NZ508326A - A polyketide synthase and non ribosomal peptide synthase genes, isolated from a myxobacterium, necessary for synthesis of epothiones A and B - Google Patents

A polyketide synthase and non ribosomal peptide synthase genes, isolated from a myxobacterium, necessary for synthesis of epothiones A and B

Info

Publication number
NZ508326A
NZ508326A NZ508326A NZ50832698A NZ508326A NZ 508326 A NZ508326 A NZ 508326A NZ 508326 A NZ508326 A NZ 508326A NZ 50832698 A NZ50832698 A NZ 50832698A NZ 508326 A NZ508326 A NZ 508326A
Authority
NZ
New Zealand
Prior art keywords
ala
leu
gly
arg
val
Prior art date
Application number
NZ508326A
Inventor
Thomas Schupp
James Madison Ligon
Istvan Molnar
Ross Irkle
Jorn Gorlach
Devon Cyr
Original Assignee
Novartis Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novartis Ag filed Critical Novartis Ag
Publication of NZ508326A publication Critical patent/NZ508326A/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52Genes encoding for enzymes or proenzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/18Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing at least two hetero rings condensed among themselves or condensed with a common carbocyclic ring system, e.g. rifamycin
    • C12P17/181Heterocyclic compounds containing oxygen atoms as the only ring heteroatoms in the condensed system, e.g. Salinomycin, Septamycin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biophysics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Oncology (AREA)
  • Plant Pathology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Veterinary Medicine (AREA)
  • Physics & Mathematics (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

Described are nucleic acid molecules isolated from Sorangium cellulosum that encode polypeptides necessary for the biosynthesis of epothilone. Disclosed are methods for the production of epothilone in recombinant hosts transformed with the genes of the invention. In this manner, epothilone can be produced in quantities large enough to enable their purification and use in pharmaceutical formulations such as those for the treatment of cancer.

Description

<div class="application article clearfix" id="description"> <p class="printTableText" lang="en">New Zealand Paient Spedficaiion for Paient Number 508326 <br><br> 50832 <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> GENES FOR THE BIOSYNTHESIS OF EPOTHILONES <br><br> FIELD OF THE INVENTION <br><br> The present invention relates generally to polyketides and genes for their synthesis. In particular, the present invention relates to the isolation and characterization of novel poly-ketide synthase and nonribosomal peptide synthetase genes from Sorangium cellulosum that are necessary for the biosynthesis of epothilones A and B. <br><br> Polyketides are compounds synthesized from two-carbon building blocks, the (3-carbon of which always carries a keto group, thus the name polyketide. These compounds include many important antibiotics, immunosuppressants, cancer chemotherapeutic agents, and other compounds possessing a broad range of biological properties. The tremendous structural diversity derives from the different lengths of the polyketide chain, the different side-chains introduced (either as part of the two-carbon building blocks or after the polyketide backbone is formed), and the stereochemistry of such groups. The keto groups may also be reduced to hydroxyls, enoyls, or removed altogether. Each round of two-carbon addition is carried out by a complex of enzymes called the polyketide synthase (PKS) in a manner similar to fatty acid biosynthesis. <br><br> The biosynthetic genes for an increasing number of polyketides have been isolated and sequenced. For example, see U.S. Patent Nos. 5,639,949, 5,693,774, and 5,716,849, all of which are incorporated herein by reference, which describe genes for the biosynthesis of soraphen. See also, Schupp et at., FEMS Microbiology Letters 159: 201-207 (1998) and WO 98/07868, which describe genes for the biosynthesis of rifamycin, and U.S. Patent No. 5,876,991, which describes genes for the biosynthesis of tylactone, all of which are incorporated herein by reference. The encoded proteins generally fall into two types: type I and type II. Type I proteins are polyfunctional, with several catalytic domains carrying out different enzymatic steps covalently linked together (e.g. PKS for erythromycin, soraphen, rifamycin, and avermectin (MacNeil et al., in Industrial Microorganisms: Basic and Applied Molecular Genetics, (ed.: Baltz et al.), American Society for Microbiology, Washington D. C. <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -3- <br><br> BACKGROUND OF THE INVENTION <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -2- <br><br> pp. 245-256 (1993)); whereas type II proteins are monofunctional (Hutchinson eta!., in Industrial Microorganisms: Basic and Applied Molecular Genetics, (ed.: Baltz et al.), American Society for Microbiology, Washington D. C. pp. 203-216 (1993)). <br><br> For the simpler polyketides such as actinorhodin (produced by Streptomyces coelicoloi), the several rounds of two-carbon additions are carried out iteratively on PKS enzymes encoded by one set of PKS genes. In contrast, synthesis of the more complicated compounds such as erythromycin and soraphen involves PKS enzymes that are organized into modules, whereby each module carries out one round of two-carbon addition (for review, see Hopwood et al., in Industrial Microorganisms: Basic and Applied Molecular Genetics, (ed.: Baltz etal.), American Society for Microbiology, Washington D. C., pp. 267-275 (1993)). <br><br> Complex polyketides and secondary metabolites in general may contain substructures that are derived from amino acids instead of simple carboxylic acids, incorporations of these building blocks are accomplished by non-ribosomal polypeptide synthetases (NRPSs). NRPSs are multienzymes that are organized in modules. Each module is responsible for the addition (and the additional processing, if required) of one amino acid building block. NRPSs activate amino acids by forming aminoacyl-adenylates, and capture the activated amino acids on thiol groups of phophopantheteinyl prosthetic groups on peptidyl carrier protein domains. Further, NRPSs modify the amino acids by epimerization, N-methyla-tion, or cyclization if necessary, and catalyse the formation of peptide bonds between the enzyme-bound amino acids. NRPSs are responsible for the biosynthesis of peptide secondary metabolites like cyclosporin, could provide polyketide chain terminator units as in rapa-mycin, or form mixed systems with PKSs as in yersiniabactin biosynthesis. <br><br> Epothilones A and B are 16-membered macrocyciic polyketides with an acylcyste-ine-derived starter unit that are produced by the bacterium Sorangium cellulosum strain So ce90 (Gerth et al., J. Antibiotics 49:560-563 (1996), incorporated herein by reference). The structure of epothilone A and B wherein R signifies hydrogen (epothiione A) or methyl (epo-thilone B) is: <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -4- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -3- <br><br> HC <br><br> i y- <br><br> S <br><br> N <br><br> O <br><br> OH <br><br> O <br><br> The epothilones have a narrow antifungal spectrum and especially show a high cytotoxicity in animal cell cultures (see, Hofle etal., Patent DE 4138042 (1993), incorporated herein by reference). Of significant importance, epothilones mimic the biological effects of taxol, both in vivo and in cultured cells (Bollag et al., Cancer Research 55: 2325-2333 (1995), incorporated herein by reference). Taxol and taxotere, which stabilize cellutar microtubules, are cancer chemotherapeutic agents with significant activity against various human solid tumors (Rowinsky etal., J. Natl. Cancer Inst. 83:1778-1781 (1991)). Competition studies have revealed that epothilones act as competitive inhibitors of taxol binding to microtubules, consistent with the interpretation that they share the same microtubule-bin-ding site and possess a similar microtubule affinity as taxol. However, epothilones enjoy a significant advantage over taxol in that epothilones exhibit a much lower drop in potency compared to taxol against a multiple drug-resistant cell line (Bollag etal. (1995)). Furthermore, epothilones are considerably less efficiently exported from the cells by P-glycoprotein than is taxol (Gerth etal. (1996)). In addition, several epothilone analogs have been synthesized that have a superior cytotoxic activity as compared to epothilone A or epothilone B as demonstrated by their enhanced ability to induce the polymerization and stabilization of microtubules (WO 98/25929, incorporated herein by reference). <br><br> Despite the promise shown by the epothilones as anticancer agents, problems pertaining to the production of these compounds presently limit their commercial potential. The compounds are too complex for industrial-scale chemical synthesis and so must be produced by fermentation. Techniques for the genetic manipulation of myxobacteria such as Sorangium cellulosum are described in U.S. Patent No. 5,686,295, incorporated herein by reference. However, Sorangium cellulosum is notoriously difficult to ferment and production levels of epothilones are therefore low. Recombinant production of epothilones in heterologous hosts that are more amenable to fermentation could solve current production problems. However, the genes that encode the polypeptides responsible for epothilone bio- <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -5- <br><br> 4-30582A <br><br> -4- <br><br> synthesis have heretofore not been isolated. Furthermore, the strain that produces epothilones, i.e. So ce90, also produces at least one additional polyketide, spirangien, which would be expected to greatly complicate the isolation of the genes particularly responsible for epothilone biosynthesis. <br><br> Therefore, in view of the foregoing, one object of the present invention is to isolate the genes that are involved in the synthesis of epothilones, particularly the genes that are involved in the synthesis of epothilones A and B in myxobacteria of the Sorangium/-Polyangium group, i.e., Sorangium cellulosum strain So ce90. A further object of the invention is to provide a method for the recombinant production of epothilones for application in anticancer formulations. The above objects should be read disjunctively with the object of at least providing a useful alternative. <br><br> SUMMARY OF THE INVENTION <br><br> In furtherance of the aforementioned and other objects, the present invention unexpectedly overcomes the difficulties set forth above to provide for the first time a nucleic acid molecule comprising a nucleotide sequence that encodes at least one polypeptide involved in the biosynthesis of epothilone. In a preferred embodiment, the nucleotide sequence is isolated from a species belonging to Myxobacteria, most preferably Sorangium cellulosum. <br><br> In another preferred embodiment, the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence that encodes at least one polypeptide involved in the biosynthesis of an epothilone, wherein said polypeptide comprises an amino acid sequence substantially similar to an amino acid sequence selected from the group consisting of: SEQ ID NO:2, amino acids 11 -437 of SEQ ID NO:2, amino acids 543-864 of SEQ ID NO:2, amino acids 974-1273 of SEQ ID NO:2, amino acids 1314-1385 of SEQ ID NO:2, SEQ ID NO:3, amino acids 72-81 of SEQ ID NO:3, amino acids 118-125 of SEQ ID NO:3, amino acids 199-212 of SEQ ID NO:3, amino acids 353-363 of SEQ ID NO:3, amino acids 549-565 of SEQ ID NO:3, amino acids 588-603 of SEQ ID NO:3, amino acids 669-684 of SEQ ID NO:3, amino acids 815-821 of SEQ ID NO:3, amino acids 868-892 of SEQ ID NO:3, amino acids 903-912 of SEQ ID NO:3, amino acids 918-940 of SEQ ID NO:3, amino acids 1268-1274 of SEQ ID NO:3, amino acids 1285-1297 of SEQ ID NO:3, amino acids 973-1256 of SEQ ID NO:3, amino acids 1344-1351 of SEQ ID NO:3, SEQ ID NO:4, amino acids 7-432 of SEQ ID NO:4, amino acids 539-859 of SEQ ID NO:4, amino acids 869-1037 of SEQ ID NO:4, amino acids 1439-1684 of SEQ ID NO:4, amino acids 1722-1792 of SEQ ID <br><br> IPONZ <br><br> - 9 JUL 2003 <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -5- <br><br> NO:4, SEQ ID NO:5, amino acids 39-457 of SEQ ID NO:5, amino acids 563-884 of SEQ ID NO:5, amino acids 1147-1399 of SEQ ID NO:5, amino acids 1434-1506 of SEQ ID NO:5, amino acids 1524-1950 of SEQ ID NO:5, amino acids 2056-2377 of SEQ ID NO:5, amino acids 2645-2895 of SEQ ID NO:5, amino acids 2932-3005 of SEQ ID NO:5, amino acids 3024-3449 of SEQ ID NO:5, amino acids 3555-3876 of SEQ ID NO:5, amino acids 3886-4048 of SEQ ID NO:5, amino acids 4433-4719 of SEQ ID NO:5, amino acids 4729-4974 of SEQ ID NO:5, amino acids 5010-5082 of SEQ ID NO:5, amino acids 5103-5525 of SEQ ID NO:5, amino acids 5631-5951 of SEQ ID NO:5, amino acids 5964-6132 of SEQ ID NO:5, amino acids 6542-6837 of SEQ ID NO:5, amino acids 6857-7101 of SEQ ID NO:5, amino acids 7140-7211 of SEQ ID NO:5, SEQ ID NO:6, amino acids 35-454 of SEQ ID NO:6, <br><br> amino acids 561-881 of SEQ ID NO:6, amino acids 1143-1393 of SEQ ID NO:6, amino acids 1430-1503 of SEQ ID NO:6, amino acids 1522-1946 of SEQ ID NO: 6, amino acids 2053-2373 of SEQ ID NO:6, amino acids 2383-2551 of SEQ ID NO:6, amino acids 2671-3045 of SEQ ID NO:6, amino acids 3392-3636 of SEQ ID NO:6, amino acids 3673-3745 of SEQ ID NO:6, SEQ ID NO:7, amino acids 32-450 of SEQ ID NO:7, amino acids 556-877 of SEQ ID NO:7, amino acids 887-1051 of SEQ ID NO:7, amino acids 1478-1790 of SEQ ID NO:7, amino acids 1810-2055 of SEQ ID NO:7, amino acids 2093-2164 of SEQ ID NO:7, amino acids 2165-2439 of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO: 10, SEQ ID NO:11, and SEQ ID NO:22. <br><br> In a more preferred embodiment, the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence that encodes at least one polypeptide involved in the biosynthesis of an epothilone, wherein said polypeptide comprises an amino acid sequence selected from the group consisting of: SEQ ID NO:2, amino acids 11 -437 of SEQ ID NO:2, amino acids 543-864 of SEQ ID NO:2, amino acids 974-1273 of SEQ ID NO:2, amino acids 1314-1385 of SEQ ID NO:2, SEQ ID NO:3, amino acids 72-81 of SEQ ID NO:3, amino acids 118-125 of SEQ ID NO:3, amino acids 199-212 of SEQ ID NO:3, amino acids 353-363 of SEQ ID NO:3, amino acids 549-565 of SEQ ID NO:3, amino acids 588-603 of SEQ ID NO:3, amino acids 669-684 of SEQ ID NO:3, amino acids 815-821 of SEQ ID NO:3, amino acids 868-892 of SEQ ID NO:3, amino acids 903-912 of SEQ ID NO:3, amino acids 918-940 of SEQ ID NO:3, amino acids 1268-1274 of SEQ ID NO:3, amino acids 1285-1297 of SEQ ID NO:3, amino acids 973-1256 of SEQ ID NO:3, amino acids 1344-1351 of SEQ ID NO:3, SEQ ID NO:4, amino acids 7-432 of SEQ ID NO:4, amino acids 539-859 of SEQ ID NO:4, amino acids 869-1037 of SEQ ID NO:4, amino acids 1439-1684 <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -7- <br><br> WO 99/66028 PCT/EP99/04171 <br><br> -6- <br><br> of SEQ ID NO:4, amino acids 1722-1792 of SEQ ID NO:4, SEQ ID NO:5, amino acids 39-457 of SEQ ID NO:5, amino acids 563-884 of SEQ ID NO:5, amino acids 1147-1399 of SEQ ID NO:5, amino acids 1434-1506 of SEQ ID NO:5, amino acids 1524-1950 of SEQ ID NO:5, amino acids 2056-2377 of SEQ ID NO:5, amino acids 2645-2895 of SEQ ID NO:5, amino acids 2932-3005 of SEQ ID NO:5, amino acids 3024-3449 of SEQ ID NO:5, amino acids 3555-3876 of SEQ ID NO:5, amino acids 3886-4048 of SEQ ID NO:5, amino acids 4433-4719 of SEQ ID NO:5, amino acids 4729-4974 of SEQ ID NO:5, amino acids 5010-5082 of SEQ ID NO:5, amino acids 5103-5525 of SEQ ID NO:5, amino acids 5631-5951 of SEQ ID NO:5, amino acids 5964-6132 of SEQ ID NO:5, amino acids 6542-6837 of SEQ ID NO:5, amino acids 6857-7101 of SEQ ID NO:5, amino acids 7140-7211 of SEQ ID NO:5, SEQ ID NO:6, amino acids 35-454 of SEQ ID NO:6, amino acids 561-881 of SEQ ID NO:6, amino acids 1143-1393 of SEQ ID NO:6, amino acids 1430-1503 of SEQ ID NO:6, amino acids 1522-1946 of SEQ ID NO: 6, amino acids 2053-2373 of SEQ ID NO:6, amino acids 2383-2551 of SEQ ID NO:6, amino acids 2671-3045 of SEQ ID NO:6, amino acids 3392-3636 of SEQ ID NO:6, amino acids 3673-3745 of SEQ ID NO:6, SEQ ID NO:7, amino acids 32-450 of SEQ ID NO:7, amino acids 556-877 of SEQ ID NO:7, amino acids 887-1051 of SEQ ID NO:7, amino acids 1478-1790 of SEQ ID NO:7, amino acids 1810-2055 of SEQ ID NO:7, amino acids 2093-2164 of SEQ ID NO:7, amino acids 2165-2439 of SEQ ID NO:7, SEQ ID NO:8, SEQ ID N0:10, SEQ ID NO:11, and SEQ ID NO:22. <br><br> In yet another preferred embodiment, the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence that encodes at least one polypeptide involved in the biosynthesis of an epothilone, wherein said nucleotide sequence is substantially similar to a nucleotide sequence selected from the group consisting of: the complement of nucleotides 1900-3171 of SEQ ID NO:1, nucleotides 3415-5556 of SEQ ID NO:1, nucleotides 7610-11875 of SEQ ID NO:1, nucleotides 7643-8920 of SEQ ID NO:1, nucleotides 9236-10201 of SEQ ID NO:1, nucleotides 10529-11428 of SEQ ID NO:1, nucleotides 11549-11764 of SEQ ID NO:1, nucleotides 11872-16104 of SEQ ID NO:1, nucleotides 12085-12114 of SEQ ID NO:1, nucleotides 12223-12246 of SEQ ID NO:1, nucleotides 12466-12507 of SEQ ID NO:1, nucleotides 12928-12960 of SEQ ID NO:1, nucleotides 13516-13566 of SEQ ID NO:1, nucleotides 13633-13680 of SEQ ID NO:1, nucleotides 13876-13923 of SEQ ID NO:1, nucleotides 14313-14334 of SEQ ID NO:1, nucleotides 14473-14547 of SEQ ID NO:1, nucleotides 14578-14607 of SEQ ID NO:1, nucleotides 14623-14692 of SEQ ID NO:1, nucleotides 15673-15693 of SEQ ID NO:1, <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -8- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -7- <br><br> nucleotides 15724-15762 of SEQ ID NO:1, nucleotides 14788-15639 of SEQ ID NO:1, nucleotides 15901-15924 of SEQ ID NO:1, nucleotides 16251-21749 of SEQ ID NO:1, nucleotides 16269-17546 of SEQ ID NO:1, nucleotides 17865-18827 of SEQ ID NO:1, nucleotides 18855-19361 of SEQ ID NO:1, nucleotides 20565-21302 of SEQ ID NO:1, nucleotides 21414-21626 of SEQ ID NO:1, nucleotides 21746-43519 of SEQ ID NO:1, nucleotides 21860-23116 of SEQ ID NO:1, nucleotides 23431-24397 of SEQ ID NO:1, nucleotides 25184-25942 of SEQ ID NO:1, nucleotides 26045-26263 of SEQ ID NO:1, nucleotides 26318-27595 of SEQ ID NO:1, nucleotides 27911-28876 of SEQ ID NO:1, nucleotides 29678-30429 of SEQ ID NO:1, nucleotides 30539-30759 of SEQ ID NO:1, nucleotides 30815-32092 of SEQ ID NO: 1, nucleotides 32408-33373 of SEQ ID NO:1, nucleotides 33401-33889 of SEQ ID NO:1, nucleotides 35042-35902 of SEQ ID NO:1, nucleotides 35930-36667 of SEQ ID NO:1, nucleotides 36773-36991 of SEQ ID NO:1, nucleotides 37052-38320 of SEQ ID NO:1, nucleotides 38636-39598 of SEQ ID NO:1, nucleotides 39635-40141 of SEQ ID NO:1, nucleotides 41369-42256 of SEQ ID NO:1, nucleotides 42314-43048 of SEQ ID NO: 1, nucleotides 43163-43378 of SEQ ID NO:1, nucleotides 43524-54920 of SEQ ID NO: 1, nucleotides 43626-44885 of SEQ ID NO:1, nucleotides 45204-46166 of SEQ ID NO:1, nucleotides 46950-47702 of SEQ ID NO:1, nucleotides 47811-48032 of SEQ ID NO:1. nucleotides 48087-49361 of SEQ ID NO:1. nucleotides 49680-50642 of SEQ ID NO:1, nucleotides 50670-51176 of SEQ ID NO:1, nucleotides 51534-52657 of SEQ ID NO:1, nucleotides 53697-54431 of SEQ ID NO:1, nucleotides 54540-54758 of SEQ ID NO:1, nucleotides 54935-62254 of SEQ ID NO:1, nucleotides 55028-56284 of SEQ ID NO:1, nucleotides 56600-57565 of SEQ ID NO:1, nucleotides 57593-58087 of SEQ ID NO:1, nucleotides 59366-60304 of SEQ ID NO:1, nucleotides 60362-61099 of SEQ ID NO:1, nucleotides 61211-61426 of SEQ ID NO:1, nucleotides 61427-62254 of SEQ ID NO: 1, nucleotides 62369-63628 of SEQ ID NO:1, nucleotides 67334-68251 of SEQ ID NO:1, and nucleotides 1-68750 SEQ ID NO:1. <br><br> In an especially preferred embodiment, the present invention provides a nucleic acid molecule comprising a nucleotide sequence that encodes at least one polypeptide involved in the biosynthesis of an epothilone, wherein said nucleotide sequence is selected from the group consisting of: the complement of nucleotides 1900-3171 of SEQ ID NO:1, nucleotides 3415-5556 of SEQ ID NO:1, nucleotides 7610-11875 of SEQ ID NO:1, nucleotides 7643-8920 of SEQ ID NO:1, nucleotides 9236-10201 of SEQ ID NO:1, nucleotides 10529-11428 of SEQ ID NO:1, nucleotides 11549-11764 of SEQ ID NO:1, nucleotides 11872-16104 of <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -9- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -8- <br><br> SEQ ID NO:1, nucleotides 12085-12114 of SEQ ID NO:1, nucleotides 12223-12246 of SEQ ID NO:1, nucleotides 12466-12507 of SEQ ID NO:1, nucleotides 12928-12960 of SEQ ID NO:1, nucleotides 13516-13566 of SEQ ID NO:1, nucleotides 13633-13680 of SEQ ID NO:1, nucleotides 13876-13923 of SEQ ID NO:1, nucleotides 14313-14334 of SEQ ID NO:1, nucleotides 14473-14547 of SEQ ID NO:1, nucleotides 14578-14607 of SEQ ID NO:1, nucleotides 14623-14692 of SEQ ID NO:1, nucleotides 15673-15693 of SEQ ID NO:1, nucleotides 15724-15762 of SEQ ID NO:1, nucleotides 14788-15639 of SEQ ID NO:1, nucleotides 15901-15924 of SEQ ID NO:1, nucleotides 16251-21749 of SEQ ID NO:1, nucleotides 16269-17546 of SEQ ID NO:1, nucleotides 17865-18827 of SEQ ID NO:1, nucleotides 18855-19361 of SEQ ID NO:1, nucleotides 20565-21302 of SEQ ID NO: 1, nucleotides 21414-21626 of SEQ ID NO:1, nucleotides 21746-43519 of SEQ ID NO:1, nucleotides 21860-23116 of SEQ ID NO:1, nucleotides 23431-24397 of SEQ ID NO: 1, nucleotides 25184-25942 of SEQ ID NO:1, nucleotides 26045-26263 of SEQ ID NO:1, nucleotides 26318-27595 of SEQ ID NO:1, nucleotides 27911-28876 of SEQ ID NO:1, nucleotides 29678-30429 of SEQ ID NO:1, nucleotides 30539-30759 of SEQ ID NO:1, nucleotides 30815-32092 of SEQ ID NO:1, nucleotides 32408-33373 of SEQ ID NO:1, nucleotides 33401-33889 of SEQ ID NO:1, nucleotides 35042-35902 of SEQ ID NO:1, nucleotides 35930-36667 of SEQ ID NO:1, nucleotides 36773-36991 of SEQ ID NO:1, nucleotides 37052-38320 of SEQ ID NO:1, nucleotides 38636-39598 of SEQ ID NO:1, nucleotides 39635-40141 of SEQ ID NO:1, nucleotides 41369-42256 of SEQ ID NO:1, nucleotides 42314-43048 of SEQ ID NO:1, nucleotides 43163-43378 of SEQ ID NO:1, nucleotides 43524-54920 of SEQ ID NO:1, nucleotides 43626-44885 of SEQ ID NO:1, nucleotides 45204-46166 of SEQ ID NO:1, nucleotides 46950-47702 of SEQ ID NO:1, nucleotides 47811-48032 of SEQ ID NO:1, nucleotides 48087-49361 of SEQ ID NO:1, nucleotides 49680-50642 of SEQ ID NO:1, nucleotides 50670-51176 of SEQ ID NO:1, nucleotides 51534-52657 of SEQ ID N0:1, nucleotides 53697-54431 of SEQ ID NO: 1, nucleotides 54540-54758 of SEQ ID NO:1, nucleotides 54935-62254 of SEQ ID NO:1, nucleotides 55028-56284 of SEQ ID NO:1, nucleotides 56600-57565 of SEQ ID NO:1, nucleotides 57593-58087 of SEQ ID NO:1, nucleotides 59366-60304 of SEQ ID NO:1, nucleotides 60362-61099 of SEQ ID NO:1, nucleotides 61211-61426 of SEQ ID NO:1, nucleotides 61427-62254 of SEQ ID NO:1, nucleotides 62369-63628 of SEQ ID NO: 1, nucleotides 67334-68251 of SEQ ID NO:1. and nucleotides 1-68750 SEQ ID NO:1. <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -10- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -9- <br><br> In yet another preferred embodiment, the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence that encodes at least one polypeptide involved in the biosynthesis of an epothilone, wherein said nucleotide sequence comprises a consecutive 20,25, 30, 35, 40, 45, or 50 (preferably 20) base pair nucleotide portion identical in sequence to a respective consecutive 20, 25, 30,35, 40,45, or 50 (preferably 20) base pair portion of a nucleotide sequence selected from the group consisting of: the complement of nucleotides 1900-3171 of SEQ ID NO:1, nucleotides 3415-5556 of SEQ ID NO:1, nucleotides 7610-11875 of SEQ ID NO:1, nucleotides 7643-8920 of SEQ ID NO:1, nucleotides 9236-10201 of SEQ ID NO: 1, nucleotides 10529-11428 of SEQ ID NO:1, nucleotides 11549-11764 of SEQ ID NO:1, nucleotides 11872-16104 of SEQ ID NO:1, nucleotides 12085-12114 of SEQ ID NO:1, nucleotides 12223-12246 of SEQ ID NO:1, nucleotides 12466-12507 of SEQ ID NO:1, nucleotides 12928-12960 of SEQ ID NO:1, nucleotides 13516-13566 of SEQ ID NO:1, nucleotides 13633-13680 of SEQ ID NO: 1, nucleotides 13876-13923 of SEQ ID NO:1, nucleotides 14313-14334 of SEQ ID NO:1, nucleotides 14473-14547 of SEQ ID NO:1, nucleotides 14578-14607 of SEQ ID NO:1, nucleotides 14623-14692 of SEQ ID NO:1, nucleotides 15673-15693 of SEQ ID NO:1, nucleotides 15724-15762 of SEQ ID NO:1, nucleotides 14788-15639 of SEQ ID NO:1, nucleotides 15901-15924 of SEQ ID NO:1, nucleotides 16251-21749 of SEQ ID NO:1, nucleotides 16269-17546 of SEQ ID NO:1, nucleotides 17865-18827 of SEQ ID NO:1, nucleotides 18855-19361 of SEQ ID NO:1, nucleotides 20565-21302 of SEQ ID NO: 1, nucleotides 21414-21626 of SEQ ID NO:1, nucleotides 21746-43519 of SEQ ID NO:1, nucleotides 21860-23116 of SEQ ID NO:1, nucleotides 23431-24397 of SEQ ID NO:1, nucleotides 25184-25942 of SEQ ID NO:1, nucleotides 26045-26263 of SEQ ID NO:1, nucleotides 26318-27595 of SEQ ID NO:1, nucleotides 27911-28876 of SEQ ID NO:1, nucleotides 29678-30429 of SEQ ID NO:1, nucleotides 30539-30759 of SEQ ID NO:1, nucleotides 30815-32092 of SEQ ID NO:1, nucleotides 32408-33373 of SEQ ID NO:1, nucleotides 33401-33B89 of SEQ ID NO: 1, nucleotides 35042-35902 of SEQ ID NO:1, nucleotides 35930-36667 of SEQ ID NO:1, nucleotides 36773-36991 of SEQ ID NO:1, nucleotides 37052-38320 of SEQ ID NO:1, nucleotides 38636-39598 of SEQ ID NO:1, nucleotides 39635-40141 of SEQ ID NO:1, nucleotides 41369-42256 of SEQ ID NO:1, nucleotides 42314-43048 of SEQ ID NO:1, nucleotides 43163-43378 of SEQ ID NO:1, nucleotides 43524-54920 of SEQ ID NO:1, nucleotides 43626-44885 of SEQ ID NO:1, nucleotides 45204-46166 of SEQ ID NO:1, nucleotides 46950-47702 of SEQ ID <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -11- <br><br> WO 99/66028 PCT/EP99/04171 <br><br> -10 <br><br> NO:1, nucleotides 47811-48032 of SEQ ID NO:1, nucleotides 48087-49361 of SEQ ID NO:1, nucleotides 49680-50642 of SEQ ID NO:1, nucleotides 50670-51176 of SEQ ID NO:1, nucleotides 51534-52657 of SEQ ID NO:1, nucleotides 53697-54431 of SEQ ID NO:1, nucleotides 54540-54758 of SEQ ID NO:1, nucleotides 54935-62254 of SEQ ID NO:1, nucleotides 55028-56284 of SEQ ID NO:1, nucleotides 56600-57565 of SEQ ID NO:1, nucleotides 57593-58087 of SEQ ID NO:1, nucleotides 59366-60304 of SEQ ID NO:1, nucleotides 60362-61099 of SEQ ID NO:1, nucleotides 61211-61426 of SEQ ID NO:1, nucleotides 61427-62254 of SEQ ID NO:1, nucleotides 62369-6362B of SEQ ID NO:1, nucleotides 67334-68251 of SEQ ID NO:1, and nucleotides 1-68750 SEQ ID NO:1. <br><br> The present invention also provides a chimeric gene comprising a heterologous promoter sequence operatively linked to a nucleic acid molecule of the invention. Further, the present invention provides a recombinant vector comprising such a chimeric gene, wherein the vector is capable of being stably transformed into a host ceil. Still further, the present invention provides a recombinant host cell comprising such a chimeric gene, wherein the host cell is capable of expressing the nucleotide sequence that encodes at least one polypeptide necessary for the biosynthesis of an epothilone. in a preferred embodiment, the recombinant host cell is a bacterium belonging to the order Actinomycetales, and in a more preferred embodiment the recombinant host cell is a strain of Streptomyces. in other embodiments, the recombinant host cell is any other bacterium amenable to fermentation, such as a pseudomonad or E. coli. Even further, the present invention provides a Bac clone comprising a nucleic acid molecule of the invention, preferably Bac clone pEP015. <br><br> in another aspect, the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence that encodes an epothilone synthase domain. <br><br> According to one embodiment, the epothilone synthase domain is a p-ketoacyl-syn-thase (KS) domain comprising an amino acid sequence substantially similar to an amino acid sequence selected from the group consisting of: amino acids 11 -437 of SEQ ID NO:2, amino acids 7-432 of SEQ ID NO:4, amino acids 39-457 of SEQ ID NO:5, amino acids 1524-1950 of SEQ ID NO:5, amino acids 3024-3449 of SEQ ID NO:5, amino acids 5103-5525 of SEQ ID NO:5, amino acids 35-454 of SEQ ID NO:6, amino acids 1522-1946 of SEQ ID NO: 6, and amino acids 32-450 of SEQ ID NO:7. According to this embodiment, said KS domain preferably comprises an amino acid sequence selected from the group consisting of: amino acids 11-437 of SEQ ID NO:2, amino acids 7-432 of SEQ ID NO:4, amino acids 39-457 of SEQ ID NO:5, amino acids 1524-1950 of SEQ ID NO:5, amino acids <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -12- <br><br> WO 99/66028 PCT/EP99/04171 <br><br> -11 - <br><br> 3024-3449 of SEQ ID NO:5, amino acids 5103-5525 of SEQ ID NO:5, amino acids 35-454 of SEQ ID NO:6, amino acids 1522-1946 of SEQ ID NO: 6, and amino acids 32-450 of SEQ ID NO:7. Also, according to this embodiment, said nucleotide sequence preferably is substantially similar to a nucleotide sequence selected from the group consisting of: nucleotides 7643-8920 of SEQ ID NO:1, nucleotides 16269-17546 of SEQ ID NO:1, nucleotides 21860-23116 of SEQ ID NO:1, nucleotides 26318-27595 of SEQ ID NO:1, nucleotides 30815-32092 of SEQ ID NO:1, nucleotides 37052-38320 of SEQ |D NO:1, nucleotides 43626-44885 of SEQ ID NO:1, nucleotides 48087-49361 of SEQ ID NO:1, and nucleotides 55028-56284 of SEQ ID NO:1. According to this embodiment, said nucleotide sequence more preferably comprises a consecutive 20, 25, 30, 35, 40, 45, or 50 (preferably 20) base pair nucleotide portion identical in sequence to a respective consecutive 20,25, 30, 35, 40, 45, or 50 (preferably 20) base pair portion of a nucleotide sequence selected from the group consisting of: nucleotides 7643-8920 of SEQ ID NO:1, nucleotides 16269-17546 of SEQ ID NO:1, nucleotides 21860-23116 of SEQ ID NO: 1, nucleotides 26318-27595 of SEQ ID NO:1, nucleotides 30815-32092 of SEQ ID NO:1, nucleotides 37052-38320 of SEQ ID NO:1, nucleotides 43626-44885 of SEQ ID NO:1, nucleotides 48087-49361 of SEQ ID NO: 1, and nucleotides 55028-56284 of SEQ ID NO:1. In addition, according to this embodiment, said nucleotide sequence most preferably is selected from the group consisting of: nucleotides 7643-8920 of SEQ ID NO:1, nucleotides 16269-17546 of SEQ ID NO:1, nucleotides 21860-23116 of SEQ ID NO:1, nucleotides 26318-27595 of SEQ ID NO:1, nucleotides 30815-32092 of SEQ ID NO:1, nucleotides 37052-38320 of SEQ ID NO:1, nucleotides 43626-44885 of SEQ ID NO:1, nucleotides 48087-49361 of SEQ ID NO:1, and nucleotides 55028-56284 of SEQ ID NO: 1. <br><br> According to another embodiment, the epothilone synthase domain is an acyltrans-ferase (AT) domain comprising an amino acid sequence substantially similar to an amino acid sequence selected from the group consisting of: amino acids 543-864 of SEQ ID NO:2, amino acids 539-859 of SEQ ID NO:4, amino acids 563-884 of SEQ ID NO:5, amino acids 2056-2377 of SEQ ID NO:5, amino acids 3555-3876 of SEQ ID NO:5, amino acids 5631-5951 of SEQ ID NO:5, amino acids 561-881 of SEQ ID NO:6, amino acids 2053-2373 of SEQ ID NO:6, and amino acids 556-877 of SEQ ID NO:7. According to this embodiment, said AT domain preferably comprises an amino acid sequence selected from the group consisting of: amino acids 543-864 of SEQ ID NO:2, amino acids 539-859 of SEQ ID NO:4, amino acids 563-884 of SEQ ID NO:5, amino acids 2056-2377 of SEQ ID NO:5, amino <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -13- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -12- <br><br> acids 3555-3876 of SEQ ID NO:5, amino acids 5631-5951 of SEQ ID NO:5, amino acids 561-881 of SEQ ID NO:6, amino acids 2053-2373 of SEQ ID NO:6, and amino acids 556-877 of SEQ ID NO:7. Also, according to this embodiment, said nucleotide sequence preferably is substantially similar to a nucleotide sequence selected from the group consisting of: nucleotides 9236-10201 of SEQ ID NO:1, nucleotides 17865-18827 of SEQ ID NO:1, nucleotides 23431-24397 of SEQ ID NO:1, nucleotides 27911-28876 of SEQ ID NO:1, nucleotides 32408-33373 of SEQ ID NO:1, nucleotides 38636-39598 of SEQ ID NO:1, nucleotides 45204-46166 of SEQ ID NO:1, nucleotides 49680-50642 of SEQ ID NO:1, and nucleotides 56600-57565 of SEQ ID NO:1. According to this embodiment, said nucleotide sequence more preferably comprises a consecutive 20, 25, 30,35, 40, 45, or 50 (preferably 20) base pair nucleotide portion identical in sequence to a respective consecutive 20, 25, 30, 35, 40,45, or 50 (preferably 20) base pair portion of a nucleotide sequence selected from the group consisting of: nucleotides 9236-10201 of SEQ ID NO:1, nucleotides 17865-18827 of SEQ ID NO:1, nucleotides 23431-24397 of SEQ ID NO:1, nucleotides 27911-28876 of SEQ ID NO:1, nucleotides 32408-33373 of SEQ ID NO:1, nucleotides 38636-39598 of SEQ ID NO:1, nucleotides 45204-46166 of SEQ ID NO: 1, nucleotides 49680-50642 of SEQ ID NO:1, and nucleotides 56600-57565 of SEQ ID NO:1. In addition, according to this embodiment, said nucleotide sequence most preferably is selected from the group consisting of: nucleotides 9236-10201 of SEQ ID NO:1, nucleotides 17865-18827 of SEQ ID NO:1, nucleotides 23431-24397 of SEQ ID NO:1, nucleotides 27911-28876 of SEQ ID NO:1, nucleotides 32408-33373 of SEQ ID NO:1, nucleotides 38636-39598 of SEQ ID NO:1, nucleotides 45204-46166 of SEQ ID NO:1, nucleotides 49680-50642 of SEQ ID NO:1, and nucleotides 56600-57565 of SEQ ID NQ:1. <br><br> According to still another embodiment, the epothilone synthase domain is an enoyl reductase (ER) domain comprising an amino acid sequence substantially similar to an amino acid sequence selected from the group consisting of: amino acids 974-1273 of SEQ ID NO:2, amino acids 4433-4719 of SEQ ID NO:5, amino acids 6542-6837 of SEQ ID NO:5, and amino acids 1478-1790 of SEQ ID NO:7. According to this embodiment, said ER domain preferably comprises an amino acid sequence selected from the group consisting of: amino acids 974-1273 of SEQ ID NO:2, amino acids 4433-4719 of SEQ ID NO:5, amino acids 6542-6837 of SEQ ID NO:5, and amino acids 1478-1790 of SEQ ID NO:7. Also, according to this embodiment, said nucleotide sequence preferably is substantially similar to a nucleotide sequence selected from the group consisting of: nucleotides 10529-11428 of <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -14- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -13- <br><br> SEQ ID NO:1, nucleotides 35042-35902 of SEQ ID NO:1, nucleotides 41369-42256 of SEQ ID NO:1, and nucleotides 59366-60304 of SEQ ID NO:1. According to this embodiment, <br><br> said nucleotide sequence more preferably comprises a consecutive 20, 25, 30, 35, 40, 45, or 50 (preferably 20) base pair nucleotide portion identical in sequence to a respective consecutive 20, 25, 30, 35, 40, 45, or 50 (preferably 20) base pair portion of a nucleotide sequence selected from the group consisting of: nucleotides 10529-11428 of SEQ ID NO:1, nucleotides 35042-35902 of SEQ ID NO:1, nucleotides 