RU2565544C2 - Recombinant strain vv-gmcsf-s1/3 of vaccinia virus, producing secreted granulocyte-macrophage colony-stimulating human factor - Google Patents

Abstract

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to the field of biotechnology and deals with a recombinant strain of the vaccinia virus. The characterised strain is constructed on the basis of L-IVP strain of the vaccinia virus and contains an insert of a gene of the human granulocyte-macrophage colony-stimulating factor (GM-CSF), the structure of which corresponds to cDNA of the matrix RNA of human GM-CSF, represented in the GenBank under number Ml 1220.1. The gene of human GM-CSF is expressed under the control of the natural promoter p7.5K of the vaccinia virus and produces a secreted form of the biologically active human GM-CSF in mammalian cells at the level of 40 mg per ml of a culture medium. The strain VV-GMCSF-S1/3 is deposited in the State collection of Rospotrebnadzor (Federal Service for Supervision of Consumer Rights Protection and Human Welfare) of pathogens of viral infections, ricketsioses of FBSI SRC VB (Federal Budgetary Scientific Institution the State Research Centre of Virology and Biotechnology) "Vector" under number V-631 and can be used for the elaboration of medications for fighting oncologic and infectious diseases.

EFFECT: obtaining the recombinant strain of the vaccinia virus.

3 ex, 5 dwg

Description

The invention relates to recombinant strains of the vaccinia virus producing secreted granulocyte-macrophage colony stimulating factor (GM-CSF) of a person, and can be used in biotechnology, in particular, in genetic engineering for the development of new generation vaccines and drugs for the fight against cancer and infectious diseases .

The vaccinia virus (WWII) has a long and successful history of medical use as a live vaccine in the eradication of smallpox in the world (As it was, 2011 [1]). In different countries, different vaccinia virus strains have been used to vaccinate against smallpox. One of the strains used in Russia is L-IVP, a biovariant of the Lister strain (Marennikova, 1998 [2]). To prevent possible post-vaccination complications, a number of attenuated variants of the vaccinia virus have been developed with deletions of genome regions responsible for virulence (Maksyutov, 2011 [3]). The thymidine kinase (tk) gene is a BOB virulence factor, the inactivation of which leads to significant attenuation of the virus in vivo (Sierpinski, 1996 [4]). This region of the genome is widely used for the insertion of foreign genes (transgenes) in order to obtain bivalent vaccines (genes of protective proteins of pathogens of viral and bacterial diseases (Schelkunov, 2010 [5])) or oncolytic drugs (genes of immunostimulating, cytotoxic and other proteins (Kochnev, 2012 [6]). The insertion of cytokine genes as transgenes into the virus genome is a universal technology for increasing the immunostimulating activity of the virus both in vaccination and in the treatment of cancer (Kochneva, 2012 [6]).

GM-CSF - a polypeptide cytokine, belongs to the group of granulocyte-macrophage colony-stimulating factors. Stimulates the formation of colonies of granulocytes and macrophages from committed precursors. In vivo and in vitro GM-CSF not only stimulates the proliferation and maturation of myeloid progenitor cells, but can also enhance the various functions of mature effector cells: it increases the ability of neutrophils, macrophages and eosinophils to phagocytosis and destruction of microorganisms (Weisbart, 1985 [7], Fleischmann , 1986 [8]), increases antibody-dependent cell-mediated cytotoxicity against tumor cells (Kushner, 1989 [9]).

It is advisable to use GM-CSF in the case of combined use of anticancer drugs together with chemotherapy to reduce the severity of neutropenia (Kim, 2006 [10]). Previously, the human GM-CSF gene was inserted into the genome of two strains of the vaccinia virus WR (JX-963) (Thome, 2007 [11]) and Wyeth (JX-594) (Kirn, 2010 [12]) in the tk gene region under control early-late promoter W (Cochran, 1985 [13]). These strains are currently being successfully tested as antitumor drugs (Kirn, 2010 [12]; Breitbach, 2011 [14]). In this regard, the recombinant L-IVP strain we obtained with the insertion of the GM-CSF gene also seems to be a promising oncolytic drug. The L-IVP strain was used in Russia for vaccination against smallpox and is currently being used to a limited extent, therefore, preparations based on it with attenuated properties have an additional chance of being considered as drugs in the Russian Federation.

