagolysate of the bacteriophage and the native bacteriophage gene were used. It turned out that the sensitivity of PCR in the claimed method when detecting an admixture of dog tissue in feed and minced meat is approximately 1.33 times higher. The complexity and cost of the process of determining the DNA of a dog’s tissue in feed and meat decreased by 3.2-5%.

Claims (9)

A method for detecting donkey tissue DNA (Equus asinus) in dry food and meat products, including the extraction of DNA from animal tissue by the sorption method, the production of a polymerase chain reaction with fluorescence detection with 45 amplification cycles in real time using oligonucleotide-specific DNA genome site primers, probes, fluorescent dyes: for a specific signal for an animal and Cy5 / Red - for an internal control sample in the form of a suspension of bacteriophage T4 with a concentration of 5 × 10 ³ phage particles per 1 μl, a positive control sample in the form of a mixture containing fragments of animal genomes and bacteriophage T4 with a nucleotide sequence: T4F TACATATAAATCACGCAAAGC; T4R TAGTATGGCTAATCTTATTGG; T4P CY5 ACATTGGCACTGACCGAGTTC, taken in the ratio 1: 1, and measuring the accumulation of fluorescent signals through the channels of the corresponding fluorescent dyes, interpreting the results based on the presence or absence of the intersection of the fluorescence curve with the threshold line, if the fluorescence signal accumulation curves go out before the 35th cycle, the reaction result is considered positive, and if the curves do not cross the threshold line or cross it after the 35th cycle, then the reaction result is negative, characterized in that DNA is isolated from donkey tissue (Equus asinus) and bacteriophage T4 phagolysate is used for the internal control sample, and fragments for the positive control sample genomes of native T4 bacteriophage and donkey tissue (Equus asinus) with the following nucleotide sequence: Donk F: 5'-CATATCTTAATCCCAATAATAGAC-3 'direct primer; Donk R: 5'-AGTATTCGTTCTGATATAGGC-3 'reverse primer; Donk P: FAM-5'-ATCTTATACTGGACTATTCTATCGAC-3 -BHQ1 probe, in addition, FAM / Green fluorescent dye is used to detect donkey tissue DNA (Equus asinus).