41369-42256 of SEQ ID NO:1, and nucleotides 59366-60304 of SEQ ID NO:1. In addition, according to this embodiment, said nucleotide sequence most preferably is selected from the group consisting of: nucleotides 10529-11428 of SEQ ID NO:1, nucleotides 35042-35902 of SEQ ID NO:1, nucleotides 41369-42256 of SEQ ID NO:1, and nucleotides 59366-60304 of SEQ ID NO:1. <br><br> According to another embodiment, the epothilone synthase domain is an acyl carrier protein (ACP) domain, wherein said polypeptide comprises an amino acid sequence substantially similar to an amino acid sequence selected from the group consisting of: <br><br> amino acids 1314-1385 of SEQ ID NO:2, amino acids 1722-1792 of SEQ ID NO:4, amino acids 1434-1506 of SEQ ID NO:5, amino acids 2932-3005 of SEQ ID NO:5, amino acids 5010-5082 of SEQ ID NO:5, amino acids 7140-7211 of SEQ ID NO:5, amino acids 1430-1503 of SEQ ID NO:6, amino acids 3673-3745 of SEQ ID NO:6, and amino acids 2093-2164 of SEQ ID NO:7. According to this embodiment, said ACP domain preferably comprises an amino acid sequence selected from the group consisting of: amino acids 1314-1385 of SEQ ID NO:2, amino acids 1722-1792 of SEQ ID NO:4, amino acids 1434-1506 of SEQ ID NO:5, amino acids 2932-3005 of SEQ ID NO:5, amino acids 5010-5082 of SEQ ID NO:5, amino acids 7140-7211 of SEQ ID NO:5, amino acids 1430-1503 of SEQ ID NO:6, amino acids 3673-3745 of SEQ ID NO:6, and amino acids 2093-2164 of SEQ ID NO:7. Also, according to this embodiment, said nucleotide sequence preferably is substantially similar to a nucleotide sequence selected from the group consisting of: nucleotides 11549-11764 of SEQ ID NO:1, nucleotides 21414-21626 of SEQ ID NO:1, nucleotides 26045-26263 of SEQ ID NO:1, nucleotides 30539-30759 of SEQ ID NO:1, nucleotides 36773-36991 of SEQ ID NO:1, nucleotides 43163-43378 of SEQ ID N0:1, nucleotides 47811-48032 of SEQ ID NO:1, nucleotides 54540-54758 of SEQ ID NO:1, and nucleotides 61211-61426 of SEQ ID NO:1. According to this embodiment, said nucleotide sequence more preferably comprises a consecutive 20, 25, 30, 35, 40,45, or 50 (preferably 20) base pair nucleotide portion identical in sequence to a respective consecutive 20,25, 30, 35, 40, <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -15- <br><br> WO 99/66028 PCT/EP99/04171 <br><br> -14- <br><br> 45, or 50 (preferably 20) base pair portion of a nucleotide sequence selected from the group consisting of: nucleotides 11549-11764 of SEQ ID N0:1, nucleotides 21414-21626 of SEQ ID N0:1, nucleotides 26045-26263 of SEQ ID NO:1, nucleotides 30539-30759 of SEQ ID NO:1, nucleotides 36773-36991 of SEQ ID NO:1, nucleotides 43163-43378 of SEQ ID NO:1, nucleotides 47811-48032 of SEQ ID NO:1, nucleotides 54540-54758 of SEQ ID NO:1, and nucleotides 61211 -61426 of SEQ ID NO:1. In addition, according to this embodiment, said nucleotide sequence most preferably is selected from the group consisting of: nucleotides 11549-11764 of SEQ ID NO:1, nucleotides 21414-21626 of SEQ ID NO:1, nucleotides 26045-26263 of SEQ ID NO:1, nucleotides 30539-30759 of SEQ ID NO:1, nucleotides 36773-36991 of SEQ ID NO:1, nucleotides 43163-43378 of SEQ ID NO:1, nucleotides 47811-48032 of SEQ ID NO:1, nucleotides 54540-54758 of SEQ ID NO:1, and nucleotides 61211-61426 of SEQ ID NO:1. <br><br> According to another embodiment, the epothilone synthase domain is a dehydratase (DH) domain comprising an amino acid sequence substantially similar to an amino acid sequence selected from the group consisting of: amino acids 869-1037 of SEQ ID NO:4, amino acids 3886-4048 of SEQ ID NO:5, amino acids 5964-6132 of SEQ ID NO:5, amino acids 2383-2551 of SEQ ID NO:6, and amino acids 887-1051 of SEQ ID NO:7. According to this embodiment, said DH domain preferably comprises an amino acid sequence selected from the group consisting of: amino acids 869-1037 of SEQ ID NO:4, amino acids 3886-4048 of SEQ ID NO:5, amino acids 5964-6132 of SEQ ID NO:5, amino acids 2383-2551 of SEQ ID NO:6, and amino acids 887-1051 of SEQ ID NO:7. Also, according to this embodiment, said nucleotide sequence preferably is substantially similar to a nucleotide sequence selected from the group consisting of: nucleotides 18855-19361 of SEQ ID NO:1, nucleotides 33401-33889 of SEQ ID NO: 1, nucleotides 39635-40141 of SEQ ID NO:1, nucleotides 50670-51176 of SEQ ID NO:1, and nucleotides 57593-58087 of SEQ ID NO:1. According to this embodiment, said nucleotide sequence more preferably comprises a consecutive 20, 25, 30, 35,40, 45, or 50 (preferably 20) base pair nucleotide portion identical in sequence to a respective consecutive 20, 25, 30, 35, 40,45, or 50 (preferably 20) base pair portion of a nucleotide sequence selected from the group consisting of: nucleotides 18855-19361 of SEQ ID NO: 1, nucleotides 33401-33889 of SEQ ID NO:1, nucleotides 39635-40141 of SEQ ID NO:1, nucleotides 50670-51176 of SEQ ID NO:1, and nucleotides 57593-58087 of SEQ ID NO:1. In addition, according to this embodiment, said nucleotide sequence most preferably is selected from the group consisting of: nucleotides 18855-19361 of SEQ ID NO:1, <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -16- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -15- <br><br> nucieotides 33401-33889 of SEQ ID NO: 1, nucleotides 39635-40141 of SEQ ID NO:1, nucleotides 50670-51176 of SEQ ID NO:1, and nucleotides 57593-58087 of SEQ ID NO:1. <br><br> According to yet another embodiment, the epothilone synthase domain is a p-keto-reductase (KR) domain comprising an amino acid sequence substantially similar to an amino acid sequence selected from the group consisting of: amino acids 1439-1684 of SEQ ID NO:4, amino acids 1147-1399 of SEQ ID NO:5, amino acids 2645-2895 of SEQ ID NO:5, amino acids 4729-4974 of SEQ ID NO:5, amino acids 6857-7101 of SEQ ID NO:5, amino acids 1143-1393 of SEQ ID NO:6, amino acids 3392-3636 of SEQ ID NO:6, and amino acids 1810-2055 of SEQ ID NO:7. According to this embodiment, said KR domain preferably comprises an amino acid sequence selected from the group consisting of: amino acids 1439-1684 of SEQ ID NO:4, amino acids 1147-1399 of SEQ ID NO:5, amino acids 2645-2895 of SEQ ID NO:5, amino acids 4729-4974 of SEQ ID NO:5, amino acids 6857-7101 of SEQ ID NO:5, amino acids 1143-1393 of SEQ ID NO:6, amino acids 3392-3636 of SEQ ID NO:6, and amino acids 1810-2055 of SEQ ID NO:7. Also, according to this embodiment, said nucleotide sequence preferably is substantially similar to a nucleotide sequence selected from the group consisting of: nucleotides 20565-21302 of SEQ ID NO:1, nucleotides 25184-25942 of SEQ ID NO:1, nucleotides 29678-30429 of SEQ ID NO:1, nucleotides 35930-36667 of SEQ ID NO:1, nucleotides 42314-43048 of SEQ ID NO:1, nucleotides 46950-47702 of SEQ ID NO:1, nucleotides 53697-54431 of SEQ ID NO:1, and nucleotides 60362-61099 of SEQ ID NO: 1. According to this embodiment, said nucleotide sequence more preferably comprises a consecutive 20,25, 30, 35, 40, 45, or 50 (preferably 20) base pair nucleotide portion identical in sequence to a respective consecutive 20, 25, 30,35, 40, 45, or 50 (preferably 20) base pair portion of a nucleotide sequence selected from the group consisting of: nucleotides 20565-21302 of SEQ ID NO:1, nucleotides 25184-25942 of SEQ ID NO:1, nucleotides 29678-30429 of SEQ ID NO:1, nucleotides 35930-36667 of SEQ ID NO:1, nucleotides 42314-43048 of SEQ ID NO:1, nucleotides 46950-47702 of SEQ ID NO:1, nucleotides 53697-54431 of SEQ ID NO:1, and nucleotides 60362-61099 of SEQ ID NO:1. In addition, according to this embodiment, said nucleotide sequence most preferably is selected from the group consisting of: nucleotides 20565-21302 of SEQ ID NO:1, nucleotides 25184-25942 of SEQ ID NO:1, nucleotides 29678-30429 of SEQ ID NO:1, nucleotides 35930-36667 of SEQ ID NO:1, nucleotides 42314-43048 of SEQ ID NO:1, nucleotides 46950-47702 of SEQ ID NO:1, nucleotides 53697-54431 of SEQ ID NO:1, and nucleotides 60362-61099 of SEQ ID NO:1. <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -17- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -16- <br><br> According to an additional embodiment, the epothilone synthase domain is a methyltransferase (MT) domain comprising an amino acid sequence substantially similar to amino acids 2671-3045 of SEQ ID NO:6. According to this embodiment, said MT domain preferably comprises amino acids 2671-3045 of SEQ ID NO:6. Also, according to this embodiment, said nucleotide sequence preferably is substantially similar to nucleotides 51534-52657 of SEQ ID NO:1. According to this embodiment, said nucleotide sequence more preferably comprises a consecutive 20,25, 30, 35, 40, 45, or 50 (preferably 20) base pair nucleotide portion identical in sequence to a respective consecutive 20,25, 30, 35, 40, 45, or 50 (preferably 20) base pair portion of nucleotides 51534-52657 of SEQ ID NO:1. In addition, according to this embodiment, said nucleotide sequence most preferably is nucleotides 51534-52657 of SEQ ID NO:1. <br><br> According to another embodiment, the epothilone synthase domain is a thioesterase (TE) domain comprising an amino acid sequence substantially similar to amino acids 2165-2439 of SEQ ID NO:7. According to this embodiment, said TE domain preferably comprises amino acids 2165-2439 of SEQ ID NO:7. Also, according to this embodiment, said nucleotide sequence preferably is substantially similar to nucleotides 61427-62254 of SEQ ID NO:1. According to this embodiment, said nucleotide sequence more preferably comprises a consecutive 20, 25, 30, 35, 40, 45, or 50 (preferably 20) base pair nucleotide portion identical in sequence to a respective consecutive 20, 25, 30, 35, 40, 45, or 50 (preferably 20) base pair portion of nucleotides 61427-62254 of SEQ ID NO:1. In addition, according to this embodiment, said nucleotide sequence most preferably is nucleotides 61427-62254 of SEQ ID NO:1. <br><br> In still another aspect, the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence that encodes a non-ribosomal peptide synthetase, wherein said non-ribosomal peptide synthetase comprises an amino acid sequence substantially similar to an amino acid sequence selected from the group consisting of: SEQ ID NO:3, amino acids 72-81 of SEQ ID NO:3, amino acids 118-125 of SEQ ID NO:3, amino acids 199-212 of SEQ ID NO:3, amino acids 353-363 of SEQ ID NO:3, amino acids 549-565 of SEQ ID NO:3, amino acids 588-603 of SEQ ID NO:3, amino acids 669-684 of SEQ ID NO:3, amino acids 815-821 of SEQ ID NO:3, amino acids 868-892 of SEQ ID NO:3, amino acids 903-912 of SEQ ID NO:3, amino acids 918-940 of SEQ ID NO:3, amino acids 1268-1274 of SEQ ID NO:3, amino acids 1285-1297 of SEQ ID NO:3, amino acids 973-1256 of SEQ ID NO:3, and amino acids 1344-1351 of SEQ ID NO:3. According to this <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -18- <br><br> WO 99/66028 <br><br> PCT/EP99/04I71 <br><br> -17- <br><br> embodiment, said non-ribosomal peptide synthetase preferably comprises an amino acid sequence selected from the group consisting of: SEQ ID NO:3, amino acids 72-81 of SEQ ID NO:3, amino acids 118-125 of SEQ ID NO:3, amino acids 199-212 of SEQ ID NO:3, amino acids 353-363 of SEQ ID NO:3, amino acids 549-565 of SEQ ID NO:3, amino acids 588-603 of SEQ ID NO:3, amino acids 669-6B4 of SEQ ID NO:3, amino acids 815-821 of SEQ ID NO:3, amino acids 868-892 of SEQ ID NO:3, amino acids 903-912 of SEQ ID NO:3, amino acids 918-940 of SEQ ID NO:3, amino acids 1268-1274 of SEQ ID NO:3, amino acids 1285-1297 of SEQ ID NO:3, amino acids 973-1256 of SEQ ID NO:3, and amino acids 1344-1351 of SEQ ID NO:3. Also, according to this embodiment, said nucleotide sequence preferably is substantially similar to a nucleotide sequence selected from the group consisting of: nucleotides 11872-16104 of SEQ ID NO:1, nucleotides 12085-12114 of SEQ ID NO:1, nucleotides 12223-12246 of SEQ ID NO: 1, nucleotides 12466-12507 of SEQ ID NO: 1, nucleotides 12928-12960 of SEQ ID NO: 1, nucleotides 13516-13566 of SEQ ID NO:1, nucleotides 13633-13680 of SEQ ID NO:1, nucleotides 13876-13923 of SEQ ID NO: 1, nucleotides 14313-14334 of SEQ ID NO:1, nucleotides 14473-14547 of SEQ ID NO: 1, nucleotides 14578-14607 of SEQ ID NO:1, nucleotides 14623-14692 of SEQ ID NO:1, nucleotides 15673-15693 of SEQ ID NO:1, nucleotides 15724-15762 of SEQ ID NO:1, nucleotides 14788-15639 of SEQ ID NO:1, and nucleotides 15901-15924 of SEQ ID NO: 1. According to this embodiment, said nucleotide sequence more preferably comprises a consecutive 20, 25, 30, 35, 40, 45, or 50 (preferably 20) base pair nucleotide portion identical in sequence to a respective consecutive 20, 25, 30, 35, 40, 45, or 50 (preferably 20) base pair portion of a nucleotide sequence selected from the group consisting of: nucleotides 11872-16104 of SEQ ID NO:1, nucleotides 12085-12114 of SEQ ID NO:1, nucleotides 12223-12246 of SEQ ID NO:1, nucleotides 12466-12507 of SEQ ID NO:1, nucleotides 12928-12960 of SEQ ID NO: 1, nucleotides 13516-13566 of SEQ ID NO:1, nucleotides 13633-13680 of SEQ ID NO: 1, nucleotides 13876-13923 of SEQ ID NO:1, nucleotides 14313-14334 of SEQ ID NO: 1, nucleotides 14473-14547 of SEQ ID NO:1, nucleotides 14578-14607 of SEQ ID NO:1, nucleotides 14623-14692 of SEQ ID NO:1, nucleotides 15673-15693 of SEQ ID NO:1, nucleotides 15724-15762 of SEQ ID NO:1, nucleotides 14788-15639 of SEQ ID NO:1, and nucleotides 15901-15924 of SEQ ID NO:1. In addition, according to this embodiment, said nucleotide sequence most preferably is selected from the group consisting of: nucleotides 11872-16104 of SEQ ID NO:1, nucleotides 12085-12114 of SEQ ID NO:1, nucleotides 12223-12246 of SEQ ID NO:1, nucleotides 12466- <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -19- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -18- <br><br> 12507 of SEQ ID NO:1, nucleotides 12928-12960 of SEQ ID NO:1, nucleotides 13516-13566 of SEQ ID NO:1, nucleotides 13633-13680 of SEQ ID NO:1, nucleotides 13876-13923 of SEQ ID NO:1, nucleotides 14313-14334 of SEQ ID NO:1, nucleotides 14473-14547 of SEQ ID NO:1, nucleotides 14578-14607 of SEQ ID NO:1, nucleotides 14623-14692 of SEQ ID NO:1, nucleotides 15673-15693 of SEQ ID NO:1, nucleotides 15724-15762 of SEQ ID NO:1, nucleotides 14788-15639 of SEQ ID NO:1, and nucleotides 15901-15924 of SEQ ID NO:1. <br><br> The present invention further provides an isolated nucleic acid molecule comprising a nucleotide sequence that encodes a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs:2-23. <br><br> In accordance with another aspect, the present invention also provides methods for the recombinant production of polyketides such as epothilones in quantities large enough to enable their purification and use in pharmaceutical formulations such as those for the treatment of cancer. A specific advantage of these production methods is the chirality of the molecules produced; production in transgenic organisms avoids the generation of populations of racemic mixtures, within which some enantiomers may have reduced activity. In particular, the present invention provides a method for heterologous expression of epothilone in a recombinant host, comprising: (a) introducing into a host a chimeric gene comprising a heterologous promoter sequence operatively linked to a nucleic acid molecule of the invention that comprises a nucleotide sequence that encodes at least one polypeptide involved in the biosynthesis of epothilone; and (b) growing the host in conditions that allow biosynthesis of epothilone in the host. The present invention aiso provides a method for producing epothilone, comprising: (a) expressing epothilone in a recombinant host by the aforementioned method; and (b) extracting epothilone from the recombinant host. <br><br> According to still another aspect, the present invention provides an isolated polypeptide comprising an amino acid sequence that consists of an epothilone synthase domain. <br><br> According to one embodiment, the epothilone synthase domain is a (3-ketoacyl-synthase (KS) domain comprising an amino acid sequence substantially similar to an amino acid sequence selected from the group consisting of: amino acids 11-437 of SEQ ID NO:2, amino acids 7-432 of SEQ ID NO:4, amino acids 39-457 of SEQ ID NO:5, amino acids 1524-1950 of SEQ ID NO:5, amino acids 3024-3449 of SEQ ID NO:5, amino acids 5103-5525 of SEQ ID NO:5, amino acids 35-454 of SEQ ID NO:6, amino acids 1522-1946 of SEQ ID NO: 6, and amino acids 32-450 of SEQ ID NO:7. According to this embodiment, <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -20- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -19- <br><br> said KS domain preferably comprises an amino acid sequence selected from the group consisting of: amino acids 11-437 of SEQ ID NO:2, amino acids 7-432 of SEQ ID NO:4, amino acids 39-457 of SEQ ID NO:5, amino acids 1524-1950 of SEQ ID NO:5, amino acids 3024-3449 of SEQ ID NO:5, amino acids 5103-5525 of SEQ ID NO:5, amino acids 35-454 of SEQ ID NO:6, amino acids 1522-1946 of SEQ ID NO: 6, and amino acids 32-450 of SEQ ID NO:7. <br><br> According to another embodiment, the epothilone synthase domain is an acyltrans-ferase (AT) domain comprising an amino acid sequence substantially similar to an amino acid sequence selected from the group consisting of: amino acids 543-864 of SEQ ID NO:2, amino acids 539-859 of SEQ ID NO:4, amino acids 563-884 of SEQ ID NO:5, amino acids 2056-2377 of SEQ ID NO:5, amino acids 3555-3876 of SEQ ID NO:5, amino acids 5631-5951 of SEQ ID NO:5, amino acids 561-881 of SEQ ID NO:6, amino acids 2053-2373 of SEQ ID NO:6, and amino acids 556-877 of SEQ ID NO:7. According to this embodiment, said AT domain preferably comprises an amino acid sequence selected from the group consisting of: amino acids 543-864 of SEQ ID NO:2, amino acids 539-859 of SEQ ID NO:4, amino acids 563-884 of SEQ ID NO:5, amino acids 2056-2377 of SEQ ID NO:5, amino acids 3555-3876 of SEQ ID NO:5, amino acids 5631-5951 of SEQ ID NO:5, amino acids 561-881 of SEQ ID NO:6, amino acids 2053-2373 of SEQ ID NO:6, and amino acids 556-877 of SEQ ID NO:7. <br><br> According to still another embodiment, the epothilone synthase domain is an enoyl reductase (ER) domain comprising an amino acid sequence substantially similar to an amino acid sequence selected from the group consisting of: amino acids 974-1273 of SEQ ID NO:2, amino acids 4433-4719 of SEQ ID NO:5, amino acids 6542-6837 of SEQ ID NO:5, and amino acids 1478-1790 of SEQ ID NO:7. According to this embodiment, said ER domain preferably comprises an amino acid sequence selected from the group consisting of: amino acids 974-1273 of SEQ ID NO:2, amino acids 4433-4719 of SEQ ID NO:5, amino acids 6542-6837 of SEQ ID NO:5, and amino acids 1478-1790 of SEQ ID NO:7. <br><br> According to another embodiment, the epothilone synthase domain is an acyl carrier protein (ACP) domain, wherein said polypeptide comprises an amino acid sequence substantially similar to an amino acid sequence selected from the group consisting of: amino acids 1314-1385 of SEQ ID NO:2, amino acids 1722-1792 of SEQ ID NO:4, amino acids 1434-1506 of SEQ ID NO:5, amino acids 2932-3005 of SEQ ID NO:5, amino acids 5010-5082 of SEQ ID NO:5, amino acids 7140-7211 of SEQ ID NO:5, amino acids 1430-1503 of <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -21- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -20- <br><br> SEQ ID NO:6, amino acids 3673-3745 of SEQ ID NO:6, and amino acids 2093-2164 of SEQ ID NO:7. According to this embodiment, said ACP domain preferably comprises an amino acid sequence selected from the group consisting of: amino acids 1314-1385 of SEQ ID NO:2, amino acids 1722-1792 of SEQ ID NO:4, amino acids 1434-1506 of SEQ ID NO:5, amino acids 2932-3005 of SEQ ID NO:5, amino acids 5010-5082 of SEQ ID NO:5, amino acids 7140-7211 of SEQ ID NO:5, amino acids 1430-1503 of SEQ ID NO:6, amino acids 3673-3745 of SEQ ID NO:6, and amino acids 2093-2164 of SEQ ID NO:7. <br><br> According to another embodiment, the epothilone synthase domain is a dehydratase (DH) domain comprising an amino acid sequence substantially similar to an amino acid sequence selected from the group consisting of: amino acids 869-1037 of SEQ ID NO:4, amino acids 3886-4048 of SEQ ID NO:5, amino acids 5964-6132 of SEQ ID NO:5, amino acids 2383-2551 of SEQ ID NO:6, and amino acids 887-1051 of SEQ ID NO:7. According to this embodiment, said DH domain preferably comprises an amino acid sequence selected from the group consisting of: amino acids 869-1037 of SEQ ID NO:4, amino acids 3886-4048 of SEQ ID NO:5, amino acids 5964-6132 of SEQ ID NO:5, amino acids 2383-2551 of SEQ ID NO:6, and amino acids 887-1051 of SEQ ID NO:7. <br><br> According to yet another embodiment, the epothilone synthase domain is a p-keto-reductase (KR) domain comprising an amino acid sequence substantially similar to an amino acid sequence selected from the group consisting of: amino acids 1439-1684 of SEQ ID NO:4, amino acids 1147-1399 of SEQ ID NO:5, amino acids 2645-2895 of SEQ ID NO:5, amino acids 4729-4974 of SEQ ID NO:5, amino acids 6857-7101 of SEQ ID NO:5, amino acids 1143-1393 of SEQ ID NO:6, amino acids 3392-3636 of SEQ ID NO:6, and amino acids 1810-2055 of SEQ ID NO:7. According to this embodiment, said KR domain preferably comprises an amino acid sequence selected from the group consisting of: amino acids 1439-1684 of SEQ ID NO:4, amino acids 1147-1399 of SEQ ID NO:5, amino acids 2645-2895 of SEQ ID NO:5, amino acids 4729-4974 of SEQ ID NO:5, amino acids 6857-7101 of SEQ ID NO:5, amino acids 1143-1393 of SEQ ID NO:6, amino acids 3392-3636 of SEQ ID NO:6, and amino acids 1810-2055 of SEQ ID NO:7. <br><br> According to an additional embodiment, the epothilone synthase domain is a methyl-transferase (MT) domain comprising an amino acid sequence substantially similar to amino acids 2671-3045 of SEQ ID NO:6. According to this embodiment, said MT domain preferably comprises amino acids 2671-3045 of SEQ ID NO:6. <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -22- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -21 - <br><br> According to another embodiment, the epothilone synthase domain is a thioesterase (TE) domain comprising an amino acid sequence substantially similar to amino acids 2165-2439 of SEQ ID NO:7. According to this embodiment, said TE domain preferably comprises amino acids 2165-2439 of SEQ ID NO:7. <br><br> Other aspects and advantages of the present invention will become apparent to those skilled in the art from a study of the following description of the invention and non-limiting examples. <br><br> DEFINITIONS <br><br> In describing the present invention, the following terms will be employed, and are intended to be defined as indicated below. <br><br> Associated With / Operativeiy Linked: Refers to two DNA sequences that are related physically or functionally. For example, a promoter or regulatory DNA sequence is said to be "associated with" a DNA sequence that codes for an RNA or a protein if the two sequences are operativeiy linked, or situated such that the regulator DNA sequence will affect the expression level of the coding or structural DNA sequence. <br><br> Chimeric Gene: A recombinant DNA sequence in which a promoter or regulatory DNA sequence is operativeiy linked to, or associated with, a DNA sequence that codes for an mRNA or which is expressed as a protein, such that the regulator DNA sequence is able to regulate transcription or expression of the associated DNA sequence. The regulator DNA sequence of the chimeric gene is not normally operativeiy linked to the associated DNA sequence as found in nature. <br><br> Coding DNA Sequence: A DNA sequence that is translated in an organism to produce a protein. <br><br> Domain: That part of a polyketide synthase necessary for a given distinct activity. Examples include acyi carrier protein (ACP), fi-ketosynthase (KS), acyltransferase (AT), (3-ketoreductase (KR), dehydratase (DH), enoylreductase (ER), and thioesterase (TE) domains. <br><br> Epothilones: 16-membered macrocyclic polyketides naturally produced by the bacterium Sorangium cellulosum strain So ce90, which mimic the biological effects of taxol. In this application, "epothilone" refers to the class of polyketides that includes epothilone A and epothilone B, as well as analogs thereof such as those described in WO 98/25929. <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -23- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -22- <br><br> Epothilone Synthase: A polyketide synthase responsible for the biosynthesis of epothilone. <br><br> Gene: A defined region that is located within a genome and that, besides the aforementioned coding DNA sequence, comprises other, primarily regulatory, DNA sequences responsible for the control of the expression, that is to say the transcription and translation, of the coding portion. <br><br> Heterologous DNA Sequence: A DNA sequence not naturally associated with a host cell into which it is introduced, including non-naturally occurring multiple copies of a naturally occurring DNA sequence. <br><br> Homologous DNA Sequence: A DNA sequence naturally associated with a host cell into which it is introduced. <br><br> Homologous Recombination: Reciprocal exchange of DNA fragments between homologous DNA molecules. <br><br> Isolated: In the context of the present invention, an isolated nucleic acid molecule or an isolated enzyme is a nucleic acid molecule or enzyme that, by the hand of man. exists apart from its native environment and is therefore not a product of nature. An isolated nucleic acid molecule or enzyme may exist in a purified form or may exist in a non-native environment such as, for example, a recombinant host cell. <br><br> Module: A genetic element encoding all of the distinct activities required in a single round of polyketide biosynthesis, i.e., one condensation step and all the (3-carbonyl processing steps associated therewith. Each module encodes an ACP, a KS, and an AT activity to accomplish the condensation portion of the biosynthesis, and selected post-condensation activities to effect the p-carbonyl processing. <br><br> NRPS: A non-ribosomal polypeptide synthetase, which is a complex of enzymatic activities responsible for the incorporation of amino acids into secondary metabolites including, for example, amino acid adenylation, epimerization, N-methylation, cyclization, peptidyl carrier protein, and condensation domains. A functional NRPS is one that catalyzes the incorporation of an amino acid into a secondary metabolite. <br><br> NRPS gene: One or more genes encoding NRPSs for producing functional secondary metabolites, e.g., epothilones A and B, when under the direction of one or more compatible control elements. <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -24- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -23- <br><br> Nucieic Acid Molecule: A linear segment of single- or double-stranded DNA or RNA that can be isolated from any source. In the context of the present invention, the nucleic acid molecule is preferably a segment of DNA. <br><br> ORF: Open Reading Frame. <br><br> PKS: A polyketide synthase, which is a complex of enzymatic activities (domains) responsible for the biosynthesis of polyketides including, for example, ketoreductase, dehydratase, acyl carrier protein, enoylreductase, ketoacyl ACP synthase, and acyltransferase. A functional PKS is one that catalyzes the synthesis of a polyketide. <br><br> PKS Genes: One or more genes encoding various polypeptides required for producing functional polyketides, e.g., epothilones A and B, when under the direction of one or more compatible control elements. <br><br> Substantially Similar: With respect to nucleic acids, a nucleic acid molecule that has at least 60 percent sequence identity with a reference nucleic acid molecule. In a preferred embodiment, a substantially similar DNA sequence is at least 80% identical to a reference DNA sequence; in a more preferred embodiment, a substantially similar DNA sequence is at least 90% identical to a reference DNA sequence; and in a most preferred embodiment, a substantially similar DNA sequence is at least 95% identical to a reference DNA sequence. A substantially similar DNA sequence preferably encodes a protein or peptide having substantially the same activity as the protein or peptide encoded by the reference DNA sequence. A substantially similar nucleotide sequence typically hybridizes to a reference nucleic acid molecule, or fragments thereof, under the following conditions: hybridization at 7% sodium dodecyl sulfate (SDS), 0.5 M NaP04 pH 7.0,1 mM EDTA at 50°C; wash with 2X SSC, 1% SDS, at 50°C. With respect to proteins or peptides, a substantially similar amino acid sequence is an amino acid sequence that is at least 90% identical to the amino acid sequence of a reference protein or peptide and has substantially the same activity as the reference protein or peptide. <br><br> Transformation: A process for introducing heterologous nucleic acid into a host cell or organism. <br><br> Transformed / Transgenic / Recombinant: Refers to a host organism such as a bacterium into which a heterologous nucleic acid molecule has been introduced. The nucleic acid molecule can be stably integrated into the genome of the host or the nucleic acid molecule can also be present as an extrachromosomal molecule. Such an extrachromosomal molecule can be auto-replicating. Transformed cells, tissues, or plants are understood to <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -25- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -24- <br><br> encompass not only the end product of a transformation process, but also transgenic progeny thereof. A "non-transformed", "non-transgenic", or "non-recombinant" host refers to a wild-type organism, i.e., a bacterium, which does not contain the heterologous nucleic acid molecule. <br><br> Nucleotides are indicated by their bases by the following standard abbreviations: adenine (A), cytosine (C), thymine (T), and guanine (G). Amino acids are likewise indicated by the following standard abbreviations: alanine (ala; A), arginine (Arg; R), asparagine (Asn; N), aspartic acid (Asp; D), cysteine (Cys; C), glutamine (Gin; Q), glutamic acid (Glu; E), glycine (Gly; G), histidine (His; H), isoleucine (lie; I), leucine (Leu; L), lysine (lys; K), methionine (Met; M), phenylalanine (Phe; F), proline (Pro; P), serine (Ser; S), threonine (Thr; T), tryptophan (Trp; W), tyrosine (Tyr; Y), and valine (Val; V). Furthermore, (Xaa; X) represents any amino acid. <br><br> DESCRIPTION OF THE SEQUENCES IN THE SEQUENCE LISTING <br><br> SEQ ID NO:1 is the nucleotide sequence of a 68750 bp contig containing 22 open reading frames (ORFs), which comprises the epothilone biosynthesis genes. <br><br> SEQ ID NO:2 is the protein sequence of a type I polyketide synthase (EPOS A) encoded by epoA (nucleotides 7610-11875 of SEQ ID NO:1). <br><br> SEQ ID NO:3 is the protein sequence of a non-ribosomal peptide synthetase (EPOS P) encoded by epoP (nucleotides 11872-16104 of SEQ ID NO:1). <br><br> SEQ ID NO:4 is the protein sequence of a type I polyketide synthase (EPOS B) encoded by epoB (nucleotides 16251-21749 of SEQ ID NO:1). <br><br> SEQ ID NO:5 is the protein sequence of a type I polyketide synthase (EPOS C) encoded by epoC (nucleotides 21746-43519 of SEQ ID NO:1). <br><br> SEQ ID NO:6 is the protein sequence of a type I polyketide synthase (EPOS D) encoded by epoD (nucleotides 43524-54920 of SEQ ID NO:1). <br><br> SEQ ID NO:7 is the protein sequence of a type I polyketide synthase (EPOS E) encoded by epoE (nucleotides 54935-62254 of SEQ ID NO:1). <br><br> SEQ ID NO:8 is the protein sequence of a cytochrome P450 oxygenase homologue (EPOS F) encoded by epoF (nucleotides 62369-63628 of SEQ ID NO:1). <br><br> SEQ ID NO:9 is a partial protein sequence (partial Orf 1) encoded by ort\ (nucleotides 1-1826 of SEQ ID NO:1). <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -26- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -25- <br><br> SEQ ID N0:10 is a protein sequence (Orf 2) encoded by ort2 (nucleotides 3171-1900 on the reverse complement strand of SEQ ID NO:1). <br><br> SEQ ID NO: 11 is a protein sequence (Orf 3) encoded by ort3 (nucleotides 3415-5556 of SEQ ID NO:1). <br><br> SEQ ID NO:12 is a protein sequence (Orf 4) encoded by or/4 (nucleotides 5992-5612 on the reverse complement strand of SEQ ID NO:1). <br><br> SEQ ID NO:13 is a protein sequence (Orf 5) encoded by or/5 (nucleotides 6226-6675 of SEQ ID NO:1). <br><br> SEQ ID NO:14 is a protein sequence (Orf 6) encoded by oriB (nucleotides 63779-64333 of SEQ ID NO:1). <br><br> SEQ ID NO:15 is a protein sequence (Orf 7) encoded by orfT (nucleotides 64290-63853 on the reverse complement strand of SEQ ID NO:1). <br><br> SEQ ID NO:16 is a protein sequence (Orf 8) encoded by or© (nucleotides 64363-64920 of SEQ ID NO:1). <br><br> SEQ ID NO:17 is a protein sequence (Orf 9) encoded by or/9 (nucleotides 64727-64287 on the reverse complement strand of SEQ ID NO:1). <br><br> SEQ ID NO:18 is a protein sequence (Orf 10) encoded by orf10 (nucleotides 65063-65767 of SEQ ID NO:1). <br><br> SEQ ID NO:19 is a protein sequence (Orf 11) encoded by orf11 (nucleotides 65874-65008 on the reverse complement strand of SEQ ID NO:1). <br><br> SEQ ID N0:20 is a protein sequence (Orf 12) encoded by orf12 (nucleotides 66338-65871 on the reverse complement strand of SEQ ID NO:1). <br><br> SEQ ID NO:21 is a protein sequence (Orf 13) encoded by orf13 (nucleotides 66667-67137 of SEQ ID NO:1). <br><br> SEQ ID NO:22 is a protein sequence (Orf 14) encoded by orf14 (nucleotides 67334-68251 of SEQ ID NO:1). <br><br> SEQ ID NO:23 is a partial protein sequence (partial Orf 15) encoded by orf15 (nucleotides 68346-68750 of SEQ ID NO:1). <br><br> SEQ ID NO:24 is the universal reverse PCR primer sequence. <br><br> SEQ ID NO:25 is the universal forward PCR primer sequence. <br><br> SEQ ID NO:26 is the NH24 end "B" PCR primer sequence. <br><br> SEQ ID NO:27 is the NH2 end "A" PCR primer sequence. <br><br> SEQ ID NO:28 is the NH2 end "B" PCR primer sequence. <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -27- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -26- <br><br> SEQ ID NO:29 is the pEP015-NH6 end "B" PCR primer sequence. SEQ ID N0:30 is the pEPOl5-H2.7 end "A" PCR primer sequence. <br><br> DEPOSIT INFORMATION <br><br> The following material has been deposited with the Agricultural Research Service, Patent Culture Collection (NRRL), 1815 North University Street, Peoria, Illinois 61604, under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. All restrictions on the availability of the deposited material will be irrevocably removed upon the granting of a patent. <br><br> Deposited Material Accession Number Deposit Date <br><br> The genes involved in the biosynthesis of epothilones can be isolated using the techniques according to the present invention. The preferable procedure for the isolation of epothilone biosynthesis genes requires the isolation of genomic DNA from an organism identified as producing epothilones A and B, and the transfer of the isolated DNA on a suitable plasmid or vector to a host organism that does not normally produce the polyketide, followed by the identification of transformed host colonies to which the epothilone-producing ability has been conferred. Using a technique