Known recombinant non-replicating in human cells bird poxvirus for the delivery of GM-CSF to enhance the immune response to a specific antigen that is delivered by another recombinant virus (WO 0195919 (A2) - A recombinant non-replicating virus expressing GM-CSF and uses its to enhance immune responses)

However, the delivery of GM-CSF and antigen in different vectors complicates the technology for their further use (at the injection site), and can also significantly reduce the effectiveness of immunostimulation.

Known recombinant strain of the virus of the Second World War, secreting GM-CSF (US Patent 6548068, published in 2003, and extension in the application US 20050186180, published in 2005). In these inventions, recombinants were prepared based on the Wyeth strain of vaccinia virus, which was used as a vaccine in the United States. To enhance the immune response, a mixture of recombinant and parental virus strains was used, which increases the likelihood of post-vaccination complications. Also, for the insertion of antigen and immunomodulating molecules, the authors use two different recombinant viruses, which presents additional difficulties in vaccination and colocalization of transgene products in the body to induce an effective immune response. For the expression of transgenes in this analogue, the superearly promoter P40 was used, which ensures the production of transgenes only at the very early stages of a viral infection. In addition, these publications do not show the expression of the GM-CSF gene and its secretion into the culture medium in general. For the selection of recombinants of the vaccinia virus, additional insertion and expression of the bacterial beta-galactosidase gene is used, which may have negative consequences during vaccination.

The closest analogue of the invention (prototype) is a recombinant variant of the BOB, obtained on the basis of the American vaccine strain Wyeth and carrying the human GM-CSF gene in the structural part of the tk gene under the control of the early-late synthetic promoter of the BOB (Mastrangelo, 2000 [15] US Patent No. 6,093,700 published July 25, 2000). In addition to the GM-CSF gene, the E. coli B-galactosidase gene is also integrated into the structural part of the tk gene of this strain under the control of the natural promoter BOB p7.5K. The strain was named JX-594 (from Jennerex Biotherapeutics, Inc.) and is currently undergoing clinical trials as an antitumor drug (Parato, 2012 [16]).

However, the Wyeth strain of smallpox vaccine virus has never been used in Russia as an anti-inflammatory vaccine, and the level of GM-CSF production under the control of the synthetic promoter in the recombinant strain JX-594 is very low - 20-40 picograms per ml of culture medium with cell infection with a multiplicity of 0, 1 PFU / cell (Kim, 2006 [10]). In addition, the strain JX-594, in addition to the GM-CSF gene, contains a large fragment of bacterial DNA in excess of 3,000 bp. (E. coli β-galactosidase gene) in the immediate vicinity of the GM-CSF gene, which can destabilize the structure of the entire insertion region and whose expression under the highly potent promoter BOB p7.5K can adversely affect cell activity.

The technical result of the claimed invention is the creation of a more highly productive recombinant strain of the Second World War, producing secreted human GM-CSF with an efficiency of not less than 1 μg / ml of culture medium and suitable for constructing oncolytic drugs and multivalent vaccines on its basis.

The specified technical result is achieved by the creation of a strain of the recombinant vaccinia virus VV-GMCSF-S1 / 3 containing the cDNA insertion of the human GM-CSF matrix RNA in the structural part of the viral thymidine kinase gene expressed under the control of the natural promoter p7.5K BOB producing a secreted biologically active GM-K-GM human cells in mammalian cells at a level of 1-40 μg per ml of culture medium and deposited in the State collection of Rospotrebnadzor of causative agents of viral infections, rickettsioses FBUN SSC WB "Vector" p d number of V-631 (certificate of deposit strain №0315 / 1381 on 04/26/2913 was attached).

