RU2271392C1 - RECOMBINANT PLASMID DNA pFGM17 ENCODING POLYPEPTIDE OF HUMAN GRANULOCYTIC-MACROPHAGAL COLONY-STIMULATING FACTOR AND STRAIN OF BACTERIUM Escherichia coli BL21(DE3)/pFGM17 AS PRODUCER OF POLYPEPTIDE OF HUMAN GRANULOCYTIC-MACROPHAGAL COLONY-STIMULATING FACTOR - Google Patents

Abstract

FIELD: biotechnology, microbiology, genetic engineering.

SUBSTANCE: invention describes construction of recombinant plasmid DNA pFGM17 encoding constitutive synthesis of polypeptide of human granulocytic-macrophagal colony-stimulating factor (GM-CSF) and consisting of Kpn I/Eco RI-fragment of plasmid pSPF1 DNA and artificial DNA sequence encoding signal peptide of the protein Caf1 from Yersinia pestis, and also Kpn I/Eco RI-fragment of intermediate plasmid pSK-GM comprising the synthetic human gene GM-CSF. Escherichia coli cells are transformed with plasmid DNA pFGM17 and strain E. coli BL21(DE3)/pFGM17 is prepared that is a producer of human polypeptide GM-CSF. Invention provides enhancing technological effectiveness and economy of process for preparing recombinant FM-CSF due to excluding the induction stage in biosynthesis process and in simultaneous increasing the yield of the end product by 2 times. Invention can be used for preparing human granulocytic-macrophagal colony-stimulating factor.

EFFECT: valuable properties of plasmid DNA and microorganism strain.

2 cl, 4 dwg, 4 ex

Description

The invention relates to biotechnology, in particular to genetic engineering. It can be used to obtain granulocyte-macrophage colony stimulating factor (GM-CSF) person.

Granulocyte-macrophage colony-stimulating human factor (GM-CSF) can be used in the treatment of various pathological conditions of the immune and hematopoietic systems (anemic and myelodysplastic syndromes, neutropenia, AIDS, etc.), the consequences of radiation and chemotherapy of tumor diseases [Sakamoto KM, Golde DW, Gasson jc The biology and clinical applications of granulocyte-macrophage colony-stimulating factor. J. of Pediatrics, 1991, v.118, No. 3, p.s17-s20], as well as in cancer immunotherapy for extracorporeal activation of dendritic cells and stimulation of the immune response to cancer antigens [Nestle F.O., Alijagic S., Gilliet M., Sun Y., Grabbe S., Dummer R., Burg G., Schadendorf D. Vaccination ofmelanoma patients with peptide - or tumor lysine - pulsed dendritic cells. Nature Med., 1998, v.4, p. 328-332].

Known methods for producing human GM-CSF based on expression in transformed mammalian cells [Wong GG, Witek JS, Temple PA, Wilkens KM, Leary AC, Luxenberg DP, Jones SS, Brown EL, Kay RM, Orr EG, Shoemaker C., Golde DW, Kaufman RJ, Hewick RM, Wang EA, Clark SC Human GM-CSF: Molecular cloning of the complementary DNA and purification of the natural and recombinant proteins. Science, 1985, v. 228, No. 4701, p.810-815] and in yeast [Miyajima A., Otsu K., Schreurs J., Bond MW, Abrams JS, Arai K. Expression ofmurine and human GM-CSF in S. cerevisiae: mutagenesis of the potential glycosvlation sites. EMBO J., 1986, v.5., No. 6, p. 1193-1197]. The disadvantage of the first method is the extremely low yield of the target product (50 μg of protein from 1 liter of medium). Yeast cells provide a higher level of synthesis (0.5 mg from 1 l of medium), however, in this case, the species-specific post-translational glycosylation is an obstacle to the use of the drug.

Microbiological synthesis is a promising way to obtain human GM-CSF. Closest to the claimed is the method described in [Libby RT, Braedt G., Kronheim SR, March CJ, Urdal DL, Chiaverotti SR, Tushinski RJ, Mochizuki DY, Hopp TP, Cosman D. Expression and purification of native human granulocyte- macrophage colony-stimulating factor from an e. coli secretion vector. DNA, 1987, v. 6, No. 3, p. 221-229]. Recombinant plasmid DNA contains the gene for the artificial human GM-CSF precursor gene, which consists of a sequence encoding the OmpA signal peptide E. coli and mature human GM-CSF cDNA under the control of the Ipp-lac hybrid promoter.