such as X.::Tn5 transposon mutagenesis (de Bruijn &amp; Lupski, Gene 27:131-149 (1984)), the exact region of the transforming epothilone-conferring DNA can be more precisely defined. Alternatively or additionally, the transforming epothiione-conferring DNA can be cleaved into smaller fragments and the smallest that maintains the epothiione-conferring ability further characterized. Whereas the host organism lacking the ability to produce epothilone may be a different species from the organism from which the polyketide derives, a variation of this technique involves the transformation of host DNA into the same host that has had its epothilone-producing ability disrupted by mutagenesis. In this method, an epothilone-producing organism is mutated and non-epothilone-producing mutants are isolated. These are then complemented by genomic DNA isolated from the epothilone-producing parent strain. <br><br> pEP015 pEP032 <br><br> NRRL B-30033 NRRL B-30119 <br><br> June 11,1998 April 16, 1999 <br><br> DETAILED DESCRIPTION OF THE INVENTION <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -28- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -27- <br><br> A further example of a technique that can be used to isolate genes required for epothilone biosynthesis is the use of transposon mutagenesis to generate mutants of an epothilone-producing organism that, after mutagenesis, fails to produce the polyketide. Thus, the region of the host genome responsible for epothilone production is tagged by the transposon and can be recovered and used as a probe to isolate the native genes from the parent strain. PKS genes that are required for the synthesis of polyketides and that'are similar to known PKS genes may be isolated by virtue of their sequence homology to the biosynthetic genes for which the sequence is known, such as those for the biosynthesis of rifamycin or soraphen. Techniques suitable for isolation by homology include standard library screening by DNA hybridization. <br><br> Preferred for use as a probe molecule is a DNA fragment that is obtainable from a gene or another DNA sequence that plays a part in the synthesis of a known polyketide. A preferred probe molecule comprises a 1.2 kb Smal DNA fragment encoding the ketosyntha-se domain of the fourth module of the soraphen PKS (U.S. Patent No. 5,716,849), and a more preferred probe molecule comprises the fl-ketoacyl synthase domains from the first and second modules of the rifamycin PKS (Schupp etal., FEMS Microbiology Letters 159: 201-207 (1998)). These can be used to probe a gene library of an epothilone-producing microorganism to isolate the PKS genes responsible for epothilone biosynthesis. <br><br> Despite the well-known difficulties with PKS gene isolation in general and despite the difficulties expected to be encountered with the isolation of epothilone biosynthesis genes in particular, by using the methods described in the instant specification, biosynthetic genes for epothilones A and B can surprisingly be cloned from a microorganism that produces that polyketide. Using the methods of gene manipulation and recombinant production described in this specification, the cloned PKS genes can be modified and expressed in transgenic host organisms. <br><br> The isolated epothilone biosynthetic genes can be expressed in heterologous hosts to enable the production of the polyketide with greater efficiency than might be possible from native hosts. Techniques for these genetic manipulations are specific for the different available hosts and are known in the art. For example, heterologous genes can be expressed in Streptomyces and other actinomycetes using techniques such as those described in McDaniel etal., Science262:1546-1550 (1993) and Kao etal., Science265:509-512 (1994), both of which are incorporated herein by reference. See also, Rowe etal., Gene <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -29- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -28- <br><br> 216: 215-223 (1998); Holmes etal., EMBO Journal 12(8): 3183-3191 (1993) and Bibb etal.. Gene 38: 215-226 (1985), all of which are incorporated herein by reference. <br><br> Alternately, genes responsible for polyketide biosynthesis, i.e., epothilone biosynthetic genes, can also be expressed in other host organisms such as pseudomonads and E. coli. Techniques for these genetic manipulations are specific for the different available hosts and are known in the art. For example, PKS genes have been sucessfully expressed in E. coli using the pT7-7 vector, which uses the T7 promoter. See, Tabor et al., Proc. Natl. <br><br> Acad. Sci. USA 82:1074-1078 (1985), incorporated herein by reference. In addition, the expression vectors pKK223-3 and pKK223-2 can be used to express heterologous genes in E. coli, either in transcriptional or translational fusion, behind the tac or trc promoter. For the expression of operons encoding multiple ORFs, the simplest procedure is to insert the operon into a vector such as pKK223-3 in transcriptional fusion, allowing the cognate ribo-some binding site of the heterologous genes to be used. Techniques for overexpression in gram-positive species such as Bacillus are also known in the art and can be used in the context of this invention (Quax et al., in: Industrial Microorganisms: Basic and Applied Molecular Genetics, Eds. Baltz etal., American Society for Microbiology, Washington (1993)). <br><br> Other expression systems that may be used with the epothilone biosynthetic genes of the invention include yeast and baculovirus expression systems. See, for example, The Expression of Recombinant Proteins in Yeasts," Sudbery, P. E., Curr. Opin. Biotechnol. 7(5): 517-524 (1996); "Methods for Expressing Recombinant Proteins in Yeast," Mackay, et al., Editor(s): Carey, Paul R., Protein Eng. Des. 105-153, Publisher: Academic, San Diego, Calif (1996); "Expression of heterologous gene products in yeast," Pichuantes, et al., Editor(s): Cleland, J. L.f Craik, C. S., Protein Eng. 129-161, Publisher: Wiley-Liss, New York, N. Y (1996); WO 98/27203; Kealey etal., Proc. Natl. Acad. Sci. USA 95: 505-509 (1998); "Insect Cell Culture: Recent Advances, Bioengineering Challenges And Implications In Protein Production," Palomares, et al., Editor(s): Galindo, Enrique; Ramirez, Octavio T„ Adv. Bioprocess Eng. Vol. II, Invited Pap. Int. Symp., 2nd (1998) 25-52, Publisher: Kluwer, Dordrecht, Neth; "Baculovirus Expression Vectors," Jarvis, Donald L„ Editor(s): Miller, Lois K., Baculoviruses 389-431, Publisher: Plenum, New York, N. Y. (1997); "Production Of Heterologous Proteins Using The Baculovirus/lnsect Expression System," Grittiths, et al., Methods Mol. Biol. (Totowa, N. J.) 75 (Basic Cell Culture Protocols (2nd Edition)) 427-440 (1997); and "Insect Cell Expression Technology," Luckow, Veme A., Protein Eng. 183-218, <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -30- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -29- <br><br> Publisher: Wiley-Liss, New York, N. Y. (1996); all of which are incorporated herein by reference. <br><br> Another consideration for expression of PKS genes in heterologous hosts is the requirement of enzymes for posttranslational modification of PKS enzymes by phosphopante-theinylation before they can synthesize polyketides. However, the enzymes responsible for this modification of type I PKS enzymes, phosphopantetheinyl (P-pant) transferases are not normally present in many hosts such as E. coli. This problem can be solved by coexpres-sion of a P-pant transferase with the PKS genes in the heterologous host, as described by Kealey etal., Proc. Natl. Acad. Sci. USA 95: 505-509 (1998), incorporated herein by reference. <br><br> Therefore, for the purposes of polyketide production, the significant criteria in the choice of host organism are its ease of manipulation, rapidity of growth (i.e. fermentation), possession or the proper molecular machinery for processes such as posttranslational modification, and its lack of susceptibility to the polyketide being overproduced. Most preferred host organisms are actinomycetes such as strains of Streptomyces. Other preferred host organisms are pseudomonads and E. coli. The above-described methods of polyketide production have significant advantages over the technology currently used in the preparation of the compounds. These advantages include the cheaper cost of production, the ability to produce greater quantities of the compounds, and the ability to produce compounds of a preferred biological enantiomer, as opposed to racemic mixtures inevitably generated by organic synthesis. Compounds produced by heterologous hosts can be used in medical {e.g. cancer treatment in the case of epothilones) as well as agricultural applications. <br><br> Printed from Mimosa <br><br> 03/20/2002 15:55:45 page -31- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -30-EXPERIMENTAL <br><br> The invention will be further described by reference to the following detailed examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Standard recombinant DNA and molecular cloning techniques used here are well known in the art and are described by Ausubel (ed.), Current Protocols in Molecular Biology, John Wiley and Sons, inc. (1994); T. Maniatis, E. F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor laboratory, Cold Spring Harbor, NY (1989); and by T.J. Silhavy, M.L. Berman, and L.W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984). <br><br> Example 1: Cultivation of an Epothilone-Producing Strain of Sorangium cellulosum <br><br> Sorangium cellulosum strain 90 (DSM 6773, Deutsche Sammlung von Mikroorganis-men und Zellkulturen, Braunschweig) is streaked out and grown (30°C) on an agar plate of SolE medium (0.35% glucose, 0.05% tryptone, 0.15% MgSO* x 7H20, 0.05% ammonium sulfate, 0.1% CaClz, 0.006% K2HPO4, 0.01% sodium dithionite, 0.0008% Fe-EDTA, 1.2% HEPES, 3.5% [vol/vol] supernatant of sterilized stationary S. cellulosum culture) pH ad. 7.4. Cells from about 1 square cm are picked and inoculated into 5 mis of G51t liquid medium (0.2% glucose, 0.5% starch, 0.2% tryptone, 0.1% probion S, 0.05% CaCI2x2H20, 0.05% MgS04x7H20, 1.2% HEPES, pH ad. 7.4) and incubated at 30°C with shaking at 225 rpm. After 4 days, the culture is transferred into 50 mis of G51t and incubated as above for 5 days. This culture is used to inoculate 500 mis of G5lt and incubated as above for 6 days. The culture is centrifuged for 10 minutes at 4000 rpm and the cell pellet is resuspended in 50 mis of G51t. <br><br> Example 2: Generation of a Bacterial Artificial Chromosome (Bac) Library <br><br> To generate a Bac library, S. cellulosum cells cultivated as described in Example 1 above are embedded into agarose blocks, lysed, and the liberated genomic DNA is partially digested by the restriction enzyme H/ndlll. The digested DNA is separated on an agarose gel by pulsed-field electrophoresis. Large (approximately 90-150 kb) DNA fragments are <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -32- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -31 - <br><br> isolated from the agarose gel and iigated into the vector pBelobacll. pBelobacll contains a gene encoding chloramphenicol resistance, a multiple cloning site in the lacZ gene providing for blue/white selection on appropriate medium, as well as the genes required for the replication and maintenance of the plasmid at one or two copies per cell. The ligation mixture is used to transform Escherichia coli DH10B electrocompetent cells using standard electroporation techniques. Chloramphenicol-resistant recombinant (white, lacZ mutant) colonies are transferred to a positively charged nylon membrane filter in 384 3X3 grid format. The clones are lysed and the DNA is cross-linked to the filters. The same clones are also preserved as liquid cultures at -80°C. <br><br> Example 3: Screening the Bac Library of Sorangium cellulosum 90 for the Presence of Type I Polyketide Synthase-Related Sequences <br><br> The Bac library filters are probed by standard Southern hybridization procedures. The DNA probes used encode p-ketoacyl synthase domains from the first and second modules of the rifamycin polyketide synthase (Schupp et al., FEMS Microbiology Letters 159: 201-207 (1998)). The probe DNAs are generated by PCR with primers flanking each ketosynthase domain using the plasmid pNE95 as the template (pNE95 equals cosmid 2 described in Schupp et al. (1998)). 25 ng of PCR-amplified DNA is isolated from a 0.5% agarose gel and labeled with 32P-dCTP using a random primer labeling kit (Gibco-BRL, Bethesda MD, USA) according to the manufacturer's instructions. Hybridization is at 65°C for 36 hours and membranes are washed at high stringency (3 times with 0.1 x SSC and 0.5% SDS for 20 min at 65°C). The labeled blot is exposed on a phosphorescent screen and the signals are detected on a Phospholmager 445SI (screen and 445SI from Molecular Dynamics). This results in strong hybridization of certain Bac clones to the probes. These clones are selected and cultured overnight in 5 mis of Luria broth (LB) at 37°C. Bac DNA from the Bac clones of interest is isolated by a typical miniprep procedure. The cells are resuspended in 200 til lysozyme solution (50mM glucose, 10 mM EDTA, 25 mM Tris-HCI, 5mg/ml lysozyme), lysed in 400 til lysis solution (0.2 N NaOH and 2% SDS), the proteins are precipitated (3.0 M potassium acetate, adjusted to pH5.2 with acetic acid), and the Bac DNA is precipitated with isopropanol. The DNA is resuspended in 20|il of nuclease-free distilled water, restricted with flamHI (New England Biolabs, Inc.) and separated on a 0.7% agarose gel. The gel is blotted by Southern hybridization as described above and probed <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -33- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -32- <br><br> under conditions described above, with a 1.2 kb SmaI DNA fragment encoding the ketosyn-thase domain of the fourth module of the soraphen polyketide synthase as the probe (see, U.S. Patent No. 5,716,849). Five different hybridization patterns are observed. One clone representing each of the five patterns is selected and named pEP015, pEP020, pEP030, pEP031, and pEP033, respectively. <br><br> Example 4: Subcloning of BamHl Fragments from pEP015, pEP020, pEP030, pEP031, <br><br> and pEP033 <br><br> The DNA of the five selected Bac clones is digested with Bam HI and random fragments are subcloned into pBluescript II SK+ (Stratagene) at the BamHI site. Subclones carrying inserts between 2 and 10 kb in size are selected for sequencing of the flanking ends of the inserts and also probed with the 1.2 Sma\ probe as described above. Subclones that show a high degree of sequence homology to known polyketide synthases and/or strong hybridization to the soraphen ketosynthase domain are used for gene disruption experiments. <br><br> Example 5: Preparation of Streptomycin-Resistant Spontaneous Mutants of Sorangium cellulosum strain So ce90 <br><br> 0.1 ml of a three day old culture of Sorangium cellulosum strain So ce90, which is raised in liquid medium G52-H (0.2% yeast extract, 0.2% soyameal defatted, 0.8% potato starch, 0.2% glucose, 0.1% MgS04 x7H20, 0.1% CaCI2 X2H20, 0.008% Fe-EDTA, pH ad 7.4 with KOH), is plated out on agar plates with SolE medium supplemented with 100 p.g/ml streptomycin. The plates are incubated at 30°C for 2 weeks. The colonies growing on this medium are streptomycin-resistant mutants, which are streaked out and cultivated once more on the same agar medium with streptomycin for purification. One of these streptomycin-resistant mutants is selected and is called BCE28/2. <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -34- <br><br> WO 99/66028 <br><br> PCT7EP99/04171 <br><br> -33- <br><br> Example 6: Gene Disruptions in Sorangium cellulosum BCE28/2 Using the Subcloned <br><br> BamHI Fragments <br><br> The BamHI inserts of the subclones generated from the five selected Bac clones as described above are isolated and ligated into the unique BamHI site of plasmid pCIB132 (see, U.S. Patent No. 5,716,849). The pCIB132 derivatives carrying the inserts are transformed into Escherichia coli ED8767 containing the helper plasmid pUZ8 (Hedges and Matthew, Plasmid 2: 269-278 (1979). The transformants are used as donors in conjugation experiments with Sorangium cellulosum BCE2B/2 as recipient. For the conjugation, 5-10 x 109 cells of Sorangium cellulosum BCE28/2 from an early stationary phase culture (reaching about 5 x 108 cells/ml) grown at 30°C in liquid medium G51b (G51b equals medium G51t with tryptone replaced by peptone) are mixed in a 1:1 cellular ratio with a late-log phase culture (in LB liquid medium) of E. coli ED8767 containing pCIB132 derivatives carrying the subcloned BamHI fragments and the helper plasmid pUZ8. The mixed cells are then centri-fuged at 4000 rpm for 10 minutes and resuspended in 0.5 ml G51b medium. This cell suspension is then plated as a drop in the center of a plate with So1 E agar containg 50 mg/l kanamycin. The cells obtained after incubation for 24 hours at 30°C are harvested and resuspended in 0.8 ml of G51b medium, and 0.1 to 0.3 ml of this suspension is plated out on a selective So1E solid medium containing phleomycin (30 mg/l), streptomycin (300 mg/l), and kanamycin (50 mg/i). The counterselection of the donor Escherichia coli strain takes place with the aid of streptomycin. The colonies that grow on this selective medium after an incubation time of 8-12 days at a temperature of 30°C are isolated with a plastic loop and streaked out and cultivated on the same agar medium for a second round of selection and purification. The colony-derived cultures that grow on this selective agar medium after 7 days at a temperature of 30°C are transconjugants of Sorangium cellulosum BCE28/2 that have acquired phleomycin resistance by conjugative transfer of the pCIB132 derivatives carrying the subcloned BamHI fragments. <br><br> Integration of the pCIB132-derived plasmids into the chromosome of Sorangium cellulosum BCE28/2 by homologous recombination is verified by Southern hybridization. For this experiment, complete DNA from 5-10 tranconjugants per transferred BamHI fragment is isolated (from 10 mi cultures grown in medium G52-H for three days) applying the method described by Pospiech and Neumann, Trends Genet. 11: 217 (1995). For the Southern blot, the DNA isolated as described above is cleaved either with the restriction <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -35- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -34- <br><br> enzymes Bg!i\, Clal, or Noti, and the respective BamHI inserts or pCIB132 are used as 32P labelled probes. <br><br> Example 7: Analysis of the Effect of the Integrated BamHI Fragments on Epothilone Production by Sorangium cellulosum After Gene Disruption <br><br> Transconjugant cells grown on about 1 square cm surface of the selective So1 E plates of the second round of selection (see Example 6) are transferred by a sterile plastic loop into 10 ml of medium G52-H in an 50 ml Erlenmeyer flask. After incubation at 30°C and 180 rpm for 3 days, the culture is transfered into 50 ml of medium G52-H in an 200 ml Erlenmeyer flask. After incubation at 30°C and 180 rpm for 4-5 days, 10 ml of this culture is transfered into 50 ml of medium 23B3 (0.2 % glucose, 2 % potato starch, 1.6 % soya meal defatted, 0.0008 % Fe-EDTA Sodium salt, 0.5 % HEPES (4-(2-hydroxyethyl)-piperazine-1-ethane-sulfonic-acid), 2 % vol/vol polysterole resin XAD16 (Rohm &amp; Haas), pH adjusted to 7.8 with NaOH) in an 200 ml Erlenmeyer flask. <br><br> Quantitative determination of the epothilone produced takes place after incubation of the cultures at 30°C and 180 rpm for 7 days. The complete culture broth is filtered by suction through a 150 jim nylon filter. The resin remaining on the filter is then resuspended in 10 mi isopropanol and extracted by shaking the suspension at 180 rpm for 1 hour. 1 ml is removed from this suspension and centrifuged at 12,000 rpm in an Eppendorff Microfuge. The amount of epothilones A and B therein is determined by means of an HPLC and detection at 250 nm with a UV_DAD detector (HPLC with Waters -Symetry C18 column and a gradient of 0.02 % phosphoric acid 60%-0% and acetonitril 40%-100%). <br><br> Transconjugants with three different integrated BamHI fragments subcloned from pEP015, namely transconjugants with the BamHI fragment of plasmid pEPOl 5-21, transconjugants with the BamHI fragment of plasmid pEPOl5-4-5, and transconjugants with the BamHI fragment of plasmid pEPOl 5-4-1, are tested in the manner described above. HPLC analysis reveals that all transconjugants no longer produce epothilone A or B. By contrast, epothilone A and B are detectable in a concentration of 2-4 mg/l in transconjugants with BamHI fragments integrated that are derived from pEP020, pEP030, pEP031, pEP033, and in the parental strain BCE28/2. <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -36- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -35- <br><br> Example 8: Nucleotide Sequence Determination of the Cloned Fragments and <br><br> Construction of Contigs <br><br> A. BamHI Insert of Plasmid pEP015-21 <br><br> Plasmid DNA is isolated from the strain Escherichia coli DH10B [pEP015-21], and the nucleotide sequence of the 2.3-kb BamHI insert in pEP015-21 is determined. Automated DNA sequencing is done on the double-stranded DNA template by the dideoxynucleo-tide chain termination method, using Applied Biosystems model 377 sequencers. The primers used are the universal reverse primer (5' GGA AAC AGC TAT GAC CAT G 3' (SEQ ID NO:24)) and the universal forward primer (5* GTA AAA CGA CGG CCA GT 3' (SEQ ID NO:25)). In subsequent rounds of sequencing reactions, custom-synthesized oligonucleotides, designed for the 3' ends of the previously determined sequences, are used to extend and join contigs. Both strands are entirely sequenced, and every nucleotide is sequenced at least two times. The nucleotide sequence is compiled using the program Sequencher vers. 3.0 (Gene Codes Corporation), and analyzed using the University of Wisconsin Genetics Computer Group programs. The nucleotide sequence of the 2213-bp insert corresponds to nucleotides 20779-22991 of SEQ ID NO:1. <br><br> B. BamHI Insert of Plasmid pEPOl 5-4-1 <br><br> Plasmid DNA is isolated from the strain Escherichia co//'DH10B [pEPOl 5-4-1], and the nucleotide sequence of the 3.9-kb BamHI insert in pEPOl5-4-1 is determined as described in (A) above. The nucleotide sequence of the 3909-bp insert corresponds to nucleotides 16876-20784 of SEQ ID NO:1. <br><br> C. BamHI Insert of Plasmid pEPOl5-4-5 <br><br> Plasmid DNA is isolated from the strain Escherichia CO//DH10B [pEPOl 5-4-5], and the nucleotide sequence of the 2.3-kb BamHI insert in pEPOl 5-4-5 is determined as described in (A) above. The nucleotide sequence of the 2233-bp insert corresponds to nucleotides 42528-44760 of SEQ ID NO:1. <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -37- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -36- <br><br> Example 9: Subcloning and Ordering of DNA Fragments from pEP015 Containing Epothilone Biosynthesis Genes pEP015 is digested to completion with the restriction enzyme H/'ndlll and the resulting fragments are subcloned into pBluescript IISK- or pNEB193 (New England Biolabs) <br><br> that has been cut with H/ndlll and dephosphorylated with calf intestinal alkaline phosphatase. Six different clones are generated and named pEP0l5-NH1, pEP015-NH2, pEP015-NH6, pEP015-NH24 (all based on pNEB193), and pEP015-H2.7 and pEP015-H3.0 (both based on pBluescript II SK-). <br><br> The BamHI insert of pEP015-21 is isolated and DIG-labeled (Non-radioactive DNA labeling and detection system, Boehringer Mannheim), and used as a probe in DNA hybridization experiments at high stringency against pEP015-NH1, pEP015-NH2, pEP015-NH6, pEP015-NH24, pEP015-H2.7 and pEP015-H3.0. Strong hybridization signal is detected for pEP015-NH24, indicating that pEP015-21 is contained within pEP015-NH24. <br><br> The BamHI insert of pEPOl 5-4-1 is isolated and DIG-labeled as above, and used as a probe in DNA hybridization experiments at high stringency against pEP015-NH1, PEP015-NH2, PEP015-NH6, pEP015-NH24, pEP015-H2.7 and pEP015-H3.0. Strong hybridization signals are detected for pEP015-NH24 and pEP015-H2.7. Nucleotide sequence data generated from one end each of pEP015-NH24 and pEP015-H2.7 are also in complete agreement with the previously determined sequence of the BamHI insert of pEPOl 5-4-1. These experiments demonstrate that pEPOl 5-4-1 (which contains one internal H/ndlll site) overlaps pEP015-H2.7 and pEP015-NH24, and that pEP015-H2.7 and pEP015-NH24, in this order, are contiguous. <br><br> The BamHI insert of pEPOl 5-4-5 is isolated and DIG-labeled as above, and used as a probe in DNA hybridization experiments at high stringency against pEP015-NH1, pEP015-NH2, pEP015-NH6, pEP015-NH24, pEP015-H2.7 and pEP015-H3.0. Strong hybridization signal is detected for pEP015-NH2, indicating that pEP015-21 is contained within pEP015-NH2. <br><br> Nucleotide sequence data is generated from both ends of pEP015-NH2 and from the end of pEP015-NH24 that does not overlap with pEPOl5-4-1. PCR primers NH24 end "B": GTGACTGGCGCCTGGAATCTGCATGAGC (SEQ ID NO:26), NH2 end "A": AGCGGGAGCTTGCTAGACATTCTGTTTC (SEQ ID NO:27), and NH2 end "B": GACGCGCCTCGGGCAGCGCCCCAA (SEQ ID NO:28), pointing towards the H/ndlll sites, <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -38- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -37- <br><br> are designed based on these sequences and used in amplification reactions with pEP015 and, in separate experiments, with Sorangium cellulosum So ce90 genomic DNA as the templates. Specific amplification is found with primer pair NH24 end "B" and NH2 end "A" with both templates. The amplimers are cloned into pBluescript II SK- and completely sequenced. The sequences of the amplimers are identical, and also agree completely with the end sequences of pEP015-NH24 and pEP015-NH2, fused at the H/ndlll site, establishing that the H/ndlll fragments of pEP015-NH2 and pEP015-NH24 are, in this order, contiguous. <br><br> The H/ndlll insert of pEP015-H2.7 is isolated and DIG-labeled as above, and used as a probe in a DNA hybridization experiment at high stringency against pEP015 digested by A/ofl. A NotI fragment of about 9 kb in size shows a strong a hybridization, and is further subcloned into pBluescript II SK- that has been digested with A/ofl and dephosphorylated with calf intestinal alkaline phosphatase, to yield pEP015-N9-16. The A/ofl insert of pEP015-N9-16 is isolated and DIG-labeled as above, and used as a probe in DNA hybridization experiments at high stringency against pEP015-NH1, pEPOl5-NH2, pEP015-NH6, pEP015-NH24, pEP015-H2.7 and pEP015-H3.0. Strong hybridization signals are detected for pEPOl5-NH6, and also for the expected clones pEP015-H2.7 and pEP015-NH24. Nucleotide sequence data is generated from both ends of pEPOl 5-NH6 and from the end of pEP015-H2.7 that does not overlap with pEPOl 5-4-1. PCR primers are designed pointing towards the H/ndlll sites and used in amplification reactions with pEP015 and, in separate experiments, with Sorangium cellulosum So ce90 genomic DNA as the templates. Specific amplification is found with primer pair pEP015-NH6 end "B": CACCGAAGCGTCGATCTGGTCCATC (SEQ ID NO:29) and pEPOl 5-H2.7 end "A": CGGTCAGATCGACGACGGGCTTTCC (SEQ ID N0:30) with both templates. The amplimers are cloned into pBluescript II SK- and completely sequenced. The sequences of the amplimers are identical, and also agree completely with the end sequences of pEP015-NH6 and pEP015-H2.7, fused at the H/ndlll site, establishing that the H/ndlll fragments of pEP015-NH6 and pEP015-H2.7 are, in this order, contiguous. <br><br> All of these experiments, taken together, establish a contig of H/ndlll fragments covering a region of about 55 kb and consisting of the H/ndlll inserts of pEP015-NH6, pEP015-H2.7, pEP015-NH24, and pEP015-NH2, in this order. The inserts of the remaining two H/ndlll subclones, namely pEP015-NH1 and pEP015-H3.0, are not found to be parts of this contig. <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -39- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -38- <br><br> Example 10: Further Extension of the Subclone Contig Covering the Epothilone <br><br> Biosynthesis Genes <br><br> An approximately 2.2 kb BamHI - H/ndlll fragment derived from the downstream end of the insert of pEP015-NH2 and thus representing the downstream end of the subclone contig described in Example 9 is isolated, DIG-labeled, and used in Southern hybridization experiments against pEP015 and pEP015-NH2 DNAs digested with several enzymes. The strongly hybridizing bands are always found to be the same in size between the two target DNAs indicating that the Sorangium cellulosum So ce90 genomic DNA fragment cloned into pEP015 ends with the H/ndlll site at the downstream end of pEP015-NH2. <br><br> A cosmid DNA library of Sorangium cellulosum So ce90 is generated, using established procedures, in pScosTriplex-ll (Ji, etal., Genomics31:185-192 (1996)). Briefly, high-molecular weight genomic DNA of Sorangium cellulosum So ce90 is partially digested with the restriction enzyme 5au3AI to provide fragments with average sizes of about 40 kb, and ligated to Bam HI and Xba\ digested pScosTriplex-ll. The ligation mix is packaged with Gigapack III XL (Stratagene) and used to transfect E. coli XL1 Blue MR cells. <br><br> The cosmid library is screened with the approximately 2.2 kb BamHI - H/ndlll fragment, derived from the downstream end of the insert of pEP015-NH2, used as a probe in colony hybridization. A strongly hybridizing clone, named pEP04E7 is selected. <br><br> pEP04E7 DNA is isolated, digested with several restriction endonucleases, and probed in Southern hybridization experiments with the 2.2 kb BamHI - H/ndlll fragment. A strongly hybridizing NotI fragment of approximately 9 kb in size is selected and subcloned into pBluescript II SK- to yield pEP04E7-N9-8. Further Southern hybridization experiments reveal that the approximately 9 kb A/ofl insert of pEP04E7-N9-8 overlaps pEP015-NH2 over 6 kb in a Atofl - H/ndlll fragment, while the remaining approximately 3 kb H/ndlll - A/ofl fragment would extend the subclone contig described in Example 9. End sequencing reveals, however, that the downstream end of the insert of pEP04E7-N9-8 contains the BamHI - A/ofl polylinker of pScosTriplex-ll, thereby indicating that the genomic DNA insert of pEP04E7 ends at a Sau3AI site within the extending H/ndlll - A/ofl fragment and that the A/ofl site is derived from pScosTriplex-ll. <br><br> An approximately 1.6 kb Psfl - SalI fragment derived from the approximately 3 kb extending H/ndlll - A/ofl subfragment of pEP04E7-N9-8, containing only Sorangium <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -40- <br><br> WO 99/66028 PCT/EP99/04171 <br><br> -39 <br><br> cellulosum So ce90-derived sequences free of vector, is used as a probe against the bacterial artificial chromosome library described in Example 2. Besides the previously-isolated EP015, a Bac clone, named EP032, is found to strongly hybridize to the probe. pEP032 is isolated, digested with several restriction endonucleases, and hybridized with the approximately 1.6-kb Psfl - SalI probe. A H/ndlll - EcoRV fragment of about 13 kb in size is found to strongly hybridize to the probe, and is subcloned into pBluescript II SK-digested with H/ndlll and H/ncll to yield pEP032-HEV15. <br><br> Oligonucleotide primers are designed based on the downstream end sequence of pEP015-NH2 and on the upstream (H/ndlll) end sequence derived from pEP032-HEV15, and used in sequencing reactions with pEP04E7-N9-8 as the template. The sequences reveal the existence of a small H/ndlll fragment (EP04E7-H0.02) of 24 bp, undetectable in standard restriction analysis, separating the H/ndlll site at the downstream end of pEP015-NH2 from the H/ndlll site at the upstream end of pEP032-HEV15. <br><br> Thus, the subclone contig described in Example 9 is extended to include the H/ndlll fragment EP04E7-H0.02 and the insert of pEP032-HEV15, and constitutes the inserts of: pEP015-NH6, PEP015-H2.7, pEP015-NH24, pEP015-NH2, EP04E7-H0.02 and pEP032-HEV15, in this order. <br><br> Example 11: Nucleotide Sequence Determination of the Subclone Contig Covering the <br><br> Epothilone Biosynthesis Genes <br><br> The nucleotide sequence of the subclone contig described in Example 10 is determined as follows. <br><br> pEPOl 5-H2.7. Plasmid DNA is isolated from the strain Escherichia coli DH1 OB [pEP015-H2.7], and the nucleotide sequence of the 2.7-kb BamHI insert in pEP015-H2.7 is determined. Automated DNA sequencing is done on the double-stranded DNA template by the dideoxynucleotide chain termination method, using Applied Biosystems model 377 sequencers. The primers used are the universal reverse primer (5' GGA AAC AGC TAT GAC CAT G 3' (SEQ ID NO:24)) and the universal forward primer (5* GTA AAA CGA CGG CCA GT 3' (SEQ ID NO:25)). In subsequent rounds of sequencing reactions, custom-synthesized oligonucleotides, designed for the 3' ends of the previously determined sequences, are used to extend and join contigs. <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -41- <br><br> WO 99/66028 PCT/EP99/04171 <br><br> -40 <br><br> pEP015-NH6, pEP015-NH24 and pEP015-NH2. The H/ndlll inserts ot these plas-mids are isolated, and subjected to random fragmentation using a Hydroshear apparatus (Genomic Instrumentation Services, Inc.) to yield an average fragment size of 1-2 kb. The fragments are end-repaired using T4 DNA Polymerase and Klenow DNA Polymerase enzymes in the presence of desoxynucleotide triphosphates, and phosphorylated with T4 DNA Kinase in the presence of ribo-ATP. Fragments in the size range of 1.5-2.2 kb are isolated from agarose gels, and iigated into pBluescript II SK- that has been cut with EcoRV and de-phosphorylated. Random subclones are sequenced using the universal reverse and the universal forward primers. <br><br> pEP032-HEV15. pEP032-HEV15 is digested with H/ndlll and Sspl, the approximately 13.3 kb fragment containing the -13 kb H/ndlll - EcoRV insert from So. cellulosum So ce90 and a 0.3 kb H/ncll - Sspl fragment from pBluescript II SK- is isolated, and partially digested with Haelll to yield fragments with an average size of 1-2 kb. Fragments in the size range of 1.5-2.2 kb are isolated from agarose gels, and Iigated into pBluescript II SK- that has been cut with EcoRV and dephosphorylated. Random subclones are sequenced using the universal reverse and the universal forward primers. <br><br> The chromatograms are analyzed and assembled into contigs with the Phred, Phrap and Consed programs (Ewing, etal., Genome Res. 8(3): 175-185 (1998); Ewing, etal.. Genome Res. 8(3): 186-194 (1998); Gordon, etal., Genome Res. 8(3): 195-202 (1998)). Contig gaps are filled, sequence discrepancies are resolved, and low-quality regions are resequenced using custom-designed oligonucleotide primers for sequencing on either the original subclones or selected clones from the random subclone libraries. Both strands are completely sequenced, and every basepair is covered with at least a minimum aggregated Phred score of 40 (confidence