The creation of the recombinant vaccinia virus strain VV-GMCSF-S1 / 3 is achieved by homologous recombination between the BOB DNA of strain L-IVP and plasmid DNA pXJP5.2-GMCSF (Fig. 1) in the cytoplasm of CV-1 cells and subsequent selection of recombinants in cells клет 143 TC ^- with the addition of bromodeoxyuridine (BDU) to the culture medium. The plasmid pXJP5.2-GMCSF was created on the basis of pXJP5.2 (Fig. 2), which provides the insertion

transgenes into the region of the viral thymidine kinase (tk) gene due to the presence of the BOB DNA fragment of the L-IVP strain corresponding to the positions of nucleotides 83070-84639 deposited in GenBank of strain BOB Lister 107 (Accession DQ 121394), divided into the left (595 bp ) and the right (933 bp) flanks with a deletion of 31 bp in the center of the tk gene, into the region of which the natural BOB p7.5K promoter (276 bp) was introduced (Cochran, 1985 [13]) and the polylinker for insertion of transgenes (Fig. 2). A full-sized DNA copy (cDNA) of human GM-CSF matrix RNA was isolated from our cDNA library, cloned into a universal pUC19 vector and sequenced. The structure of the cloned GM-CSF cDNA coincided with the structure deposited in GenBank (Accession Ml 1220.1), but had 4 additional nucleotides (AAAA) at the 3 ′ end in the polyA pathway. Next, the GM-CSF cDNA as part of a 850 bp fragment flanked by the restriction sites EcoRI and HindIII was transferred from plasmid pUC19 to polylinker pXJP5.2 to obtain plasmid pXJP5.2-GMCSF (Fig. 1).

Strain VV-GMCSF-S1 / 3 is characterized by the following features: Morphological characters. The strain has the properties of a typical representative of the Second World War, but unlike the vector virus, it has the phenotype TK ^- GMKSF +.

Physiological and biochemical characteristics and cultural properties of the strain. Recombinant BOB DNA is about 200,000 bp in length. The presence of the human GM-CSF gene in its genome was confirmed by PCR (Fig. 3), the expression of the human GM-CSF gene was confirmed by Western blot analysis of the culture medium and lysates of CV-1 cells infected with the recombinant strain W-GMCSF-S1 / 3 (Fig. 4). The biological activity of secreted recombinant GM-CSF was evaluated in human TF-1 erythroleukemia cell culture, which is GM-CSF-dependent and proliferates only in the presence of GM-CSF and a number of other human cytokines (Fig. 5).

The inventive strain of smallpox virus, as a platform for the construction of antitumor and vaccine preparations, has a number of advantages. It replicates in the cytoplasm of infected cells in

autonomous formations - viral factories, does not contact with cellular genetic material, does not integrate into chromosomes, does not have oncogenic potential. The vaccinia virus is able to induce both a humoral and a cellular immune response (Damon, 2007 [17]), which is especially important for the recognition and destruction of tumor cells or cells infected with pathogenic viruses in the development of antiviral multivalent vaccines.

The claimed strain of the vaccinia virus VV-GMCSF-S1 / 3 was obtained on the basis of the vaccine strain L-IVP, which has been widely used in medical practice for the control of smallpox in Russia, but since 1980 such vaccination has been discontinued due to the eradication of smallpox in the world (How is it was, 2011 [1]). Thus, most people do not have antibodies to smallpox viruses, which significantly increases the effectiveness of using the vaccinia virus as an antitumor and multivaccine drug. The incorporation of the GM-CSF gene with simultaneous inactivation of the thymidine kinase gene provides additional attenuation and immunogenicity of the virus.