Protein synthesis is carried out by adding an inducer, isopropyl-β-D-thiogalactopyranoside (IPTG), to a final concentration of 2 mM. The synthesized target protein after cleavage of the signal sequence is in an insoluble state. The resulting protein is purified using ion exchange and hydrophobic chromatography under denaturing conditions, followed by renaturation. The result is a mature human GM-CSF with a total yield of 2.5 mg / l of culture fluid.

The disadvantage of this method is the relatively low level of synthesis of GM-CSF and the use of large quantities of IPTG for induction.

The invention solves the problem of obtaining a polypeptide with the properties of human GM-CSF by constitutive synthesis, as well as increasing the level of its biosynthesis in bacterial cells.

The problem is solved by constructing recombinant plasmid DNA pFGM17 that encodes the constitutive synthesis of a polypeptide with the properties of human GM-CSF and a strain of Escherichia coli BL21 (DE3) / pEGM17, which ensures the synthesis of this polypeptide with an expression level of at least 15% of the total cellular protein. A high constitutive level of synthesis of the target polypeptide is ensured by the fact that the plasmid pFGM17 has a high copy number and contains the lac promoter E. coli, which works as constitutive in strains that are not superproducers of the lac repressor.

Recombinant plasmid DNA pFGM17 encoding a polypeptide with a human GM-CSF structure is characterized by the following features:

has a molecular weight of 2.04 Md (3.133 kbp);

encodes the amino acid sequence of a human GM-CSF artificial precursor;

consists of KpnI / EcoRI - DNA fragment of the plasmid pSPFl [Petrovskaya L.E., Kryukova E.A., Yakimov S.A., Wolfson A.N., Alibaeva R.A., Guzaev A.A., Abramov V. M., Korobko V.G. The effect of the topography of the signal peptidase site on the efficiency of secretion of the recombinant granulocyte-macrophage colony stimulating human factor in the periplasm of Escherichia coli. Bioorgan. Chemistry, 1995, Vol. 21, No. 12, pp. 912-919], length 2,686 kbp, containing the E. coli lac promoter, β-lactamase bla gene, E. coli lacZ gene fragment, ori initiation site replication and artificial DNA sequence encoding a signal peptide of a Cafl Yersinia pestis protein; as well as from the KpnI / EcoRI fragment of the intermediate plasmid pSK-GM with a length of 447 bp, including the synthetic human gene GM-CSF;

contains: the lac promoter E. coli, a synthetic gene for the artificial precursor of human GM-CSF, the β-lactamase bla gene, which determines the resistance of ampicillin to cells transformed with plasmid pFGM17, the ori site for replication initiation; unique recognition sites by restriction endonucleases having the following coordinates: KpnI - 280, PstI - 293, BglII - 309, NcoI - 333, Xhol - 474, BamHI - 688, SalGI - 700, ClaI - 710, EcoRI - 727.

A feature of the proposed plasmid construct is that the nucleotide sequence of mature human GM-CSF, together with the sequence encoding the signal peptide of the Cafl protein of Yersinia pestis, is part of the artificial precursor gene, which is controlled by the E. coli lac promoter. When using strains of E. coli, which are superproducers of lac-penpeccopa (lacl- ^q strains, for example, JM101), IPTG is required in small concentrations (0.1 mM) to induce the promoter and synthesize the target protein. In strains that are not superproducers of lac-penpeccopa (for example, BL21 (DE3)), the expression of this gene is independent of the presence of an inducer, which provides highly efficient constitutive synthesis of the precursor protein, which is cleaved by bacterial signal peptidase to form mature GM-CSF (target product).

The use of the secretory apparatus of bacterial cells for heterologous expression has several advantages, in particular, it allows to obtain the target protein, devoid of N-terminal methionine, in a soluble state from periplasm, bypassing the stage of destruction of the cell wall. In addition, the presence of a signal peptide coding sequence at the 5'-end of the artificial precursor gene circumvents the difficulties often encountered in the expression of GC-rich sequences. The use of the signal sequence of Cafl Yersinia pestis is explained by the fact that this protein, which is a component of a bacterial capsule, is synthesized and secreted with high efficiency.