level of 99.99%). <br><br> The nucleotide sequence of the 68750 bp contig is shown as SEQ ID NO:1. <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -42- <br><br> WO 99/66028 PCT/EP99/04171 <br><br> -41 - <br><br> Example 12: Nucleotide Sequence Analysis of the Epothilone Biosynthesis Genes SEQ ID NO:1 is found to contain 22 ORFs as detailed below in Table 1: <br><br> Table 1 <br><br> ORF <br><br> Start codon <br><br> Stop codon <br><br> Homology of deduced protein <br><br> Proposed function of deduced protein orfl outside of sequenced ranee <br><br> 1826 <br><br> orfl * <br><br> 3171 <br><br> 1900 <br><br> Hypothetical protein SP: Ql 1037; DD-peptidase SP:P15555 <br><br> orfi <br><br> 3415 <br><br> 5556 <br><br> Na/H antiporter PID: D10I7724 <br><br> Transport orfA * <br><br> 5992 <br><br> 5612 <br><br> orfS <br><br> 6226 <br><br> 6675 <br><br> epoA <br><br> 7610 <br><br> 11875 <br><br> Type 1 polyketide synthase <br><br> Epothilone synthase: Thiazole ring formation epoP <br><br> 11872 <br><br> 16104 <br><br> Non-ribosomal peptide synthetase <br><br> Epothilone synthase: Thiazole ring formation epoB <br><br> 16251 <br><br> 21749 <br><br> Type 1 polyketide synthase <br><br> Epothilone synthase: Polyketide backbone formation epoC <br><br> 21746 <br><br> 43519 <br><br> Type 1 polyketide synthase <br><br> Epothilone synthase: Polyketide backbone formation epo D <br><br> 43524 <br><br> 54920 <br><br> Type 1 polyketide synthase <br><br> Epothilone synthase: Polyketide backbone formation epoE <br><br> 54935 <br><br> 62254 <br><br> Type 1 polyketide synthase <br><br> Epothilone synthase: Polyketide backbone formation epoF <br><br> 62369 <br><br> 63628 <br><br> Cytochrome P450 <br><br> Epothilone macrolacione oxidase orfb <br><br> 63779 <br><br> 64333 <br><br> orfl * <br><br> 64290 <br><br> 63853 <br><br> orfS <br><br> 64363 <br><br> 64920 <br><br> orf) * <br><br> 64727 <br><br> 64287 <br><br> orflO <br><br> 65063 <br><br> 65767 <br><br> orf\I * <br><br> 65874 <br><br> 65008 <br><br> orfll * <br><br> 66338 <br><br> 65871 <br><br> orfl 3 <br><br> 66667 <br><br> 67137 <br><br> or/14 <br><br> 67334 <br><br> 68251 <br><br> Hypothetical protein GI:3293544; Cation efflux system protein GI: 2623026 <br><br> Transport <br><br> 0i/15 <br><br> 68346 <br><br> outside of sequenced ranee <br><br> * On the reverse complementer strand. Numbering according to SEQ ID NO:1. <br><br> epoA (nucleotides 7610-11875 of SEQ ID NO:1) codes for EPOS A (SEQ ID NO:2), a type I polyketide synthase consisting of a single module, and harboring the following domains: P-ketoacyl-synthase (KS) (nucleotides 7643-8920 of SEQ ID NO:1, amino acids 11- <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -43- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -42- <br><br> 437 of SEQ ID NO:2); acyltransferase (AT) (nucleotides 9236-10201 of SEQ ID NO:1, <br><br> amino acids 543-864 of SEQ ID NO:2); enoyl reductase (ER) (nucleotides 10529-11428 of SEQ ID NO:1, amino acids 974-1273 of SEQ ID NO:2); and acyl carrier protein homologous domain (ACP) (nucleotides 11549-11764 of SEQ ID NO:1, amino acids 1314-1385 of SEQ ID NO:2). Sequence comparisons and motif analysis (Haydock, et al. FEBS Lett. 374: 246-248 (1995); Tang, et al., Gene 216: 255-265 (1998)) reveal that the AT encoded by EPOS A is specific for maionyi-CoA. EPOS A should be involved in the initiation of epothilone biosynthesis by loading the acetate unit to the multienzyme complex that will eventually form part of the 2-methylthiazoie ring (C26 and C20). <br><br> epoP (nucleotides 11872-16104 of SEQ ID NO:1) codes for EPOS P (SEQ ID NO:3), a non-ribosomal peptide synthetase containing one module. EPOS P harbors the following domains: <br><br> • peptide bond formation domain, as delineated by motif K (amino acids 72-81 [FPLTDIQESY] of SEQ ID NO:3, corresponding to nucleotide positions 12085-12114 of SEQ ID NO:1); motif L (amino acids 118-125 [VVARHDML] of SEQ ID NO:3, corresponding to nucleotide positions 12223-12246 of SEQ ID NO:1); motif M (amino acids 199-212 [SIDLINVDLGSLSI] of SEQ ID NO:3, corresponding to nucleotide positions 12466-12507 of SEQ ID NO:1); and motif O (amino acids 353-363 [GDFTSMVLLDI] of SEQ ID NO:3, corresponding to nucleotide positions 12928-12960 of SEQ ID NO:1); <br><br> • aminoacyl adenylate formation domain, as delineated by motif A (amino acids 549-565 [LTYEELSRRSRRLGARL] of SEQ ID NO:3, corresponding to nucleotide positions 13516-13566 of SEQ ID NO:1); motif B (amino acids 588-603 [VAVLAVLESGAAYVPI] of SEQ ID NO:3, corresponding to nucleotide positions 13633-13680 of SEQ ID NO:1); <br><br> motif C (amino acids 669-684 [AYVIYTSGSTGLPKGV] of SEQ ID NO:3, corresponding to nucleotide positions 13876-13923 of SEQ ID NO:1); motif D (amino acids 815-821 [SLGGATE] of SEQ ID NO:3, corresponding to nucleotide positions 14313-14334 of SEQ ID NO:1): motif E (amino acids 868-892 [GQLYIGGVGLALGYWRDEEKTRKSF] of SEQ ID NO:3, corresponding to nucleotide positions 14473-14547 of SEQ ID NO:1); motif F (amino acids 903-912 [YKTGDLGRYL] of SEQ ID NO:3, corresponding to nucleotide positions 14578-14607 of SEQ ID NO:1); motif G (amino acids 918-940 [EFMGREDNQIKLRGYRVELGEIE] of SEQ ID NO:3, corresponding to nucleotide positions 14623-14692 of SEQ ID NO:1); motif H (amino acids 1268-1274 [LPEYMVP] of SEQ ID NO:3, corresponding to nucleotide positions 15673-15693 of SEQ ID NO:1); and <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -44- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -43- <br><br> motif I (amino acids 1285-1297 [LTSNGKVDRKALR] of SEQ ID NO:3, corresponding to nucleotide positions 15724-15762 of SEQ ID NO:1); <br><br> • an unknown domain, inserted between motifs G and H of the aminoacyl adenylate formation domain (amino acids 973-1256 of SEQ ID NO:3, corresponding to nucleotide positions 14788-15639 of SEQ ID NO:1); and <br><br> • a peptidyl carrier protein homologous domain (PCP), delineated by motif J (amino acids 1344-1351 [GATSIHIV] of SEQ ID NO:3, corresponding to nucleotide positions 15901-15924 of SEQ ID NO:1). <br><br> It is proposed that EPOS P is involved in the activation of a cysteine by adenylation, binding the activated cysteine as an aminoacyi-S-PCP, forming a peptide bond between the en-zyme-bound cysteine and the acetyl-S-ACP supplied by EPOS A, and the formation of the initial thiazoiine ring by intramolecular heterocyciization. The unknown domain of EPOS P displays very weak homologies to NAD(P)H oxidases and reductases from Bacillus species. Thus, this unknown domain and/or the ER domain of EPOS A may be involved in the oxidation of the initial 2-methylthiazoline ring to a 2-methylthiazoie. <br><br> epoB (nucleotides 16251-21749 of SEQ ID NO:1) codes for EPOS B (SEQ ID NO:4), a type I polyketide synthase consisting of a single module, and harboring the following domains: KS (nucleotides 16269-17546 of SEQ ID NO:1, amino acids 7-432 of SEQ ID NO:4); AT (nucleotides 17865-18827 of SEQ ID NO:1, amino acids 539-859 of SEQ ID NO:4); dehydratase (DH) (nucleotides 18855-19361 of SEQ ID NO:1, amino acids 869-1037 of SEQ ID NO:4); (3-ketoreductase (KR) (nucleotides 20565-21302 of SEQ ID NO:1, amino acids 1439-1684 of SEQ ID NO:4); and ACP (nucleotides 21414-21626 of SEQ ID NO:1, amino acids 1722-1792 of SEQ ID NO:4). Sequence comparisons and motif analysis reveal that the AT encoded by EPOS B is specific for methylmalonyl-CoA. EPOS A should be involved in the first polyketide chain extension by catalysing the Claisen-like condensation of the 2-methyl-4-thiazolecarboxyl-S-PCP starter group with the methylmalonyl-S-ACP, and the concomitant reduction of the b-keto group of C17 to an enoyl. <br><br> epcC (nucleotides 21746-43519 of SEQ ID NO:1) codes for EPOS C (SEQ ID NO:5), a type I polyketide synthase consisting of 4 modules. The first module harbors a KS (nucleotides 21860-23116 of SEQ ID NO:1, amino acids 39-457 of SEQ ID NO:5); a maionyl CoA-specific AT (nucleotides 23431 -24397 of SEQ ID NO:1, amino acids 563-884 of SEQ ID NO:5); a KR (nucleotides 25184-25942 of SEQ ID NO: 1, amino acids 1147-1399 of SEQ ID NO:5); and an ACP (nucleotides 26045-26263 of SEQ ID NO:1, amino acids 1434-1506 of <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -45- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -44- <br><br> SEQ ID NO:5). This module incorporates ari acetate extender unit (C14-C13) and reduces the p-keto group at C15 to the hydroxyl group that takes part in the final lactonization of the epothilone macrolactone ring. The second module of EPOS C harbors a KS (nucleotides 26318-27595 of SEQ ID NO:1, amino acids 1524-1950 of SEQ ID NO:5); a malonyl CoA-specific AT (nucleotides 27911-28876 of SEQ ID NO:1, amino acids 2056-2377 of SEQ ID NO:5); a KR (nucleotides 29678-30429 of SEQ ID NO:1, amino acids 2645-2895 of SEQ ID NO:5); and an ACP (nucleotides 30539-30759 of SEQ ID NO:1, amino acids 2932-3005 of SEQ ID NO:5). This module incorporates an acetate extender unit (C12-C11) and reduces the (3-keto group at C13 to a hydroxyl group. Thus, the nascent polyketide chain of epothilone corresponds to epothilone A, and the incorporation of the methyl side chain at C12 in epothilone B would require a post-PKS C-methyltransferase activity. The formation of the epoxi ring at C13-C12 would also require a post-PKS oxidation step. The third module of EPOS C harbors a KS (nucleotides 30815-32092 of SEQ ID NO:1, amino acids 3024-3449 of SEQ ID NO:5); a malonyl CoA-specific AT (nucleotides 32408-33373 of SEQ ID NO:1, amino acids 3555-3876 of SEQ ID NO:5); a DH (nucleotides 33401-33889 of SEQ ID NO:1, amino acids 3886-4048 of SEQ ID NO:5); an ER (nucleotides 35042-35902 of SEQ ID NO:1, amino acids 4433-4719 of SEQ ID NO:5); a KR (nucleotides 35930-36667 of SEQ ID NO:1, amino acids 4729-4974 of SEQ ID NO:5); and an ACP (nucleotides 36773-36991 of SEQ ID NO:1, amino acids 5010-5082 of SEQ ID NO:5). This module incorporates an acetate extender unit (C10-C9) and fully reduces the p-keto group at C11. The fourth module of EPOS C harbors a KS (nucleotides 37052-38320 of SEQ ID NO:1, amino acids 5103-5525 of SEQ ID NO:5); a methylmalonyl CoA-specific AT (nucleotides 38636-39598 of SEQ ID NO:1, amino acids 5631-5951 of SEQ ID NO:5); a DH (nucleotides 39635-40141 of SEQ ID NO:1, amino acids 5964-6132 of SEQ ID NO:5); an ER (nucleotides 41369-42256 of SEQ ID NO:1, amino acids 6542-6837 of SEQ ID NO:5); a KR (nucleotides 42314-43048 of SEQ ID NO:1, amino acids 6857-7101 of SEQ ID NO:5); and an ACP (nucleotides 43163-43378 of SEQ ID NO:1, amino acids 7140-7211 of SEQ ID NO:5). This module incorporates a propionate extender unit (C24 and C8-C7) and fully reduces the P-keto group at C9. <br><br> epoD (nucleotides 43524-54920 of SEQ ID NO:1) codes for EPOS D (SEQ ID NO:6), a type I polyketide synthase consisting of 2 modules. The first module harbors a KS (nucleotides 43626-44885 of SEQ ID NO:1, amino acids 35-454 of SEQ ID NO:6); a methylmalonyl CoA-specific AT (nucleotides 45204-46166 of SEQ ID NO:1, amino acids 561-881 of SEQ ID NO:6); a KR (nucleotides 46950-47702 of SEQ ID NO:1, amino acids <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -46- <br><br> WO 99/66028 PCT/EP99/04171 <br><br> -45- <br><br> 1143-1393 of SEQ ID NO:6); and an ACP (nucleotides 47811 -48032 of SEQ ID NO:1, amino acids 1430-1503 of SEQ ID NO:6). This module incorporates a propionate extender unit (C23 and C6-C5) and reduces the (J-keto group at C7 to a hydoxyl group. The second module harbors a KS (nucleotides 48087-49361 of SEQ ID NO:1, amino acids 1522-1946 of SEQ ID NO: 6); a methylmalonyl CoA-specific AT (nucleotides 49680-50642 of SEQ ID NO:1, amino acids 2053-2373 of SEQ ID NO:6); a DH (nucleotides 50670-51176 of SEQ ID NO:1, amino acids 2383-2551 of SEQ ID NO:6); a methyltransferase (MT, nucleotides 51534-52657 of SEQ ID NO:1, amino acids 2671-3045 of SEQ ID NO:6); a KR (nucleotides 53697-54431 of SEQ ID NO:1, amino acids 3392-3636 of SEQ ID NO:6); and an ACP (nucleotides 54540-54758 of SEQ ID NO:1, amino acids 3673-3745 of SEQ ID NO:6). This module incorporates a propionate extender unit (C21 or C22 and C4-C3) and reduces the |}-keto group at C5 to a hydoxyl group. This reduction is somewhat unexpected, since epothilones contain a keto group at C5. Discrepancies of this kind between the deduced reductive capabilities of PKS modules and the redox state of the corresponding positions in the final polyketide products have been, however, reported in the literature (see, for example, Schwecke, et al., Proc. Natl. Acad. Sci. USA 92:7839-7843 (1995) and Schupp, et al., FEMS Microbiology Letters 159: 201-207 (1998)). An important feature of epothilones is the presence of gem-methyl side groups at C4 (C21 and C22). The second module of EPOS D is predicted to incorporate a propionate unit into the growing polyketide chain, providing one methyl side chain at C4. This module also contains a methyltransferase domain integrated into the PKS between the DH and the KR domains, in an arrangement similar to the one seen in the HMWP1 yersiniabactin synthase (Gehring, A.M., DeMoll, E., Fetherston, J.D., Mori, I., Mayhew, G.F., Blattner, F.R., Walsh, C.T., and Perry, R.D.: Iron acquisition in plague: modular logic in enzymatic biogenesis of yersiniabactin by Yersinia pestis. Chem. Biol. 5, 573-586,1998). This MT domain in EPOS D is proposed to be responsible for the incorporation of the second methyl side group (C21 or C22) at C4. <br><br> epoE (nucleotides 54935-62254 of SEQ ID NO:1) codes for EPOS E (SEQ ID NO:7), a type I polyketide synthase consisting of one module, harboring a KS (nucleotides 55028-56284 of SEQ ID NO:1, amino acids 32-450 of SEQ ID NO:7); a malonyl CoA-specific AT (nucleotides 56600-57565 of SEQ ID NO:1, amino acids 556-877 of SEQ ID NO:7); a DH (nucleotides 57593-58087 of SEQ ID NO:1, amino acids 887-1051 of SEQ ID NO:7); a probably nonfunctional ER (nucleotides 59366-60304 of SEQ ID NO:1, amino acids 1478-1790 of SEQ ID NO:7); a KR (nucleotides 60362-61099 of SEQ ID NO:1, amino acids 1810-2055 <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -47- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -46- <br><br> of SEQ ID NO:7); an ACP (nucleotides 61211-61426 of SEQ ID NO:1. amino acids 2093-2164 of SEQ ID NO:7); and a thioesterase (TE) (nucleotides 61427-62254 of SEQ ID NO:1, amino acids 2165-2439 of SEQ ID NO:7). The ER domain in this module harbors an active site motif with some highly unusual amino acid substitutions that probably render this domain inactive. The module incorporates an acetate extender unit (C2-C1), and reduces the ()-keto at C3 to an enoyl group. Epothilones contain a hydroxyl group at C3, so this reduction also appears to be excessive as discussed for the second module of EPOS D. The TE domain of EPOS E takes part in the release and cyciization of the grown polyketide chain via lactonization between the carboxyl group of C1 and the hydroxy! group of C15. <br><br> Five ORFs are detected upstream of epoA in the sequenced region. The partially sequenced orfl has no homologues in the sequence databanks. The deduced protein product (Orf 2, SEQ ID NO: 10) of orfl (nucleotides 3171-1900 on the reverse complement strand of SEQ ID NO:1) shows strong similarities to hypothetical ORFs from Mycobacterium and Streptomyces coelicolor, and more distant similarities to carboxypeptidases and DD-peptidases of different bacteria. The deduced protein product of ort3 (nucleotides 3415-5556 of SEQ ID NO:1), Orf 3 (SEQ ID NO:11), shows homologies to Na/H antiporters of different bacteria. Orf 3 might take part in the export of epothilones.from the producer strain. orf4 and oh5 have no homologues in the sequence databanks. <br><br> Eleven ORFs are found downstream of epoE in the sequenced region. epoF (nucleotides 62369-63628 of SEQ ID NO:1) codes for EPOS F (SEQ ID NO:8), a deduced protein with strong sequence similarities to cytochrome P450 oxygenases. EPOS F may take part in the adjustment of the redox state of the carbons C12, C5, and/or C3. The deduced protein product of orfl 4 (nucleotides 67334-68251 of SEQ ID NO:1), Orf 14 (SEQ ID NO:22) shows strong similarities to G!:3293544, a hypothetic protein with no proposed function from Streptomyces coelicolor, and also to Gl:2654559, the human embrionic lung protein. It is also more distantly related to cation efflux system proteins like Gl:2623026 from Methano-bacterium thermoautotrophicum, so it might also take part in the export of epothilones from the producing cells. The remaining ORFs (orf6-orfl 3 and orfl 5) show no homologies to entries in the sequence databanks. <br><br> Example 13: Recombinant Expression of Epothilone Biosynthesis Genes <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -48- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -47- <br><br> Epothilone synthase genes according to the present invention are expressed in heterologous organisms for the purposes of epothilone production at greater quantities than can be accomplished by fermentation of Sorangium cellulosum. A preferable host for heterologous expression is Streptomyces, e.g. Streptomyces coelicolor, which natively produces the polyketide actinorhodin. Techniques for recombinant PKS gene expression in this host are described in McDaniel etal., Science262:1546-1550 (1993) and Kao etal., Science 265: 509-512 (1994). See also. Holmes etal., EMBO Journal 12(8): 3183-3191 (1993) and Bibb etal., Gene 38: 215-226 (1985), as well as U.S. Patent Nos. 5,521,077, 5,672,491, and 5,712,146, which are incorporated herein by reference. <br><br> According to one method, the heterologous host strain is engineered to contain a chromosomal deletion of the actinorhodin (act) gene cluster. Expression plasmids containing the epothilone synthase genes of the invention are constructed by transferring DNA from a temperature-sensitive donor plasmid to a recipient shuttle vector in E. coli (McDaniel et al. (1993) and Kao et al. (1994)), such that the synthase genes are built-up by homologous recombination within the vector. Alternatively, the epothilone synthase gene cluster is introduced into the vector by restriction fragment ligation. Following selection, e.g. as described in Kao et al. (1994), DNA from the vector is introduced into the acf-minus Streptomyces coelicolor strain according to protocols set forth in Hopwood etal., Genetic Manipulation of Streptomyces. A Laboratory Manual (John Innes Foundation, Norwich, United Kingdom, 1985), incorporated herein by reference. The recombinant Streptomyces strain is grown on R2YE medium (Hopwood et al. (1985)) and produces epothilones. Alternatively, the epothilone synthase genes according to the present invention are expressed in other host organisms such as pseudomonads, Bacillus, yeast, insect cells and/or E. coli. PKS and NRPS genes are preferably expressed in E. coli using the pT7-7 vector, which uses the T7 promoter. See, Tabor etal., Proc. Natl. Acad. Sci. USA 82:1074-1078 (1985). In another embodiment, the expression vectors pKK223-3 and pKK223-2 are used to express PKS and NRPS genes in E. coli, either in transcriptional or translation^ fusion, behind the tac or trc promoter. Expression of PKS and NRPS genes in heterologous hosts, which do not naturally have the phosphopantetheinyl (P-pant) transferases needed for posttranslational modification of PKS enzymes, requires the coexpression in the host of a P-pant transferase, as described by Kealey etal., Proc. Natl. Acad. Sci. USA 95: 505-509 (1998). <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -49- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -48- <br><br> Example 14: Isolation of Epothilones from Producing Strains <br><br> Examples of cultivation, fermentation, and extraction procedures for polyketide isolation, which are useful for extracting epothilones from both native and recombinant hosts according to the present invention, are given in WO 93/10121, incorporated herein by reference, in Example 57 of U.S. Patent No. 5,639,949, in Gerth et al., J. Antibiotics 49: 560-563 (1996), and in Swiss patent application no. 396/98, filed February 19,1996, and U.S. patent application no. 09/248,910 (that discloses also preferred mutant strains of Sorangium cellulosum), both of which are incorporated herein by reference. The following are procedures that are useful for isolating epothilones from cultured Sorangium cellulosum strains such as So ce90, and may also be used for the isolation of epothilone from recombinant hosts. <br><br> A: Cultivation of epothilone-producing strains: <br><br> Strain: <br><br> Sorangium cellulosum Soce-90 or a recombinant host strain according to the present invention. <br><br> Preservation of the strain: In liquid N2. <br><br> Media: <br><br> Precultures and intermediate cultures: G52 <br><br> Main culture: <br><br> 1612 <br><br> G52 Medium: <br><br> yeast extract, low in salt (BioSpringer, Maison Alfort, France) 2 g/l <br><br> MgS04 (7 HzO) <br><br> CaCI2 (2 H20) <br><br> soya meal defatted Soyamine 50T (Lucas Meyer, Hamburg, Germany) <br><br> potato starch Noredux A-150 (Blattmann, Waedenswil, <br><br> Switzerland) <br><br> glucose anhydrous <br><br> EDTA-Fe(lll)-Na salt (8 g/l) <br><br> 1 g/l 1 g/l <br><br> 2 g/l <br><br> 8 g/l 2 g/l 1 ml/I <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -50- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -49- <br><br> pH 7.4, corrected with KOH Sterilisation: 20 mins. 120 °C <br><br> 1B12 Medium: <br><br> potato starch Noredux A-150 (Blattmann, Waedenswil, <br><br> Switzerland) 20 g/l soya meal defatted Soyamine 50T (Lucas Meyer, Hamburg, <br><br> Germany) 11 g/l <br><br> EDTA-Fe(lll)-Na salt 8 mg/l pH 7.8, corrected with KOH Sterilisation: 20 mins. 120 °C <br><br> Addition of cvclodextrins and cvclodextrin derivatives: <br><br> Cyclodextrins (Fluka, Buchs, Switzerland, or Wacker Chemie, Munich, Germany) in different concentrations are sterilised separately and added to the 1B12 medium prior to seeding. <br><br> Cultivation: 1 ml of the suspension of Sorangium cellulosum Soce-90 from a liquid N2 ampoule is transferred to 10 ml of G52 medium (in a 50 ml Erlenmeyer flask) and incubated for 3 days at 180 rpm in an agitator at 30°C, 25 mm displacement. 5 ml of this culture is added to 45 ml of G52 medium (in a 200 ml Erlenmeyer flask) and incubated for 3 days at 180 rpm in an agitator at 30°C, 25 mm displacement. 50 ml of this culture is then added to 450 ml of G52 medium (in a 2 litre Erlenmeyer flask) and incubated for 3 days at 180 rpm in an agitator at 30°C, 50 mm displacement. <br><br> Maintenance culture: The culture is overseeded every 3-4 days, by adding 50 ml of culture to 450 ml of G52 medium (in a 2 litre Erlenmeyer flask). All experiments and fermentations are carried out by starting with this maintenance culture. <br><br> Tests in a flask: <br><br> Jh Preculture in an agitating flask: <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -51- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -50- <br><br> Starting with the 500 ml of maintenance culture, 1 x 450 ml of G52 medium are seeded with 50 mi of the maintenance culture and incubated for 4 days at 180 rpm in an agitator at 30°C, 50 mm displacement. <br><br> (ifl Main culture in the agitating flask: <br><br> 40 mi of 1B12 medium plus 5 g/l 4-morpholine-propane-sulfonic acid (= MOPS) powder (in a 200 mi Erlenmeyer flask) are mixed with 5 ml of a 10x concentrated cyclodextrin solution, seeded with 10 ml of preculture and incubated for 5 days at 180 rpm in an agitator at 30°C, 50 mm displacement. <br><br> Fermentation: Fermentations are carried out on a scale of 10 litres, 100 litres and 500 litres. 20 litre and 100 litre fermentations serve as an intermediate culture step. Whereas the pre-cuttures and intermediate cultures are seeded as the maintenance culture 10% (v/v), the main cultures are seeded with 20% (v/v) of the intermediate culture. Important: In contrast to the agitating cultures, the ingredients of the media for the fermentation are calculated on the final culture volume including the inoculum. If, for example, 18 litres of medium + 2 litres of inoculum are combined, then substances for 20 litres are weighed in, but are only mixed with 18 litres. <br><br> Preculture in an agitating flask: <br><br> Starting with the 500 ml maintenance culture, 4 x 450 ml of G52 medium (in a 2 litre Erlenmeyer flask) are each seeded with 50 ml thereof, and incubated for 4 days at 180 rpm in an agitator at 30°C, 50 mm displacement. <br><br> Intermediate culture. 20 litres or 100 litres: <br><br> 20 litres: 18 litres of G52 medium in a fermenter having a total volume of 30 litres are seeded with 2 litres of the preculture. Cultivation lasts for 3-4 days, and the conditions are: 30°C, 250 rpm, 0.5 litres of air per litre liquid per min, 0.5 bars excess pressure, no pH control. <br><br> 100 litres: 90 litres of G52 medium in a fermenter having a total volume of 150 litres are seeded with 10 litres of the 20 litre intermediate culture. Cultivation lasts for 3-4 days, and the conditions are: 30°C, 150 rpm, 0.5 litres of air per litre liquid per min, 0.5 bars excess pressure, no pH control. <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -52- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -51 - <br><br> Main culture. 10 litres. 100 litres or 500 litres: <br><br> 10 litres: The media substances for 10 litres of 1B12 medium are sterilised in 7 litres of water, then 1 litre of a sterile 10% 2-(hydroxypropyl) -P-cyclodextrin solution are added, and seeded with 2 litres of a 20 litre intermediate culture. The duration of the main culture is 6-7 days, and the conditions are: 30°C, 250 rpm, 0.5 litres of air per litre of liquid per min, 0.5 bars excess pressure, pH control with H2SO4/KOH to pH 7.6 +/- 0.5 (i.e. no control between pH 7.1 and 8.1). <br><br> 100 litres: The media substances for 100 litres of 1B12 medium are sterilised in 70 litres of water, then 10 litres of a sterile 10% 2-(hydroxypropyl) -p-cyclodextrin solution are added, and seeded with 20 litres of a 20 litre intermediate culture. The duration of the main culture is 6-7 days, and the conditions are: 30°C, 200 rpm, 0.5 litres air per litre liquid per min., 0.5 bars excess pressure. pH control with H2SO4/KOH to pH 7.6 +/- 0.5. The chain of seeding for a 100 litre fermentation is shown schematically as follows: <br><br> maintenance culture (500ml) <br><br> G52 medium <br><br> 10% <br><br> 10% <br><br> precultures (4 x 500 ml) G52 medium <br><br> 10% <br><br> intermediate culture (e.g. 20 I) G52 medium <br><br> 20% <br><br> maintenance culture (500 ml) G52 medium main culture (e.g. 1001) medium + HP-p-CD <br><br> 500 litres: The media substances for 500 litres of 1B12 medium are sterilised in 350 litres of water, then 50 litres of a sterile 10% 2-(hydroxypropyi) -p-cyclodextrin solution are added, and seeded with 100 litres of a 100 litre intermediate culture. The duration of the main culture is 6-7 days, and the conditions are: 30°C, 120 rpm, 0.5 litres air per litre liquid per min., 0.5 bars excess pressure, pH control with H2SO«/KOH to pH 7.6 +/- 0.5. <br><br> Product analysis: <br><br> Preparation of the sample: <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -53- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -52- <br><br> 50 ml samples are mixed with 2 ml of polystyrene resin Amberlite XAD16 (Rohm + Haas, Frankfurt, Germany) and shaken at 180 rpm for one hour at 30°C. The resin is subsequently filtered using a 150 pm nylon sieve, washed with a little water and then added together with the filter to a 15 ml Nunc tube. <br><br> Elution of the product from the resin: <br><br> 10 ml of isopropanol (&gt;99%) are added to the tube with the filter and the resin. Afterwards, the sealed tube is shaken for 30 minutes at room temperature on a Rota-Mixer (Labinco BV, Netherlands). Then, 2 ml of the liquid are centrifuged off and the supernatant is added using a pipette to HPLC tubes. <br><br> HPLC analysis: <br><br> Column: <br><br> Solvents: <br><br> Gradient: <br><br> Oven temp.: <br><br> Detection: <br><br> Injection vol.: <br><br> Retention time: <br><br> Waters-Symetry C18, 100 x 4 mm, 3.5 pm WAT066220 + preliminary column 3.9 x 20 mm WAT054225 <br><br> A: 0.02 % phosphoric acid B: Acetonitrile (HPLC-Quality) 41 % B from 0 to 7 min. <br><br> 100% B from 7.2 to 7.8 min. <br><br> 41 % B from 8 to 12 min. <br><br> 30°C <br><br> 250 nm, UV-DAD detection 10 pi <br><br> Epo A: 4.30 min Epo B: 5.38 min <br><br> B: Effect of the addition of cvclodextrin and cvclodextrin derivatives to the epothilone concentrations attained. <br><br> Cyclodextrins are cyclic (a-1,4)-linked oligosaccharides of a-D-glucopyranose with a relatively hydrophobic central cavity and a hydrophilic external surface area. <br><br> The following are distinguished in particular (the figures in parenthesis give the number of glucose units per molecule): a-cyclodextrin (6), p-cyclodextrin (7), y- cyclodextrin (8), 5-cyclodextrin (9), e- cyclodextrin (10), £-cyclodextrin (11), ri-cyclodextrin (12), and 6-cyclodextrin (13). Especially preferred are 5-cyclodextrin and in particular a-cyclodextrin, |3-cyclodextrin or y-cyclodextrin, or mixtures thereof. <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -54- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -53- <br><br> Cyclodextrin derivatives are primarily derivatives of the above-mentioned cyclodextrins, especially of a-cyclodextrin, p-cyclodextrin or y-cyclodextrin, primarily those in which one or more up to all of the hydroxy groups (3 per glucose radical) are etherified or este-rified. Ethers are primarily alkyl ethers, especially lower alkyl, such as methyl or ethyl ether, also propyl or butyl ether; the aryl-hydroxyalkyl ethers, such as phenyl-hydroxy-lower-alkyl, especially phenyl-hydroxyethyl ether; the hydroxyalkyl ethers, in particular hydroxy-lower-alkyl ethers, especially 2-hydroxyethyl, hydroxypropyl such as 2-hydroxypropyl or hydroxy-butyl such as 2-hydroxybutyl ether; the carboxyalkyl ethers, in particular carboxy-lower-alkyl ethers, especially carboxymethyl or carboxyethyl ether; derivatised carboxyalkyl ethers, in particular derivatised carboxy-lower-alkyl ether in which the derivatised carboxy is etherified or amidated carboxy (primarily aminocarbonyl, mono- or di-lower-alkyl-aminocarbonyl, mor-pholino-, piperidino-, pyrrolidine)- or piperazino-carbonyl, or alkyloxycarbonyl), in particular lower alkoxycarbonyl-lower-alkyl ether, for example methyloxycarbonylpropyl ether or ethyloxycarbonylpropyl ether; the sulfoalkyl ethers, in particular suifo-lower-alkyl ethers, especially sulfobutyl ether; cyclodextrins in which one or more OH groups are etherified with a radical of formula <br><br> -0-[alk-0-]„-H <br><br> wherein alk is alkyl, especially lower alkyl, and n is a whole number from 2 to 12, especially 2 to 5, in particular 2 or 3; cyclodextrins in which one or more OH groups are etherified with a radical of formula <br><br> R' <br><br> I 0 <br><br> (Alk-O)- Alk ^ <br><br> / Y <br><br> wherein R' is hydrogen, hydroxy, -0-(alk-0)i-H, -0-(alk(-R)-0-)p-H or -0-(alk(-R)-0-)q-alk-C0-Y; alk in all cases is alkyl, especially lower alkyl; m, n, p, q and z are a whole number from 1 to 12, preferably 1 to 5, in particular 1 to 3; and Y is ORi or NR2R3, wherein Ri, Rz and R3 independently of one another, are hydrogen or lower alkyl, or R2 and R3 combined together with the linking nitrogen signify morphoiino, piperidino, pyrroiidino or piperazino; <br><br> or branched cyclodextrins, in which etherifications or acetals with other sugar molecules are present, especially glucosyl-, diglucosyl- (G2-p-cyclodextrin), maltosyl- or dimaltosyl-cyclodextrin, or N-acetylglucosaminyl-, glucosaminyl-, N-acetylgalactosaminyl- or galactosaminyl-cyclodextrin. <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -55- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -54- <br><br> Esters are primarily alkanoyl esters, in particular lower alkanoyi esters, such as acetyl esters of cyclodextrins. <br><br> It is also possible to have cyclodextrins in which two or more different said ether and ester groups are present at the same time. <br><br> Mixtures of two or more of the said cyclodextrins and/or cyclodextrin derivatives may also exist. <br><br> Preference is given in particular to a-, (J- or ^cyclodextrins or the lower alkyl ethers thereof, such as methyl-p-cyclodextrin or in particular 2,6-di-O-methyl-fS-cyclodextrin, or in particular the hydroxy lower alkyl ethers thereof, such as 2-hydroxypropyl-a- 2-hydroxy-propyl-fi- or 2-hydroxypropyl-Y-cyclodextrin. <br><br> The cyclodextrins or cyclodextrin derivatives are added to the culture medium preferably in a concentration of 0.02 to 10, preferably 0.05 to 5, especially 0.1 to 4, for example 0.1 to 2 percent by weight (w/v). <br><br> Cyclodextrins or cyclodextrin derivatives are known or may be produced by known processes (see for example US 3,459,731; US 4,383,992; US 4,535,152; US 4,659,696; EP 0 094 157; EP 0 149 197; EP 0 197 571; EP 0 300 526; EP 0 320 032; EP 0 499 322; EP 0 503 710; EP 0 818 469; WO 90/12035; WO 91/11200; WO 93/19061; WO 95/08993; WO 96/14090; GB 2,189,245; DE 3,118,218; DE 3,317,064 and.the references mentioned therein, which also refer to the synthesis of cyclodextrins or cyclodextrin derivatives, or also: T. Loftsson and M.E. Brewster (1996): Pharmaceutical Applications of Cyclodextrins: Drug Solubilization and Stabilisation: Journal of Pharmaceutical Science 85 (10):1017-1025; R.A. Rajewski and V.J. Stella(1996): Pharmaceutical Applications of Cyclodextrins: In Vivo Drug Delivery: Journal of Pharmaceutical Science 85 (11): 1142-1169). <br><br> All the cyclodextrin derivatives tested here are obtainable from the company Fluka, Buchs, CH. The tests are carried out in 200 ml agitating flasks with 50 ml culture volume. As controls, flasks with adsorber resin Amberlite XAD-16 (Rohm &amp; Haas, Frankfurt, Germany) and without any adsorber addition are used. After incubation for 5 days, the following epothilone titres can be determined by HPLC: <br><br> Table 2: <br><br> Addition order No. <br><br> Cone <br><br> ["/oW/v]1 <br><br> Epo A [mg/l] <br><br> Epo B [mg/l] <br><br> Amberlite XAD-16 (v/v) <br><br> 2.0 (%v/v) <br><br> 9.2 <br><br> 3.8 <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -56- <br><br> WO 99/66028 <br><br> -55- <br><br> PCT/EP99/04171 <br><br> Addition order No. <br><br> Cone [%w/v]' <br><br> Epo A [mg/l] <br><br> Epo B [mg/l] <br><br> 2-hydroxypropyl-p-cyclodextrin <br><br> 56332 <br><br> 0.1 <br><br> 2.7 <br><br> 1.7 <br><br> 2-hydroxypropyl-p-cyclodextrin <br><br> II <br><br> 0.5 <br><br> 4.7 <br><br> 3.3 <br><br> 2-hydroxypropyl-p-cyclodextrin <br><br> II <br><br> 1.0 <br><br> 4.7 <br><br> 3.4 <br><br> 2-hydroxypropyl-p-cyclodextrin <br><br> 11 <br><br> 2.0 <br><br> 4.7 <br><br> 4.1 <br><br> 2-hydroxypropyl-p-cyclodextrin <br><br> II <br><br> 5.0 <br><br> 1.7 <br><br> 0.5 <br><br> 2-hydroxypropyl- a-cyclodextrin <br><br> 56330 <br><br> 0.5 <br><br> 1.2 <br><br> 1.2 <br><br> 2-hydroxypropyl- a-cyclodextrin <br><br> M <br><br> 1.0 <br><br> 1.2 <br><br> 1.2 <br><br> 2-hydroxypropyl- a-cyciodextrin <br><br> II <br><br> 5.0 <br><br> 2.5 <br><br> 2.3 <br><br> P-cyclodextrin <br><br> 28707 <br><br> 0.1 <br><br> 1.6 <br><br> 1.3 <br><br> p-cyclodextrin