The invention is illustrated by the following figures of graphic images:

- in FIG. Figure 1 shows the design of the recombinant strain VV-GMCSF-S1 / 3 by homologous recombination of BOB DNA and plasmid pXJP5.2-GMCSF DNA, in which L-tk is the left flank of the insert, which is a fragment of the BOB genome of the L-IVP strain, corresponding to the area of 83070-83665 bp strain Lister 107 (GenBank DQ 121394) and including 244 bp The N-terminal portion of the tk gene; p7.5K - natural early-late promoter of BOB; GMCSF - DNA copy of human GM-CSF messenger RNA; R-tk is the right flank of the insert, which is a fragment of the genome of the Second World War of strain L-IVP, corresponding to region 83696-84639 bp strain Lister 107 (GenBank DQ 121394) and including 257 bp C-terminal portion of the tk gene; AP ^r - ampicillin resistance gene; ORI is the replication start area. The DNA of strain VV-GMCSF-S1 / 3 shows the positions of the direct primer TKVVsense

and two reverse primers: TK2 internal antisense and GMCSF antisense. These primers were used to identify and confirm the structure of the recombinant virus;

- in FIG. Figure 2 shows the physical map of plasmid DNA pXJP5.2, which shows: L-tk - the left flank of the insert, which is a fragment of the BOB genome of strain L-IVP, corresponding to the region 83070-83665 bp strain Lister 107 (GenBank DQ 121394); p7.5K - natural early-late promoter of the Second World War; XbaI polylinker - EcoRI, containing unique restriction sites for insertion of transgenes; R-tk is the right flank of the insert, which is a fragment of the genome of the Second World War of strain L-IVP, corresponding to region 83696-84639 strain Lister 107 (GenBank DQ121394); AP ^{r is} ampicillin resistance gene; ORI - region of the beginning of replication;

- in FIG. Figure 3 shows the electrophoretic analysis in 1% agarose of PCR fragments amplified using two specific primer pairs: TKVVsense × TK2 internal antisense (lanes 1-2) and TKVVsense × GMCSF antisense (lanes 3-4), primer positions are shown in FIG. 1. Μ - molecular weight marker M28 (NPO SibEnzyme, Russia): 3000,1500,1000, 900,800,700 ... 100 bp Lane 1 - L-IVP, fragment 748 bp (lack of insertion of the GM-CSF gene); lane 2 - recombinant VV-GMCSF-S1 / 3, fragment 2092 bp (presence of GM-CSF gene insertion); lane 3 - L-IVP, amplification does not occur, since the sequence complementary to the GMCSF antisense primer is absent; lane 4 - recombinant VV-GMCSF-S1 / 3, fragment 1018 bp (presence of GM-CSF gene insertion);

- in FIG. 4 presents the data of the analysis of the expression of the human GM-CSF gene in the composition of the recombinant BOB W-GMCSF-S1 / 3. Electrophoregram (A) and Western blot (B). The size of the non-glycosylated mature human GM-CSF is 14.4 kDa (lane 5, non-glycosylated human GM-CSF produced in E. coli cells). Lanes 1.3 — isoforms of human GM-CSF corresponding to various degrees of protein glycosylation: 1 — culture medium of CV-1 cells infected with recombinant VV-GMCSF-S1 / 3, 48 hours of incubation; 2-control, the culture medium of CV-1 cells infected with L-IVP, 48 hours

incubation; 3 - lysate of CV-1 cells infected with the recombinant VV-GMCSF-S1 / 3, 48 hours of incubation; 4 - control, lysate of CV-1 cells infected with L-IVP, 48 hours of incubation; M- control M.v. 250,150, 100, 75; 50, 37, 25, 20, 15 kDa (BioRad, Kaleidoscope Prestained Standards). In the Western blot analysis, Rabbit anti-human GM-CSF Polyclonal antibody (PerroTech) was used as primary antibody. As secondary antibodies - Anti-rabbit IgG (Whole molecular le) alkaline phosphatase conjugate (Sigma);

- in FIG. 5 presents the analysis of the biological activity of human GM-CSF expressed in the composition of the recombinant vaccinia virus W-GMCSF-S1 / 3. The Υ axis shows the biological activity of GM-CSF -% stimulation of the proliferation of cytokine-dependent human erythroleukemia cells TF-1. The number of living cells grown in untreated medium and adding medium from CV-1 cells infected with the wild-type L-IVP virus was taken as 100%. On the X axis, the concentration of the recombinant prokaryotic drug GM-CSF (calibration) or dilution of the culture medium of CV-1 cells infected with the recombinant VV-GMCSF-S1 / 3 and the original L-IVP strain (negative control).