The N-terminal sequence of mature GM-CSF contains an arginine residue and therefore carries a positive charge that negatively affects the efficiency of signal sequence cleavage [Yamane K., Mizushima S. Introduction of basic amino acid residues after the signal peptide inhibits protein translation across the cytoplasmic membrane of E. coli. J. Biol. Chem., 1988, v. 263, No. 36, p. 19690-19696]. To eliminate this effect, the asparagine residue at position (-2) relative to the cleavage site was replaced by an aspartic acid residue, which led to the neutralization of the charge of this site and increased the efficiency of cleavage of the signal sequence. The primary structure of mature GM-CSF has not changed. This replacement was carried out by cloning an oligonucleotide duplex of the corresponding structure (see Example 1) between the Kpnl restriction enzyme cleavage sites (at the 3'-end of the sequence encoding the signal peptide) and BglII (at the 5'-end of the gmcsf gene).

Expression of the hybrid precursor gene in E. coli cells is accompanied by a partial translocation of mature GM-CSF into the periplasmic space, from where the target protein can be isolated in soluble form, but most of the protein remains in an insoluble state after cleavage of the signal sequence. To isolate it, the use of denaturing agents is necessary.

To obtain a producer strain of a polypeptide with a human GM-CSF structure, competent cells of Escherichia coli BL21 (DE3) are transformed with the recombinant plasmid pFGM17.

The resulting strain of Escherichia coli BL21 (DE3) / pFGM17 is characterized by the following features.

Morphological signs. The cells are small, rod-shaped, gram-negative, non-spore-bearing, 1 × 3-5 μm, motile.

Cultural signs. When growing on a dense LA medium, the colonies are round, smooth, translucent, shiny, gray, the edge is even, the diameter of the colonies is 1-3 mm; pasty consistency. Growth in a liquid LB medium is characterized by even turbidity with the formation of a light precipitate.

Physico-biochemical characteristics. Cells grow at a temperature of 4-42 ° C with an optimum pH of 6.8-7.2. As a source of nitrogen, both mineral salts in the ammonium form and organic compounds in the form of peptone, tryptone, yeast extract, amino acids are used. Amino acids, glycerin, carbohydrates are used as a carbon source.

Antibiotic resistance. Cells are resistant to ampicillin (up to 200 μg / ml) due to the presence of the betalactamase gene in the plasmid.

The strain E. coli BL21 (DE3) / pFGM17 provides constitutive synthesis of a polypeptide with the properties of human GM-CSF in an amount of at least 15% of the total cellular protein, which is 2 times higher than in the prototype, while in contrast to the prototype, the induction operation during the cultivation of the strain is not required. The combination of the listed properties of the strain E. coli BL21 (DE3) / pFGM17 determines the high adaptability of the process for producing a recombinant polypeptide.

Figure 1 presents the physical map of the recombinant plasmid pFGM17; figure 2 - nucleotide sequence of the synthetic gene of the artificial precursor of human GM-CSF with adjacent regulatory elements: lac - promoter (1-84 bp), the DNA sequence encoding the signal peptide of the Cafl protein (123-206 bp) gmcsf gene (207-590 bp); the initiating and terminating codons are in bold, the restriction enzyme sites are underlined: KpnI, Pstl, BgIII and BamHI; figure 3 is the amino acid sequence of the GM-CSF polypeptide encoded by the recombinant plasmid pFGM17; figure 4 is an electrophoregram of cell lysates of the recipient strain of E. coli BL21 (DE3) (lane 1), the producer strain of E. coli BL21 (DE3) / pFGM17 (lane 2) in a 13% polyacrylamide gel (M - protein molecular weight markers; arrow indicates GM-CSF polypeptide).

The invention is illustrated by the following examples.

Example 1. Construction of intermediate recombinant plasmid DNA pSK-GM.

5 μg of pBluescript (SK) + plasmid DNA (Stratagene, USA) was sequentially treated with restriction enzymes Kpnl and SalGI (Fermentas, Lithuania) in branded buffer solutions and a linearized vector plasmid DNA was isolated from the obtained hydrolyzate in a 0.8% agarose gel. .