ll <br><br> 0.5 <br><br> 3.6 <br><br> 2.5 <br><br> P-cyclodextrin u <br><br> 1.0 <br><br> 4.8 <br><br> 3.7 <br><br> P-cyciodextrin u <br><br> 2.0 <br><br> 4.8 <br><br> 2.9 <br><br> P-cyclodextrin <br><br> II <br><br> 5.0 <br><br> 1.1 <br><br> 0.4 <br><br> methyl-p-cyclodextrin <br><br> 66292 <br><br> 0.5 <br><br> 0.8 <br><br> &lt;0.3 <br><br> methyl-p-cyclodextrin u <br><br> 1.0 <br><br> &lt;0.3 <br><br> &lt;0.3 <br><br> methyl-p-cyclodextrin <br><br> II <br><br> 2.0 <br><br> &lt;0.3 <br><br> &lt;0.3 <br><br> 2,6 di-o-methyl-p-cyclodextrin <br><br> 39915 <br><br> 1.0 <br><br> &lt;0.3 <br><br> &lt;0.3 <br><br> 2-hydroxypropyl-y-cyclodextrin <br><br> 56334 <br><br> 0.1 <br><br> 0.3 <br><br> &lt;0.3 <br><br> 2-hydroxypropyl-y-cyclodextrin <br><br> II <br><br> 0.5 <br><br> 0.9 <br><br> 0.8 <br><br> 2-hydroxypropyl-y-cyclodextrin ll <br><br> 1.0 <br><br> 1.1 <br><br> 0.7 <br><br> 2-hydroxypropyi-y-cyclodextrin u <br><br> 2.0 <br><br> 2.6 <br><br> 0.7 <br><br> 2-hydroxypropyl-y-cyclodextrin u <br><br> 5.0 <br><br> 5.0 <br><br> 1.1 <br><br> no addition <br><br> 0.5 <br><br> 0.5 <br><br> 1) Apart from Amberlite (%v/v), all percentages are by weight (%w/v). <br><br> Few of the cyclodextrins tested (2,6-di-o-methyl-p-cyclodextrin, methyl-p-cyclodextrin) display no effect or a negative effect on epothilone production at the concentrations used. 1 -2% 2-hydroxy-propyl-p-cyclodextrin and p-cyclodextrin increase epothilone production in the examples by 6 to 8 times compared with production using no cyclodextrins. <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -57- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -56- <br><br> C: 10 litre fermentation with 1% 2-fhvdroxvpropvn-B-cvclodextrinl: <br><br> Fermentation is carried out in a 15 litre glass fermenter. The medium contains 10 g/l of 2-(hydroxypropyl)-p-cyclodextrin from Wacker Chemie, Munich, Germany. The progress of fermentation is illustrated in Table 3. Fermentation is ended after 6 days and working up takes place. <br><br> Table 3: Progress of a 10 litre fermentation duration of culture [d] <br><br> Epothilone A [mg/l] <br><br> Epothilone B [mg/l] <br><br> 0 <br><br> 0 <br><br> 0 <br><br> 1 <br><br> 0 <br><br> 0 <br><br> 2 <br><br> 0.5 <br><br> 0.3 <br><br> 3 <br><br> 1.8 <br><br> 2.5 <br><br> 4 <br><br> 3.0 <br><br> 5.1 <br><br> 5 <br><br> 3.7 <br><br> 5.9 <br><br> 6 <br><br> 3.6 <br><br> 5.7 <br><br> D: 100 litre fermentation with 1% 2-(hvdroxvpropvh-6-cvclodextrin): <br><br> Fermentation is carried out in a 150 litre fermenter. The medium contains 10 g/l of 2-(Hydroxypropyl)-p-cyclodextrin. The progress of fermentation is illustrated in Table 4. The fermentation is harvested after 7 days and worked up. <br><br> Table 4: Progress of a 100 litre fermentation duration of <br><br> Epothilone A <br><br> Epothilone B <br><br> culture [d] <br><br> [mg/l] <br><br> [mg/l] <br><br> 0 <br><br> 0 <br><br> 0 <br><br> 1 <br><br> 0 <br><br> 0 <br><br> 2 <br><br> 0.3 <br><br> 0 <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -58- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -57- <br><br> 3 <br><br> 0.9 <br><br> 1.1 <br><br> 4 <br><br> 1.5 <br><br> 2.3 <br><br> 5 <br><br> 1.6 <br><br> 3.3 <br><br> 6 <br><br> 1.8 <br><br> 3.7 <br><br> 7 <br><br> 1.8 <br><br> 3.5 <br><br> E: 500 litre fermentation with 1% 2-fhvdroxvpropvh-B-cvclodextrin): <br><br> Fermentation is carried out in a 750 litre fermenter. The medium contains 10 g/l of 2-(Hydroxypropyl)-p-cyclodextrin. The progress of fermentation is illustrated in Table 5. The fermentation is harvested after 7 days and worked up. <br><br> Table 5: Progress of a 500 litre fermentation duration of culture [d] <br><br> Epothilone A [mg/l] <br><br> Epothilone B [mg/l] <br><br> 0 <br><br> 0 <br><br> 0 <br><br> 1 <br><br> 0 <br><br> 0 <br><br> 2 <br><br> 0 <br><br> 0 <br><br> 3 <br><br> 0.5 <br><br> 0.6 <br><br> 4 <br><br> 1.7 <br><br> 2.2 <br><br> 5 <br><br> 3.1 <br><br> 4.5 <br><br> 6 <br><br> 3.1 <br><br> 5.1 <br><br> F: Comparison example 10 litre fermentation without adding an adsorber: <br><br> Fermentation is carried out in a 15 litre glass fermenter. The medium does not contain any cyclodextrin or other adsorber. The progress of fermentation is illustrated in Table 6. The fermentation is not harvested and worked up. <br><br> Table 6: Progress of a 10 litre fermentation without adsorber. . <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -59- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -58- <br><br> duration of culture [d] <br><br> Epothilone A [mg/l] <br><br> Epothilone B [mg/l] <br><br> 0 <br><br> 0 <br><br> 0 <br><br> 1 <br><br> 0 <br><br> 0 <br><br> 2 <br><br> 0 <br><br> 0 <br><br> 3 <br><br> 0 <br><br> 0 <br><br> 4 <br><br> 0.7 <br><br> 0.7 <br><br> 5 <br><br> 0.7 <br><br> 1.0 <br><br> 6 <br><br> 0.8 <br><br> 1.3 <br><br> G: Working up of the epothilones: Isolation from a 500 litre main culture: <br><br> The volume of harvest from the 500 litre main culture of example 2D is 450 litres and is separated using a Westfafia clarifying separator Type SA-20-06 (rpm = €500) into the liquid phase (centrifugate + rinsing water = 650 litres) and solid phase (cells = ca. 15 kg). The main part of the epothilones are found in the centrifugate, The centrifuged cell pulp contains &lt; 15% of the determined epothilone portion and is not further processed. The 650 litre centrifugate is then placed in a 4000 litre stirring vessel, mixed with 10 litres of Amberlite XAD-16 (centrifugate:resin volume = 65:1) and stirred. After a period of contact of ca. 2 hours, the resin is centrifuged away in a Heine overflow centrifuge (basket content 40 litres; rpm = 2800). The resin is discharged from the centrifuge and washed with 10-15 litres of deionised water. Desorption is effected by stirring the resin twice, each time in portions with 30 litres of isopropanol in 30 litre glass stirring vessels for 30 minutes. Separation of the isopropanol phase from the resin takes place using a suction filter. The isopropanol is then removed from the combined isopropanol phases by adding 15-20 litres of water in a vacuum-operated circulating evaporator (Schmid-Verdampfer) and the resulting water phase of ca. 10 litres is extracted 3x each time with 10 litres of ethyl acetate. Extraction is effected in 30 litre glass stirring vessels. The ethyl acetate extract is concentrated to 3-5 litres in a vacuum-operated circulating evaporator (Schmid-Verdampfer) and afterwards concentrated to dryness in a rotary evaporator (Buchi type) under vacuum. The result is an ethyl acetate extract of 50.2 g. The ethyl acetate extract is dissolved in <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -60- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -59- <br><br> 500 ml of methanol, the insoluble portions filtered off using a folded filter, and the solution added to a 10 kg Sephadex LH 20 column (Pharmacia, Uppsala, Sweden) (column diameter 20 cm, filling level ca. 1.2 m). Elution is effected with methanol as eluant. Epothilone A and B is present predominantly in fractions 21-23 (at a fraction size of 1 litre). These fractions are concentrated to dryness in a vacuum on a rotary evaporator (total weight 9.0 g). These Sephadex peak fractions (9.0 g) are thereafter dissolved in 92 ml of acetonitrile:-water:-methylene chloride = 50:40:2, the solution filtered through a folded filter and added to a RP column (equipment Prepbar 200, Merck; 2. 0 kg LiChrospher RP-18 Merck, grain size 12p.m, column diameter 10 cm, filling level 42 cm; Merck, Darmstadt, Germany). Elution is effected with acetonitrile:water = 3:7 (flow rate = 500 ml/min.; retention time of epothilone A = ca. 51-59 mins.; retention time of epothilone B = ca. 60-69 mins.). Fractionation is monitored with a UV detector at 250 nm. The fractions are concentrated to dryness under vacuum on a Buchi-Rotavapor rotary evaporator. The weight of the epothilone A peak fraction is 700 mg, and according to HPLC (external standard) it has a content of 75.1%. That of the epothilone B peak fraction is 1980 mg, and the content according to HPLC (external standard) is 86.6%. Finally, the epothilone A fraction (700 mg) is crystallised from 5 ml of ethyl acetate:toiuene = 2:3, and yields 170 mg of epothilone A pure crystallisate [content according to HLPC (% of area) = 94.3%]. Crystallisation of the epothilone B fraction (1980 mg) is effected from 18 ml of methanol and yields 1440 mg of epothilone B pure crystallisate [content according to HPLC (% of area) = 99.2%]. m.p. (Epothilone B): e.g. 124-125 °C; 'H-NMR data for Epothilone B: <br><br> 500 MHz-NMR, solvent: DMSO-d6. Chemical displacement § in ppm relative to TMS. s = singlet; d = doublet; m = multiplet <br><br> 8 (Multiplicity) Integral (number of H) <br><br> 7.34 (s) 1 <br><br> 6.50 (s) 1 <br><br> 5.28 (d) 1 <br><br> 5.08 (d) 1 <br><br> 4.46 (d) 1 <br><br> 4.08 (m) 1 <br><br> Printed from Mimosa 03/20/2002 15:55:45 page <br><br> -61- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -60- <br><br> 3.47 <br><br> (m) <br><br> 1 <br><br> 3.11 <br><br> (m) <br><br> 1 <br><br> 2.83 <br><br> (dd) <br><br> 1 <br><br> 2.64 <br><br> (s) <br><br> 3 <br><br> 2.36 <br><br> (m) <br><br> 2 <br><br> 2.09 <br><br> (s) <br><br> 3 <br><br> 2.04 <br><br> (m) <br><br> 1 <br><br> 1.83 <br><br> (m) <br><br> 1 <br><br> 1.61 <br><br> (m) <br><br> 1 <br><br> 1.47-1.24 (m) <br><br> 4 <br><br> 1.18 <br><br> (s) <br><br> 6 <br><br> 1.13 <br><br> (m) <br><br> 2 <br><br> 1.06 <br><br> • (d) <br><br> 3 <br><br> 0.89 (d + s, overlapping) <br><br> 6 <br><br> 1 = 41 <br><br> Example 15: Medical Uses of Recombinantiy Produced Epothilones <br><br> Pharmaceutical preparations or compositions comprising epothilones are used for example in the treatment of cancerous diseases, such as various human solid tumors. <br><br> Such anticancer formulations comprise, for example, an active amount of an epothilone together with one or more organic or inorganic, liquid or solid, pharmaceutically suitable carrier materials. Such formulations are delivered, for example, enterally, nasally, rectally, orally, or parenteraliy, particularly intramuscularly or intravenously. The dosage of the active ingredient is dependent upon the weight, age, and physical and pharmacokinetical condition of the patient and is further dependent upon the method of delivery. Because epothilones mimic the biological effects of taxol, epothilones may be substituted for taxol in compositions and methods utilizing taxol in the treatment of cancer. See, for example, U.S. <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -62- <br><br> WO 99/66028 <br><br> PCT/EP99/04171 <br><br> -61 - <br><br> Patent Nos. 5,496,804, 5,565,478, and 5,641,803, all of which are incorporated herein by reference. <br><br> For example, for treatments, epothilone B is supplied in individual 2 ml glass vials formulated as 1 mg/1 mi of clear, colorless intravenous concentrate. The substance is formulated in polyethylene glycol 300 (PEG 300) and diluted with 50 or 100 ml 0.9% <br><br> Sodium Chloride Injection, USP, to achieve the desired final concentration of the drug for infusion. It is administered as a single 30-minute intravenous infusion every 21 days (treatment three-weekly) for six cycles, or as a single 30-minute intravenous infusion every 7 days (weekly treatment). <br><br> Preferably, for weekly treatment, the dose is between about 0.1 and about 6, preferably about 0.1 and about 5 mg/m2, more preferably about 0.1 and about 3 mg/m2, even more preferably 0.1 and 1.7 mg/m2, most preferably about 0.3 and about 1 mg/mz; for three-weekly treatment (treatment every three weeks or every third week) the dose is between about 0.3 and about 18 mg/m2, preferably about 0.3 and about 15 mg/m2, more preferably about 0.3 and about 12 mg/m2, even more preferably about 0.3 and about 7.5 mg/m2, still more preferably about 0.3 and about 5 mg/m2, most preferably about 1.0 and about 3.0 mg/m2. This dose is preferably administered to the human by intravenous (i.v.) administration during 2 to 180 min, preferably 2 to 120 min, more preferably during about 5 to about 30 min, most preferably during about 10 to about 30 min, e.g. during about 30 min. <br><br> While the present invention has been described with reference to specific embodiments thereof, it will be appreciated that numerous variations, modifications, and embodiments are possible, and accordingly, all such variations, modifications and embodiments are to be regarded as being within the spirit and scope of the present invention. <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -63- <br><br> WO 99/66028 <br><br> - 62 - <br><br> PCT/EP99/04171 <br><br> BUDAPEST TREAT* OH THE INTERNATIONAL RECOGNITION OF THE DEPOSIT OF MICROORGANISMS FOR THE PURPOSE OF PATENT PROCEDURES <br><br> INTERNATIONAL FORK <br><br> TO <br><br> Novartis AG <br><br> Novartis Corporation <br><br> Patent and Trademark Dept. <br><br> 3054 Cornwall!? Rd. <br><br> Research Triangle Park, NC 27709 <br><br> NAME AND ADDRESS OF DEPOSITOR <br><br> RECEIPT IN THE CASE OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by the INTERNATIONAL DEPOSITARY AUTHORITY identified at the bottom of this paga <br><br> I. IDENTIFICATION OF THE HICROQROANISH <br><br> Identification reference given by the DEPOSITORI <br><br> Zaaberlahia aali DH1QB [pEPOlS) <br><br> Accession number given by the INTERNATIONAL DEPOSITARY AUTHORITY: <br><br> NRRL B—30033 <br><br> II. SCIENTIFIC DESCRIPTION AND/OR PROPOSED TAXONOHIC DESIGNATION <br><br> Tha microorganism identified under I. above was accompanied byi PI " soientific daseription <br><br> ET! a proposed taxonomic designation <br><br> (Mark with a cross where applicable! <br><br> XII. RECEIPT AND ACCEPTANCE <br><br> This International Depositary Authority aaeapta the microorganism identified under I. above, which was received by it on June ll, 199a(date of the original deposit)' <br><br> IV. RECEIPT OF REQUEST FOR CONVERSION <br><br> The microorganism identified under I. above was received by this International Depositary Authority on (date of the original deposit) and a request to convert the original deposit to a deposit under the Budapest Treaty was reaelved by it an (date of rBoelpt of request for conversion). <br><br> V. INTERNATIONAL DEPOSITARY AUTHORITY <br><br> Name; Agricultural Research Culture Collection (NRRL) <br><br> International Depositary Authority <br><br> AddresBt IBIS V. University Street Peoria. IllinolB 61604 U.S.A. <br><br> 8lgnature(s) of person!a) having tha power to represent the International Depositary Authority or of ^authorised official(b); <br><br> Date, 7-"-^ <br><br> of au /* <br><br> 1 Whera Rule 6.4(d) applies, such date la the date on which the status of international depositary authority was acquired. <br><br> Printed from Mimosa 03/20/2002 15:55:45 page -64- <br><br></p> </div>

Claims (1)

  1. <div class="application article clearfix printTableText" id="claims"> <p lang="en"> WO 99/66028<br><br> - 63 -<br><br> PCT/EP99/04171<br><br> BUDAPEST TBBXTX OB TBS iVIkSBUIOUUi RECOGNITION OF THE DEPOSIT OF MXCROOHGWHSISS FOR THE PURPOSE OF PATENT PROCEDURES<br><br> INTiiKNAXiUHAL FORM<br><br> TO<br><br> Rovatis JU3<br><br> c/o Bnaztls Agriculcural Biotechnology<br><br> Research, inc.<br><br> Patent &amp; Trademark Deportmezit 3054 Connrallis Road Research Triangle Park, RC 27709 HAKE ASD ADDRESS<br><br> of depositor<br><br> RECEIPT IN THE CASS OF AN ORIGINAL DEPOSIT issued pursuant to Rule 7.1 by tha INTERNATIONAL DEPOSITARY AUTHORITY<br><br> identified at the bottom of this page i. identification of tub mickoorgakism<br><br> Identification reference given by the depositor:<br><br> BseheriChia coli DH10B [pBP033]<br><br> Accession number given by the IHTEHHATIOHAL DEPOSITARY ADTHORIT*:;HKRL B-30119;ii. bumrrlfic descriptiok and/or proposed tmcqmokic designation;The microorganism identified under I. above was accompanied by: □ a scientific description;H a proposed taxonomic designation;(Mark vith a cross where applicable);III. RECEIPT AHD ACCEPTANCE;This International Depositary Authority accepts the microorganism identified under I. above, which was received by it on April 16, 1999 (date of the original deposit)1;iv. receipt of request for cobtorsiok;The microorganiam identified under I. above was received by this international Depositaxy Authority on (date of the original deposit) and a request;CO convert the original deposit to a deposit under the Budapest Treaty was received by it en (date of receipt of request for conversion).;DmnawnomL depositary authority samei Agricultural Research Culture Collection (NRRL);International Depositary Authority;Address: 1815 K. University Street;Peoria. Illinois 61604 U.S.A.;Signature(s) of person(b) having the power to represent the International Depositary Authority or of authorieed official (s):;Date:;?-g(- il;1 Where Rule 6.4(d) applies, such date is the date on which the status of international depositary authority was acquired.;Printed from Mimosa 03/20/2002 15:55:45 page -65-;Case 4-30582A;-62-;What is claimed is:;1. An isolated nucleic acid molecule comprising a nucleotide sequence that encodes at least one polypeptide involved in the biosynthesis of epothilone, wherein the complement of said nucleotide sequence hybridizes to a nucleotide sequence selected from the group consisting of: the complement of nucleotides 1900-3171 of SEQ ID NO:1, nucleotides 3415-5556 of SEQ ID NO:1, nucleotides 7610-11875 of SEQ ID NO:1, nucleotides 7643-8920 of SEQ ID NO:1, nucleotides 9236-10201 of SEQ ID NO: 1, nucleotides 10529-11428 of SEQ ID NO:1, nucleotides 11549-11764 of SEQ ID NO:1, nucleotides 11872-16104 of SEQ ID NO:1, nucleotides 12085-12114 of SEQ ID NO:1, nucleotides 12223-12246 of SEQ ID NO:1, nucleotides 12466-12507 of SEQ ID NO:1, nucleotides 12928-12960 of SEQ ID NO:1,;nucleotides 13516-13566 of SEQ ID NO:1 nucleotides 13876-13923 of SEQ ID NO:1 nucleotides 14473-14547 of SEQ ID NO:1 nucleotides 14623-14692 of SEQ ID NO:1 nucleotides 15724-15762 of SEQ ID NO:1 nucleotides 15901-15924 of SEQ ID NO:1 nucleotides 16269-17546 of SEQ ID NO:1 nucleotides 18855-19361 of SEQ ID NO:1 nucleotides 21414-21626 of SEQ ID NO:1 nucleotides 21860-23116 of SEQ ID NO:1 nucleotides 25184-25942 of SEQ ID NO:1 nucleotides 26318-27595 of SEQ ID NO:1 nucleotides 29678-30429 of SEQ ID NO:1 nucleotides 30815-32092 of SEQ ID NO:1 nucleotides 33401-33889 of SEQ ID NO:1 nucleotides 35930-36667 of SEQ ID NO:1 nucleotides 37052-38320 of SEQ ID NO:1 nucleotides 39635-40141 of SEQ ID NO:1 nucleotides 42314-43048 of SEQ ID NO:1 nucleotides 43524-54920 of SEQ ID NO:1 nucleotides 45204-46166 of SEQ ID NO:1 nucleotides 47811-48032 of SEQ ID NO:1 nucleotides 49680-50642 of SEQ ID NO:1;nucleotides 13633-13680 of SEQ ID NO nucleotides 14313-14334 of SEQ ID NO nucleotides 14578-14607 of SEQ ID NO nucleotides 15673-15693 of SEQ ID NO nucleotides 14788-15639 of SEQ ID NO nucleotides 16251-21749 of SEQ ID NO nucleotides 17865-18827 of SEQ ID NO nucleotides 20565-21302 of SEQ ID NO nucleotides 21746-43519 of SEQ ID NO nucleotides 23431-24397 of SEQ ID NO nucleotides 26045-26263 of SEQ ID NO nucleotides 27911-28876 of SEQ ID NO nucleotides 30539-30759 of SEQ ID NO nucleotides 32408-33373 of SEQ ID NO nucleotides 35042-35902 of SEQ ID NO nucleotides 36773-36991 of SEQ ID NO nucleotides 38636-39598 of SEQ ID NO nucleotides 41369-42256 of SEQ ID NO nucleotides 43163-43378 of SEQ ID NO nucleotides 43626-44885 of SEQ ID NO nucleotides 46950-47702 of SEQ ID NO nucleotides 48087-49361 of SEQ ID NO nucleotides 50670-51176 of SEQ ID NO;1PONZ;-S JUL2003;Case 4-30582A;-63-;nucleotides;51534-52657;of;SEQ;ID;NO;1,;nucleotides 53697-54431 of SEQ ID NO;1,;nucleotides;54540-54758;of;SEQ;ID;NO;1.;nucleotides 54935-62254 of SEQ ID NO;1,;nucleotides;55028-56284;of;SEQ;ID;NO;1,;nucleotides 56600-57565 of SEQ ID NO;1,;nucleotides;57593-58087;of;SEQ;ID;NO;1,;nucleotides 59366-60304 of SEQ ID NO;1,;nucleotides;60362-61099;of;SEQ;ID;NO;1,;nucleotides 61211-61426 of SEQ ID NO;1,;nucleotides;61427-62254;of;SEQ;ID;NO;1,;nucleotides 62369-63628 of SEQ ID NO;1,;nucleotides;67334-68251;of;SEQ;ID;NO;1,;and nucleotides 1-68750 SEQ ID NO:1,;under conditions of hybridization at 7% sodium dodecyl sulfate (SDS), 0.5 M NaP04 pH 7.0, 1 mM EDTA at 50°C and washing with 2X SSC, 1% SDS at 50°C.;2. An isolated nucleic acid molecule according to claim 1 comprising a nucleotide sequence whose complement hybridizes to a nucleotide sequence selected from the group consisting of: the complement of nucleotides 1900-3171 of SEQ ID NO:1, nucleotides 3415-5556 of SEQ ID NO:1, nucleotides 7610-11875 of SEQ ID NO:1, nucleotides 7643-8920 of SEQ ID NO:1, nucleotides 9236-10201 of SEQ ID NO:1, nucleotides 10529-11428 of SEQ ID NO:1, nucleotides 11549-11764 of SEQ ID NO:1, nucleotides 11872-16104 of SEQ ID NO:1, nucleotides 12085-12114 of SEQ ID NO:1, nucleotides 12223-12246 of SEQ ID NO:1,;nucleotides 12466-12507 of SEQ;ID;NO:1;nucleotides;12928-12960 of SEQ;ID;NO;1,;nucleotides 13516-13566 of SEQ;ID;NO:1;nucleotides;13633-13680 of SEQ;ID;NO;1,;nucleotides 13876-13923 of SEQ;ID;NO:1;nucleotides;14313-14334 of SEQ;ID;NO;1,;nucleotides 14473-14547 of SEQ;ID;NO:1;nucleotides;14578-14607 of SEQ;ID;NO;1,;nucleotides 14623-14692 of SEQ;ID;NO:1;nucleotides;15673-15693 of SEQ;ID;NO;1,;nucleotides 15724-15762 of SEQ;ID;NO:1;nucleotides;14788-15639 of SEQ;ID;NO;1,;nucleotides 15901-15924 of SEQ;ID;NO:1;nucleotides;16251-21749 of SEQ;ID;NO;1,;nucleotides 16269-17546 of SEQ;ID;NO:1;nucleotides;17865-18827 of SEQ;ID;NO;1,;nucleotides 18855-19361 of SEQ;ID;NO:1;nucleotides;20565-21302 of SEQ;ID;NO;1,;nucleotides 21414-21626 of SEQ;ID;NO:1;nucleotides;21746-43519 of SEQ;ID;NO;1,;nucleotides 21860-23116 of SEQ;ID;NO:1;nucleotides;23431-24397 of SEQ;ID;NO;1,;nucleotides 25184-25942 of SEQ;ID;NO:1;nucleotides;26045-26263 of SEQ;ID;NO;1,;nucleotides 26318-27595 of SEQ;ID;NO:1;nucleotides;27911-28876 of SEQ;ID;NO;1,;nucleotides 29678-30429 of SEQ;ID;NO:1;nucleotides;30539-30759 of SEQ;ID;NO;1,;nucleotides 30815-32092 of SEQ;ID;NO:1;nucleotides;32408-33373 of SEQ;ID;NO;1,;nucleotides 33401-33889 of SEQ;ID;NO:1;nucleotides;35042-35902 of SEQ;ID;NO;1,;nucleotides 35930-36667 of SEQ;ID;NO:1,;nucleotides;36773-36991 of SEQ;ID;NO;1,;IPONZ;-9 JUL2003;Case 4-30582A;-64-;nucleotides;37052-38320;of;SEQ;ID;NO:1;nucleotides;38636-39598;of SEQ;ID;NO;1,;nucleotides;39635-40141;of;SEQ;ID;NO:1;nucleotides;41369-42256;of SEQ;ID;NO;1,;nucleotides;42314-43048;of;SEQ;ID;NO:1;nucleotides;43163-43378;of SEQ;ID;NO;1,;nucleotides;43524-54920;of;SEQ;ID;NO:1;nucleotides;43626-44885;of SEQ;ID;NO;1,;nucleotides;45204-46166;of;SEQ;ID;NO:1;nucleotides;46950-47702;of SEQ;ID;NO;1,;nucleotides;47811-48032;of;SEQ;ID;NO:1;nucleotides;48087-49361;of SEQ;ID;NO;1,;nucleotides;49680-50642;of;SEQ;ID;NO:1;nucleotides;50670-51176;of SEQ;ID;NO;1,;nucleotides;51534-52657;of;SEQ;ID;NO:1;nucleotides;53697-54431;of SEQ;ID;NO;1,;nucleotides;54540-54758;of;SEQ;ID;NO:1;nucleotides;54935-62254;of SEQ;ID;NO;1,;nucleotides;55028-56284;of;SEQ;ID;NO:1;nucleotides;56600-57565;of SEQ;ID;NO;1,;nucleotides;57593-58087;of;SEQ;ID;NO:1;nucleotides;59366-60304;of SEQ;ID;NO;1,;nucleotides;60362-61099;of;SEQ;ID;NO:1;nucleotides;61211-61426;of SEQ;ID;NO;1,;nucleotides;61427-62254;of;SEQ;ID;NO:1;nucleotides;62369-63628;of SEQ;ID;NO;1,;nucleotides;67334-68251;of;SEQ;ID;NO:1;and nucleotides 1-68750 SEQ ID;NO:1,;under conditions of hybridization at 65°C for 36 hours and washing 3 times at high stringency with 0.1X SSC and 0.5% SDS for 20 minutes at 65°C.;3. An isolated nucleic acid molecule comprising a nucleotide sequence that encodes at least one polypeptide involved in the biosynthesis of epothilone, wherein said nucleotide sequence has at least 80 percent sequence identity with a nucleotide sequence selected from the group consisting of: the complement of nucleotides 1900-3171 of SEQ ID NO:1, nucleotides 3415-5556 of SEQ ID NO:1, nucleotides 7610-11875 of SEQ ID NO:1, nucleotides 7643-8920 of SEQ ID NO:1, nucleotides 9236-10201 of SEQ ID NO:1,;nucleotides;10529-11428;of;SEQ;ID;NO:1;nucleotides;11549-11764;of;SEQ;ID;NO:;nucleotides;11872-16104;of;SEQ;ID;NO:1;nucleotides;12085-12114;of;SEQ;ID;NO:;nucleotides;12223-12246;of;SEQ;ID;NO:1;nucleotides;12466-12507;of;SEQ;ID;NO:;nucleotides;12928-12960;of;SEQ;ID;NO:1;nucleotides;13516-13566;of;SEQ;ID;NO:;nucleotides;13633-13680;of;SEQ;ID;NO:1;nucleotides;13876-13923;of;SEQ;ID;NO:;nucleotides;14313-14334;of;SEQ;ID;NO:1;nucleotides;14473-14547;of;SEQ;ID;NO:;nucleotides;14578-14607;of;SEQ;ID;NO:1;nucleotides;14623-14692;of;SEQ;ID;NO:;nucleotides;15673-15693;of;SEQ;ID;NO:1;nucleotides;15724-15762;of;SEQ;ID;NO:;nucleotides;14788-15639;of;SEQ;ID;NO:1;nucleotides;15901-15924;of;SEQ;ID;NO:;nucleotides;16251-21749;of;SEQ;ID;NO:1;nucleotides;16269-17546;of;SEQ;ID;NO:;nucleotides;17865-18827;of;SEQ;ID;NO:1;nucleotides;18855-19361;of;SEQ;ID;NO:;IPONZ;-9 JUL2003;Case 4-30582A;-65-;nucleotides;20565-21302 of SEQ;ID;NO:1;nucleotides;21414-21626;of SEQ;ID;NO:1;nucleotides;21746-43519 of SEQ;ID;NO:1;nucleotides;21860-23116;of SEQ;ID;NO;1;nucleotides;23431-24397 of SEQ;ID;NO:1;nucleotides;25184-25942;of SEQ;ID;NO;1;nucleotides;26045-26263 of SEQ;ID;NO:1;nucleotides;26318-27595;of SEQ;ID;NO;1;nucleotides;27911-28876 of SEQ;ID;NO:1;nucleotides;29678-30429;of SEQ;ID;NO;1;nucleotides;30539-30759 of SEQ;ID;NO:1;nucleotides;30815-32092;of SEQ;ID;NO;1;nucleotides;32408-33373 of SEQ;ID;NO:1;nucleotides;33401-33889;of SEQ;ID;NO;1;nucleotides;35042-35902 of SEQ;ID;NO:1;nucleotides;35930-36667;of SEQ;ID;NO;1;nucleotides;36773-36991 of SEQ;ID;NO:1;nucleotides;37052-38320;of SEQ;ID;NO;1;nucleotides;38636-39598 of SEQ;ID;NO:1;nucleotides;39635-40141;of SEQ;ID;NO;1;nucleotides;41369-42256 of SEQ;ID;NO:1;nucleotides;42314-43048;of SEQ;ID;NO;1;nucleotides;43163-43378 of SEQ;ID;NO:1;nucleotides;43524-54920;of SEQ;ID;NO;1;nucleotides;43626-44885 of SEQ;ID;NO:1;nucleotides;45204-46166;of SEQ;ID;NO;1;nucleotides;46950-47702 of SEQ;ID;NO:1;nucleotides;47811-48032;of SEQ;ID;NO;1;nucleotides;48087-49361 of SEQ;ID;NO:1;nucleotides;49680-50642;of SEQ;ID;NO;1;nucleotides;50670-51176 of SEQ;ID;NO:1;nucleotides;51534-52657;of SEQ;ID;NO;1;nucleotides;53697-54431 of SEQ;ID;NO:1;nucleotides;54540-54758;of SEQ;ID;NO;1;nucleotides;54935-62254 of SEQ;ID;NO:1;nucleotides;55028-56284;of SEQ;ID;NO;1;nucleotides;56600-57565 of SEQ;ID;NO:1;nucleotides;57593-58087;of SEQ;ID;NO;1;nucleotides;59366-60304 of SEQ;ID;NO:1;nucleotides;60362-61099;of SEQ;ID;NO;1;nucleotides;61211-61426 of SEQ;ID;NO:1;nucleotides;61427-62254;of SEQ;ID;NO;1;nucleotides;62369-63628 of SEQ;ID;NO:1;nucleotides;67334-68251;of SEQ;ID;NO;1;nucleotides 1-68750 SEQ ID NO:1.;4. An isolated nucleic acid molecule according to claim 3 comprising a nucleotide sequence that has at least 90 percent sequence identity with a nucleotide sequence selected from the group consisting of: the complement of nucleotides 1900-3171 of SEQ ID NO:1, nucleotides 3415-5556 of SEQ ID NO:1, nucleotides 7610-11875 of SEQ ID NO:1, nucleotides 7643-8920 of SEQ ID NO:1, nucleotides 9236-10201 of SEQ ID NO:1, nucleotides 10529-11428 of SEQ ID NO:1, nucleotides 11549-11764 of SEQ ID NO:1, nucleotides 11872-16104 of SEQ ID NO:1, nucleotides 12085-12114 of SEQ ID NO:1, nucleotides 12223-12246 of SEQ ID NO:1, nucleotides 12466-12507 of SEQ ID NO:1, nucleotides 12928-12960 of SEQ ID NO:1, nucleotides 13516-13566 of SEQ ID NO:1, nucleotides 13633-13680 of SEQ ID NO:1, nucleotides 13876-13923 of SEQ ID NO:1,;IPONZ;-9 JUL2003;Case 4-30582A;-66-;nucleotides 14313-14334 of SEQ ID NO:1 nucleotides 14578-14607 of SEQ ID NO:1 nucleotides 15673-15693 of SEQ ID NO:1 nucleotides 14788-15639 of SEQ ID NO:1 nucleotides 16251-21749 of SEQ ID NO:1 nucleotides 17865-18827 of SEQ ID NO:1 nucleotides 20565-21302 of SEQ ID NO:1 nucleotides 21746-43519 of SEQ ID NO:1 nucleotides 23431-24397 of SEQ ID NO:1 nucleotides 26045-26263 of SEQ ID NO:1 nucleotides 27911-28876 of SEQ ID NO:1 nucleotides 30539-30759 of SEQ ID NO:1 nucleotides 32408-33373 of SEQ ID NO:1 nucleotides 35042-35902 of SEQ ID NO:1 nucleotides 36773-36991 of SEQ ID NO:1 nucleotides 38636-39598 of SEQ ID NO:1 nucleotides 41369-42256 of SEQ ID NO:1 nucleotides 43163-43378 of SEQ ID NO:1 nucleotides 43626-44885 of SEQ ID NO:1 nucleotides 46950-47702 of SEQ ID NO:1 nucleotides 48087-49361 of SEQ ID NO:1 nucleotides 50670-51176 of SEQ ID NO:1 nucleotides 53697-54431 of SEQ ID NO:1 nucleotides 54935-62254 of SEQ ID NO:1 nucleotides 56600-57565 of SEQ ID NO:1 nucleotides 59366-60304 of SEQ ID NO:1 nucleotides 61211-61426 of SEQ ID NO:1 nucleotides 62369-63628 of SEQ ID NO:1 nucleotides 1-68750 SEQ ID NO:1.;nucleotides 14473-14547 of SEQ ID NO:1;nucleotides 14623-14692 of SEQ ID NO nucleotides 15724-15762 of SEQ ID NO nucleotides 15901-15924 of SEQ ID NO nucleotides 16269-17546 of SEQ ID NO nucleotides 18855-19361 of SEQ ID NO nucleotides 21414-21626 of SEQ ID NO nucleotides 21860-23116 of SEQ ID NO nucleotides 25184-25942 of SEQ ID NO nucleotides 26318-27595 of SEQ ID NO nucleotides 29678-30429 of SEQ ID NO nucleotides 30815-32092 of SEQ ID NO nucleotides 33401-33889 of SEQ ID NO nucleotides 35930-36667 of SEQ ID NO nucleotides 37052-38320 of SEQ ID NO nucleotides 39635-40141 of SEQ ID NO nucleotides 42314-43048 of SEQ ID NO nucleotides 43524-54920 of SEQ ID NO nucleotides 45204-46166 of SEQ ID NO nucleotides 47811-48032 of SEQ ID NO nucleotides 49680-50642 of SEQ ID NO nucleotides 51534-52657 of SEQ ID NO nucleotides 54540-54758 of SEQ ID NO nucleotides 55028-56284 of SEQ ID NO nucleotides 57593-58087 of SEQ ID NO nucleotides 60362-61099 of SEQ ID NO nucleotides 61427-62254 of SEQ ID NO nucleotides 67334-68251 of SEQ ID NO;and;5. An isolated nucleic acid molecule according to claim 4 comprising a nucleotide sequence that has at least 95 percent sequence identity with a nucleotide sequence selected from the group consisting of: the complement of nucleotides 1900-3171 of SEQ ID NO:1, nucleotides 3415-5556 of SEQ ID NO:1, nucleotides 7610-11875 of SEQ ID NO:1,;IPONZ;-9 JUL2003;Case 4-30582A;nucleotides 7643-8920 of SEQ ID NO:1, nucleotides 10529-11428 of SEQ ID NO1 nucleotides 11872-16104 of SEQ ID NO. nucleotides 12223-12246 of SEQ ID NO nucleotides 12928-12960 of SEQ ID NO: nucleotides 13633-13680 of SEQ ID NO: nucleotides 14313-14334 of SEQ ID NO: nucleotides 14578-14607 of SEQ ID NO: nucleotides 15673-15693 of SEQ ID NO: nucleotides 14788-15639 of SEQ ID NO: nucleotides 16251-21749 of SEQ ID NO: nucleotides 17865-18827 of SEQ ID NO: nucleotides 20565-21302 of SEQ ID NO: nucleotides 21746-43519 of SEQ ID NO: nucleotides 23431-24397 of SEQ ID NO: nucleotides 26045-26263 of SEQ ID NO: nucleotides 27911-28876 of SEQ ID NO: nucleotides 30539-30759 of SEQ ID NO: nucleotides 32408-33373 of SEQ ID NO: nucleotides 35042-35902 of SEQ ID NO: nucleotides 36773-36991 of SEQ ID NO: nucleotides 38636-39598 of SEQ ID NO: nucleotides 41369-42256 of SEQ ID NO: nucleotides 43163-43378 of SEQ ID NO: nucleotides 43626-44885 of SEQ ID NO: nucleotides 46950-47702 of SEQ ID NO: nucleotides 48087-49361 of SEQ ID NO: nucleotides 50670-51176 of SEQ ID NO: nucleotides 53697-54431 of SEQ ID NO: nucleotides 54935-62254 of SEQ ID NO: nucleotides 56600-57565 of SEQ ID NO: nucleotides 59366-60304 of SEQ ID NO: nucleotides 61211-61426 of SEQ ID NO:;-67-;nucleotides 9236-10201 of SEQ ID NO:1, nucleotides 11549-11764 of SEQ ID NO:1 nucleotides 12085-12114 of SEQ ID NO:1 nucleotides 12466-12507 of SEQ ID NO:1 nucleotides 13516-13566 of SEQ ID NO:1 nucleotides 13876-13923 of SEQ ID NO:1 nucleotides 14473-14547 of SEQ ID NO:1 nucleotides 14623-14692 of SEQ ID NO:1 nucleotides 15724-15762 of SEQ ID NO:1 nucleotides 15901-15924 of SEQ ID NO:1 nucleotides 16269-17546 of SEQ ID NO:1 nucleotides 18855-19361 of SEQ ID NO:1 nucleotides 21414-21626 of SEQ ID NO:1 nucleotides 21860-23116 of SEQ ID NO:1 nucleotides 25184-25942 of SEQ ID NO:1 nucleotides 26318-27595 of SEQ ID NO:1 nucleotides 29678-30429 of SEQ ID NO:1 nucleotides 30815-32092 of SEQ ID NO:1 nucleotides 33401-33889 of SEQ ID NO:1 nucleotides 35930-36667 of SEQ ID NO:1 nucleotides 37052-38320 of SEQ ID NO:1 nucleotides 39635-40141 of SEQ ID NO:1 nucleotides 42314-43048 of SEQ ID NO:1 nucleotides 43524-54920 of SEQ ID NO:1 nucleotides 45204-46166 of SEQ ID NO:1 nucleotides 47811-48032 of SEQ ID NO:1 nucleotides 49680-50642 of SEQ ID NO:1 nucleotides 51534-52657 of SEQ ID NO:1 nucleotides 54540-54758 of SEQ ID NO:1 nucleotides 55028-56284 of SEQ ID NO:1 nucleotides 57593-58087 of SEQ ID NO:1 nucleotides 60362-61099 of SEQ ID NO:1 nucleotides 61427-62254 of SEQ ID NO:1;IPONZ;-8 JUL2003;Case 4-30582A;-68-;nucleotides 62369-63628 of SEQ ID NO:1, nucleotides 67334-68251 of SEQ ID NO:1, and nucleotides 1-68750 SEQ ID NO:1.;6. An isolated nucleic acid molecule according to claim 1 or 3 comprising a nucleotide sequence that encodes a polypeptide which comprises an amino acid sequence selected from the group consisting of: SEQ ID NO:2, amino acids 11-437 of SEQ ID NO:2, amino acids 543-864 of SEQ ID NO:2, amino acids 974-1273 of SEQ ID NO:2, amino acids 1314-1385 of SEQ ID NO:2, SEQ ID NO:3, amino acids 72-81 of SEQ ID NO:3, amino acids 118-125 of SEQ ID NO:3, amino acids 199-212 of SEQ ID NO:3, amino acids 353-363 of SEQ ID NO:3, amino acids 549-565 of SEQ ID NO:3, amino acids 588-603 of SEQ ID NO:3,;amino acids 669-684 of SEQ ID NO:3, amino acids 815-821 of SEQ ID NO:3, amino acids;/';868-892 of SEQ ID NO:3, amino acids 903-912 of SEQ ID NO:3, amino acids 918-940 of SEQ ID NO:3, amino acids 1268-1274 of SEQ ID NO:3, amino acids 1285-1297 of SEQ ID NO:3, amino acids 973-1256 of SEQ ID NO:3, amino acids 1344-1351 of SEQ ID NO:3, SEQ ID NO:4, amino acids 7-432 of SEQ ID NO:4, amino acids 539-859 of SEQ ID NO:4, amino acids 869-1037 of SEQ ID NO:4, amino acids 1439-1684 of SEQ ID NO:4, amino acids 1722-1792 of SEQ ID NO:4, SEQ ID NO:5, amino acids 39-457 of SEQ ID NO:5, amino acids 563-884 of SEQ ID NO:5, amino acids 1147-1399 of SEQ ID NO:5, amino acids 1434-1506 of SEQ ID NO:5, amino acids 1524-1950 of SEQ ID NO:5, amino acids 2056-2377 of SEQ ID NO:5, amino acids 2645-2895 of SEQ ID NO:5, amino acids 2932-3005 of SEQ ID NO:5, amino acids 3024-3449 of SEQ ID NO:5, amino acids 3555-3876 of SEQ ID NO:5, amino acids 3886-4048 of SEQ ID NO:5, amino acids 4433-4719 of SEQ ID NO:5, amino acids 4729-4974 of SEQ ID NO:5, amino acids 5010-5082 of SEQ ID NO:5, amino acids 5103-5525 of SEQ ID NO:5, amino acids 5631-5951 of SEQ ID NO:5, amino acids 5964-6132 of SEQ ID NO:5, amino acids 6542-6837 of SEQ ID NO:5, amino acids 6857-7101 of SEQ ID NO:5, amino acids 7140-7211 of SEQ ID NO:5, SEQ ID NO:6, amino acids 35-454 of SEQ ID NO:6, amino acids 561-881 of SEQ ID NO:6, amino acids 1143-1393 of SEQ ID NO:6, amino acids 1430-1503 of SEQ ID NO:6, amino acids 1522-1946 of SEQ ID NO: 6, amino acids 2053-2373 of SEQ ID NO:6, amino acids 2383-2551 of SEQ ID NO:6, amino acids 2671-3045 of SEQ ID NO:6, amino acids 3392-3636 of SEQ ID NO:6, amino acids 3673-3745 of SEQ ID NO:6, SEQ ID NO:7, amino acids 32-450 of SEQ ID NO:7, amino acids 556-877 of SEQ ID NO:7, amino acids 887-1051 of SEQ ID NO:7, amino acids 1478-1790 of SEQ ID NO:7, amino acids 1810-2055 of SEQ ID NO:7, amino acids 2093-;IPONZ;-9 JUL2003;Case 4-30582A;-69-;2164 of SEQ ID N0:7, amino acids 2165-2439 of SEQ ID NO:7, SEQ ID NO:8, SEQ ID N0:10, SEQ ID NO:11, and SEQ ID NO:22.;7. An isolated nucleic acid molecule