For a better understanding of the invention, the following are examples of its implementation.

Example 1. Transfection of CV-1 cells with the recombinant plasmid pXJP5.2-GMCSF and obtaining the recombinant BOB strain VV-GMCSF-S1 / 3

For transfection of plasmid DNA, pXJP5.2-GMCSF was prepared in preparative quantities from 250 ml of Luria-Bertani medium and isolated using EndoFree Plasmid Maxi Kit (QIAGEN), a laboratory reagent kit for isolating plasmid DNA purified from endotoxins.

To obtain a recombinant strain of the virus, Lipofectamine ™ LTX transfection reagent, 1 ml and Plus reagent (Invitrogen) were used. Transfection was performed on a 90% monolayer of CV-1 cells grown in six-well plates (Greiner). Cells were infected with vaccinia virus with a multiplicity of 0.05 PFU / cell, and after 1 hour incubation at 37 ° C was added

a mixture of plasmid DNA (5 μg) + lipofectamine (20 μl) + Reagent Plus in accordance with the manufacturer's recommendation in 1 ml of Opti-MEM medium (Invitrogen). After 1 hour of incubation at 37 ° C, 2 ml of Opti-MEM medium was added to the wells and incubated at 37 ° C in an atmosphere of 5% CO _{2 for} another 24-36 hours until the development of a cytopathic effect. The material was frozen three times, thawed and sonicated to obtain a homogeneous viral suspension. Further selection of recombinants was performed by passaging twice on a monolayer of cells N143TK ^- supplemented with bromodeoxyuridine (Sigma) at a concentration of 25 ug / ml DMEM medium (Invitrogen). The virus was cloned using plaques under a hard agar coating and analyzed for the presence of the insertion of the human GM-CSF gene by PCR using primers

TKVVsense 20 bp 5 ′ cgatgttcttcgcagatgat 3 ′

TK2 internal antisense 20 bp 5 ′ ttctgtgagcgtatggcaaa 3 ′

GMCSF antisense 20 bp 5 ′ gggctaaagttctctctggagg 3 ′

The TKVVsense primer is located on the viral genome to the left of the flanking sequence of the plasmid pXJP5.2-GMCSF and "binds" the insertion of the GM-CSF gene directly to viral DNA (Fig. 1). The TK2 internal antisense primer lies within the right flanking fragment of the viral genome, which is common to the plasmid and viral DNA (Fig. 1). Using a pair of primers TKVVsense × TK2 internal antisense in the presence of an insert of the GM-CSF gene with viral DNA, a fragment of 2092 bp is amplified, and in the absence of an insert (wild-type virus) - 748 bp When using a pair of TKVVsense × GMCSF antisense primers, amplification occurs only with recombinant viral DNA since the GMCSF antisense primer lies inside the GM-CSF gene (Fig. 1) - in the presence of an insert, the size of the amplified fragment is 1018 bp, in the case of wild-type virus - 0 (Fig. 3).

Viral DNA for PCR was isolated using DNA sorb kits (CJSC Interlabservis). The selected recombinant variant W-GMCSF-S1 / 3 was double-cloned, produced on a monolayer of CV-1 cells and purified by centrifugation in a density gradient with acharose (25-40%).

Virus titer was determined by plaque on a CV-1 cell monolayer stained with a crystal violet fixative solution (2 g / L crystal violet, 50 ml / L formaldehyde, 100 ml / L ethanol, water). The purified recombinant strain BOB VV-GMCSF-S1 / 3 with a titer of 10 ⁹ PFU / ml is stored in bulk at -80 ° C.