5 μg of plasmid DNA pGMS231 [Petrovskaya L.E., Ruzin A.V., Shingarova L.N., Korobko V.G. "Construction of recombinant strains of Escherichia coli that determine the secretory expression of artificial genes of granulocyte-macrophage colony stimulating human factor." Bioorgan. Chemistry, 1995, v.21, No. 12, pp. 845-854] are treated with restriction enzymes BglII and SalGI and a 0.391 kb fragment containing the gmcsf gene is isolated from the hydrolyzate obtained in a 1% gel of low-melting agarose.

0.5 μg of the obtained fragment with a length of 0.391 t.p. and 0.1 μg of the vector part of the plasmid pBluescript (SK) + is crosslinked using 3 units. T4 DNA ligases (Fermentas, Lithuania) in 20 μl of ligation buffer (Fermentas) with a 50-fold molar excess of oligonucleotide duplex:

CATTGCAACTGCAGATGCGGCACCTGCTA

CATGGTAACGTTGACGTCTACGCCGTGGACGATCTAG

10 μl of the reaction mixture was used to transform 100 μl of competent Escherichia coli XL-1 Blue cells (Stratagene, USA). 1/10 of the total number of cells used for transformation was plated on LB agar containing 75 μg / ml ampicillin. During cell sieving, 100 μl of a 0.1 M IPTG solution and 20 μl of a 4% solution of 5-bromo-4-chloro-3-indoxyl-β-D-galactoside are added to the agar surface.

The construction of pSK-GM intermediate recombinant plasmid DNA allows the use of the color selection principle to search for clones containing an inserted fragment. Plasmid DNA is isolated from the grown white clones and analyzed by restriction analysis. Plasmid DNAs containing the desired set of restriction fragments are selected. The nucleotide sequence of the selected DNAs is determined and plasmid DNAs are finally selected in which the nucleotide sequence of the gmcsf gene is fully consistent with the data shown in FIG. 2.

Example 2. Construction of recombinant plasmid DNA pFGM17.

5 μg of pSK-GM plasmid DNA was sequentially treated with restriction enzymes Kpnl and EcoRI (Fermentas, Lithuania), and a 0.447 kb fragment containing the gmcsf gene was isolated from the hydrolyzate obtained in a 1% gel of low-melting agarose.

5 μg of plasmid DNA pSPFl was sequentially treated with restriction enzymes Kpnl and EcoRI, and from the obtained hydrolyzate vector DNA of 2.866 kb was isolated in 1% gel of low melting agarose.

The resulting fragment and vector DNA are combined using a ligase reaction in 20 μl of ligation buffer (Fermentas) containing 2 units T4 DNA ligase. 10 μl of the reaction mixture was used to transform 100 μl of competent XL-1 Blue cells. 1/10 of the cells used for transformation are seeded on LB agar containing 75 μg / ml ampicillin. From the grown clones, the target plasmid DNA pFGM17 is isolated and analyzed by treatment with a set of restriction endonucleases HaeIII, HinDIII, EcoRV, Kpnl and EcoRI followed by electrophoretic analysis of the lengths of restriction fragments in a 5% lolacrylamide gel.

Finally, the structure of recombinant pFGM17 DNA is confirmed by determining the nucleotide sequence in the region of an inserted fragment containing the synthetic human GM-CSF gene.

Example 3. Obtaining and determining the productivity of the producer strain of the polypeptide with the properties of human GM-CSF.

Recombinant plasmid DNA pFGM17 transform competent cells of Escherichia coli BL21 (DE3) (Novagen) and get the producer strain of the polypeptide with the properties of human GM-CSF. E. coli BL21 (DE3) / pFGM17 cells were grown at 37 ° C in 20 ml of LB liquid medium containing 75 μg / ml ampicillin for 16 hours on a shaker at 175 rpm. A 1 ml sample was taken and centrifuged for 5 min at a speed of 6000 rpm, after which the cells were suspended in 100 μl of buffer containing 125 mM Tris-HCl, pH 6.8, 20% glycerol, 3% sodium dodecyl sulfate, 3% mercaptoethanol, 0.005 % bromphenol blue, incubated for 10 min in a boiling water bath, samples with a volume of 5 μl were analyzed by electrophoresis in 13% polyacrylamide gel with sodium dodecyl sulfate. The gel is stained with Coomassie R-250 (Fig. 4), scanned and the percentage of recombinant protein in lysates is calculated using the Scion Image program (Scion Corp., USA). According to the scan, the GM-CSF polypeptide is 15% of the total cellular protein.