according to claim 1 or 3 comprising a nucleotide sequence selected from the group consisting of: the complement of nucleotides 1900-3171 of SEQ ID NO:1, nucleotides 3415-5556 of SEQ ID NO:1, nucleotides 7610-11875 of SEQ ID NO:1, nucleotides 7643-8920 of SEQ ID NO:1, nucleotides 9236-10201 of SEQ ID NO:1, nucleotides 10529-11428 of SEQ ID NO:1, nucleotides 11549-11764 of SEQ IDNO:1, nucleotides 11872-16104 of SEQ IDNO:1, nucleotides 12085-12114 of SEQ ID NO:1, nucleotides 12223-12246 of SEQ ID NO:1, nucleotides 12466-12507 of SEQ ID NO:1,;nucleotides 12928-12960 of SEQ;ID;NO:1;nucleotides 13516-13566 of SEQ;ID;NO;1,;nucleotides 13633-13680 of SEQ;ID;NO:1;nucleotides 13876-13923 of SEQ;ID;NO;1,;nucleotides 14313-14334 of SEQ;ID;NO:1;nucleotides 14473-14547 of SEQ;ID;NO;1,;nucleotides 14578-14607 of SEQ;ID;NO:1;nucleotides 14623-14692 of SEQ;ID;NO;1,;nucleotides 15673-15693 of SEQ;ID;NO:1;nucleotides 15724-15762 of SEQ;ID;NO;1,;nucleotides 14788-15639 of SEQ;ID;NO:1;nucleotides 15901-15924 of SEQ;ID;NO;1,;nucleotides 16251-21749 of SEQ;ID;NO:1;nucleotides 16269-17546 of SEQ;ID;NO;1,;nucleotides 17865-18827 of SEQ;ID;NO:1;nucleotides 18855-19361 of SEQ;ID;NO;1,;nucleotides 20565-21302 of SEQ;ID;NO:1;nucleotides 21414-21626 of SEQ;ID;NO;1,;nucleotides 21746-43519 of SEQ;ID;NO:1;nucleotides 21860-23116 of SEQ;ID;NO;1,;nucleotides 23431-24397 of SEQ;ID;NO:1;nucleotides 25184-25942 of SEQ;ID;NO;1,;nucleotides 26045-26263 of SEQ;ID;NO:1;nucleotides 26318-27595 of SEQ;ID;NO;1,;nucleotides 27911-28876 of SEQ;ID;NO:1;nucleotides 29678-30429 of SEQ;ID;NO;1,;nucleotides 30539-30759 of SEQ;ID;NO:1;nucleotides 30815-32092 of SEQ;ID;NO;1,;nucleotides 32408-33373 of SEQ;ID;NO:1;nucleotides 33401-33889 of SEQ;ID;NO;1,;nucleotides 35042-35902 of SEQ;ID;NO:1;nucleotides 35930-36667 of SEQ;ID;NO;1,;nucleotides 36773-36991 of SEQ;ID;NO:1;nucleotides 37052-38320 of SEQ;ID;NO;1,;nucleotides 38636-39598 of SEQ;ID;NO:1;nucleotides 39635-40141 of SEQ;ID;NO;1,;nucleotides 41369-42256 of SEQ;ID;NO:1;nucleotides 42314-43048 of SEQ;ID;NO;1,;nucleotides 43163-43378 of SEQ;ID;NO:1;nucleotides 43524-54920 of SEQ;ID;NO;1,;nucleotides 43626-44885 of SEQ;ID;NO:1;nucleotides 45204-46166 of SEQ;ID;NO;1,;nucleotides 46950-47702 of SEQ;ID;NO:1;nucleotides 47811-48032 of SEQ;ID;NO;1,;nucleotides 48087-49361 of SEQ;ID;NO:1;nucleotides 49680-50642 of SEQ;ID;NO;1,;nucleotides 50670-51176 of SEQ;ID;NO:1;nucleotides 51534-52657 of SEQ;ID;NO;1,;IPONZ;-S JUL2003;Case 4-30582A;-70-;nucleotides;53697-54431 of SEQ;ID;NO;1,;nucleotides;54540-54758;of SEQ;ID;NO;1.;nucleotides;54935-62254 of SEQ;ID;NO;1,;nucleotides;55028-56284;of SEQ;ID;NO;1,;nucleotides;56600-57565 of SEQ;ID;NO;1,;nucleotides;57593-58087;of SEQ;ID;NO;1,;nucleotides;59366-60304 of SEQ;ID;NO;1,;nucleotides;60362-61099;of SEQ;ID;NO;1,;nucleotides;61211-61426 of SEQ;ID;NO;1,;nucleotides;61427-62254;of SEQ;ID;NO;1,;nucleotides;62369-63628 of SEQ;ID;NO;1,;nucleotides;67334-68251;of SEQ;ID;NO;1, and nucleotides;1-68750 SEQ ID NO:1.;8. An isolated nucleic acid molecule according to claim 1 or 3, wherein said polypeptide comprises a p-ketoacyl-synthase domain comprising an amino acid sequence selected from the group consisting of: amino acids 11-437 of SEQ ID NO:2, amino acids 7-432 of SEQ ID NO:4, amino acids 39-457 of SEQ ID NO:5, amino acids 1524-1950 of SEQ ID NO:5, amino acids 3024-3449 of SEQ ID NO:5, amino acids 5103-5525 of SEQ ID NO:5, amino acids 35-454 of SEQ ID NO:6, amino acids 1522-1946 of SEQ ID NO: 6, and amino acids 32-450 of SEQ ID NO:7.;9. An isolated nucleic acid molecule according to claim 8, wherein said nucleotide sequence is selected from the group consisting of: nucleotides 7643-8920 of SEQ ID NO:1, nucleotides 16269-17546 of SEQ ID NO:1, nucleotides 21860-23116 of SEQ ID NO:1, nucleotides 26318-27595 of SEQ ID NO:1, nucleotides 30815-32092 of SEQ ID NO:1, nucleotides 37052-38320 of SEQ ID NO:1, nucleotides 43626-44885 of SEQ ID NO:1, nucleotides 48087-49361 of SEQ ID NO:1, and nucleotides 55028-56284 of SEQ ID NO:1.;10. An isolated nucleic acid molecule according to claim 1 or 3, wherein said polypeptide comprises an acyltransferase domain comprising an amino acid sequence selected from the group consisting of: amino acids 543-864 of SEQ ID NO:2, amino acids 539-859 of SEQ ID NO:4, amino acids 563-884 of SEQ ID NO:5, amino acids 2056-2377 of SEQ ID NO:5, amino acids 3555-3876 of SEQ ID NO:5, amino acids 5631-5951 of SEQ ID NO:5, amino acids 561-881 of SEQ ID NO:6, amino acids 2053-2373 of SEQ ID NO:6, and amino acids 556-877 of SEQ ID NO:7.;11. An isolated nucleic acid molecule according to claim 10, wherein said nucleotide sequence is selected from the group consisting of: nucleotides 9236-10201 of SEQ ID NO:1, nucleotides 17865-18827 of SEQ ID NO:1, nucleotides 23431-24397 of SEQ ID NO:1,;IPONZ;-9 JUL2003;Case 4-30582A;-71 -;nucleotides 27911-28876 of SEQ ID NO:1, nucleotides 38636-39598 of SEQ ID NO:1, nucleotides 49680-50642 of SEQ ID NO:1,;nucleotides 32408-33373 of SEQ ID NO:1, nucleotides 45204-46166 of SEQ ID NO:1, and nucleotides 56600-57565 of SEQ ID NO:1.;12. An isolated nucleic acid molecule according to claim 1 or 3, wherein said polypeptide comprises an enoyl reductase domain comprising an amino acid sequence selected from the group consisting of: amino acids 974-1273 of SEQ ID NO:2, amino acids 4433-4719 of SEQ ID NO:5, amino acids 6542-6837'of SEQ ID NO:5, and amino acids 1478-1790 of SEQ ID NO:7.;13. An isolated nucleic acid molecule according to claim 12, wherein said nucleotide sequence is selected from the group consisting of: nucleotides 10529-11428 of SEQ ID NO:1, nucleotides 35042-35902 of SEQ ID NO:1, nucleotides 41369-42256 of SEQ ID NO:1, and nucleotides 59366-60304 of SEQ ID NO:1.;14. An isolated nucleic acid molecule according to claim 1 or 3, wherein said polypeptide comprises an acyl carrier protein domain comprising an amino acid sequence selected from the group consisting of: amino acids 1314-1385 of SEQ ID NO:2, amino acids 1722-1792 of SEQ ID NO:4, amino acids 1434-1506 of SEQ ID NO:5, amino acids 2932-3005 of SEQ ID NO:5, amino acids 5010-5082 of SEQ ID NO:5, amino acids 7140-7211 of SEQ ID NO:5, amino acids 1430-1503 of SEQ ID NO:6, amino acids 3673-3745 of SEQ ID NO:6, and amino acids 2093-2164 of SEQ ID NO:7.;15. An isolated nucleic acid molecule according to claim 14, wherein said nucleotide sequence is selected from the group consisting of: nucleotides 11549-11764 of SEQ ID NO:1, nucleotides 21414-21626 of SEQ ID NO:1, nucleotides 26045-26263 of SEQ ID NO:1, nucleotides 30539-30759 of SEQ ID NO:1, nucleotides 36773-36991 of SEQ ID NO:1, nucleotides 43163-43378 of SEQ ID NO:1, nucleotides 47811-48032 of SEQ ID NO:1, nucleotides 54540-54758 of SEQ ID NO:1, and nucleotides 61211-61426 of SEQ ID NO:1.;16. An isolated nucleic acid molecule according to claim 1 or 3, wherein said polypeptide comprises a dehydratase domain comprising an amino acid sequence selected from the group consisting of: amino acids 869-1037 of SEQ ID NO:4, amino acids 3886-;IPONZ;-9 JUL2003;Case 4-30582A;-72-;4048 of SEQ ID NO:5, amino acids 5964-6132 of SEQ ID NO:5, amino acids 2383-2551 of SEQ ID NO:6, and amino acids 887-1051 of SEQ ID NO:7.;17. An isolated nucleic acid molecule according to claim 16, wherein said nucleotide sequence is selected from the group consisting of: nucleotides 18855-19361 of SEQ ID NO:1, nucleotides 33401-33889 of SEQ ID NO:1, nucleotides 39635-40141 of SEQ ID NO:1, nucleotides 50670-51176 of SEQ ID NO:1, and nucleotides 57593-58087 of SEQ ID NO:1.;18. An isolated nucleic acid molecule according to claim 1 or 3, wherein said polypeptide comprises a (3-ketoreductase domain comprising an amino acid sequence selected from the group consisting of: amino acids 1439-1684 of SEQ ID NO:4, amino acids 1147-1399 of SEQ ID NO:5, amino acids 2645-2895 of SEQ ID NO:5, amino acids 4729-4974 of SEQ ID NO:5, amino acids 6857-7101 of SEQ ID NO:5, amino acids 1143-1393 of SEQ ID NO:6, amino acids 3392-3636 of SEQ ID NO:6, and amino acids 1810-2055 of SEQ ID NO:7.;19. An isolated nucleic acid molecule according to claim 18, wherein said nucleotide sequence is selected from the group consisting of: nucleotides 20565-21302 of SEQ ID NO:1, nucleotides 25184-25942 of SEQ ID NO:1, nucleotides 29678-30429 of SEQ ID NO:1, nucleotides 35930-36667 of SEQ ID NO:1, nucleotides 42314-43048 of SEQ ID NO:1, nucleotides 46950-47702 of SEQ ID NO:1, nucleotides 53697-54431 of SEQ ID NO:1, and nucleotides 60362-61099 of SEQ ID NO:1.;20. An isolated nucleic acid molecule according to claim 1 or 3, wherein said polypeptide comprises a methyltransferase domain comprising amino acids 2671-3045 of SEQ ID NO:6.;21. An isolated nucleic acid molecule according to claim 20, wherein said nucleotide sequence is nucleotides 51534-52657 of SEQ ID NO:1.;22. An isolated nucleic acid molecule according to claim 1 or 3, wherein said polypeptide comprises a thioesterase domain comprising amino acids 2165-2439 of SEQ ID NO:7.;IPONZ;-» JUL2003;Case 4-30582A;-73-;23. An isolated nucleic acid molecule according to claim 22, wherein said nucleotide sequence is nucleotides 61427-62254 of SEQ ID NO:1.;24. An isolated nucleic acid molecule according to claim 1 or 3, wherein said polypeptide comprises a non-ribosomal peptide synthetase comprising an amino acid sequence selected from the group consisting of: SEQ ID NO:3, amino acids 72-81 of SEQ ID NO:3, amino acids 118-125 of SEQ ID NO:3, amino acids 199-212 of SEQ ID NO:3, amino acids 353-363 of SEQ ID NO:3, amino acids 549-565 of SEQ ID NO:3, amino acids 588-603 of SEQ ID NO:3, amino acids 669-684 of SEQ ID NO:3, amino acids 815-821 of SEQ ID NO:3, amino acids 868-892 of SEQ ID NO:3, amino acids 903-912 of SEQ ID NO:3, amino acids 918-940 of SEQ ID NO:3, amino acids 1268-1274 of SEQ ID NO:3, amino acids 1285-1297 of SEQ ID NO:3, amino acids 973-1256 of SEQ ID NO:3, and amino acids 1344-1351 of SEQ ID NO:3.;25. An isolated nucleic acid molecule according to claim 24, wherein said nucleotide sequence is selected from the group consisting of: nucleotides 11872-16104 of SEQ ID NO:1, nucleotides 12085-12114 of SEQ ID NO:1, nucleotides 12223-12246 of SEQ ID NO:1,;nucleotides 12466-12507 of SEQ ID NO nucleotides 13516-13566 of SEQ ID NO nucleotides 13876-13923 of SEQ ID NO nucleotides 14473-14547 of SEQ ID NO nucleotides 14623-14692 of SEQ ID NO nucleotides 15724-15762 of SEQ ID NO nucleotides 15901-15924 of SEQ ID NO;1, nucleotides 12928-12960 of SEQ ID NO 1, nucleotides 13633-13680 of SEQ ID NO 1, nucleotides 14313-14334 of SEQ ID NO 1, nucleotides 14578-14607 of SEQ ID NO 1, nucleotides 15673-15693 of SEQ ID NO 1, nucleotides 14788-15639 of SEQ ID NO 1.;and;26. An isolated nucleic acid molecule according to any one of claims 1 to 25, wherein said nucleotide sequence is isolated from a myxobacterium.;27. An isolated nucleic acid molecule according to claim 26, wherein said myxobacterium is Sorangium cellulosum.;28. A chimeric gene comprising a heterologous promoter sequence operativeiy linked to a nucleic acid molecule according to any one of claims 1 to 27.;IPONZ;-9 JUL2003;Case 4-30582A;-74-;29. A recombinant vector comprising a chimeric gene according to claim 28.;30. A recombinant host cell comprising a chimeric gene according to claim 28.;31. The recombinant host cell of claim 30, which is a bacteria.;32. The recombinant host cell of claim 31, which is an Actinomycete.;33. The recombinant host cell of claim 32, which is Streptomyces.;34. A Bac clone comprising a nucleic acid molecule according to any one of claims 1;to 27.;35. The Bac clone of claim 34, which is pEP015 as deposited under the Accession Number NRRL B-30033.;36. A method for heterologous expression of epothilone in a recombinant host, comprising:;(a) introducing a chimeric gene according to claim 28 into a host; and;(b) growing the host in conditions that allow biosynthesis of epothilone in the host.;37. A method for producing epothilone, comprising:;(a) expressing epothilone in a recombinant host by the method of claim 36; and;(b) extracting epothilone from the recombinant host.;38. An isolated polypeptide involved in the biosynthesis of epothilone, wherein said polypeptide comprises an amino acid sequence that is at least 90% identical to an amino acid sequence selected from the group consisting of: SEQ ID NO:2, amino acids 11-437 of SEQ ID NO:2, amino acids 543-864 of SEQ ID NO:2, amino acids 974-1273 of SEQ ID NO:2, amino acids 1314-1385 of SEQ ID NO:2, SEQ ID NO:3, amino acids 72-81 of SEQ ID NO:3, amino acids 118-125 of SEQ ID NO:3, amino acids 199-212 of SEQ ID NO:3, amino acids 353-363 of SEQ ID NO:3, amino acids 549-565 of SEQ ID NO:3, amino acids 588-603 of SEQ ID NO:3, amino acids 669-684 of SEQ ID NO:3, amino acids 815-821 of SEQ ID NO:3, amino acids 868-892 of SEQ ID NO:3, amino acids 903-912 of SEQ ID NO:3, amino;IPONZ;-S JUL2003;Case 4-30582A;-75-;acids 918-940 of SEQ ID NO:3, amino acids 1268-1274 of SEQ ID NO:3, amino acids 1285-1297 of SEQ ID NO:3, amino acids 973-1256 of SEQ ID NO:3, amino acids 1344-1351 of SEQ ID NO:3, SEQ ID NO:4, amino acids 7-432 of SEQ ID NO:4, amino acids 539-859 of SEQ ID NO:4, amino acids 869-1037 of SEQ ID NO:4, amino acids 1439-1684 of SEQ ID NO:4, amino acids 1722-1792 of SEQ ID NO:4, SEQ ID NO:5, amino acids 39-457 of SEQ ID NO:5, amino acids 563-884 of SEQ ID NO:5, amino acids 1147-1399 of SEQ ID NO:5, amino acids 1434-1506 of SEQ ID NO:5, amino acids 1524-1950 of SEQ ID NO:5, amino acids 2056-2377 of SEQ ID NO:5, amino acids 2645-2895 of SEQ ID NO:5, amino acids 2932-3005 of SEQ ID NO:5, amino acids 3024-3449 of SEQ ID NO:5, amino acids 3555-3876 of SEQ ID NO:5, amino acids 3886-4048 of SEQ ID NO:5, amino acids 4433-4719 of SEQ ID NO:5, amino acids 4729-4974 of SEQ ID NO:5, amino acids 5010-5082 of SEQ ID NO:5, amino acids 5103-5525 of SEQ ID NO:5, amino acids 5631-5951 of SEQ ID NO:5, amino acids 5964-6132 of SEQ ID NO:5, amino acids 6542-6837 of SEQ ID NO:5, amino acids 6857-7101 of SEQ ID NO:5, amino acids 7140-7211 of SEQ ID NO:5, SEQ ID NO:6, amino acids 35-454 of SEQ ID NO:6, amino acids 561-881 of SEQ ID NO:6, amino acids 1143-1393 of SEQ ID NO:6, amino acids 1430-1503 of SEQ ID NO:6, amino acids 1522-1946 of SEQ ID NO: 6, amino acids 2053-2373 of SEQ ID NO:6, amino acids 2383-2551 of SEQ ID NO:6, amino acids 2671-3045 of SEQ ID NO:6, amino acids 3392-3636 of SEQ ID NO:6, amino acids 3673-3745 of SEQ ID NO:6, SEQ ID NO:7, amino acids 32-450 of SEQ ID NO:7, amino acids 556-877 of SEQ ID NO:7, amino acids 887-1051 of SEQ ID NO:7, amino acids 1478-1790 of SEQ ID NO:7, amino acids 1810-2055 of SEQ ID NO:7, amino acids 2093-2164 of SEQ ID NO:7, amino acids 2165-2439 of SEQ ID NO:7, SEQ ID NO:8, SEQ ID N0:10, SEQ ID NO:11, and SEQ ID NO:22.;39. An isolated polypeptide according to claim 38 comprising an amino acid sequence selected from the group consisting of: SEQ ID NO:2, amino acids 11-437 of SEQ ID NO:2, amino acids 543-864 of SEQ ID NO:2, amino acids 974-1273 of SEQ ID NO:2, amino acids 1314-1385 of SEQ ID NO:2, SEQ ID NO:3, amino acids 72-81 of SEQ ID NO:3, amino acids 118-125 of SEQ ID NO:3, amino acids 199-212 of SEQ ID NO:3, amino acids 353-363 of SEQ ID NO:3, amino acids 549-565 of SEQ ID NO:3, amino acids 588-603 of SEQ ID NO:3, amino acids 669-684 of SEQ ID NO:3, amino acids 815-821 of SEQ ID NO:3, amino acids 868-892 of SEQ ID NO:3, amino acids 903-912 of SEQ ID NO:3, amino acids 918-940 of SEQ ID NO:3, amino acids 1268-1274 of SEQ ID NO:3, amino acids 1285-1297 of SEQ ID NO:3, amino acids 973-1256 of SEQ ID NO:3, amino acids 1344-1351 of SEQ ID;IPONZ;-9 JUL2003;Case 4-30582A;-76-;N0:3, SEQ ID N0:4, amino acids 7-432 of SEQ ID NO:4, amino acids 539-859 of SEQ ID NO:4, amino acids 869-1037 of SEQ ID NO:4, amino acids 1439-1684 of SEQ ID NO:4, amino acids 1722-1792 of SEQ ID NO:4, SEQ ID NO:5, amino acids 39-457 of SEQ ID NO:5, amino acids 563-884 of SEQ ID NO:5, amino acids 1147-1399 of SEQ ID NO:5, amino acids 1434-1506 of SEQ ID NO:5, amino acids 1524-1950 of SEQ ID NO:5, amino acids 2056-2377 of SEQ ID NO:5, amino acids 2645-2895 of SEQ ID NO:5, amino acids 2932-3005 of SEQ ID NO:5, amino acids 3024-3449 of SEQ ID NO:5, amino acids 3555-3876 of SEQ ID NO:5, amino acids 3886-4048 of SEQ ID NO:5, amino acids 4433-4719 of SEQ ID NO:5, amino acids 4729-4974 of SEQ ID NO:5, amino acids 5010-5082 of SEQ ID NO:5, amino acids 5103-5525 of SEQ ID NO:5, amino acids 5631-5951 of SEQ ID NO:5, amino acids 5964-6132 of SEQ ID NO:5, amino acids 6542-6837 of SEQ ID NO:5, amino acids 6857-7101 of SEQ ID NO:5, amino acids 7140-7211 of SEQ ID NO:5, SEQ ID NO:6, amino acids 35-454 of SEQ ID NO:6, amino acids 561-881 of SEQ ID NO:6, amino acids 1143-1393 of SEQ ID NO:6, amino acids 1430-1503 of SEQ ID NO:6, amino acids 1522-1946 of SEQ ID NO: 6, amino acids 2053-2373 of SEQ ID NO:6, amino acids 2383-2551 of SEQ ID NO:6, amino acids 2671-3045 of SEQ ID NO:6, amino acids 3392-3636 of SEQ ID NO:6, amino acids 3673-3745 of SEQ ID NO:6, SEQ ID NO:7, amino acids 32-450 of SEQ ID NO:7, amino acids 556-877 of SEQ ID NO:7, amino acids 887-1051 of SEQ ID NO:7, amino acids 1478-1790 of SEQ ID NO:7, amino acids 1810-2055 of SEQ ID NO:7, amino acids 2093-2164 of SEQ ID NO:7, amino acids 2165-2439 of SEQ ID NO:7, SEQ ID NO:8, SEQ ID N0:10, SEQ ID NO:11, and SEQ ID NO:22.;40. An isolated polypeptide according to claim 38, wherein said polypeptide comprises a p-ketoacyl-synthase domain comprising an amino acid sequence selected from the group consisting of: amino acids 11-437 of SEQ ID NO:2, amino acids 7-432 of SEQ ID NO:4, amino acids 39-457 of SEQ ID NO:5, amino acids 1524-1950 of SEQ ID NO:5, amino acids 3024-3449 of SEQ ID NO:5, amino acids 5103-5525 of SEQ ID NO:5, amino acids 35-454 of SEQ ID NO:6, amino acids 1522-1946 of SEQ ID NO: 6, and amino acids 32-450 of SEQ ID NO:7.;41. An isolated polypeptide according to claim 38, wherein said polypeptide comprises an acyltransferase domain comprising an amino acid sequence selected from the group consisting of: amino acids 543-864 of SEQ ID NO:2, amino acids 539-859 of SEQ ID NO:4, amino acids 563-884 of SEQ ID NO:5, amino acids 2056-2377 of SEQ ID NO:5,;IPONZ;-9 JUL 2003;Case 4-30582A;-77-;amino acids 3555-3876 of SEQ ID NO:5, amino acids 5631-5951 of SEQ ID NO:5, amino acids 561-881 of SEQ ID NO:6, amino acids 2053-2373 of SEQ ID NO:6, and amino acids 556-877 of SEQ ID NO:7.;42. An isolated polypeptide according to claim 38, wherein said polypeptide comprises an enoyl reductase domain comprising an amino acid sequence selected from the group consisting of: amino acids 974-1273 of SEQ ID NO:2, amino acids 4433-4719 of SEQ ID NO:5, amino acids 6542-6837 of SEQ ID NO:5, and amino acids 1478-1790 of SEQ ID NO:7.;43. An isolated polypeptide according to claim 38, wherein said polypeptide comprises an acyl carrier protein domain comprising an amino acid sequence selected from the group consisting of: amino acids 1314-1385 of SEQ ID NO:2, amino acids 1722-1792 of SEQ ID NO:4, amino acids 1434-1506 of SEQ ID NO:5, amino acids 2932-3005 of SEQ ID NO:5, amino acids 5010-5082 of SEQ ID NO:5, amino acids 7140-7211 of SEQ ID NO:5, amino acids 1430-1503 of SEQ ID NO:6, amino acids 3673-3745 of SEQ ID NO:6, and amino acids 2093-2164 of SEQ ID NO:7.;44. An isolated polypeptide according to claim 38, wherein said polypeptide comprises a dehydratase domain comprising an amino acid sequence selected from the group consisting of: amino acids 869-1037 of SEQ ID NO:4, amino acids 3886-4048 of SEQ ID NO:5, amino acids 5964-6132 of SEQ ID NO:5, amino acids 2383-2551 of SEQ ID NO:6, and amino acids 887-1051 of SEQ ID NO:7.;45. An isolated polypeptide according to claim 38, wherein said polypeptide comprises a p-ketoreductase domain comprising an amino acid sequence selected from the group consisting of: amino acids 1439-1684 of SEQ ID NO:4, amino acids 1147-1399 of SEQ ID NO:5, amino acids 2645-2895 of SEQ ID NO:5, amino acids 4729-4974 of SEQ ID NO:5, amino acids 6857-7101 of SEQ ID NO:5, amino acids 1143-1393 of SEQ ID NO:6, amino acids 3392-3636 of SEQ ID NO:6, and amino acids 1810-2055 of SEQ ID NO:7.;46. An isolated polypeptide according to claim 38, wherein said polypeptide comprises a methyltransferase domain comprising amino acids 2671-3045 of SEQ ID NO:6.;IPONZ;-3 JUL 2003;Case 4-30582A;-78-;47. An isolated polypeptide according to claim 38, wherein said polypeptide comprises a thioesterase domain comprising amino acids 2165-2439 of SEQ ID NO:7.;48. An isolated polypeptide according to claim 38, wherein said polypeptide comprises a non-ribosomal peptide synthetase comprising an amino acid sequence selected from the group consisting of: SEQ ID NO:3, amino acids 72-81 of SEQ ID NO:3, amino acids 118-125 of SEQ ID NO:3, amino acids 199-212 of SEQ ID NO:3, amino acids 353-363 of SEQ ID NO:3, amino acids 549-565 of SEQ ID NO:3, amino acids 588-603 of SEQ ID NO:3, amino acids 669-684 of SEQ ID NO:3, amino acids 815-821 of SEQ ID NO:3, amino acids 868-892 of SEQ ID NO:3, amino acids 903-912 of SEQ ID NO:3, amino acids 918-940 of SEQ ID NO:3, amino acids 1268-1274 of SEQ ID NO:3, amino acids 1285-1297 of SEQ ID NO:3, amino acids 973-1256 of SEQ ID NO:3, and amino acids 1344-1351 of SEQ ID NO:3.;49. A recombinant host cell comprising a recombinantly expressed polypeptide according to any one of claims 38 to 48.;50. The recombinant host cell of claim 49, which is a bacteria.;51. The recombinant host cell of claim 50, which is an Actinomycete.;52. The recombinant host cell of claim 51, which is Streptomyces.;53. An isolated nucleic acid according to claim 1 or claim 3, substantially as herein described with reference to any one of examples 1 to 15 and/or the sequence listings thereof.;54. An isolated nucleic acid according to any one of claims 1 to 27, substantially as herein described with reference to any one of examples 1 to 15, and/or the sequence listings thereof.;55. A chimeric gene according to claim 28, substantially as herein described with reference to any one of examples 1 to 15, and/or the sequence listings thereof.;56. A vector according to claim 29, substantially as herein described with reference to any one of examples 1 to 15, and/or the sequence listings thereof.;IPONZ;-9 JUL2003;-79-;57. A host cell according to claim 30 or claim 49, substantially as herein described with reference to any one of examples 1 to 15, and/or the sequence listings thereof.;58. A host cell according to any one of claims 30 to 33 or 49 to 52, substantially as herein described with reference to any one of examples 1 to 15, and/or the sequence listings thereof.;59. A Bac clone according to claim 34 or claim 35, substantially as herein described with reference to any one of examples 1 to 15, and/or the sequence listings thereof.;60. A method according to claim 36, substantially as herein described with reference to any one of examples 1 to 15, and/or the sequence listings thereof.;61. An isolated polypeptide according to claim 38, substantially as herein described with reference to any one of examples 1 to 15, and/or the sequence listings thereof.;62. An isolated polypeptide according to any one of claims 38 to 48, substantially as herein described with reference to any one of examples 1 to 15, and/or the sequence listings thereof.;NOVARTIS AG;7;By Its Attorneys;BALDWIN SHELSTON WATERS;IPONZ;-s JUL2003;WO 99/66028 PCT/EP99/04171;SEQUENCE LISTING;&lt;110&gt; Novartis AG;&lt;120&gt; GENES FOR THE BIOSYNTHESIS OF EPOTHILONES;&lt;130&gt; 4-30582A;&lt;140&gt;;&lt;141&gt;;&lt;160&gt; 30;&lt;170&gt; Patentln Ver. 2.0;&lt;210&gt; 1 &lt;211&gt; 68750 &lt;212&gt; DNA;&lt;213&gt; Sorangium cellulosum &lt;400&gt; 1;aagcttcgct cgacgccccc ttcgcccgcg ccacctctgc ccgtgtgctc gacgacggcc 60 acggccgggc cacggagcgg catgtgctcg ccgaggcgcg cgggaccgag gacctccgcg 120 cccnccgaga gcacccccgc atccaggaag gggggccgtc c^tccactgc acgtgcctcg 180 gcgacctgac ggtggagctc cccgcgcacg accagccccc cgcgcccatc agcttccacc 240 acgcccgcag cccgaggcac cccgactgga cctcggacgc gatgctcgtc gacggccccg 300 cgctcgtccg gcggctcgcc gcgcgcggcg cgccgggtcc cctccgcgag tacgaagagg 360 agcgcgagcg agcccgaacc gcgcaggagg cgaggcgcct gtggctcgcg gccgcgccgc 420 cctgcttcgc gcccgatctg ccccgcttcg aggacgacgc caacgggccg ccgctcggcc 480 cgatgtcgcc tgaagtcgcc gaggccgagc ggcgcccccg cgccncgnac gcgactcctg 540 agctcgcctg tgccgcgcng ctcgcctggc tcgggacggg cgcgggtccc tggtccggat 600 atcccgccta cgagatgctg ccagagaatc tgctccccgg gtttggccnc ccgaccgcga 660 tcgccgcggc ctccgcgccc ggcacatcgg aggccgctct ccgcggcgca gcgcggctgt 720 tcgcctcctg ggaggtcgta tcgagcaaga agagccagcc cggcaacatc cccgaagccc 7B0 tgcgggagcg gccccggacg atcgtccgcg cgacgggcaa tgccgacaac ctctctcgct 840 ccgagcgcgc cgaggcgatc gcggcggagg cgcgccgccc gcgcgcacag ccggcgccct 900 tcgcggcggg cgccggcczg gcggtcgctg gggccccccc gagcggccgg ctcccgggcc 960 tcgtgaccga cggagacgca ccgtactccg gcgacggcaa cgacatcgtc acgtcccaac 1020 ccggccggat cccgccggtc gtgccgctcg ccggaaccga tcccttcctc gagcccgcac 1080 cgcccctcag ccagacgccc ctcgtcgcgc acgccaacgc gggcaccatc tccaaggtcc 1140 tgacggaagg cagccccctc accgtgatgg caagaaacca ggcgcgaccg atgagcctcg 1200 cccacgcncg cgggttcatg gcgtgggtca accaggccat ggtgcccgac cccgagcggg 1260 gcgcgccctt cgtcgtccag cgctcgacca tcatggaacc cgagcacccc acgcctcgtt 1320 gtctccacga gcccgccggc agcgccttct ccctcgcctg cgacgaggag cacctctact 1380 ggtgcgagct rtcggctggc cggctcgagc cacggcgcca cccgcaccac cgccccggcg 1440 ccccgagccg c-rcgcgtac ctcggcgagc accccattgc ggcgacccgg tacccctcgc 1500 tcaccctcaa tgcgacccac gtgccgtggg ccgaccccga ccgcagggcc atcctcgggg 1560 ccgacaagcg caccggcgta gagcccatcg tccccgcgga gacgcgccac cccccggcgc 1620 acgtcgtgtc cgaggaccgg gacatcttcg cgcttaccgg acagcccgac tcccgcgact 1660 ggcacgtcga gcacatccgc tccggcgcct ccaccgccgc ggccgactac cagcgccagc 1740 tatgggaccg ccctgacatg gtgctcaatc ggcgcggccc cttcttcacg acgaacgacc 1800 gcaccctgac gctcgcccgc agccgacatc gctcgacgcc gggccgccca ccgagggcgc 1860 ccggaccgag ctggcgaccc gccgctggcg ggccgcagct catgccgatt cggtggcgac 1920 gcagacgctg cgccagaaac gctcgagagc ccccgagaac aggaagccgg cggattgtgt 1980 catcacgatc ccgatcagct cgcggcccgg atcattgatc caggacgtcc cgaacccgcc 2040 gtcccaccca tagcgcccgg gcacctccga gaccgcgtcc ggcgccgtga ccacggccat 2100 cccataaccc cagccgtgcg tcccgaagaa gcccgggaaa aacgaggacg ccgccttccg 2160 ggccggcgtg aggtgatcgg ccgccatctc gcgcaccgag gcggcgctca agagccgccg 2220 gccctcgtgc acaccgccgc tcacgagcat gcgcgcgaac aggaggtagc cgtccaccgc 2280 cgacacgagc ccggcggcgc ccgaagggaa cgccggcggg ccggcatagg cgccctcggc 2340 cccgtcgcga tccatgcgcg tcctctcccc cgtctgctcg tcggtgaagt aaccgcagcc 2400 cgcgaaccga gcgagcttgt ccgccgggac gtgaaagtcg gtgtcccgca tcccgagcgg 2460 cgcgaggatg cgctcgcgca cgaacgcatc gaagccccgg tcggccgcgc gccccacgag 2520 caccccctgc accaggcccc ccgcgttgta cacccaccgc gcccccggct gacgcatgag 2580 cggcagcgtc ccgagccgcc ggatccactc gtccggcccg cgcggcgcca tcggcaccgg 2640;Printed from Mimosa 03/20/2002 15:55:45 page -87-;WO 99/66028;PCT/EP99/04171;-2;ctgcgcgttg acgagcccga gcccgccgat ggcccgctgg atcggcgacg acgcgtcgaa 2700 cgagaccccg aagcccatcg tgaacgtcat caggccgcgc accgtgaccg gccgctccgc 2760 gggcaccgtc tcgtcgatcg gaccatcgat gcgcgccagc accttccggt ccgcgagctc 2820 cggcaaccat cggtcgacgg gggagtcgag gccgagcttg cccccctcga cgagcaccac 2880 caccgccgtc gcggcgaccg cctccgccac cgaggcgacc cggaagaccg tgccccgccg 2940 cacgggcgcg ctgccgccga gctcggccac gcccaccgcg cccacgcgca cgncgccgcc 3000 gcgcgcgacc agccagaccg ctcccggcac ctgccccgcc gccacccccg ccgccatcac 3060 cccgcgcgcg ggcgccagcg cgccggcccc cgcgtcctgc cctggccgcc cccccccccc 3120 ggccccaccc aacgcgcacc ccggcgccgc cacgctgatc aaagctccca taaacccccg 3180 ccttctcacg accgccgacg cctctccgag cgggggcgcc tgcccctgcc gagagcactg 3240 accgcccgcg cccgaaaaaa ccaccggcgc cccgccacga tcgccgccgg gcgcggcccc 3300 gcccggccgc ccgctcgggc gcccgcccct ggacgagcaa agcccgcccg cccgcgccca 3360 gcacgccgct tgccatgccc ggcctgcacc cacaccgagg agccacccac cccgacgcac 3420 ggccccaccg agcggcaggt cccgcccccg cccgtcaccc Ccgcgctcat ccccgcgacc 3480 gcgcgcgcct ccggcgagct cgcgcggcgg ctgcgccagc ccgaggcgct cggggagctc 3540 tccggcggcg tcgtgctggg cccctccgcc gccggcgcgc ccgcgcccgg gccccatcga 3600 gccctcttce aggagccggc ggccggggcc gtgctctcgg gcaccccccg gataggcgcg 3660 ctcctcccgc tgctgatggc gggcatcgag gtcgacgtgg gcatcctgcg caaggaggcg 3720 cgccccgggg cgccctcggc gcccggcgcg accgcgcccc cgcccgcggc gggcgccgcc 3780 cccccggcgc ccgtgctcga tcggcccccc ccgagcggcc tccccctcgg gaccgcgccc 3840 ccggcgacgg cggccagcgt gatcgcgaag gtgctgatcg agcgcgagcc gatgcgccgc 3900 agctacgcgc aggtgacgcc cgcggcgggg gcggccagcg aggccgccgc ccgggcgccc 3960 gccgcgacga cgtcgccgag ccacggcgcg ccgcccgcgc tggcggtcgc ccggagcgcg 4020 ctcctggcga gcggactcct gctgcccatg gcgctcgccg ggcggcggcc cacccacctc 4080 gcgacgcgcc gggcggccga cgcgacgcgc gtccccaagg gacaggcgcc gcccgccctc 4140 gtccccacgt ccctggccgc ggcgctgacg cagcggctcg gcccgcaccc gccgcccggc 4200 gcgttcgcgc tcggcgtgcc gcccaacagc gcccctcgca ccaaccgccc tctcctcgac 4260 ggcgcgcaga cgctcgtggc gggcctcttc gcgcctgtgc cccccgcccc cgcgggcacg 4320 cgcgtcgacg tgtcgcagcc gcgcacgccg gcggcgtggg ggacggccgc gtcgctgc-g 4380 gcgaccgcga cggcggcgaa ggtcgccccc gccgcgcccg gcgcgcggcc cagcaggccc 4440 aggggcagcg aggcggcgcc cgcggcggtg ggcctgaaca cgaagggcgg cacggacccc 4500 atcgtcgcga tcgtcggcgc cgagcccggg ctcctctcca acgaggctta cacgatgcac 4560 gccgtcgccg cgctggccac ggcgaccgcc tcacccgcgc tcctcatctg gctcgagaaa 4620 agggcgcctc cgacgcagga ggagtcggcc cgccccgagc gcgaggaggc cgcgaggcgc 4680 gcgcacatcc ccggggtcga gcggatcctc gtcccgaccg tggcgcacgc cctgcccggg 4740 cccgccacgg acaccgcgga gagcaccgcc gcctccaagc gaaagctcgg cgagacggtc 4800 gacatcacgg agccctccgc ggagcagcag gcgcccggcc caccgcgcgc cgcgggggag 4860 gcgagccggg ggctcgcgag gcccggcgcg cgcccccgcg ccggcacccg gcggcaaagg 4920 cgcgagccgc gcggctcgat ccaggccacc ctgcgcgcct cgcgggacca caatccgctc 4980 gcgaccggcg cgcgaccgcc ggcgcgcgcg cgcggaacgt cgcccggccg cccgcaagac 5040 gcgaccgccc agcgggccga gtccaacgcg ctcgccgcgg cgggcgaccc cccggcggcg 5100 gagcgcgcct ccgcgcggcg gaccctcgtc ccgaccatcg gcctcgagca ccccctcgcc 5160 gccgccgacc ccgcggccca cgcggcgctg gcgcgggacg ccgagcccgc gccgctcagc 5220 agcgcgcaga ccgacccggg cgcggccgtc tggcgcgatc gcgagccatc ccgggcgcgc 5280 gcggtggcgc ggagcgtcgc cgacgaggcg gtcctccggg ggcgccggcc cggcgcgcgc 5340 gccccgccgc gcgcgcacgc gggcgcgcac ccgagcgacg agacaacgcg ggagcccgcg 5400 cgcgccccgc acgacccgcc cgcgcccgga cgccacgacc acgggccgcc cggccggccc 5460 caccccggca gcacggccga gccggcggtg gcccggagcc gggcgccggc cgcgctgccc 5520 gccgcgcatg gagggactcg agagcaggtg aggcgaggcc tccaccgcgc ccgcccgcga 5580 ggaagcgagc gcccggcccc gccgacgatc gtcacccccg gcccgcgcag gcgaccgcgc 5640 cgagcagcgc gccctccgcc tgacgcgagt cgagccgggc acgctgcacg acgacggggg 5700 cgcccgactc gaccacgctg gcatagcccg caccgcgcgg gaccggcccg ggcccggcca 5760 gatcgccgaa ccggacgcgc cgggcgcgcc ccgctggaac ggtcacccgg taaggcccgg 5820 cggggtcgcg gccgccgaag caaacggcga cggcgacccg cgcgccccgg cccgacgcac 5880 tcaacaggca ggccgcccca cggcccgcca cccgcggccc aggtccgccg cccccgcccg 5940 ggacgcagcc ccccgcgacc gcacagcgcg tccgcccgac cggcccgccc acgcgccccc 6000 ccccctggcc cctctttggc agcctccctc cgctgcccag gagcgacggc ccccccgccc 6060 aacgcgcccg gggatccacg gccgaggatc cccgccgagc gccccccgcc gaccggcgcg 6120 ccgagcgccg acgggcttcg aaagcgcgcg accggccagc ccggacgcgg gcccgagagg 6180 gacagtgggc ccgccgcgaa gcagagaggc gaccgaggcg gcgagacgaa acacgccgac 6240 acgggccgac gactcggccg ccggacaggg cacacgcccg gtcttcccgc gagcacggcg 6300 cccgccggcc gcggcggccc gagcgagaaa accgcgcagg gcacgcggcc cgcgcccggc 6360 gccgacgcgc gcgccaccgc cgacgtcgac cccgacgccg cgaccacgcg gccggcggcg 6420 gacgccgccc accccccgcc gcccgagcgg cccgaggccg gcagcgagcg gcccgccgcc 6480 tggcagcgtc cgagccccga gcccccgcgg cgacgggtcg gagtgcccga ctacaacgcc 6540;Printed from Mimosa 03/20/2002 15:55:45 page -88-;WO 99/66028;PCT/EP99/04171;-3-;gacagccgaa gaggcaagct ggccgagacg accgcgccgt atgccaactt cgagctgctc 6600 atcaccgccg agaagcagag cagccctcag tcgccatcgt ctgccgccgt catcgggccg 6660 acgtctgtcg ggtgacatcg cgctatcagc agcgctgagc ccgccagcag gccccagggc 6720 cccgcctcga tggccttccc catcacccct gcgcaccccc ccagcgacgg ccgcgcagcg 6780 acggccgcgt ccaagcaacc gccgtgccgg cgcggctcca cgcgcgcgac aggcgagcgt 6840 cccggcgcgg cctgcgcatc gctggaagga tcggcggagc atggatagag aatcgaggat 6900 cgcgatcttc gttgccatcg cagccaacgt ggcgatcgcg gcggtcaagc tcatcgccgc 6960 cgccgtgacc ggcagctcgg cgaggcgcct gccgacttcg gcggcgtccc gcgcgtgctg 7020 ctctacgaca acctcaagag cgccgtcgcc gagcgccacg gcgacgcgac ccggttccac 7080 cccacgctgc tggctctgtc ggcgcattac cgcttcgagc cgcgccccgt cgccgtcgcc 7140 cgcggcaacg agaagggccg cgcccagcgc gccaccacgg cgtggacgac acggcgcgga 7200 aacgccgtcg taaccgccca gcaatgtcat gggaacggcc ccttgaaatg gccccctgag 7260 ggggctggcc ggggtcgacg atatcgcgcg atctccccgt caattcccga tggtaaaaga 7320 aaaatttgtc acagatcgta agctgtgata gtggtctgtc ttacgttgcg ccttccgcac 7380 ctcgagcgag ttctctcgga taactttcaa cctctccgag gggggcttgg tccccggtcc 7440 ctcaggaagc ctgaccggga cgagctaatt cccatccact ttttcgaggc tctgctcaaa 7500 gggatcagat cgagcgagac agttcttttg cagtgcgcga agaacctggg cctcgaccgg 7560 aggacgatcg acgtccgcga gcgggtcagc cgctgaggat gtgcccgtcg tggcggatcg 7620 tcccatcgag cgcgcagccg aagatccgat cgcgaccgtc ggagcgagtt gccgtccgcc 7680 cggtggcgtg atcgatctga gcgggttctg gacgctcctc gagggctcgc gcgacaccgc 7740 cgggcgagtc cccgccgaac gctgggatgc agcagcgtgg tttgatcccg accccgatac 7800 cccggggaag acgcccgtta cgcgcgcatc tctcctgagc gacgcagcct gcttcgacgc 7860 ccccttcttc ggcatctcgc ctcgcgaagc gctgcggatg gaccccgcac atcgactctc 7920 gctggaggtg tgccgggagg cgctggagaa cgccgcgaec gctccatcgg cgctcgccgg 7980 tacggaaacg ggagtgttca tcgggatcgg cccgtccgaa catgaggccg cgctgccgca 8040 agcgacggcg tccgcagaga tcgacgctca tggcgggctg gggacgacgc ccagcgccgg 8100 agcgggccga atctcgtatg ccctcgggct gcgagggccg tgtgtcgcgg tggatacggc 8160 ctattcgtcc tcgctggtgg ccgttcatct ggcctgtcag agcttgcgct ccggggaatg 8220 ctccacggcc ctggctggtg gggtatcgct gatgttgtcg ccgagcaccc tcgtgtggcc 8280 ctcgaagacc cgggcgctgg ccagggacgg ccgccgcaag gcattctcgg cggaggccga 8340 cgggcccgga cgaggcgaag ggcgcgccgc cgcggccctc aagcggctca gcggagcccg 8400 cgcggacggc gatcggacat tggcggtgac ccgaggaccc gcgatcaacc acgacggcgc 8460 gagcagcggc ctgaccgtgc cgaacgggag cccccaagaa accgcgccga aacgggcccc 8520 ggcggacgca ggccgcgccg cgtcctcggc cggccatgtc gaggcacacg gcacgggcac 8580 gacgcttggt gaccccaccg aaatccaagc cctgaatgcg gtatacggcc ccgggcgaga 8640 tgtcgccacg ccgctgctga tcgggtcggc gaagaccaac cctggccatc ctgagtatgc 8700 gtcggggacc accgggctgc tgaaggtcgc crcgtcccct cagcacgggc agatccctgc 8760 gcacctccac gcgcaggcgc tgaacccccg gatctcatgg ggcgaccttc ggccgaccgc 8820 cacgcgcgcc cggacaccgt ggccggaccg gaatacgccg cgacgggcgg gggtgagctc 8880 gtccggcacg agcgggacca acgcgcacgc ggtgctggaa gaggcgccgg cggcgacgtg 8940 cacaccgccg gcgccggagc gaccggcaga gctgccggtg ctgtcggcaa ggaccgcgtc 9000 agccctggat gcacaggcgg cgcggctgcg cgaccatctg gagacccacc ccccgcagcg 9060 cccgggcgat gcggcgctca gcccggcgac gacgcgcagc gcgatggagc accggcccgc 9120 ggtggcggcg acgccgaggg aggggctgcg ggcagccctg gacgccgcgg cgcagggaca 9180 gacgtcgccc ggtgcggtgc gcagtaccgc cgattcctca cgcggcaagc tcgcctttct 9240 ccccaccgga cagggggcgc agacgctggg catgggccgt gggctgtacg atgtatggtc 9300 cgcgttccgc gaggcgttcg acctgtgcgt gaggccgttc aaccaggagc ccgaccggcc 9360 gctccgcgag gcgatgtggg ccgaaccggc cagcgccgac gccgcgctgc tcgaccagac 9420 agcctccacc cagccggcgc tgttcacctt cgaatatgcg ctcgccgcgc Cgtggcggcc 9480 gtggggcgta gagccggagt tggtcgccgg ccatagcatc ggtgagctgg tggctgcctg 9540 cgtggcgggc gcgctctcgc ctgaggacgc ggtgctcctg gcggccgcgc gcgggcgccc 9600 gatgcaggcg ccgccggccg gcggggcgat cgtgtcgatc gaggcgccgg aggccgatgc 9660 ggctgccgcg gtggcgccgc acgcagcgcc cgtgccgacc gccgcggtca acgccccgga 9720 ccaggtggtc accgcgggcg ccgggcaacc cgtgcatgcg atcgcggcgg cgacggccgc 9780 gcgcggggcg cgaaccaagg cgctccacgt ctcgcacgcg