Example 2. Evaluation of the production of human GM-CSF by the recombinant strain BOB VV-GMCSF-S1 / 3 Human GM-CSF is synthesized as a precursor protein (144 a.a.) followed by cleavage of the signal peptide (17 a.a.), such thus, the mature polypeptide contains 127 a.a. (14.4 kDa). The existence of 16 different isoforms of human GM-CSF produced in eukaryotic cells has been shown. These isoforms, which have different glycosylation patterns, determine the heterogeneity of natural GM-CSF and the molecular weight spread from 14.4 to 32 kDa.

A monolayer of CV-1 cells (90% of the surface) grown in a 650 ml culture mattress (Greiner) was infected with a recombinant BOB strain VV-GMCSF-S1 / 3 or the original BOB strain L-IVP with a multiplicity of 1 PFU / cell. Incubated for 24 hours at 37 ° C in an atmosphere of 5% CO ₂ , the supporting medium (DMEM + 2% fetal bovine serum (HyClone)) was removed, the cells were destroyed with lysis buffer (50mM TRIS-HCl pH 7.5, 150 tM NaCl, 1% Triton X -100, 5 tM MgCl ₂ , proteases inhibitor cocktail) in a volume of 7 ml, 3 rounds of freezing-thawing were carried out, then three times sonication (20 sec at 200-300 W with 10 sec cooling after each treatment), centrifugation 14000 rpm , 30 min, 4 ° C, the supernatant was analyzed in Western blot analysis using Rabbit anti-human GM-CSF Polyclonal antibody (PerroTech) as primary antibody. As secondary antibodies - Anti-rabbit IgG (Whole molecular le) alkaline phosphatase conjugate (Sigma). Electrophoretic separation of proteins was carried out in a BioRad chamber in a 5% concentrating and 14% separating acrylamide gel at V = 100. Protein transfer from the gel was carried out in a MiniTrans-Blot cell “BioRad” chamber onto an Immun-Blot TMPVDF Membrane for

Protein Blotting 0.2µm at V = 100 1 hour 20 minutes. Then the membrane was washed with transfer buffer and placed in a blocking solution of TBS pH 7.4 with 5% milk (Skim Milk Powder, Biochemika, Fluka) for 1 hour at room temperature (CT) on a rocking chair. The membrane was washed 3 times for 5 minutes with TBS pH 7.4 on a shaker and incubated for 16 hours, at + 4 ° C with primary antibodies at a working concentration of 0.2 μg / ml, in TBS pH 7.4 with 0.1% Tween- 20 and 5% milk. After binding to the primary antibodies, the membranes were washed 3 times for 5 minutes with TBS pH 7.4 with 0.1% Tween-20 on a shaker, then binding was performed with secondary antibodies at a working dilution of 1: 5000 in TBS pH 7.4 with 0.1 % Tween-20 and 5% milk for 1 hour with CT on a rocking chair. After binding to the conjugate, TBS pH 7.4 was washed 3 times for 5 minutes with 0.1% Tween-20 on a rocking chair and 1 time with substrate buffer (AP buffer: 100 mMTris, 100mM NaCl, pH 9.5 with the addition of 50 mM MgCl ₂ ). BCIP (5-bromo-4-chloro-3-indolyl phosphate) and NBT (NitroBluetetrazolium) were used as a substrate. The reaction was stopped by washing the membrane in distilled water.

The results show that GM-CSF is detected only in the culture medium and lysates of CV-1 cells infected with the recombinant strain W-GMCSF-S1 / 3 (Fig. 4). In cells infected with L-IVP, GM-CSF is not detected. In the culture medium, a secreted form of GM-CSF with a high molecular weight is presented (Fig. 4, lane 1, 25-32 kDa) due to more complete glycosylation, in contrast to intracellular GM-CSF, detected in cell lysates, which presents a wide range of GM isoforms -KSF (Fig. 4, lane 3, 18-32 kDa). As a positive control, the non-glycosylated form of GM-CSF obtained in E. coli cells was used (Fig. 4, lane 5, 14.4 kDa).