Example 4. Isolation and characterization of a recombinant polypeptide with the properties of human GM-CSF.

E. coli BL21 (DE3) / pFGM17 cells were grown at 37 ° C in 200 ml of LB liquid medium containing 100 μg / ml ampicillin for 16 hours on a shaker at 175 rpm. The cells are centrifuged, after which 1 g of wet biomass is suspended in 10 ml of buffer A (20 mm Tris, pH 8, 300 mm NaCl, 0.1% Triton X-100, 10% sucrose, 1 mm phenylmethylsulfonyl fluoride, 5 mm EDTA) and subjected sonication (6-10 pulses of 10 seconds each) in an ice bath. The precipitate after centrifugation is washed 2 times with buffer B (50 mm Tris, pH 8, 20 mm EDTA, 0.5% Triton X-100), dissolved in 2 ml of buffer C (10 mm Tris, pH 8, 6 M urea, 10 mm beta-mercaptoethanol, 20 mM NaCl) and applied to a 70 ml Sephadex G-100 (Pharmacia) column pre-equilibrated with buffer C. Gel filtration was carried out in the same buffer for 20 hours at an elution rate of 2 ml / h. The fractions containing purified protein are determined by the results of electrophoresis in SDS-PAGE on Laemmli.

Renaturation is carried out by slowly adding a protein solution to an equal volume of buffer D (10 mm Tris, pH 8.5, 500 mm NaCl, 1 mm EDTA), followed by dialysis in a 50-fold volume of buffer E (10 mm Tris, pH 8, 100 mm NaCI, 1 mM EDTA) overnight. The resulting solution was sterilized by filtration through a 0.22 μm filter (Millipore).

The described isolation method allows to obtain 1.5 mg of GM-CSF from 1 g of wet biomass, which corresponds to 1.5 mg of protein from 100 mg of lyophilized biomass.

The N-terminal amino acid sequence is determined on a 477A sequencer and a FTG analyzer 120A from Applied Biosystems, USA. The recombinant human GM-CSF preparation has the following N-terminus structure: Ala Pro Ala Arg Ser Pro Ser ..., i.e. fully corresponds to the structure of the N-terminus of natural human GM-CSF.

Thus, the claimed technical solution allows to obtain a polypeptide with a structure and properties identical to the structure and properties of natural human GM-CSF; the biosynthesis of the polypeptide is constitutive, and the level of its synthesis is at least 15% of the total cellular protein due to the fact that the GM-CSF gene is controlled by the E. coli lac promoter in the high-copy plasmid. All this allows you to significantly improve the manufacturability and efficiency of the process of obtaining recombinant GM-CSF by eliminating the stage of induction of the biosynthesis process while simultaneously increasing the yield of the target product by 2 times.

Claims (2)

1. Recombinant plasmid DNA pFGM 17 encoding a polypeptide of granulocyte macrophage colony stimulating human factor (GM-CSF), having a molecular weight of 2.04 Md (3.133 kb) and consisting of KpnI / EcoRI - DNA fragment of the plasmid pSPFl, 2.686 kbp containing the E. coli lac promoter, β-lactamase bla gene, E. coli lacZ gene fragment, replication initiation ori region and artificial DNA sequence encoding the signal peptide of the Cafl Yersinia pestis protein, as well as KpnI / EcoRI fragment of the intermediate plasmid pSK-GM with a length of 0.447 kbp, including the synthetic gene GM-KS person, the sequence of which is shown in figure 2, and containing unique recognition sites by restriction endonucleases, having the following coordinates: KpnI - 280, PstI - 293, BglII - 309, NcoI - 333, Xhol - 474, BamHI - 688, SalGI - 700, ClaI - 710, EcoRI - 727. 2. The bacterial strain Escherichia coli BL21 (DE3) / pFGM17 is the producer of the polypeptide of the granulocyte macrophage colony stimulating human factor.

Images