ttccactcac cgctcacggc 9840 cccgatgctg gaggcgttcg ggcgtgtggc cgagtcggtg agctaccggc ggccgtcgat 9900 cgtcctggtc agcaatctga gcgggaaggc ccgcacagac gaggtgagct cgccgggcta 9960 ttgggtgcgc cacgcgcgag aggtggtgcg cctcgcggat ggagcgaagg cgctgcacgc 10020 ggccggcgcg ggcaccttcg tcgaggtcgg tccgaaatcg acgctgctcg gcctggtgcc 10080 tgcctgcatg ccggacgccc ggccggcgct gctcgcatcg tcgcgcgctg ggcgtgacga 10140 gccggcgacc gtgctcgagg cgctcggcgg gctctgggcc gtcggtggcc tggtctcctg 10200 ggccggcctc ttcccctcag gggggcggcg ggtgccgctg cccacgtacc cttggcagcg 10260 cgagcgctac tggatcgaca cgaaagccga cgacgcggcg cgtggcgacc gccgtgctcc 10320 gggagcgggt cacgacgagg tcgaggaggg gggcgcggtg cgcggcggcg accggcgcag 10380 cgctcggctc gaccatccgc cgcccgagag cggacgccgg gagaaggtcg aggccgccgg 10440;Printed from Mimosa 03/20/2002 15:55:45 page -89-;WO 99/66028 PCT/EP99/04171;-4-;cgaccgtccg ttccggctcg agatcgatga gccaggcgcg cttgatcacc ccgtgcttcg 10500 ggccacggag cggcgcgccc ctggtctggg cgaggtcgag atcgccgtcg acgcggcggg 10560 gctcagcttc aatgatgtcc agctcgcgct gggcatggtg cccgacgacc tgccgggaaa 10620 gcccaacccc ccgctgctgc tcggaggcga gtgcgccggg cgcatcgtcg ccgtgggcga 10680 gggcgtgaac ggcctcgtgg tgggccaacc ggccaccgcc ctttcggcgg gagcgttcgc 10740 tacccacgtc accacgtcgg ctgcgctggt gccgcctcgg cctcaggcgc tctcggcgat 10800 cgaggcggcc gccatgcccg tcgcgtacct gacggcatgg tacgcgctcg acagaatagc 10860 ccgccttcag ccgggggagc gggtgctgat ccatgcggcg accggcgggg tcggtctcgc 10920 cgcggtgcag cgggcgcagc acgtgggagc cgaggtccat gcgacggccg gcacgcccga 10980 gaaacgcgcc tacctggagt cgctgggcgt gcggtatgtg agcgattccc gctcggaecg 11040 gttcgtcgcc gacgtgcgcg cgtggacggg cggcgaggga gtagacgtcg tgctcaactc 11100 gctcccgggc gagctgatcg acaagagttt caatctcctg cgatcgcacg gccggtttgt 11160 ggagctcggc aagcgcgact gttacgcgga taaccagccc gggccgcggc cgtccccgcg 11220 caatctctcc ttctcgctgg tggacctccg ggggatgatg ctcgagcggc cggcgcgggt 11280 ccgtgcgctc ttggaggagc tcctcggcct gatcgcggca ggcgtgttca cccctccccc 11340 catcgcgacg ctcccgaccg cccgtgtcgc cgatgcgttc cggagcatgg cgcaggcgca 11400 gcatcttggg aagctcgtac ccacgctggg tgacccggag gcccagaccc gtattccaac 11460 ccacgcaggc gccggcccgt ccaccgggga tcgggacctg ctcgacaggc Ccgcgtcagc 11520 tgcgccggcc gcgcgcgcgg cggcgctgga ggcgttcctc cgcacgcagg tctcgcaggt 11580 gccgcgcacg cccgaaatca aggccggcgc ggaggcgccg ttcacccgcc tcggcatgga 11640 ctcgctcatg gccgtggagc tgcgcaatcg tatcgaggcg agcctcaagc tgaagctgtc 11700 gacgacgttc ctgtccacgt cccccaatat cgccttgttg gcccaaaacc tgttggatgc 11760 tctcgccaca gctctctcct tggagcgggt ggcggcggag aacctacggg caggcgtgca 11820 aaacgacttc gtcccaccgg gcgcagatca agaccgggaa atcaccgccc tatgacgatc 11880 aatcagcttc tgaacgagct cgagcaccag ggtatcaagc tggcggccga tggggagcgc 11940 ctccagatac aggcccccaa gaacgccctg aacccgaacc tgctcgctcg aatctccgag 12000 cacaaaagca cgatcctgac gatgctccgt cagagactcc ccgcagaacc catcgtgccc 12060 gccccagccg agcggcacgc tccgtttcct ctcacagaca tccaagaatc ctactggctg 12120 ggccggacag gagcgtttac ggtccccagc gggatccacg cctatcgcga atacgactgt 12180 acggatctcg acgcgccgag gctgagccgc gcctttcgga aagtcgtcgc gcggcacgac 12240 acgctccggg cccacacgct gcccgacatg acgcaggcga tcgagcccaa agtcgacgcc 12300 gacatcgaga tcaccgatct gcgcgggccc gaccggagca cacgggaagc gaggctcgtg 12360 tcgttgcgag acgcgatgtc gcaccgcatc tacgacaccg agcgccctcc gctctatcac 12420 gtcgtcgccg ttcggctgga cgagcggcaa acccgccccg tgctcagtat cgatctcatc 12480 aacgttgacc taggcagccc gtccatcatc cccaaggact ggcccagcct ctacgaagat 12540 cccgagaccc ctcrccctgt cctggagctc tcgtaccgcg attatgtacc cgcgctggag 12600 tctcgcaaga agtctgaggc gcaccaacga tcgatggatt actggaagcg gcgcaccgcc 12660 gagctcccac ctccgccgac gcntccgatg aaggccgacc catctaccct gaaggagacc 12720 cgcttccggc acacggagca atggctgccg tcggacccct ggggtcgatt gaagcggcgt 12780 gtcggggagc gcgggctgac cccgacgggc gtcatcctgg ccgcattttc cgaggtgatc 12840 gggcgctgga gcgcgagccc ccggtttacg ctcaacataa cgctcttcaa ccggctcccc 12900 gtccatccgc gcgtgaacga tatcaccggg gacttcacgt cgatggtcct cctggacatc 12960 gacaccaccc gcgacaagag cctcgaacag cgcgctaagc gtattcaaga gcagctgcgg 13020 gaagcgatgg atcactgcga cgtaagcggt accgaggtcc agcgagaggc cgcccgggtc 13080 ctggggatcc aacgaggcgc attgttcccc gtggtgctca cgagcgcgct taaccagcaa 13140 gtcgttggtg tcacctcgtt gcagaggctc ggaactccgg tgtacaccag cacgcagact 13200 cctcagctgc tgctggatca tcagctctac gagcacgatg gggacctcgt cctcgcgtgg 13260 gacatcgtcg acggagtgtt cccgcccgac cttctggacg acatgctcga agcgtacgtc 13320 gtttttctcc ggcggctcac tgaggaacca tggggtgaac aggtgcgctg ttcgcttccg 13380 cctgcccagc tagaagcgcg ggcgagcgca aacgcgacca acgcgctgcc gagcgagcat 13440 acgctgcacg gcctgttcgc ggcgcgggtc gagcagctgc ccatgcagct cgccgcggtg 13500 tcggcgcgca agacgctcac gtacgaagag ctttcgcgcc gttcgcggcg acttggcgcg 13560 cggctgcgcg agcagggggc acgcccgaac acattggtcg cggtggtgat ggagaaaggc 13620 tgggagcagg ttgtcgcggt tctcgcggtg ctcgagtcag gcgcggccta cgtgccgacc 13680 gacgccgacc taccggcgga gcgtatccac taccccctcg accatggcga ggcaaagccc 13740 gtgctgacgc agccacggcc ggatggcaaa ctgccatggc cgccggggat ccagcggccg 13800 ctcgtgagcg aggccggcgc cgaaggcgac ggcgaccagc ccccgatgat gcccattcag 13860 acaccttcgg atctcgcgta tgtcatctac acctcgggat ccacagggtt gcccaagggg 13920 gtgacgatcg atcatcgggg cgccgtcaac accatcctgg acatcaacga gcgcttcgaa 13980 atagggcccg gagacagggt gctggcgccc tcctcgctga gcttcgatct ctcggtctac 14040 gatgtgttcg ggatcccggc ggcgggcggt acgatcgtgg tgccggacgc gtccaagctg 14100 cgcgatccgg cgcactgggc agagttgatc gaacgagaga aggcgacggc gcggaacccg 14160 gtgccggcgc tgatgcggat gctcgtcgag cattttgagg gtcgccccga ttcgctcgct 14220 aggtccccgc ggctttcgcc gctgagcggc gactggatcc cggtgggccc gcccggcgag 14280 ctccaggcca tcaggcccgg cgcgtcggtg atcagcctgg gcggggccac cgaagcgtcg 14340;Printed from Mimosa 03/20/2002 15:55:45 page -90-;WO 99/66028 PCT/EP99/04171;atccggccca tcgggtaccc cgtgaggaac gccgacctat cgtgggcgag catcccctac 14400 ggccgtccgc tgcgcaacca gacgttccac gtgctcgatg aggcgcccga accgcgcccg 14460 gtctgggttc cggggcaact ctacattggc ggggtcgggc tggcactggg ctaccggcgc 14520 gatgaagaga agacgcgcaa gagcttcctc gcgcaccccg agaccgggga gcgcctctac 145B0 aagaccggcg atctgggccg ctacctgccc gatggaaaca tcgagttcat ggggcgtgag 14640 gacaaccaaa tcaagcttcg cggataccgc gttgagctcg gggaaatcga ggaaacgccc 14700 aagtcgcacc cgaacgcacg cgacgcggcg accgcgcccg ccgggaacga cgcggcgaac 14760 aagccccccc cagcctatgt ggccccggag ggcacacgga gacgcgccgc cgagcaggac 14820 gcgagcccca agaccgagcg gatcgacgcg agagcacacg ccgccgaagc ggacggcttg 14880 agcgacggcg agagggcgca gttcaagccc gcccgacacg gaccccggag ggacccggac 14940 ggaaagcccg tcgtcgatct gaccgggcag gacccgcggg aggcggggcc ggacgcccac 15000 gcgcgccgcc gtagcgtccg aacgcccccc gaggccccga ttccgtttgt tgagtttggt 15060 cgatccccga gccgcccgag cagcgcggag cccgacggcg cgacccttcc caaaccccgc 15120 cacccaccgg cgggcagcac gcacccggcg caaaccCacg cgcacgccaa acccggccgc 15180 accgagggcg cggacgaggg cccctactac taccacccgt tcgagcaccg tctgctgaag 15240 ccctccgacc acgggaccga gcgcggagcg cacgcccggc aaaacttcga cgcgcccgac 1E300 gaagcggcgc ccaacctcct gttcgcgggc aggatcgacg ccatcgagtc gccgcacgga 15360 ccgccgccgc gagaactttg cctgctggag gccggacaca cggcgcagcc cctgatggag 15420 caggcgcctc cccgcaacat cggcgcctgc ccagtggggc aatccaattt tgaacaggct 15480 cggccggccc ccgacctgcg acattcggac gtttacgcgc acggcacgcc gggcgggcgg 15540 gcagacccgc ggcagctcca ggcccgcacg cccggccagg accccccacc gaggcgcgcc 15600 acgacgcgcg gcgccccccc cggccgcgag cagcaccccg ccgatatgct tcgcgacctc 15660 ccgaggacca aaccacccga gcacacggtg cctacagccc ccgcggagcc cgatgcgttg 15720 ccgccgacgc ccaacggcaa ggtcgaCcgc aaggccccgc gcgagcggaa ggacaccccg 15780 tcgccgcggc acccggggca cacggcgcca cgggacgccc cggaggagat ccccgccgcg 15840 gccgcacggg aggtgctcgg gccggaggcg gccgggcccc agcagagctc cgtcgatccc 15900 ggcgcgacac cgactcacat cgcccgcacg aggagcccgc cgcagaagag gccggacagg 15960 gagaccgcca ccaccgagcc gtcccagcac ccgaacctcg gcccgccggc gcccggcccg 16020 cgccgagacc cgagagatct agatcagcgg ccgaacacgc aggaccgagc ggaggttcgg 16080 cgcaagggca ggagacgcag ccaagagcgc cgaacaaaac caggccgagc gggccgacga 16140 gccgcaagcc cgcccgcgcc accccgggac ccacctgacc cgaccgcggg tacgcgccgc 16200 gggcgtgcgc gctgagccgc gctgtccgaa cgctgaggaa cggcgagctc atggaagaac 16260 aagagtcctc cgccaccgca gccaccggca cgccgggccg ccccccgggg gcgcgagatc 16320 cggacgaact ccggaggaac cctcgagacg gcacggaggc cgcgcagcgc ccccccgagc 16380 aggagcccgc ggcgcccgga gtcgaccccg cgccggcgcc ggacccgagc tacgcccggg 16440 cgggcagcgc gccggaagac gccgaccggt Ccgacgctgc tccccccggc accagcccgc 16500 gcgaggcaga gctcatggat ccgcagcacc ggatccccac ggaacgcgcc cgggaggcgc 16560 cggagaacgc cggatacgac ccgacggctt acgagggctc tatcggcgtg tacgccggcg 16620 ccaacatgag ctcgcacccg acgccgaacc tccacgagca cccagcgacg acgcggcggc 16680 ccggccggcc tcagacgttg atcggcaacg acaaggatca ccccgcgacc cacgcccccc 16740 acaggccgaa cctgagaggg ccgagcatct ccgttcaaac tgcctgctcc accccgcccg 16800 cggcggctca cccggcgtgc atgagccccc cggaccgcga gtgcgacatg gcgctggccg 16860 gcgggatcac cgcccggatc ccccaccgag ccggccacgc acacgctgag gggggcatct 16920 tctctcccga cggccattgc cgggccttcg■acgccaaggc gaacggcacg atcatgggca 16980 acggccgcgg cgctgtcctc ccgaagccgc tggaccgggc gccccccgat ggcgaccccg 17040 cccgcgcggc tacccccggg cctgccacaa acaacgacgg agcgaggaag accgggccca 17100 ccgcgcccag cgaggtgggc caggcgcaag cgaccatgga ggcgctggcg ccggcagggg 17160 tcgaggcccg gtccatccaa tacatcgaga cccacgggac cggcacgctg ctcggagacg 17220 ccaccgagac ggcggcgccg cggcgggcgc tcggccgcga cgctccggcc cggaggcccc 17280 gcgcgatcgg ctccgtgaag accggcatcg gacaccccga accggcggcc ggcaccgccg 17340 gcccgaccaa gacggccccg gcgccggagc accggcagcc gccgcccagc ccgaaccccg 17400 agccccccaa cccatcgatc gatttcgcga gcagcccgtt ctacgtcaat acctccctta 17460 aagattggaa taccggcccg accccgcggc gggccggcgt cagctcgtcc gggatcggcg 17520 gcaccaacgc ccacgccgcg ccggaggaag cgcccgcggc gaagccccca gccgcggcgc 17580 cggcgcgccc tgccgagctc ctcgccgtct cggccaagag cgcagcggcg ctggatgccg 17640 cggcggcacg gctacgagat catccgcagg cgcaccaggg gactccgttg ggcgacgccg 17700 cccccagccc ggcgacgacg cgcagcccca cggagcaccg gctcgcgacg gcggcgccgt 17760 cgcgcgaggc gtcgcgagag gggctcgacg cagcggcgcg aggccagacc ccgccgggcg 17820 ccgtgcgtgg ccgccgcccc ccaggcaacg tgccgaaggc ggtcttcgcc tttcccggcc 17880 agggccccca gcgggccggc acgggccggc agcccccggc cgaggaaccc gcctcccacg 17940 cggcgccccc ggcgcgcgac cgggccaccc aggccgaagc tggctggccg ccgcccgcgg 18000 agcccgccgc cgacgaaggg ccctcccagc tcgagcgcat cgacgtggcg cagccggcgc 18060 cgtccgccct cgcggcggca ctcgcggcgc cgcggcggcc gcggggcgcc gcgcccgacg 18120 tcgcgaccgg ccacagcacg ggcgaggcag ccgccgcgca cgcggccggg gcgccgccgc 18180 ccgaggacgc ggcggcgacc acccgccggc gcagccggcc gccccggcgc accagcggcc 18240;Printed from Mimosa 03/20/2002 15:55:45 page -91-;WO 99/66028;PCT/EP99/04171;-6-;agggcgagae ggcggcgacc gagctgtegc tggccgaggc cgaggcggcg ccccgaggcc 18300 acgaggatcg ggtgagcgtg gccgtgagca acagcccgcg ctcgacggcg ctctcgggcg 18360 agccggcagc gatcggcgag gcgctgtcgt ccctgaacgc gaagggggcg ttctgccgcc 18420 gggcgaaggc ggatgccgcc agccacagcc cgcaggccga cccgccgcgc gaggacccct 18480 tggcagccct gggcgggctc cggccgggtg cggctgcggc gccgacgcgc ccgacggcga 18540 cgggcgccac ggtagcgggc ccggagcccg gagcgaacca ccggacgaac aaccccaggc 18600 agccagcgcg ccccgccgag gcagcccagg cgcagcccca aggcggccac ggcccgtccg 18660 tggagatgag cccgcatccg accccaacga cttcggtcga ggagacgcgg cgcgcggccc 18720 agcgggcggg cgcagcggcg ggcccgccgc ggcgggggca ggacgagcgc ccggcgacgc 18780 cggaggcgcc gggcacgccg cgggcgcagg gccaccccgc accccggggg cggccgcccc 18840 ccgcgggggg gcggcgggca ccgccgccga cctacccctg gcagcgcgag cggtaccgga 18900 ccgaagcgcc ggccaagagc gccgcgggcg accgccgcgg cgcgcgcgcg ggcggccacc 18960 cgccccccgg tgaaacgcag accccgccaa cccagacgag cacgcggccg Cgggagacga 19020 cgccggatcc caagcggccg ccgcggctcg gcgaccaccg ggcgcaggga gcggccgcgc 19080 ttccgggcgc ggcgcacccg gagacggcga tttcgtcggg ggccgaggct ttgggcgacg 19140 gccccccgca gacaaccgac gcggcgcccg ccgaggcgcc ggcccccgcg ggcgacgcgg 19200 cggcgctggc ccaggcggcg acgacggagc agccgccggg gcggccgcag ctccagaccg 19260 cgagccgggc gccgggcgcc ggccacgcgc ccccccgggc ccacgcccgc ggcgcgttgc 19320 cccgagcgga gcgcaccgag gtcccggccg ggcccacgct ccccgctgcg cgcgcgcggc 19380 cccaggccag cacacccgcc gcggccaccc acgcggagcc gaccgagacg gggccgcagc 19440 acggccctgc ctcccagggg attgctgagc catggcgggg cgaaggcgag gcgctgggac 19500 gggcacgccc gcccgacgcg gccggctcgg cagcggagta ccggccgcat cccgcgccgc 19560 cggacgcgCg cccccagacc gccggcagcc ccttcgcccg cagcggcgag gcgacgccgc 19620 gggcgcccgc ggagccgggc ccgccgcggc tctcgcagcg gcccccgggg gagccgcggc 19680 gccatgcgcg cgtcgtgaac cacgggcacc aaacccccga ccggcagggc gccgaccccc 19740 gggcggccga caacccgggc gcagcggtcg ccgaagcccg cgggcccgcg gcgcagcggc 19800 ctccgggagg ggcgegccgg cgcgaagaag acgattggtt cccggagccc gagcgggaac 19860 ccgcagcggc cggcacagcc aaggtcaacg cgggccggcg gccgcccccc ggcggcggcg 19920 gtgggcCcgg cgccgcgtcg cgcgcgacgc cggaggccgg cggccacgcc gccgcgcatg 19980 cggcagagaa caacacgagc gccgccggcg tacgcgcgct cctggcaaag gcctccgacg 20040 gccaggctcc gacggcgccg gtgcacctcg gcagcctcga cgggggcggc gagcccgacc 20100 cagggctcgg ggcgcaaggc gcaccggacg cgccccggag cgccgacgcc agtcccgatg 20160 cccccgaccc ggcgccggta cgcggccgcg acagcgcgcc ccggaccgcg caggccccgg 20220 ccggcacggg cccccgagac gccccgcgac cgtggccttt gacccgcggc gcacaggccg 20280 ccggcgccgg cgacgccccc gcgacacagg caccgctgcc ggggccgggc cgcgccatcg 20340 ccacggagca cgcggacccg cgccgcgccc gggccgaccc cgacccagcc cggcccgagg 20400 gggagcccgc cgccccgccg gccgagccgc cggccgacga cgccgaagcg gaagccgcgt 20460 cgcgcggcgg cgagcgacgc gccgctcgga ccgtccgccg gcagcccgag acccggcccc 20520 gggggaggat caagagctgc attccgaccg acgtcaccat ccgcgcggac agcacctacc 20580 ccgcgaccgg cggtccgggt gggcccggcc cgagcgcggc cggacggccg gccgagcgcg 20640 gcgctggtca cccggtgccg gcgggccgcc ccggcgcggc gagcgcggag caacgggcag 20700 ccgccgcggc gcccgaggcc cgcggcgcgc gcgccaccgc ggcgaaggcg gatgtcgccg 20760 accgggcgca gcccgagcgg accccccgcg aggctaccac gccggggacg ccgccgcggg 20820 gcgccgccca cgcggccggc accttggacg acgggccgcc gacgcagcag actcccgcgc 20880 ggttCcgcaa ggcgacggcg cccaaggccc agggggcctc gcacctgcac gcgccgacgc 20940 gcgaagcgcc gcctcccctc ttcgcgccgt acgcttcggg agcagggccc tcgggctcgc 21000 cgggccaggg caaccacgcc gcggccaaca cgttccccga cgccccggcg caccaccgga 21060 gggcgcaggg gccgccagcg ctgagcgtcg actggggccc gcccgcggag gcgggcatgg 21120 cggccgcgca ggaagatcgc ggcgcgcggc tggtctcccg cggaacgcgg agcctcaccc 21180 ccgacgaggg gccgcccgcc ccggcacggc cgcccgaaag cggccgcgcc caggcggggg 21240 cgacgccggc gaacccgcgg ccgcgggcgg agccctaccc cgcggcggcg cctccgcgaa 21300 cgtcgccgcg cccggcgacg gcgcaccgcg cgagcgccgg cgggccagcc ggggacgggg 21360 acccgccccg ccgccccgcc gccgccgagc cgagcgcgcg gagcgcgccc ccggagccgc 21420 ccccccgcgc ccagaccccg caggcgccgc gcccccccga gggcaagatc gaggcggacg 21480 ccccgcccac gagcccgggc acgaacccgc cgacggggcc cgagccgcgc aaccgcaccg 21540 aggccatgct gggcaccacc gcaccggcaa cgctgctgtg gacccacccc acggcggcgg 21600 cgccgagcgg gcatcCggcg cgggaggcac gcgaagccgc ccccgcggag tcaccgcaca 21660 ccaccgccga ccctgccgcc gagatcgagg agacgcccca ggacgatctg acgcagtcga 21720 ccgcagcaaa acccaaggcg cctacacgac tactcgcggt cccacggcac agcagaaccc 21780 gccgaaacaa gcggccacca ccactcagcg gccggaggag cggcccgctg ggcccgcaca 21840 ggcggagctg gaacggaccg agccgatcgc catcgtcggt atcggccgcc gcctccccgg 21900 cggtgcggac gccccggaag cgttttggga gctgctcgac gcggagcgcg acgcggtcca 21960 gccgctcgac acgcgccagg cgctggtggg tgtcgctccc gccgaggccg tgccgcaccg 22020 ggcggggccg cccaccgagc cgacagattg cctcgatgcc gcgtcccccg gcacctcgcc 22080 tcgggaggcg cgaccgctcg acccgcagca ccgcctgttg ccggaggccg ctcgggaggg 22140;Printed from Mimosa 03/20/2002 15:55:45 page -92-;WO 99/66028 PCT/EP99/04171;gcccgaggac gccggcatcc cgccccggcc cggcgctttc acggcggact acgcgcgcac cgcgtacagc gccaccggca acacgcccag ggggttgcag ggacctcgcc cgaccgccga ccaccccgcc cgccgcagcc cgcgcgcagg cagcgcgccc cccccccccg acacgacgga cgatggccgc cgccggaccc ccgacgcccc cggcccggtc gcccccaaac ggccccccga gctgatccgg ggctcggcca ccaaccatga cgtgccggcc caggagacgg ccccgcgcga ggccgcegac tacgccgaga cccacggaac cgaggcgccg cgggcgacgg tggggccggc cgcggtgaag accaacatcg gccaccccga ggcagcgctt tcgctgacgc acgagcgcat cccgcggacc cggctcgagg gcagcgcgct gcgcacggac cgcccgcgcc tcgcgggggc gcacgcggcg ctggaagagg cgccggcggt ggcggagctt tcggcgccgt cgggcaagag gccgcgcgag cacctggaca cgcacccgga ggcgacgacg cgcagcgcga cgagccaccg gccgccggcg gcgcccccgg ccgcggcgca caccgcgagc ccctcgcgcg gcaagccggc gccgggcatg ggccgggggc cccgcgcggc gcgcgcggcg ccgtccgacc gggagctgga ggcggggagc gccgagccgt tgccgcccga cgcggcggag tacgcgctga cggcgccgtg ggccgggcat agcaccgggg agccggcggc agacggggcg aggcccgtgg cggcgcgcgg cgcgacggcg ccgcccggag cgccggaggc ggcgccggcg ccgaccgcgg cggtcaatgg gcaagcggtg caggcgaccg cggcggggcc gcacgccccg cacgcgctcc acccgccgcc ggcggcggcg ccggcgacgc accggcggcc gaaggcggcc acggacgagc cgagcgcgcc ggtgcgcctc gcggacgggg cgaaggcgcc agcgggcccg aagccgacgc cgcccgggcc gacgctgccg gcgccgccgc gcgccgggcg gggcaggctg cgggccgccg gcggcccggc gcggcgggcg ccgccgccga cccacccgcg ggccgaaggg ctcggagcca cggccgccga ccggcccgag acgccccgcc cacccgcgga ggcgccggcc gaccggggcg gagccgggga acgctcgcgc gccgtgctcc acgcgcccgc ccaggccctc ggcggccgca acgaccggca cgccgcggag gcgggggcac cggccgaaga gccggcgctc gcgccgaccc aggcgcccgg cgCgacccga ggggcctgca cggcgggcgg gctgcggggt atgggccggg ccgcggcgcc ggacctggat ccggaggaga gcccgacgga gccggacgcc gaggatcagc cggcaccccg ggccgcccca ccggagggaa acgcagcgcc ggcgacgggc gggccgggcg cccccggccc ggcggggcac cccgtgccga tcagccggca agaccagccg ccagaggcgc gcgcgcgcac cacgcgggcc accgcggcgg cggccgacgc ggcggccgcc gagccgccgc tgcggggggt gccgccggcc caccaggacg ccggccggcc ggcacgggcg ccgcacaccc ccacccgcga cccggcgccg ggcgccctcg gcccgaccgg cccggacgcg ccggcggacc cccgccgaac gggcccgcgg gcggaggggg ggacgggccc gggaacccgg gcgacgccga cgagccgggc gcgcgcgacg cagcgcgcgg ccatccagac cgacgcgagc cgaggccgcc cccgggaccg cccggccgcg ccagccgcgg agcgccggcg caccgacggg agccgcaccg gcgcgcccgc 22200 ggccgcccgg ccgccgcgcg aggagcgaga 22260 caccgccgcc ggacggctgc cgcacacgcc 22320 cacggcgtgc ccgccaccgc cggcggcgac 22380 agagagcgat ctcgcgccgg cgggaggggc 22440 agccgcggcg cgcacgcaag cgccgccgcc 22500 ggccaacggg tccgtccgcg gcgagggccg 22560 cgcgcaacgg gacggcgacc gcacccgggc 22620 cggccggccg accgggctga ccgcgcccaa 22680 ggcgccgcgg agcgcccacg ccgaagccgg 22740 agggaccccg ccgggcgacc ccaccgaggc 22800 gcgccccgac ggcacacgcc gcgcgccggg 22860 ggccgcggca ggcgCagcgg gcccgaccaa 22920 cccgagaaac ctcaacttcc gcacgcccaa 22980 cgcgCtggcg accgagccgg cgccgcggcc 23040 gagcccgttc gggacgagcg gaacgaacgc 23100 ggagccgcgg cccgccgcgc cggagcgccc 23160 cgagggggcg cccgacgcgc aggcggcgcg 23220 gcccgggccc ggggacgcgg cgcccagccc 23280 gctcgcggcg gcggcgacgc cgcgcgaggg 23340 ggggcagacg ccggcggggg cggcgcgccg 23400 gtccccgtcc accggacagg gcgcgcagac 23460 gcggccagcg ccccgggagg cgcccgaccg 23520 ccgcccgccg cgcgaggcga cgcgggcgga 23580 ccagacggcg tccacccagc ccgcgccctt 23640 gcggccgtgg ggcgcagagc cggagccccc 23700 ggcgtgcgcg gcgggggcgc ccccgccgga 23760 gcggccgacg caggggcccc cggcgggcgg 23820 ggaggcggcg gcggcggcgg cgccgcacgc 23880 gccggagcag gcggcgaccg cgggcgcgga 23940 cgcggcgcgc ggcgcgcgca ccaagcggcc 24000 gacggaaccg acgccggagg agcccgggcg 24060 aagcgttccg ccggtgagca acccgagcgg 24120 ggggcaccgg gcgcggcacg cgcgggaggc 24180 gcacgaagcc ggcgcgggga cgctcgtcga 24240 gccgccagcc cgcctgccgg aggcggagcc 24300 cgaggaggcc gcgggggcgc ccgaggcgcc 24360 cagccggccg ggcgcccccc ccacggccgg 24420 gcagcggcag cggcaccgga ccgaggcgcc 24480 cgcgccggcg cagcggcccc accgggcgga 24540 cccgcggcga gcccggcccg gcgggcggcc 24600 ggcggccgcg gcggcgcctc cgccgcaggg 24660 cgaggcctcc gcggccgccg agcaggcgac 24720 gggggtgccg tacctgcggg gcccggacgc 24780 ggccgccaaa gccacccacc ccgccgcggc 24840 cacggggccg cgctcacccc ggccccggac 24900 cgagcccgac gctgcccccc gccaggcggc 24960 agagcacccc ggcccccggg gcgggcccgt 25020 ggtcgaggcc ctggtggccg agccgcttcc 25080 ccaggggcgc cggcgcgcag cgcggcccgc 25140 ggtgccgccg cccgcggagg ggagccaccc 25200 ccccgctgcg cggcggccgg cggagcgcgg 25260 cggattgccc gaccgcgagg aacggggccg 25320 cgcggcgacc gaggcgccgg aggcgcaggg 25380 ggccgacgcc gaaggcacgg cggcgccccc 25440 agcgcacgcc gcgggtctgc ccgacgacgg 25500 cgcccgggcg tcgcgcccca aggcggaggg 25560 gcagccgccg gaccccctcg caccgccccc 25620 ccagggcagc cacgcggcag gcaacgcccc 25680 gcaggggccc gccgccccga gcaccgcccg 25740 gcaggcgcag cgccgggaac acgaggcacc 25800 cccggcggcg acggaatggc cgcccggcac 25860 ggaccgggcc cacgcgggag cggcgccgcg 25920 gccggcaacc gccacgaaag aggccccctc 25980 caacgcgcct gctgcggaga cccgcccggc 26040;Printed from Mimosa 03/20/2002 15:55:45 page -93-;WO 99/66028;PCT/EP99/04171;-8-;gccctacgag cttgtgcgcg gcgtggtcgc cggggcgacg ggccccaccg accagggcac 26100 gcccgacgcg cgacgaggct tcgccgagca gggcctcgac cccccgacgg ccgcggagat 26160 ccgcaaacgg cttcagggtg agctgggtat gccgccgccg gcgacgccag cgttcgacca 26220 tccgaccgcg gagcggccgg tggaacactt gccgagccag gcgccggagc tgcaggaccg 26280 caccgacgcg cggagcgttc ggttgccggc gacagaggac ccgaccgcca tcgtgggtgc 26340 cgcccgccgc cccccgggcg gggtcgagga cctggagr.cc caccggcagc cgccgaccga 26400 gggcgtggcg gccagcaccg aggcgccggc cgaccggtgg aacggggcag acgggcgcgt 26460 ccccggctcg ggagaggcac agagacagac ccacgcgccc aggggcggcc ttccgcgcga 26520 ggcggagacg ttcgacgcgg cgcccctcca catcccgccc cgggaggcga tgagcctgga 26580 cccgcaacag cggccgccgc tggaagtgag ctcggaggcg accgagcgcg cgggccagga 26640 cccgtcggcg ccgcgcgaga gccccacggg cgcgcccgcg ggcgcgggcc ccaacgaata 26700 tgccgagcgg gcgcaggaac ccgccgatga ggcggcgggg ctccacagcg gcaccggcaa 26760 catgctcagc gctgcggcgg gacggctatc atttttcccg ggcccgcacg ggccgaccct 26820 ggctgtggat acggcgtgct cctcgtcgct ggtggcgctg caccccggct gccagagctt 26880 gcgacggggc gagcgcgacc aagccctggt cggcggggcc aacacgctgc ccccgccgaa 26940 gacctccgcg ccgcccccac ggacgcacgc acccccgccc ggcgggcggc gcaagacgcc 27000 cccggccgac gcggacggcC acgcgcgggc cgagggccgc gccgcggcgg cgcccaagcg 27060 gccccccgac gcgcagcgcg accgcgaccc caccccggcg gcgacccggg gcacggcgac 27120 caaccacgac ggcccgagca gcgggccgac agtgcccagc ggccccgccc aggaggcgcc 27180 gccacgccag gcgccggcgc acgcaggggc ggccccggcc gacgccgacc ccgcggaacg 27240 ccacgggacc gggacggcgc cgggcgaccc gaCcgaggcg cgcgcgccga gcgacgcgca 27300 cgggcaagcc cgccccgcgg accgaccgcc gaccccggga gccgccaagg ccaaccccgg 27360 gcacacggag cccgcggcgg gcccggccgg cctgcccaag gcggcgcccg cgccggggca 27420 agagcaaaca ccagcccagc cggagccggg cgagcccaac ccgcccccgc cgcgggaggc 27480 gccgccggcg gcggcggccc gcgcagcggc gccgcggccg cgcacggacc gcccgcgccc 27540 cgcgggggcg agcccgcccg ggaCgagcgg aacgaacgcg cacgcggcgc cggaagaggc 27600 gccggcggcg gagccgcggc ccgccgcgcc ggagcgcccg gcggagcccc cggcgccgcc 27660 gggcaagagc gagggggcgc ccgacgcgca ggcggcgcgg ccgcgcgagc acccggacac 27720 gcacccggag cccgggcccg gggacgcggc gctcagcccg gcgacgacgc gcagcgcgac 27780 gaaccaccgg cccgcggcgg cggcgacgcc gcgcgagggg ccgccggcgg cgccctcggc 27840 cgcggcgcag gggcagacgc cgccgggggc ggcgcgccgc accgcgagcc cgccgcgcgg 27900 caagccggcg cccccgccca ccggacaggg cgcgcagacg ccgggcacgg gccgggggcc 27960 ccgcgcggcg cggccagcgc Cccgggaggc gcccgaccgg cgcgcggcgc cgcccgaccg 28020 ggagccggac cgcccgccgc gcgaggcgac gcgggcggag ccggggagcg ccgagccgcc 28080 gccgcccgac cagacggcgc ccacccagcc cgcgcccctc acggcggagt acgcgccgac 28140 ggcgccgcgg cggccgcggg gcgcagagcc ggagccggtg gccgggcaCa gcgccgggga 28200 gccggcggcg gcgcgcgcgg cgggggcgcc cccgccggaa gacggggtga ggcccgcggc 28260 ggcgcgcggg cggccgacgc aggggccccc ggcgggcggc gcgatggtgc cgcccggagc 28320 gccggaggcg gaggcggcgg cggcggcggc gccgcacgcg gcgccggcgc cgaccgcggc 28380 ggccaacggg ccggagcagg cggcgaccgc gggcgcggag caagcggcgc aggcgaccgc 28440 ggcggggccc gcggcgcgcg gcgcgcgcac caagcggccg cacgccccgc acgcgcccca 28500 cccgccgccg acggaaccga cgccggagga gcccgggcgg gcggcggcgc cggcgacgca 28560 ccggcggcca agcgccccgc tggcgagcaa cccgagcggg aaggcggccg cggacgagcc 28620 gagcgcgccg gggcaccggg cgcggcacgc gcgggaggcg gcgcgctccg cggacggggc 28680 gaaggcgccg cacgaagccg gcgcgggcac gcccgccgaa gcgggcccga agccgacgct 28740 gcccgggccg ccgccagccc gcccgccgga ggcggagccg acgccgccgg cgccgccgcg 28800 cgccgggcgc gaggaggccg cgggggcgcc cgaggcgccg ggcaggctgc gggccgccgg 28860 cggctcggcc agccggccgg gcgccccccc cacggccggg cggcgggcgc cgccgccgac 28920 ctatccgcgg cagcggcagc ggtactggcc cgacaccgag cecgacagcc gtcgccacgc 28980 agccgcggac ccgacccaag gccggcccca ccgcgcggac tggccggaga caccccgcag 29040 cccccagaaa ccagaggagg cgagccgcgg gagccggccg gcaccggcgg acaagggcgg 29100 agccggcgag gcggccgccg cagcgccgcc gacacgcgga cccccacgcg ccgcgcccca 29160 cgcgccggca gagacatccg cgaccgccga gccggcgacc gaggccgccg gcggccgaag 29220 cgaccggcag gcagcgcccc acccgcgggg cctggacgcc gccgccggcg cggaggcgcc 29280 gaccgacgag accggcgacg cgacccgccg cgccaccgcg ccggcgcccg gcccggcccg 29340 gcctccgagc accgcgcccc gcccgccccg accccgggcc gcgacccggg gggcacgcac 29400 cgccggcgac gagcccgcga ccgccccctg ccaggcggcg ccacggggca cgggccgggc 29460 ggcggcgccc gagcaccccg gggcccgggg cgggcccgcg gacccggacc cccgagcgag 29520 cccgccccaa gccagcccga ccgacggcga gacgcccgcc accgagccac cgccgcagga 29580 gaccgaggac cagcccgccc cccgccacgg gcgccggcac gcggcacggc cggcggccgc 29640 cccgccacag gggcaagcgg caccggcgcc gctgtccgcg gaggcgagcc acccggtgac 29700 gggaggcccc ggcgggccgg gcccgaccgc ggcccagcgg ccggcggagc cgggagcgcg 29760 gcacccggca ccgaccagcc ggcgcgggcc gcccgaccgg caggcgtggt gcgagcagca 29B20 gccgcccgag acccgcgcgc ggaccgcagc ggccgaggcg ccggaggcgc ggggcgcacg 29880 ggcgaccgcg gcagcggcgg acgcggccga cgtcgaaccg acgacagcgc cggcctcgcc 29940;Printed from Mimosa 03/20/2002 15:55:45 page -94-;WO 99/66028;PCT/EP99/04171;-9-;ggtcgagccc ccgctgcgag gggcggtgca cgccgctggc gtcagcgtca cgcgcccacc 30000 ggcggagacg gacgagaccc cgcccgagcc ggtgctccgc cccaaggtgg ccgggagctg 30060 gctgctgcac cggccgccgc acggccggcc tctcgacccg tccgcgctgt ccccgccggg 30X20 cgcagcggtg cggggcagcc acagccaggg tgcgtacgcg gcggccaacg ccccccccga 30180 cgggcccgcg cacccccggc gcccgcaacc gccgcccgcg ccgagcgccg cgcggggccc 30240 gtgggccgag ggaggcacgg cggacgcgga ggcccacgca cgcccgagcg acaccggggc 30300 cccgcccacg ccgacgccgg cagcgccgcc ggcgccccag cgcccggcgg agaccggcgc 30360 ggcccagcgc acggtgaccc ggatggactg ggcgcgctcc gcgccggcgc acaccgcccg 30420 agggcgtcgc aacccgccct cggcgccggc cgcagggcgc gacatcaccg cgcccccccc 30480 cccggcggca gcaacccgga accggcgcgg cctgtccgcc gcggaagccc gcgcggcccc 30540 gcacgagacc gcccacgggg ccgccgcccg ggcgccgggc cccctcgacc cgagcgcgcc 30600 cgaccccggg atggggccca acgagcaggg ccccgacccg ccgacggcgg cggagacccg 30660 caaccccccc caggccgagc cggacgcgcg gcctccgacg acgccggccc ctgaccaccc 30720 gacggcacag cggccggcgg agcatctgcc cgccgatgca ccgaagccgg aggaccgcag 30780 cgacacccag catgcccggc cgccggcgcc agacgagccc accgccaccg cgggagccgc 30840 ccgccgcctc ccgggcgggg cggaggaccc ggagccctac cggcagccac cggccgaggg 30900 cgcggcggtc agcgccgagg cgccggccga ccggtgggat gcggcggacc ggcacgaccc 30960 cgacccggag aCcccaggcc ggacccacgc gaccaaaggc gcccccccgc gcgacccgca 31020 gagaccggac gcgacctccc cccgcatccc gccccgcgag gcgacgagcc ccgacccgca 31080 gcagcggccg cccccggagg caagcCggga agcgctcgag agcgcgggca ccgccccgga 31140 cacgccgcga gacagcccca ccggggtgcc cgcgggcgcg gggcccaacg agcaccacac 31200 gcagcggccg cgaggcctca ccgacggagc ggcagggccg cacggcggca ccgggaacac 31260 gcccagcgct acggccggac ggccgccgct ccccccgggt ccgcacggcc cgacgccggc 31320 cacggacacg gcgcgcccgc cacccccggc cgcgccgcac cccgcccgcc agagcccgcg 31380 accgggcgag cgcgaccaag cgccggctgg cggggccaac gcgccgcccg cgccggagac 31440 ccccgcgccg ctcccacgga cgcgcgcgcc cccgcccgac gggcggcgca agacgccccc 31500 ggccgacgcg gacggccacg cgcggggcga ggggcgcgcc gcggcggcgc ccaagcggcc 31560 gcgcgacgcg cagcgcgccg gcgaccccac cctggcgctg acccggggaa gcgcggcgaa 31620 ccacgacggc ccgagcagca ggccgaccgc acccaacgga cccgcccagc aagcaccgcc 31680 □cgccaggcg ccctcgcaag caggcgcgcc cccggccgac gccgatcccg cggagcgcca 31740 cgggacaggg acggcgccgg gcgacccgac cgaggcgcag gcgccgagcg aggcgcacgg 31800 cccagggcgc cccggggacc gaccgccggc gccgggggcc gccaaggcca acgccgcgca 31860 cctggaggcg gcacccggcc cggccagccc gctcaaggcc gcgcttgcgc tgcggcacga 31920 gcagaccccg gcccagccgg agccggggga gcccaacccg cacccgccgc ggaacacgcc 31980 gccggcggcg gcgccacgca aggcggcgcc gcgggggcgc ggcgcacgcc cgcgccgggc 32040 cggcgcgagc gcgcccgggc cgagcggaac caacgcgcac gccgcgccgg aggaggcacc 32100 ggaggcggag ccggcgcccg cggcgccggc gcgaccggcg gagccggccg cgccaccggc 32160 caagagcgcg gcggcgccgg acgccgcggc ggcacggccc ccggcgcacc cgcccgcgca 32220 cccggagccg agccccggcg acgcggcgcc cagcctggcg acgacgcgca gcccgacgga 32280 gcaccggccc gccaccgcga cgaccccgcg cgaggccccg cgaggcgcgc cggacgccgc 32340 ggcgcagcaa aagacgccgc agggcgcggc gcgcggcaag gccgcgcccc cacgcggcaa 32400 gccggcctcc ccgcccaccg gacagggcgc gcaaacgccg ggcacgggcc gcgggccgca 32460 cgaaacgtgg cccgcgcccc gggaggcgcc cgaccggcgc gcggcgcccc ccgaccggga 32520 gaccgaccag cccccgcgcg aggcgacgcg ggccgcgccg ggccccgccc aggcggcgcg 32580 gcccgaccag accgcgcacg cgcagccggc tcccctcgcg ccggagcacg cgccggccgc 32640 cccgcggcgc ccgcggggcg cggagccgca cgcaccgccc ggccacagca ccggcgagcc 32700 ggccgccgcc cgcgcggcgg acgcgccccc gcccgaagac gcggcgaggc cggcggccgc 32760 gcgcgggcgg ccgacgcagg cgccacccgc cggcggcgcc acggcagcca ccgcagcgtc 32820 cgaggccgag gcggccgccc ccgcggcgcc ccacgccgcc acggcgccga ccgccgcggc 32880 caacggtcct gacgccgccg cgatcgccgg cgccgaggca caggtgcccg cccccggcgc 32940 gacgcccgcg gcgcgcggga cacgcacgaa gaggcccgcc gccccccacg cgccccaccc 33000 gccgcccacg gacccgacgc cggaagacct ccagcgggcc gccgcgacga ccgcgcaccg 33060 cgcgccagac cgcccggcgg cgccgaacgt caccggccac gccgcaggcc ccgagaccgc 33120 cacgcccgag caccgggccc ggcacgcgcg aagcgccgcg cgccccggcg acggggcaaa 33180 ggcgccgcac gccgcgggcg ccgccacgcc cgccgaggcc ggcccgaagc cggccccgcc 33240 cgggccgccg ccagcgcgcc ccggggaagc ggacgcggcc cccgcgccgc cgccacgcgc 33300 ggaccgcccg gaacgcgagg cggcccccgc ggcgcccggg gcccggcacg cccggggggg 33360 cgcgcccgac cggaagggcg cgccccccga cggcgcgcgc cgcgcggccc tgcccacgca 33420 cccacggcag cgcgagcgcc accggacgga ccccaccccg cgaagcgccg cgcccgcagg 33480 gaccgcaggc cgccggccgc cggccggcgc cgggccccgc acgcccggcg ctgcgccgca 33540 ccacgcgccc ccgaccggac cacgccatca gccccccccc ggcgaccacc tcgcgtccgg 33600 caaggcggcg gcgcccggcg ccccccacgc cgcggcgacc cccagcaccg ccgccgagcg 33660 ccggcccgag cgggcgaccg agccgacagg cgcggagccc ccgaaggcca ccgcgacgga 33720 gcccgaccag gaggccgagc "ccacgccgc gcccaccccc gaagccgccg gggacggcca 33780 cctgcccgag ccggcgaccc cggcggcgcc ggagaccgaa cgccgacgga cgacccacgc 33840;Printed from Mimosa 03/20/2002 15:55:45 page -95-;WO 99/66028;PCT/EP99/04171;-10-;ccgcggccgg gtgcagccga cagaeggcgc gcccggcgcg ttgccgcgcc ccgaggcgcc 33900 ggaggaccgc gcgatccagc ccctcgactt cgccggattc ctcgacaggt catcggcggt 33960 gcggaccggc cggggtccgc tttggcgacg gccgcaggac gggcgcgccg gcgacgaggc 34020 cccgcttgcc acccccgcgc cgacctatcc gaacgcccac gacgcggcgc ccctgcaccc 34080 gatcctgctg gacaacggcc ttgcggtgag cccgctgtca acccggagcg agccggagga 34140 cgacgggacg cccccgctgc cgttcgccgt ggaacgggcg cggtggtggc gggcgccggt 34200 tggaagggcg cggcgtggcg gcgtgccgcg gtcgcaggca ttcggtgtct cgagcttcgt 34260 gccggccgac gaaactggcg aggcggccgc cgaggcggag ggacccgccc gccgccgggc 34320 gccgcgagag gtgctcccgc ggcaggagcc gggcgcgccg accgcagccc tgcaccgccc 34380 cgaccggccc gaagcgcccc cgcccgatgc gcccgcggaa cggatcgagg agagccgggc 34440 cgtggcggca gcacccggcc cggagacggc cgcggcgccc gcaacacggc tcaaccgctg 34500 cgcccccgcc gaacccaaag gcctcgaggc ggcccccgcg ggggtgcctc ccgcaggcgc 34560 gatctgcctc tgggaggccg gagcccacga ggaagccccg gcggcggcgc agcgcgcggc 34620 gaccgagggc ctctcggtgg tgcaggcgct cagggaccgc gcggcgcgcc cgcggcgggc 34680 gaccacgggc gcagcggccg ccgaggccgg cgagcgggcg caggtcgcca cagcgccggc 34740 atggggcccc ggccggacag Cgatgcagga gcgcccggag cccagccgca ccctggcgga 34800 tccggagccg gaggccgacg cagcgcgccc agccgacgct ccgttgcggg agcccggccg 34860 cgccgacgac gagacacagg cggccctecg tcccggaaag cgccgcgcag cgcggctggc 34920 caaagcgacg acccccgaag ggcccccggc ccctgacgca gagccccacc gaccggaggc 34980 tgggcaaaag ggcacattgg accagccccg cctcgcgccg gcacagcgcc gggcacccgg 35040 cccgggcgag gccgagacca aggtaaccgc cccggggccc aacctccgga ccgtcctcgc 35100 tgtgctggga atgcatccgg gcgacgccgg gccgacgggc ggagaccgtg ccggtgtcgc 35160 cacggcggcg ggccaggggg tgcgccacgc cgcggtcggc gacgccgtca cgacgccggg 35220 gacgttgcat cgactcgtca cggccgacgc gcggctggcg gcccggcagc ccgcagggcc 35280 gacccccgcg caggcagcca cggcgccggc cgcgcccccg acggcccggc tcgctccgca 35340 cgacctgggg aacctgcggc gcggcgagcg ggcgctgatc catgctgcgg ccggcggtgt 35400 gggcatggcc gcggcgcaaa tcgcccgacg gacaggggcc gaggcgttcg ccacggcgag 35460 cccgtccaag tgggcagcgg ttcaggccat gggcgcgccg cgcacgcaca tcgccagctc 35520 gcggacgctg gagttcgctg agacgtcccg gcaggccacc ggcggccggg gcgcggacgc 35580 ggtgctcaac gcgctggccg gcgagttcgt ggacgcgagc ctgtccctgc tgtcgacggg 35640 cgggcggttc ctcgagatgg gcaagaccga catacgggat cgagccgcgg tcgcggcggc 35700 gcatcccggt gcccgccacc gggcattcga catcctggag ctcgctccgg accgaactcg 35760 agagatcccc gagcgcgtgg tcgagggccc tgccgcggga cacccgcgcg caccgccggt 35820 gcatgcgttc gcgatcacca aggccgaggc agcgtcccgg ctcatggcgc aagcgcggca 35880 tcagggcaag gtcgtgctgc cgccggcgcc ctccgcagcg cccttggcgc cgacgggcac 35940 cgtactgctg accggcgggc tgggagcgtt ggggctccac gtggcccgct ggctcgccca 36000 gcagggcgcg ccgcacatgg cgcccacagg tcggcggggc ccggacacgc cgggcgctgc 36060 caaagccgtc gcggagaccg aagcgctcgg cgcccgggcg acgaccgcgg cgtcggacgt 36120 cgccgaccgg aatgcgctgg aggctgtgcc ccaggccatt ccggcggagt ggccgttaca 36180 gggcgtgacc cacgcagccg gagcgcccga cgacggcgcg cttgatgagc agaccaccga 36240 ccgcttctcg cgggtgctgg caccgaaggc gactggcgcc tggaatctgc acgagctcac 36300 ggcgggcaac gatctcgctt tcttcgcgct gttctcctcc atgccggggc ccccgggccc 36360 ggccgggcag tccaactacg cggcggccaa cacctccccc gacgcgctgg ccgcgcaccg 36420 gcgggccgaa ggcccggcgg cgcagagccc cgcgcggggc ccacggccgg acggaggcat 36480 ggcagcgggg ctcagcgcgg cgctgcaggc gcggctcgcc cggcacggga cgggagctct 36540 gccgccggcc cagggcaccg cgccgcccgg gcaggcgccg gctcggccgg aaacgcagcc 36600 cggggcgacg tcgctcgacg cgcgcgcggc aagccaagcc tcgggagcgg cagcgccgcc 36660 Cgtgtggcgc gcgttggcgc gcgcggaggc gcgccacacg gcggccgggg cgcagggggc 36720 actggccgcg cgccttgggg cgctgcccga ggcgcgtcgc gccgacgagg tgcgcaaggt 36780 cgtgcaggcc gagatcgcgc gcgtgctctc atggagcgcc gcgagcgccg cgcccgtcga 36840 tcggccgctg tcggacttgg gcctcgactc gctcacggcg gcggagctgc gcaacgtgct 36900 cggccagcgg gcgggtgcga cgctgccggc gacgccggca cccgaccacc cgacggtcga 36960 cgcgctcacg cgccggccgc ccgacaaggc cccggccgcg gccgagccga gcgcatcgtc 37020. cgcaaagccg ccgccgcagg ccgccctcga cgagcccacc gccatcaccg gcaccggccg 37080 ccgtttccca ggcggcgtgg ccgatccgga gtcgtctcgg cggctgctcg aagagggcag 37140 cgacgccgcc gccgaggcgc cgcatgagcg atgggacatc gacgcgttct atgatccgga 37200 tccggatgtg cgcggcaaga cgacgacacg ccccggcggc cccctgcccg acaccgaccg 37260 gttcgatccg gccttctCcg gcaccccgcc gcgcgaagcg acgaccacgg acccgcagca 37320 gcggccgccc ctggagacga gctgggaggc gttcgagcgc gccgggattt cgcccgagcg 37380 gctgatgggc agcgataccg gcgtgttcgt ggggctcccc caccaggagt acgctgcgct 37440 cgccggcggc atcgaggcgc tcgacggcca tctaggcacc ggcaccacgg ccagcgtcgc 37500 cccgggcagg atctcctatg tgcccgggct aaaggggccg agcctgacgg tggacaccgc 37560 gcgctccccg ccgccggccg cggcgcaccc ggcccgccag gcgctgcggc ggggcgagcg 37620 tccggtggcg ctggccggcg gcgcggcgcc gatgcccacg ccggcgacgc ccgcggagct 37680 cagccggctg cgaggcctgg ctcccgacgg acggtgcaag agccccccgg ccgcagccga 37740;Printed from Mimosa 03/20/2002 15:55:45 page -96-;WO 99/66028;PCT/EP99/04171;-11 -;cggcgcgggg tggagcgaag gccgcgccac gctcctgctc aaaccgcccc gcgacgcgca 37800 gcgcgacggg gacccgaccc tggcggcgac ccgcggcacc gcggcgaacc aggacgggcg 37860 cagcaacggg ctgacggcgc ccaacgggtc gtcgcagcaa gaggcgaccc gccgggcccc 37920 ggagcaggcg gggccggccc cggcggacgc cagccacgcc gagcgccacg gcaccggcac 37980 gacgttgggc gaccccaccg aagtgcaggc cccgggcgcc gcgccggcac aggggcgacc 38040 cccggaccgg ccgcccgega tcgggtcggc gaagtccaat atcggacata cgcaggccgc 38100 ggcgggcgtg gccggcgcca ccaaggcggc gccggcgccc gagcgcgggc ccaccccgag 38160 gagcctgcac cccgacgcgc ccaacccgca cattccgtgg ccggagcccg ccgtgcaggc 38220 ggccgccaaa cccgtcgaac ggacgagaaa cggcgtgccg cgacgagccg gggtgagccc 3 8280 gcccggcgcc agcgggacca acgcgcacgc ggtgctggag gaggcgccag cggcggcgcc 38340 cgcgcccgcg gcggcgcgct cagcggagct cctcgtgctg tcggcgaaga gcgccgcggc 38400 gctggacgcg caggcggcgc ggccctcggc gcacgccgct gcgcacccgg agcccggcct 38460 cggcgacctg gcgctcagcc cggcgacgac ccgcagcccg atgacgcacc ggctcgcggt 38520 ggcggcgacc ccgcgcgagg cgctgtctgc cgcgcccgac acagcggcgc aggggcaggc 38580 gccgcccgca gcggcccgcg gccacgcttc cacaggcagc gccccaaagg tggtcttcgc 38640 cccccccggc cagggccccc agcggccggg catgggccaa aagccccccc cggaggagcc 38700 cgtcttccgc gacgcgctct cggcgcgtga ccgagcgact caggccgaag ccggccggcc 38760 gccgcccgcc gagcccgcgg ccgacgagac cacctcgcag ctcggccgca tcgacgtggc 38820 gcagccggcg ccgctcgcga ccgaggtcgc gccgccggcg