Example 3. Analysis of the biological activity of human GM-CSF expressed in the composition of the recombinant vaccinia virus VV-GMCSF-S1 / 3

The biological activity of human GM-CSF secreted from CV-1 cells infected with the recombinant W-GMCSF-S1 / 3 was evaluated by the level of stimulation of proliferation of human erythroleukemia cells TF-1. This test

based on the ability of GM-CSF-dependent TF-1 cells to proliferate only in the presence of GM-CSF. Proliferative activity was evaluated by micromethod on 96-well culture plates (Costar) using XTT reagent (Monks, 1991 [18]; Scudiere, 1988 [19]) and DMEM culture medium obtained 48 hours after infection of CV-1 cells with recombinant VV- GMCSF-S1 / 3 or control (wild type, strain L-IVP) BOB. Before use, the culture medium was clarified by centrifugation for 10 minutes at 5000 rpm. To assess the concentration of GM-CSF in the culture medium, a purified and characterized preparation of recombinant GM-CSF obtained in E. coli cells was used (Gileva, 1997 [20]). To conduct an experiment in RPMI medium (Invitrogen) supplemented with 10% fetal bovine serum, 2-fold dilutions of the culture medium from infected VV-GMCSF-S1 / 3 CV-1 cells in the range 1: 500 -1: 4000 were prepared (Fig. 5) or recombinant protein GM-CSF to a final concentration of 0.1; one; 2; four; 8 ng / ml (calibration). As a negative control, RPMI medium and the culture medium of CV-1 cells infected with the original BOB L-IVP strain were used. 50 μl of the above dilutions or controls were added to the wells of a 96-well plate, and 50 μl of a TF-1 cell suspension in RPMI medium supplemented with 10% fetal bovine serum at 2 × 10 ⁴ cells / well was added. The tablets were placed in a thermostat at a temperature of 37 ° C, 5% CO ₂ , humidity 85% and incubated for 72 hours. After incubation, 50 μl of XTT reagent (Sigma) and PMS (Fluka) were added to each test well, which was obtained by adding 1.25 mM PMS solution to an XTT working solution of 1 mg / ml at the rate of: 20 μl PMS per ml of XTT . The plate was incubated for another 4 hours, and the optical density of OD _{490/620 was determined} on a SpectraCount (Packard) _plate spectrophotometer. Each point was made in five replicates, the average value and variance were determined for various concentrations of the culture medium and purified recombinant protein GM-CSF, and a histogram of the dependence of OD on dilutions and concentration was constructed. Stimulation of proliferation of TF-1 cells was calculated as a percentage in relation to the control. For 100% accepted

the number of living cells in the negative control. From FIG. 5 that the proliferative activity of the culture medium from infected VV-GMCSF-S1 / 3 CV-1 cells corresponds to a concentration of 40 μg / ml calibration protein GM-CSF.

Thus, the above results (examples 1-3) confirm the achievement of the claimed technical result, namely: created a recombinant strain of BOB VV-GMCSF-S1 / 3, producing secreted biologically active human GM-CSF in mammalian cells at a level of 40 μg per ml of culture Wednesday.

Sources of scientific, technical and patent information

1) HOW IT WAS: a program of global eradication of smallpox in the memories of its participants. // Ed. S.S. Marennikova. - CERIS, Novosibirsk, 2011 .-- 276 p.

2) Marennikova S.S., Schelkunov S.N. Pathogenic for humans orthopoxviruses. // M .: KMK Scientific Press Ltd. - 1998 .-- 386 p.

3) Maksyutov R.A. et al. Development of modern anti-arterial vaccines. // Questions of virology. - 2011. - T. 56. - No. 6. - S. 4-8.

4) Sierpinsky O.I. et al. 1996. Construction of recombinant variants of orthopoxviruses by insertion of foreign genes into the intergenic gap of the viral genome. // Molecular. biology. - 1996. - No. 30. - S.1064-1073.

5) Schelkunov S.N. Genetic Engineering. // Siberian University Publishing House, Novosibirsk. - 2010 .-- 514 s.

6) Kochneva G.V. et al. Oncolytic poxviruses. // Molecular Genetics, Microbiology and Virology. - 2012. - No. 1 - S.8-15.

7) Weisbart R.H. et al. Human granulocyt-macrophage colony-stimulating factor is a neutrophil activator. // Nature. - 1985. - Vol. 314. - P. 361-363.

8) Fleischmann J. et al. Granulocyte-macrophage colony-stimulating factor enhances phagocytosis of bacteria by human neutrophils. // Blood. - 1986. - V. 68 (3) - P. 708-711.

9) Kushner B.H et al. GM-CSF enhances 3F8 monoclonal antibody-dependent cellular cytoxicity against human melanoma and neuroblastoma. // Blood. - 1989. - V. 73 (7) - P. 1936-1941.

10) Kim J.H. et al. Systemic armed oncolytic and immunologic therapy for cancer with JX-594, a targeted poxvirus expressing GM-CSF. // Molecular Therapy. - 2006. - V. 14. - P. 361-370.

11) Thorne S. et al. Rational strain selection and engineering creates a broad-spectrum, systemically effective oncolytic poxvirus, JX-963. // J. Clin. Invest. - 2007. - V. 117. - P. 3350-3358.

12) Kirn D. Oncolytic vaccinia virus cancer therapy // U.S.A. Patent # 2010/0303714 A1 - 2010.

13) Cochran M.A. et al. In vitro mutagenesis of the promoter region for a vaccinia virus gene: evidence for tandem early and late regulatory signals. // J. Virol. - 1985.- V. 54 (1). - P. 30-37.

14) Breitbach C. et al. Intravenous delivery of a multi-mechanistic cancer-targeted oncolytic poxvirus in humans. // Nature. - 2011. - V. 477. - P. 99-102.

15) Mastrangelo M.J. et al. Method of inducing an immune response using vaccinia virus recombinants encoding GM-CSF. // USA Patent # 6,093,700. - 2000 (prototype).

16) Marato R. et al. The oncolytic poxvirus JX-594 selectively replicates in and destroys cancer cells driven by genetic pathways commonly activated in cancers. // Molecular Therapy. - 2012. - V. 20. - P. 749-758.

17) Damon I. Poxviridae. In: Knipe D. M. and Howley P. M. Fields Virology. 5th ed. // Lippincott Williams and Wilkins, Philidelphia. - 2007 .-- P. 2948-2974.

18) Monks A. et al. Feasibility of a High-Flux Anticancer Drug Screen Using a Diverse Panel of Cultured Human Tumor Cell Lines // Journal of the National Cancer Institute. - 1991. - V. 83. N 11. - P. 757-766.

19) Scudiere D.A. et al. Evaluation of a Soluble Tetrazolium / Formazan Assay for Cell Growth and Drug Sensitivity in Culture Using Human and Other Tumor Cell Lines. // Cancer Research. - 1988. - V. 48. - P. 4827-4833.

20) Gileva I.P. et al. Recombinant plasmid DNA p280GM encoding a polypeptide with the properties of a granulocyte macrophage colony stimulating factor and E. coli strain SG 20050 / p280GM is a producer of a polypeptide with the properties of a granulocyte macrophage colony stimulating human factor. // Patent RF 2091488, published September 27, 1997, bull. Number 27.

Claims (1)

Recombinant strain VV-GMCSF-S1 / 3, constructed on the basis of the vaccinia virus L-IVP strain, containing the embedding of the human granulocyte macrophage colony stimulating factor (GM-CSF) gene, the structure of which corresponds to the cDNA of the human GM-CSF matrix RNA, presented in GenBank number Ml 1220.1, in the central part of the viral thymidine kinase gene between positions 83665 and 83696 bp (GenBank DQ 121394); the human GM-CSF gene is expressed under the control of the natural p7.5K promoter of the vaccinia virus and produces a secreted form of biologically active human GM-CSF in mammalian cells at a level of 40 μg per ml of culture medium; strain VV-GMCSF-S1 / 3 was deposited in the State collection of Rospotrebnadzor of causative agents of viral infections, rickettsioses of the Federal State Budgetary Scientific Center of the SEC of the World Bank "Vector" under the number V-631.

Images