ccgcggcggc cgcggggcgc 38880 cgagccggac gcagcggcag gccacagcac gggcgaagcg gcggccgcgc acgccgccgg 38940 cgccccgccg cccgaggacg ccgcagcgac cacccgccgg cgcagcccgc cgccgcggcg 39000 gaccagcggc caaggcgaga cggcggccgc cgagcccccc ccggccgagg ccgaggcagc 39060 gcccccgggc cacgaagacc ggcccagcgc ggcggcgagc aacagcccgc gcccgacggc 39120 gccggcgggc gagccggcag cgcccgcaga ggcgccggcg acccccgcgg caaagggggc 39180 gccccgccgc cgagccaagg cggacgccgc cagccacagc ccacagaccg acccgccgcg 39240 cgacgagcca ccggcagcac cgggcgagcc cgagccgcga caagcgaccg cgccgacgcg 39300 cccgacggcg acgagcacga ccacggcggg cccggagccc gcggcgagcc accgggcgga 39360 caacgcccga cagccggcgc gccccgccga agcggtgcaa tcgccgatgg aagacggtca 39420 cgggccgccc gcggagacga gcccgcaccc gaccccgacg acatcggccg aggagacccg 39480 acgggcgacg aagcgggagg gagccgcggc gggcccgccg cggcgcggac aggacgagcg 39540 cccgcccacg ccggaggcgc cgggagcgcc ccgggcacac ggccaggcgg cgggccggga 39600 gcggccgccc cccgcgggcg gcgcgggcct ccgccgcgcg ccgccgccga cccacccccg 39660 gcagcgcgag cggcaccggg ccgacgcgcc gaccggcggc gcggcgggcg gcagccgccc 39720 cgcccacgcg ggcagccacc cgcccccggg tgaaaCgcag accccgccga cccagaggag 39780 cacgcgcgcg cgggagacga cgccggaccc caaacggctg ccgcggcccg gcgaccaccg 39840 ggcgcagggg gcggccgcgc ccccgggcgc ggcgcacccg gagacggcgc ccccgcccgg 39900 ggccgaggcc ccgggcgacg gcccgcccca ggccagcgac gcggcgcccg ccgaggcgcc 39960 ggcccccgcg gacgacacgc cggcggcggc gcaggccacg gcgaccgagg agcgaccagg 40020 ccgcccgcaa ccccacgccg cgagccgggc gccgggccac ggcggcgccg ccccccgaag 40080 ccacgcccgc ggggcgcCgc gccagaccga gcgcgccgag gccccggcga ggccggaccc 40140 ggccgcgccc cgcgcccggc cccaggccag cgcacccgcc gcggccaccc acgcggcgcc 40200 ggccgagacg gggcccgagc acggcccagc gccccagggg cccgccgagc cgcggcgggg 40260 ggagggcgag gcgccgggac gcgcgcggcc ccccgaggcc gccggccccc cagccgcgcg 40320 ccggccccac cccgcgcccc cggacgcgtg cccccacgtg agcagcgccc tcgccgaccg 40380 cggcgaggcg acgccacggg cacccgcgga aaccggcccg ccgcggcggc cccagcggcc 40440 gccgggggag ccgcggcgcc acgcgcggag tgCgagccac ggaaagccaa cacccgaccg 40500 gcggagcacc gacccccggg cggccgacag cacgggcgcg accgccgccg agacccccgg 40560 gcccgcggcg cagcggcccg cgggaggcgc acgccggcgc gaagaagacg accggcccac 40620 ggagccggct tgggaaccga ccgcggtccc cggatccgag gtcatggcgg gccggcggcc 40680 gcccaccggc ccgggcggcg ggcccggcgc tgcgccccac ccggcgccga cggaagctgg 40740 ccactccgcc gcccacgcga cagggcgcgg cacgagcgcc gccgggccgc aggcaccccc 40800 gacggcgccc cccgacggcc aggccccgac gccggcggcg caccccggca gccccgacga 40860 gcgcggcgcg cccgacgcgg acgccccccc cgacgccgac gcgcccgagg agccgccggc 40920 gcgcggccgc gacagcgcgc cccggaccgc gcaggccgcg gccggggcgg gcccccgaga 40980 ccccccgcgg ccgcggcccg cgacacgcgg cgcccaggcc accggcgccg gcgacgcccc 41040 cgcggcgcaa gcgccgcccc cggggccggg ccgcgccacc gccccggagc acgccgagcC 41100 gcgccgcgcc cggaccgacc ccgacccagc gcggcgcgac ggagaagccg atgagccgcc 41160 cgccgagccg ccggccgacg acgccgagga ggaagccgcg ccccgcggcg gcgagcggcg 41220 cgcggcccgg cccgcccgaa ggccgcccga gaccgaccgc cgagagaaaa ccgagcccgc 41280 ggaaggccgg ccgccccggc cggagaccga cgggcccggc gcgcccgacg acccggcgcc 41340 ccgagccacg gagcggcgcc cccccggccc gggcgaggcc gagaccgccg ccgaggcggc 41400 ggggcccaac ccccccgacg cgacgagggc cacggggacc caccccgggc ccggggacgg 41460 cccggccgcg ccgggcgccg agcgccccgg ccgaaccgtc gcgacgggcg aaggcgtcga 41520 gagcccccgc accggccagg acgccgcggc cgccgcgccc cccagccccg gcacccacgc 41580 caccaccgac gcccggacgc ccgcaccccg ccccgcggcg ccgacggccg cgcaggcagc 41640;Printed from Mimosa 03/20/2002 15:55:45 page -97-;WO 99/66028;PCT/EP99/04171;-12-;cgcgcCgccc gccgcatcca tgacggcctg gtacggtctc gcccatctgg ggaggccccg 41700 ggccggcgag cgcgcgctca cccacccggc gacggggggc accgggctcg ccgccgcgca 41760 gaccgcccgc caccccggcg cggagacacc cgcgaccgcc ggcacaccgg agaagcgggc 41820 gcggccgcgc gagcagggga ccgcgcacgc gacggacccg cggccgccgg accccgccaa 41880 gcaagcgccg gccgcgacga agggcgaggg ggccgacgcc gcgccgaacc cgccgcccgg 41940 cgccgcgacc gacgcgagcc cttcgacccc cgcgccggac ggccgctcca ccgagcccgg 42000 caagacggac acccatgcag atcgcccgcc ggggcccgcc caccccagga agagcccgcc 42060 ccacagcgcc gccgaccccg cgggcccggc cgcgcgccgg cccgagcgcg ccgcagcgcc 42120 gccggcggag gcggtggacc cgcccgcacg gggagcgccg cagccgcccc cggcagagac 42180 cccccccccc ccgcgggccg cggacgcccc ccggaaaacg gcgcaagcgc agcaccccgg 42240 gaagcccgcg cccgcgccgg aggacccgga cgcgcggacc cgcgtcccgg gcgaatccgg 42300 cgccgccacc cgcgcggacg gcgcctaccc cgcgaccggc ggcccggggg ggcccggccc 42360 gagcgcggcc ggatggctgg ccgagcaggg ggccgggcat ctggtgctgg cgggccgccc 42420 cggcgcggtg agcgcggagc agcagacggc tgccgccgcg cccgaggcgc acggcgcgcg 42480 cgccacggca gcgagggcag acgccgccga ccgggcgcag acggagcgga ccccccgcga 42540 ggccaccgcg tcggggacgc cgccccgcgg cgrcgcccac gcggccggaa ccccggacga 42600 cgggccgccg aegcagcaaa cccccgcgcg gccccgcgcg gccacggcgc ccaaggcccg 42660 aggggccccg cacccgcacg cgccgacacg cgaagcgccg ccccccctcc ccgcgccgca 42720 cgccccggga gcagggcccc cgggcccgcc gggccagggc aaccacgccg cggccaacac 42780 gccccccgac gcaccggcac accaccggag ggcgcagggg ccgccagcac cgagcaccga 42840 ccggggcccg cccgcggacg cgggcccggc cgccgggcag caaaaccgcg gcgcacggcc 42900 ggccacccgc gggacgcgga gccccacccc cgacgaaggg ccgcgggcgc ccgagcgccc 42960 gcccgacggc gaccgcaccc aggccggggc cacgccgccc gacgcgcggc agcgggtgga 43020 gccccacccg gcggcggcac ccccgcggag gccgccgcgg cccacgacgg cacggcgcgc 43080 ggcccccggc cggcccgccg gggaccggga cctgcccgaa cggcccgcca ccgccgaggc 43140 gggcgcgcgg gcagggacgc cgcaggaggc cgcgcgcgcg caggccccgc aggcgccgcg 43200 cccccccgaa ggcaagcccg acgcggacgc gccgcccacg agcccgggaa cggactcgcc 43260 gacggggcca gagccgcgca accgcaccaa ggccgcgctc ggcaccacca tgccggcgac 43320 cccgccgcgg acccacccca cggcggcagc gccgagcgcg cacccggcct ctcacgccgc 43380 ccccacgggg gacggggaac ccgcgcaccc gccggacaca gggagcgcgg ccccaacgac 43440 ccacgaagcc gccccgcccg acgaagacgg gccgcccgcg ccgaccgacg agccacccgc 43500 gcgcgcggga aagaggcgac cgcgcgacag accgagaagg ccagcccccg gagcgcccgc 43560 gcgaggccac cccggccccc cgcaagacgc cgaacgagcg cgacaccccg gagcccgaga 43620 agaccgagcc gaccgccacc gcggggaccg gccgccgccc ccccggcgga gcgggcaccc 43680 cggaggcgcc ccgggagccg cccgacgacg ggcgcgacgc gacccggccg ctcgaggagc 43740 gccgggcgcc cgcaggcgcc gacccaggcg acgacgcacc gcgccgggcg gggccgccca 43800 ccgaggccac cgacggcccc gacgccgcgc cccccggcac cgccccccgg gaggcacggc 43860 cgcccgaccc gcagcaccgc ccgccgccgg aggccgcccg ggaggggccc gaagacgccg 43920 gcaccccgcc caggcccccc gccgggagcc gcaccggcgc gcccgccggc guccgcgcca 43980 cggagcaccc ccacgccgcc gccgcgcacc agccgcgcga agagcgggac gcgcacagca 44040 ccaccggcaa cacgcccagc accgccgccg gacggccacc gcacacgccg gggccgcagg 44100 gaccccgccc gaccgccgac acggcgtgct cgccatcgcc ggcggccact caccccgccc 44160 gccgcagccc gcgcgcccga gagagcgacc ccgcgccggc gggaggggcc aacacgcccc 44220 ccccccccga cacgaCgcga gccccggcgc gcacccaggc gccgccgccc aacggccgcc 44280 gccagacccc cgacgcgccg gccaacgggt tcgcccgcgg ggagggccgc ggtccgaccg 44340 cgcccaagcg accgagcgac gcgcggcggg acggggaccg gacccgggcg ccgacccgag 44400 gaccggccac caaccaggac ggccggccga cggggccgac ggcgcccaac gcgcccgccc 44460 agggggcgcc cccgcgcgag gcgccgcgga acgccggcgc cgaggccgag gccaccggcc 44520 acaccgagac ccacggggcg gcaacctcgc egggcgacce caccgagacc gaagcgccgc 44580 gcgccgcggc ggggccggcg cgagccgacg gagcgcgccg cgcgccgggc gcggcgaaga 44640 ccaaccccgg ccacccggag ggcgccgccg gcgcggcggg cccgaccaag gcgacgcccc 44700 cgccacacca cgagcgcacc ccgaggaacc ccaacccccg cacgctcaac ccgcggaccc 44760 ggaLcgaggg gaccgcgccc gcgccggcga ccgaaccggc gccccggccg cggacgggcc 44820 ggacgcgccc cgcgggagcg agcccgcccg ggacgagcgg gaccaacgcg cacgcggcgc 44880 cggaggaggc gccggcggcg gagcccgagg ccgcggcccc cgagcgcgca gcggagccgc 44940 ccgccccgcc ggcgaagagc gcggcggcgc cggacgcgca ggcagcccgg ccgcgggacc 45000 acccggagaa gcacgccgag cccggccccg gcgacgcggc gcccagcccg gcgacgacgc 45060 gcagcgcgac ggagcaccgg ccggcggcgg ccgcgagccc gcgcgaggcg ccgcgagggg 45120 cgcccccggc cgcagcgcag gggcacacgc cgccgggagc cgcgcgcggg cgggccccgg 45180 gcggcagcgc gccgaaggcg gtccccgtgc cccccggcca gggctcgcag cgggcgggca 45240 cgggccgaaa gcccacggcc gaagagccgg ccccccgggc ggcgccggag ggccgcgacc 45300 gggccaccga ggcggaagcg ggccggccgc cgcccgggga gccccccgcc gacgaggccg 45360 ccccgcagcc cgggcgcacc gacgcggccc agccggcgcc ccccgccatg gaagcagcgc 45420 gccccccgcc gcggcggccg cggggagcgg agccggaagc ggcggcgggc cacagcacgg 45480 gcgaggccgc ggcggcgcac gcggccggcg cgccgccgcc cgaggacgcg gcggcgacca 45540;Printed from Mimosa 03/20/2002 15:55:45 page -98-;WO 99/66028;PCT/EP99/04171;-13-;cctgccggcg cagccggccg ctgcggcgga tcagcggcca gggggagacg gcgccggtcg 45600 agccgccgct ggaggaggcc gaggcggcgc tgcgtggcca cgagggtcgg ctgagcgtgg 45660 cggcgagcaa cagcccgcgc ccgaccgtgc tcgccggcga gccggcggcg ctctcggagg 45720 tgctggcggc gccgacggcc aagggggtgt tccggcggca ggcgaaggcg gacgccgcca 45780 gccacagccc gcaggccgac ccgctgcgcg aagagctgat cgcggcgctg ggagcgatcc 45840 ggccgcgagc ggctgcggtg ccgacgcgct cgacggtgac gggcggggcg accgcgggcc 45900 cggagctcgg cgcgagccac cgggcggaca accttcggca gccggtgcgc ctcgccgcgg 45960 cggcgcaagc gctgctggag ggtggccccg cgccgctcac cgagacgagc ccgcacccga 46020 ccccggtgcc gcccccggac gagacccaga cggcggccga gcaagggggc gccgcggtgg 46080 gctcgccgcg gcgagggcag gacgagcgcg cgacgctgct ggaggcgctg gggacgccgc 46140 gggcgtccgg ctacccggtg agctgggctc ggctgttccc cgcgggcggc aggcgggctc 46200 cgccgccgac ctatccctgg cagcacgagc ggtgctggat cgaggtcgag cctgacgccc 46260 gccgcctcgc cgcagccgac cccaccaagg accggtccca ccgaacggac tggcccgagg 46320 tgccccgcgc cgccccgaaa tcggagacag ctcatgggag ctggctgctg ttggccgaca 46380 ggggtggggt cggcgaggcg gccgccgcag cgctgccgac gcgcggacct tcctgcaccg 46440 tgctccacgc gtcggctgac gccCccaccg ccgccgagca ggcacccgaa gccgccagcc 46500 gccgaaacga ccggcaggga gccccctacc cgcggggcct cgacgccgcc gccgacgccg 46560 gggcaccggc cgacgaagCc agcgaggcca cccgccgcgc caccgcaccc gtccccgggc 46620 tggctcgatc cctgagcgcc gcgccccacc cccctcgccc ctgggcggcg acccgcgggg 46680 catgcacggc gggcggcgag ccagaggcct ctctttgcca agcggcgctg cggggcctcg 46740 cgcgcgccgc ggcgccggag caccccgctg cccggggtgg ccccgcggac ccggaccccc 46800 agaagagccc gacggagacc gagcccccgg cggccgagcc gccctcgccg gacgccgagg 46860 atcaactggc gttccgcagc ggtcgcaggc acgcagcacg ccccgcagcc gccccgccgg 46920 agggcgacgc cgcaccgaca ccgccgcccg cggaggggag ccacctggcg acgggcgggc 46980 cgggcggccc tggcccgctc gcggcccggc ggctggcgga gcggggagct cgacacctgg 47040 tgctcaccag ccggcacggg ctgccagagc gacaggcgcc gggcggagag cagccgccgg 47100 aggcccgcgc gcgcatcgca gcggccgagg ggctagaagc gcagggcgcg cgggcgaccg 47160 cggcagcggt ggacgtcgcc gaggccgacc ccacgacggc gccgccggcc gccaccgagc 47220 ccccgccgcg cggggcggcg cacgccgccg gcgccctccc cgcgcgtcac ccggcggaga 47280 cggacgaggc ccrgcuggag ccggtgcccc gtcccaaggt ggccgggagc tggccgccgc 47340 accggccgct gcgcgaccgg ccccccgacc cgcccgcgcc gcccccgccg ggcgcggcgg 47400 cgcggggcgg caaaggccaa ggcgcacacg ccgcggccaa tgcgcccccc gacgggcccg 47460 cgcaccaccg ccgcgcgcac ccgctgccgg cgccgagcct cgcccggggc ccacgggccg 47520 agggaggcac ggccgacgca aaggctcacg cacgtctgag cgacaccggg gccccgccca 47580 cggccacggg gccggccccg ccggcgctgg agcgcccggc gaacaccagc gctgtccagc 47640 gtccggtcac acggacggac cgggcgcgct ccgcgccggt ctatgccgcg cgagggcggc 47700 gcaacccgcc ttcggctctg gccgcggagg acgagcgcgc tgcgtctccc ccggtgccga 47760 cggcaaaccg gacccggcgc ggcctgtccg ctgcggagag ccgcccagcc ccctacgagc 47820 tcgcccgcgg caccgccgcc cgggcgccgg gcttctccga cccgggcgcg ctcgacgccg 47880 gccgaggccc cgccgagcag gggcccgacc ccctgatggc cccggagacc cgcaaccgcc 47940 etcagcgcga gcngggcgaa cggctgtcgg cgaccccggc ctccgaccac ccgacggcgg 48000 agcggccggc ggcgcacetc ctcaccgacg tgccgaagct ggaggaccgg agcgacaccc 48060 ggcacatccg gccggcggcg gcggacgacg acaccgccac cgccggcgcc gcccgccggc 48120 ccccaggcgg ggacgagggc ccggagacat actggcggca cccggccgag ggcacggcgg 48180 ccagcaccga ggcgccagcc gaccggcggc gcgcggcgga ccggcacgac cccgacccgg 48240 aggccccggg ccggacccat gtggccaagg gtgccttccc ccgcgacgcg cgcagcccgg 48300 acgcggcgcc ccccgccacc tccccccgcg aggcgacgag cccggacccg caacagcggc 48360 -gtcgccgga ggtgagccgg gaggcgaccg agcgcgctgg ccaggacccg acggcgctgc 48420 gcgagagcgc cacgggcgcg ttcgcgggca cgaccgggag cgagcacgcc gagcgggcgc 48480 agggccccga cgacgacgcg gcgctgccgc acggcaccac cggcaacccg cccagcgtcg 48540 ccgccggacg gccgccgccc cccctgggcc cgcacggccc gacgacgacg gCggacaccg 48600 cccgctcgtc gccgccggcg gcgctgcacc ccgcctgcca gagcccgcga tcgggcgagt 48660 gcgaccaggc cccggccggc gggtccagcg cgctcccgcc gccgcggtca ctcgccgcgg 48720 cgtcgcgcac gcgcccgcct tcgccagatg ggcggcgcaa gacgcccccg gccgccgcag 48780 acggccctgc gcgggccgag ggccgcgccg tggcggtgct caagcggctc cgtgacgcgc 48840 agcgcgaccg cgaccccatc ctggcggtgg ccaggagcac ggcgaccaac cacgatggcc 48900 cgagcagcgg gctcacggtg cccagcggtc ctgcccagca ggcgctgcca cgccaggcgc 48960 cggcgcaagc gggcgcggcg ccggccgagg ccgacctcgt ggagtgccac gggacgggga 49020 cagcgctggg tgacccgatc gaggtgcagg cgcegggcgc ggtgtacggg cggggccgcc 49080 ccgcggagcg gccgccccgg ccgggcgctg ccaaggccaa ccccggccac ccggaggccg 49140 cggcgggccc ggccggcgcg cccaaggcgc ccccggcgcc ggagcacgag cagaccccgg 49200 cccaaccgga gcccgacgag cccaacccgc acaccccgcg ggcagagccg ccagcggccg 49260 ccgcccgcag ggcggccccc cggccgcgcg gcgcgcgccc gcgccgcgca ggcgcgagcg 49320 cttccggcct gagcgggacc aacgcgcatg cggcgccgga ggaggcgccg gcggcggagc 49380 ccgcggccgc ggcccccgag cgcgcagcgg agccgtccgc cctgccggcg aagagcgcgg 49440;Printed from Mimosa 03/20/2002 15:55:45 page -99-;WO 99/66028;PCT/EP99/04171;-14-;cggcgccgga tgcgcaggca gcccggctgc gggaccaccc ggagaagcat gccgagcccg 49500 gccccggcga cgcggcgccc agcccggcga cgacgcgcag cgcgatggag caccggccgg 49560 cggtggccgc gagctcgcgc gaggcgctgc gaggggcgct cccggccgca gcgcaggggc 49620 acacgccgcc gggagccgcg cgcgggcggg ccccgggcgg cagcgcgccg aaggtggc.cc 49680 ccgcgccccc cggccagggc ccgcagcggg cgggcacggg ccgaaagccc acggccgaag 49740 agccggcctt ccgggcggcg ccggagggcc gcgaccgggc caccgaggcg gaagcgggcc 49800 ggtcgccgcc cggggagcCc cccgccgacg aggccgcccc gcagcccggg cgcatcgacg 49860 tggttcagcc ggtgctgttc gccatggaag cagcgcttcc tgcgccgcgg cggccgtggg 49920 gagtggagcc ggaagcggcg gcgggccaca gcacgggcga ggccgcggcg gcgcacgcgg 49980 ccggcgcgcc gccgcccgag gacgcggcgg cgatcacctg ccggcgcagc cggccgccgc 50040 ggcggaccag cggtcagggg gagacggcgc cggccgagcc gtcgctggag gaggccgagg 50100 cggcgccgcg cggccacgag ggtcggctga gcgcggcggc gagcaacagc ccgcgctcga 50160 ccgcgcccgc cggcgagccg gcggcgcccc cggaggcgcc ggcggcgccg acggccaagg 50220 gggcgttccg gcggcaggtg aaggcggacg ccgccagcca cagcccgcag gccgacccgc 50280 cgcgcgaaga gccgaccgcg gcgccgggag cgacccggcc gcgagcggct gcggcgccga 50340 tgcgcccgac ggcgacgggc ggggcgaccg cgggtccgga gcccggcgcg agccactggg 50400 cggacaaccc ccggcagccg gcgcgccccg ccgcggcggc gcaagcgccg ccggagggcg 50460 gccccgcgcc gcccaccgag acgagcccgc acccgacccc ggcgccgccc ccggacgaga 50520 cccagacggc ggccgagcaa gggggcaccg cggcgggccc gccgcggcga gggcaggacg 505B0 agcgcgcgac gccgctggag gcgccgggga cgccgcgggc gtccggccac ccggcgagcc 50640 gggcccggcc gccccccgcg ggcggcaggc gggccccgcc gccgacccac ccccggcagc 50700 acgagcggca ccggaccgag gacagcgcgc acgggccgaa gcccccgccg cggccccggc 50760 agcetcgcaa cggcgccacg gaccacccgc cgcccggggc cccaccgccc gccccggcgc 50820 gacccggagc ccacccgcgg gagcaagcgc tgagcgacga gaggccaccc caccccccgg 50880 aacacagggc ccacggcgaa gccgcgccgc ccagcgcggc gcacgcagag acggcgcccg 50940 ccgccggcgt agacccccac ggcacggcga cgccggcgcc ggagcagccg gcgcccgagc 51000 gagcccccgc cgcgccctcc gaaggcggac gcatcgcgca agcggccccc agcgaagaag 51060 gtcccggtcg ggcctcatcc caggcaccga gccgcgagga ggcaggcagg agctgggcgc 51120 ggcacgccac ggggcacgcg cgcagcggcc agagcccagc ggtgggagcg ccgaaggaag 51180 ccccgcggga gacccaacgg cgacgcccga gcgtcccgtc gccggaggcg ccccacccgc 51240 cgcccaacga gcacgccccc gaccacggcc cccgctccca gggcgcggag caggtgcggc 51300 ccggcacggg ggaggcgccc ggccgggcac gcccgccagg agacacggca cccccaagcg 51360 gcgcccaccg gacccacccc gccccgtcgg acgcacgccc ccaggcgccg acagcgccgc 51420 ccaccacgcc ggaacccacc gagacccgga ggcggccgac ggacccccac gaaccggacc 51480 ccccgcggcc cagggccccg gcgaaccaag cggtgagcga cacccggccg cgggacgccg 51540 cgccggacgg cggacggcgc cagagcgcga gcgcgcccgc cgacccggcg cccggcagcc 51600 cccacgcgaa gcgggaggcc acggagcgcc ccgcgcaggc gcacaccacc ggcactcccc 51660 gcacacggaa cgccccccgc gccgccggag agcgtcacac gacagacgag ccgcccgcca 51720 ggccccaaac ccccgccgcc cacaggaagg ccatcaagcg acggacggaa caccccgccg 51780 cgaccggcac ccctgcaggg gacggagagc accttgcgag cccccagccg czgccggaac 51840 ccgacccggc ggcggcgccc gaggaggccg ggagggcgcc cgccgacccc ccagccccac 51900 ccgagcggcg caagctcgcc ggggaacggc ccgcggacgc accgaccggc aagacgcccg 51960 cgcccgagac cccccccccc ggcggcccgc ccgacacggc ggagcgaacc caccgagacc 52020 cgcccaccgc ccgccacccg aacggcaccg cgcgcggtgc cgccgagccg gcggcgcggg 52080 cggcagcacc gccgggaacg cccagcaccc cggagaccgg agcagggacg ggcgcgacca 52140 ccgccgccgc ccccccggcg ccgccgcccg accggacgga gcaccacccc accgacgccc 52200 ctccgccccc ccccgcccgc gcggagcaaa gacttcgaga ccacccaccc ccgaagcacg 52260 gcaccccgga cgccgaccag gagccagccg gccagggaca cgcacaccag aggtttgacg 52320 ccaccgccgc ggccaatgcc acccacgcga cccgcgatat aagagccacg gcgaagcgcc 52380 ccccgtcgtc gctcgcgccc ggaggccttc cggcgccggc cgagggcaca gggcatccga 52440 cccggcccga caccaccacg ggaccgaccg aggggcggca gaagcacgaa gacgaccccc 52500 gtaccgacca cccgcccctg cccgcccgga cccggcgtga cgccccgcgc cgggcaggcc 52560 ctgcggacgc cgcgagcccg ccaggcgacg gacctccggc ggggaccccc ggacagcacg 52620 cgaccccccc gcgcgcgccg ggcacagcag gagccgcccg cgacagcccc ggcgagccgg 52680 cgaccgaacc gccggccgcg cgcgcagcac ggcaggaacg ggccgacggc cccgccgacg 52740 ccgtccaccg gacggcgccg gagaggacgc actcccaccg ccggccgggc cggcaggccc 52800 gggcccacgg ccgaccgcgc accggcggag gcgcgcccac gaaggcgccc gccggagacc 52860 cgcccccgcc cgaagacacc gggcaggccg cggcagaggc ccaggggccc cgcccgccgc 52920 agcccgaggc ccccgccccc gcgccgcggg acccgcggga agagcggccg cacgccccgg 52980 aacggcagcg caaagacccc acaccagagg ccccggcagc cgcgcccccc ccccccgcgg 53040 gggcccggcc cgcgccgacg gaccagggcg ggacaggcgc cgcgcccgca tcgccgccgg 53100 aagggcgagg cgaggcgcgc gcgcgcgcca ccgcgggtac ggcacacgcc cgccccgcgc 53160 cggggccgca ccaagccgac ccggcgcagc cagacggccc ccacaccccg ccccgcgacg 53220 cacccggcga ggaccggacc cgccgcgcgg cagcgcatac gcggagcccc gacgcgacgg 53280 cagcagggga gagggcgaca gcggagccgc cccaggccga ccaacccccg gggagcccga 53340;Printed from Mimosa 03/20/2002 15:55:45 page -100-;WO 99/66028;PCT/EP99/04171;-15 -;gcgcgctttc tccggtgcag gcgctggtgc gccggaggtg gcgcaacatg ccgcggctct 53400 ggctcttgac ccgcgccgtg catgcggtgg gcgcggagga cgcagcggcc tcggtggcgc 53460 aggcgccggt gtggggcctc ggtcggacgc tcgcgcccga gcatccagag ctgcggtgca 53520 cgcccgtgga cgtgaacccg gcgccgcctc cagaggacgc agccgcactg gcggcggagc 53580 ccggggcgag cgacagagag gaccaggtcg cactgcgctc ggacggccgc tacgtggcgc 53640 gcctcgtgcg gagctccttt tccggcaagc ctgctacgga ttgcggcatc cgggcggacg 53700 gcagctatgt gatcaccgat ggcatgggga gagtggggct ctcggtcgcg caatggacgg 53760 tgatgcaggg ggcccgccat gtggtgctcg tggatcgcgg cggcgcttcc gaggcacccc 53820 gggatgccct ccggtccatg gccgaggctg gcgcggaggt gcagatcgtg gaggccgacg 53880 tggctcggcg cgacgatgtc gctcggctcc tctcgaagac cgaaccgccg acgccgccgc 53940 ttcgggggat cgtgtacgtg gacgggacct tccagggcga ccccccgacg ctggagccgg 54000 atgcccgtcg cttcaaggag tggangtatc ccaaggngct cggagcgtgg aacccgcacg 54060 cgctgaccag ggatagatcg ctggacttct tcgtcctgta ctcctcgggc accccgcccc 54120 tgggcctgcc aggacagggg agccgcgccg ccggcgacgc ccccccggac gccaccgcgc 54180 accaccggtg caaggtgggc ctcacagcga tgagcaccaa ccggggatcg ctctccgaag 54240 catcatcgcc ggcgaccccg aacgacggcg gagcacggcc cgaataccgg gggatggaag 54300 gcctcacgct ggagcaggga gcggcggcgc tcgggcgctt gcccgcacga cccagggcgc 54360 aggcaggggc gacgcggctg aatccgcgcc agcggttgga gttctatccc aacgcggccc 54420 gatcgccgcc gtgggcggag ctgccgaagg agcgcgaccg cgccgaccga ggcgcgccga 54480 acgcgccgaa cccgcgcgag gcgctgcaga gcgccaggcc cgaagatcgt cagctgattc 54540 tggagaagca cttgagcgag ctgttggggc gggggctgcg ccttccgccg gagaggatca 54600 agcggcacgt gccgttcagc aatctcggca tggactcgct gataggcctg gagctccaca 54660 accgcaccga ggccgcgctc ggcatcaccg tgccggcgac cctgctatgg acctacccta 54720 acgtagcagc cctgagcggg agcctgctag acatnctgtt tccgaatgcc ggcgcgaccc 54780 acgctccggc caccgagcgg gagaagagct ccgagaacga tgccgcagat ctcgaggccc 54840 tgcggggcat gacggacgag cagaaggacg cgttgctcgc cgaaaagccg gcgcagctcg 54900 cgcagatcgc tggtgagtaa gggaccgagg gagtatggcg accacgaatg ccgggaagct 54960 tgagcatgcc cctctgctca tggacaagct tgcgaaaaag aacgcgtcct tggagcaaga 55020 gcggaccgag ccgatcgcca ccgtaggcat tggctgccgc ttccccggcg gagcggacac 55080 tccggaggca tcctgggagc tgctcgactc aggccgagac gcggtccagc cgctcgaccg 55140 gcgctgggcg ctggtcggcg tccatcccag cgaggaggtg ccgcgctggg ccggactgct 55200 caccgaggcg gtggacggct tcgacgccgc gccctttggc accccgcccc gggaggcgcg 55260 gtcgctcgat ccccagcaac gcctgccgct ggaggtcacc tgggaagggc tcgaggacgc 55320 cggcatcgca ccccagtccc tcgacggcag ccgcaccggg gtgttcctgg gcgcatgcag 55380 cagcgactac tcgcataccg ctgcgcaaca gcggcgcgag gagcaggacg cacacgacat 55440 caccggcaat acgcccagcg tcgccgccgg acggccgcct tatacgctag ggctgcaggg 55500 accccgcccg accgccgaca cggcccgccc gccgtcgccc gcggccaccc accctgcccg 55560 ccgcagcctg cgcgctcgcg agagcgatct cgcgctggcg ggaggcgtca acatgctcct 55620 ttcgtccaaa acgatgataa cgctggggcg catccaggcg ccgtcgcccg atggccactg 55680 ccggacaccc gacgcctcgg ccaacgggtt cgcccgtggg gagggccgcg gcacggtcgt 55740 gctcaaacgg ccccccgacg cccagcgaca cggcgaccgg acccgggccc cgacccgggg 55800 ttcggccatg aatcaggatg gccggtcgac agggttgatg gcacccaatg tgcccgctca 55860 ggaggcgctc ccgcgcgagg cgctgcagag cgctcgcgtc gacgccgggg ccatcggtta 55920 tgtcgagacc cacggaacgg ggacctcgcc cggcgacccg atcgaggtcg aggcgctgcg 55980 tgccgtgttg gggccggcgc gggccgatgg gagccgctgc gcgctgggcg cagcgaagac 56040 aaaccccggc cacctggagg gcgctgcagg cgtggcgggt tcgatcaagg cggcgccggc 56100 tctgcaccac gaaccgaccc cgcgaaacct ccatttccac acgctcaacc cgcggatccg 56160 gaccgagggg accgcgcccg cgctggcgac ggagccggtg ccgtggccgc gggcgggccg 56220 accgcgcttc gcgggggtga gcgcgttcgg cctcagcggc accaacgtcc acgccgtgct 56280 ggaggaggcg ccggccacgg tgctcgcacc ggcgacgccg gggcgcccag cggagccccc 56340 ggtgctgtcg gcgaagagcg ccgccgcgct ggacgcacag gcggcgcggc tctcagcgca 56400 catcgccgcg cacccggagc agggtcccgg agacgtcgcg cccagcctgg catcgacgcg 56460 tagcccgatg gagcaccggc ccgcggtggc ggcgaccccg cgcgaggcgc cgcgaagcgc 56520 gctggaggct gcggcgcagg ggcagacccc ggcaggcgcg gcgcgcggca gggccgctcc 56580 cccgcccggc aagcccgccc ccccgttcgc cgggcagggc gcgcaggtgc cgggcacggg 56640 ccgcgggccg cgggaggcgt ggccggcgtt ccgcgagacc cccgaccggt gcgtcacgct 56700 ctccgaccgg gagccccacc agccgctccg cgaggtgatg tgggccgagc cgggcagcag 56760 caggtcgtcg ccgctggacc agacggcgtt cacccagccg gcgctccttg cgctggagta 56820 cgcgccggcc gcgctccccc ggccgcgggg cgtggagccg gagctcgtcg ctggccatag 56880 cctcggcgag ctggtggccg cctgcgcggc gggcgcgccc ccccccgagg acgccgcgcg 56940 cttggtggtc gcgcgcggcc ggttgatgca ggcgctgccg gccggcggcg cgatggtatc 57000 gatcgccgcg ccggaggccg acgtggccgc cgcggcggcg ccgcacgcag cgccggcgcc 57060 gaccgcggca gtcaacgggc cggagcaggc ggtgatcgcg ggcgccgaga aattcgtgca 57120 gcagatcgcg gcggcgttcg cggcgcgggg ggcgcgaacc aaaccgccgc acgcctcgca 57180 cgcgccccac ccgccgccca tggacccgac gccggaggcg ccccggcggg cgaccgagcc 57240;Printed from Mimosa 03/20/2002 15:55:45 page -101-;WO 99/66028;PCT/EP99/04171;-16-;ggtgacgtac cggcggcctt cgatcgcgct ggtgagcaac ctgagcggga agccctgcac 57300 cgatgaggtg agcgcgccgg gttactgggt gcgtcacgcg cgagaggcgg tgcgcttcgc 57360 ggacggagcg aaggcgccgc acgcggccgg tgcgggcctc ttcgtcgagg tggggccgaa 57420 gccgacgccg ctcggccttg tgccggcctg cctgccggat gccaggccgg tgctgctccc 57480 agcgccgcgc gccgggcgtg acgaggctgc gagcgcgcta gaggcgccgg gtgggttctg 57540 ggtcgtcggt ggatcggtca cctggtcggg tgtcttccct tcgggcggac ggcgggtacc 57600 gctgccaacc tatccctggc agcgcgagcg ttactggatc gaagcgccgg tcgaccgcga 57660 ggcggacggc accggccgtg ctcgggcggg gggccacccc cttctgggtg aagtcttttc 57720 cgtgtcgacc catgccggtc tgcgcctgtg ggagacgacg ctggaccgaa agcggctgcc 57780 gtggctcggc gagcaccggg cgcaggggga ggtcgtgttt cctggcgccg ggtacctgga 57840 gatggcgctg tcgtcggggg ccgagatctt gggcgatgga ccgatccagg tcacggatgt 57900 ggtgctcatc gagacgctga ccttcgcggg cgatacggcg gtaccggtcc aggtggtgac 57960 gaccgaggag cgaccgggac ggctgcggtt ccaggtagcg agccgggagc cgggggaacg 58020 tcgcgcgccc ttccggaccc acgcccgcgg cgtgctgcgc cggaccgggc gcgtcgagac 58080 cccggcgagg tcgaacctcg ccgccctgcg cgcccggctt catgccgccg cgcccgctgc 58140 ggccacctac ggtgcgcccg ccgagatggg gcttcaacac ggcccggcgc tgcgggggct 58200 cgccgagctg cggcggggcg agggcgaggc gctgggcagg gcgagactgc ctgaggccgc 58260 cggccccgcg acagcccacc agccgcatcc ggtgctgccg gacgcgtgcg tccaaatgac 58320 cgctggcgcg tccgccgatc gcgatgaggc gacgccgcgg gcgccggcgg aggtgggctc 58380 ggcgcggccg tcccagcggt ctcccgggga gctatggcgc cacgcgcgcg ccgtgagcga 58440 cggtcaacag gcctccagcc ggcggagcgc cgactttgag ctgacggacg gcacgggcgc 58500 ggtggtcgcc gagatctccc ggccggtggc ggagcggcct gcgagcggcg tacgccggcg 58560 cgacgcagac gactggttcc tggagccgga ccgggagccc gcggcgcccg gcgggcccaa 58620 gaccacagcc ggccggtggc tgctgctcgg cgagggtggt gggctcgggc gctcgttgtg 58680 ctcggcgctg aaggccgccg gccatgtcgt cgtccacgcc gcgggggacg acacgagcac 58740 tgcaggaatg cgcgcgctcc tggccaacgc gttcgacggc caggccccga cggccgtggt 58800 gcacctcagc agcctcgacg ggggcggcca gctcggcccg gggctcgggg cgcagggcgc 58860 gctcgacgcg ccccggagcc cagatgtcga tgccgatgcc ctcgaatcgg cgctgatgcg 58920 tggttgcgac agcgtgctct ccctggtgca agcgctggtc ggcatggacc tccgaaacgc 58980 gccgcggctg tggctcttga cccgcggggc tcaggcggcc gccgccggcg atgtctccgt 59040 ggtgcaagcg ccgctgttgg ggctgggccg caccatcgcc ttagagcacg ccgagctgcg 59100 ctgtatcagc gtcgacctcg atccagccga gcctgaaggg gaagccgatg ctttgctggc 59160 cgagctactt gcagatgatg ccgaggagga ggtcgcgctg cgcggtggcg accggctcgt 59220 tgcgcggctc gtccaccggc tgcccgacgc tcagcgccgg gagaaggtcg agcccgccgg 59280 tgacaggccg ttccggctag agatcgatga acccggcgcg ctggaccaac tggtgctccg 59340 agccacgggg cggcgcgctc ctggtccggg cgaggtcgag atctccgtcg aagcggcggg 59400 gctcgactcc atcgacatcc agctggcgtt gggcgttgct cccaatgatc tgcctggaga 59460 agaaatcgag ccgttggtgc tcggaagcga gtgcgccggg cgcatcgtcg ctgtgggcga 59520 gggcgtgaac ggccttgtgg tgggccagcc ggtgatcgcc cttgcggcgg gagtatttgc 59580 tacccatgtc accacgtcgg ccacgctggt gttgcctcgg cctctggggc tctcggcgac 59640 cgaggcggcc gcgatgcccc tcgcgtattt gacggcctgg tacgccctcg acaaggtcgc 59700 ccacctgcag gcgggggagc gggtgctgat ccatgcggag gccggtggtg tcggtctttg 59760 cgcggtgcga tgggcgcagc gcgtgggcgc cgaggtgtat gcgaccgccg acacgcccga 59820 gaaccgtgcc tacctggagt cgctgggcgt gcggtacgtg agcgattccc gctcgggccg 59880 gttcgtcaca gacgtgcatg catggacgga cggcgagggt gtggacgtcg tgctcgactc 59940 gctttcgggc gagcgcatcg acaagagcct catggtcctg cgcgcctgtg gtcgccttgt 60000 gaagctgggc aggcgcgacg actgcgccga cacgcagcct gggctgccgc cgctcctacg 60060 gaatttttcc ttctcgcagg tggacttgcg gggaatgatg ctcgatcaac cggcgaggat 60120 ccgtgcgctc ctcgacgagc cgttcgggtt ggtcgcagcc ggtgccatca gcccactggg 60180 gtcggggttg cgcgttggcg gatccctcac gccaccgccg gtcgagacct tcccgatctc 60240 tcgcgcagcc gaggcattcc ggaggatggc gcaaggacag catctcggga agctcgtgct 60300 cacgctggac gacccggagg tgcggatccg cgctccggcc gaatccagcg tcgccgtccg 60360 cgcggacggc acctaccttg tgaccggcgg tctgggtggc ctcggtctgc gcgtggccgg 60420 atggctggcc gagcggggcg cggggcaact ggtgctggtg ggccgctccg gtgcggcgag 60480 cgcagagcag cgagccgccg tggcggcgct ggaggcccac ggcgcgcgcg tcacggtggc 60540 gaaagcggac gtcgccgatc ggtcacagat cgagcgggtc ctccgcgagg ttaccgcgtc 60600 ggggatgccg ctgcggggtg tcgtgcatgc ggcaggtctc gtggatgacg ggctgctgat 60660 gcagcagact ccggcgcggt tccgcacggt gatgggacct aaggtccagg gggccttgca 60720 cttgcacacg ctgacacgcg aagcgcctct ttccttcttc gcgctgtacg cttctgcagc 60780 tgggcttttc ggctcgccag cccagggcaa ctatgccgca gccaacgcgt tcctcgacgc 60840 ccttrcgcat caccgaaggg cgcagggcct gccggcgctg agcatcgact ggggcatgtt 60900 cacggaggtg gggatggccg ttgcgcaaga aaaccgtggc gcgcggcaga tctctcgcgg 60960 gatgcggggc atcacccccg atgagggtct gtcagctctg gcgcgcttgc tcgagggtga 61020 tcgcgtgcag acgggggtga taccgatcac tccgcggcag tgggtggagt tctacccggc 61080 aacagcggcc tcacggaggt tgtcgcggct ggtgaccacg cagcgcgcgg tcgctgatcg 61140;Printed from Mimosa 03/20/2002 15:55:45 page -102-;WO 99/66028;PCT/EP99/04171;-17-;gaccgccggg gatcgggacc cgctcgaaca gcttgcgccg gctgagccga gcgcgcgggc 61200 ggggccgccg caggacgccg tgcgcgcgca ggcctcgcat gcgctgcgcc tccctgaaga 61260 caagatcgag gcggacgccc cgccctcgag cacgggcacg gacccgctga cgagcccgga 61320 gccgcgcaac cgcatcgagg ctgcgccggg cgccgccgcg cctgcagccc cggggtggac 61380 gcacccaacg gcagcagcga caacgcgccg gccgctcgac gacgcccccg tcgtccggcc 61440 cggcggcggg tcggacacgg acgaatcgac ggcgagcgcc ggtccgttcg cccacgtccc 61500 ccgccttcgt cctgccgtca agccgcgggc tcgcctcttc tgttttcacg gttctggcgg 61560 ctcgcccgag ggcccccgcc cccggtcgga gaagcctgag cggagcgatc cggaaaccgc 61620 ggccatgtgg cacgaccgca gcctcgcctc cgaggacgcg cctggtaaga agcacgccca 61680 agaggcggcc tcgctgattc agcactatgc agacgcaccg cctgcgccag cagggcccag 61740 cctgggcgcc cggttcgcca cggggacagc cgcggagccc gccagccgtc ccggcgcacc 61800 ggccccgctg gccgtcttca cgtCgggcgg cagcctgacc ccccccccag agaccacccc 61860 ggagacggag accgatataa cagccaagct ccccttccga aatgccgcgg gtttcgtgcg 61920 acccacccaa caagtccagg ccgatgctcg cgcagacaag gtcaccacag acaccacggt 61980 ggccccggcc cccggggact cgaaggagcc gcccgtgaag accgcggccc ccaccgccgc 62040 caccgccggc ccggacgacg cgaccgcgcc cccgagcgac gcccaggacc cacaaccccg 62100 caccacggag cgcccccaca cgcaccccct Ccccggagac cacgaactcc ccgccgaccg 62160 agggcgcgag atcatgcaca tcgtcgactc gcatcccaac ccgccgcccg ccgcgaggac 62220 gacgccgcca ggccccgcgc tcgaggcaaa angatggcag ccccccccgg gcgcgcgaga 62280 -ggttgggag cagcgcgggc gctggcggcc ggcggcaggc cgcggaggcg cacgagcczz 62340 cccggacgtt tgcagcatag gagatcttat gacacaggag caagcgaatc agagcgagac 62400 gaagcctgct tccgacccca agccgttcgc gcctgggtac gcggaggacc cgtmccccgc 62460 gatcgagcgc ctgagagagg caacccccat cttctaccgg gacgaaggcc gcccccgggc 62520 ccccacccga caccacgacg tgccggcggc gccccgcgac gaacgcttcg cggccagccg 62580 agaagagcgg gaaccgagcg cggagcaccc gccggccacc cccgagccca gcgacacgaa 62640 gaagcacgga ccgcccgggc cgccgccgga ggaccacgcc cgggcccgca agcccgccaa 62700 cccgccgctc acgccacgcg ccatcgacct gccgcgcgcc gaaatacagc gcaccgtcga 62760 ccagccgccc gacgcccgcc ccggacaaga ggagtccgac gccgcgcggg accacgcgga 62820 gggaatcccg acgcgcgcga ccagcgccct gttgaaggtt ccggccgagt gcgacgagaa 62880 cgcccgccgc cccggcccgg cgactgcgcg cgcgcccggc gtgggtttgg cgccccaggc 62940 cgacgaggag accaagaccc tggtcgcgcc cgccaccgag gggcccgcgc cgccccacga 63000 cgcccccgac gagcggcgca ggaacccgcc cgaaaacgac gtcttgacga cgccgcccca 63060 ggccgaggcc gacggcagca ggctgagcac gaaggagccg gccgcgcccg cgggcgcgac 63120 caccgccgct ggcaccgata ccacgaccca ccccaccgcg cccgctgcgc tcaacccgcc 63180 gcggtcgccc gaggcgctcg agctggcgaa ggccgagccc gggctcatga ggaacgcgct 63240 cgacgaggcg ccccgccccg acaacacccc cagaacagga accgcgcgcc ccgccaggca 63300 ggacccggag caccgcgggg caccgaccaa gaaaggggag acggcccccc ccccgacccc 53360 gagcgccctg agagacggga ctgtattctc caggccagac gcgcttgacg tgcgacggga 63420 cacgggcgcg agccccgcgc acggcagagg cccccacgcc cgccccgggg cgccccccgc 63480 ccgcctcgag gcggagaccg ccgcgggcac caccccccgc aggccccccg agacgaagcr 53540 gaaagaaacc cccgtgcccg gacaccaccc cgcgccccgg aacaccgaac cacccaacgc 63600 caccccgaag ccccccaaag ccggacagcc cgcgggggca ccgccccccg aaccccaccc 63660 ccccacgaca cagcccgcgc gcgggcgccg cccgccgcgg gcgcgacccg acccagcgga 63720 caagcccact gccagcgcgc gaagaccgaa cccacggccc ggagaagagc ccgcccgggc 63780 gacgtcggaa gaagcgccgg gcgccgcccc gggagcgcaa agcccgcccg cccgcgccca 63840 gcacgccgct cgccatgccc ggccctgcac ccgcgccgag gagccgcccg ccccgacgca 63900 cggccccacc gagcggcagg ctctgctccc gcccgtcgcc ctcgcgcccg cccccccgac 63960 cgcgcgcgcc cccggcgagc ccgcgcggcg gccgcgccag cccgaggtgc ccggcgagcc 64020 ccccggcggc gcggcgccgg gcccgcccgc cgccggcgcg cccgcccccg ggtcccaccg 64080 agtcctcttc caggacccgg cggtcggggc cgcgctctcc ggcatctcct ggataggcgc 64140 gcccgccccg ccgcccacgg cgggcaccga ggccgatgcg agcaccccgc gcaaggaggc 64200 gcgccccggg gcgcccccgg cgcccggcgc gaccgcgccc ccgccgcgca cgccggggcc 64260 gccggcgcag cgcacgcagg gcgcgcccac gcgggacccc gacgcctcgc cgcgacgccc 64320 cgcgcaagcc tgagcctcgg cgcctgcccg tacaccccgc cggcgctcgc tccgcccgcg 64380 gacacccggc cgcccgccgc ggcccagccc gagccggacc cgccggacga cgaggccgac 64440 gaggccgacg aggcgccccg cccgccccgc gacgcgaccg ccgcgcaccc ggaggccgcc 64500 cggcgggcgg aggcggcgca gcggccgcgg ccggagagcc ccgcgcggcc cgcgaccgcg 64560 cggctgggca aggcgcccga caaggccccc cccgcgcaca cgacggccgg cgccccccaa 64620 accgccggca gaccccagaa cgacgcggtc cggcccgacg ccgccgcccg gcacgcgagc 64680 ^cccgcgcgg cgacggagca cgcgctccgc gacgcggcgc cggccacgga ggcgcccgcg 64740 gccggcccgc accgcggacc gagccgcgcg cccgccgccg taggggagct ccggggggag 64800 gcggcgcgcc cccaccccgc ggaccgcgca cccgcgcccg accagcagac cccgaccgcg 64860 czgcgcgcag ccgagcgggc gctcatcgcg ccccacaccg cgcccgcccg cgaggagcga 64920 gccccccccg ggcgcagccg agcggcggcg cgccggcggc cccccccccg caaccacgac 64980 cggagccgcg cccggtccgc gcagcggcca gcgcgcgccg cggcagagac cgccggagcg 65040;Printed from Mimosa 03/20/2002 15:55:45 page -103-;WO 99/66028;PCT/EP99/04I71;-18-;acaggcgacg acccgcccga gggtgtcgaa cggactgccg cagccctcat tgcggacccc 65100 ctccagacac tcgttcagct gcttggcgte gatgccgcct gggcactcgc cgaaggtcag 65160 ctcgtcgcgc cactcggatc ggatcctgtt cgagcacgcg tccttgctcg aatactcccg 65220 gtcttgtccg atgttgttgc accgcgcctc gcggtcgcac cgcgccgcca cgatgctatc 65280 gacggcgctg ccgactggca ccggcgcctc gccctgcgcg ccacccgggg tttgcgcctc 65340 cccgcctgac cgctcttcgc cgccgcacgc cgcgagcagg ctcattcccg acaccgagat 65400 caggcccacg accagcttcc cagcaatctt ttgcatggct tcccctccct cacgacacgt 65460 cacaccagag actctccgct cggcccgtcg gttcgacagc cggcgacggc cacgagcaga 65520 accgtccccg accagaacag ccgcatgcgg gtttctcgca acatgccccg acatccttgc 65580 gactagcgtg cctccgctcg tgccgagatc ggctgtcctg tgcgacggca ataccctgcg 65640 atcggccggg caggaggtac cgacacgggc gccgggcggg aggtgccgcc acgggcccga 65700 aatgtgctgc ggcaggcgcc tccatgcccg cagccgggaa cgcggcgccc ggccagcctc 65760 ggggtgacgc cgcaaacggg agatgctccc ggagaggcgc cgggcacagc cgagcgccgt 65820 caccaccgtg cgcactcgtg agctccagct cctcggcata gaagagaccg tcactcccgg 65880 tccgtgtagg cgatcgtgct gatcagcgcg ttctccgcct gacgcgagtc gagccgggta 65940 tgccgcacga caatgggaac gcccgactcg atcacgccgg cacagcccgt accgcgcggg 66000 atcggctcgg gttcggtcag atcgctgaac cggacgcgcc gggcgcgccc cgctgggacg 66060 gtcacccggt acggcccggc ggggtcgcgg tcgccgaagt agacggtgat ggcgacctgc 66120 gcgccccggc ccgacgcact caacaggcag gccgtctcat ggctcgccac ccgcggcccg 66180 ggcccgttgc cccggcccgg gatgtagccc tctgcgattg cccagcgcgt ccgcccgatc 66240 ggcctctcca tatgtcctcc ccgctggctc cccctcggct gcctccccct gctgcccagg 66300 agcgacggcc tccccccccg acgcgctcgg ggatccatgg ccgaggatcc ccgccgagcg 66360 ccccttgccg accggcgcgc cgagcgccga cgggctttga aagcacgcga ccggacacgc 66420 gatgccggcg cgacgaggcc gccccgcgcc tgatcccgac cgtgacaccg cgacgcccgc 66480 cggcgcccct gcaggccggc ctgagcgttg cgcggccacg gccgtcctcg cgccaccgcc 66540 acccgccgac ccacatccca ccgcggcacg acgcctgccc aaaccgcggc gagacggccg 66600 ggcggccgtg gtaccggcca gcccggacgc gaggcccgag agggacagtg ggcccgccgc 66660 gaagcagcga ggcgaccgag gtggcagatg aaacacgttg acacgggccg acgagtcggc 66720 cgccggacag ggcccacgct cggtctcctc gcgagcatgg cgctcgccgg ctgcggcggc 66780 ccgagcgaga aaaccgtgca gggcacgcgg cccgcgcccg gcgccgatgc gcacgccgcc 66840 gccgacgtcg accccgacgc cgcgaccacg cggccggcgg cggacgccgt tcacctcccg 66900 ccgcccgagc gcatcgaggc cggcagcgag cggttcgtcg cccggcagcg tccgagctcc 66960 gagcccccgc ggcaacgggc cggagtgctc gaccacaacg ctgccagccg aagaggcaag 67020 ccggccgaga cgaccgcgcc gcatgccaac cccgagccgc tcatcaccgt cgagaagcag 67080 agcagccccc agcccccacc ccccgccgcc gtcaccgggc cgacgcccgc cgggcaacac 67140 cgcgccacca gcagcgccga gcccgccagc aggccccaga gccccgcccc gatcgccccc 67200 tccatcacac cacccccgcg caccccccca gcgacggccc cgccgaagca accgccgcgc 67260 cggcgcggcc ccacgcgcgc gacaggagag cgccccggcg cggcccgcgc accgccggaa 67320 ggaccggcgg agcatggaga aagaaccgag gaccgcgacc cacggcgcca ccgcagccaa 67380 cgcggcgacc gcggcggcca agttcaccgc cgccgccgcg accggcagcc cggcgacgct 67440 ccccgagggc gcgcaccccc ccgccgacac cgcagacggg cccccccccc cgcccggcaa 67500 gcaccggagc gcacgcccgc ccgacgccga gcacccgccc ggccacggca aggagcccca 67560 cttccggacg ccgatcgccg ccatcatgat ccccgccgcg ggcggcggcg tctcgatcta 67620 cgaagggacc ccgcaccccc cgcacccgcg ccagatcgag gacccgacgc ggaaccacgc 67680 cgcccccggc gcagcggccg cctccgaggg gacgtcgctc accaccccga tccacgagtt 67740 caagaagaag gacggacagg gctacctcgc ggcgatgcgg tccagcaagg acccgacgac 67800 gttcacgatc gtcctggagg actccgcggc gctcgccggg ctcaccatcg ccttcctcgg 67860 cgtctggctc gggcaccgcc tgggaaaccc ctacctcgac ggcgcggcgt cgatcggcat 67920 cggcctcgtg ctcgccgcgg tcgcggtctt cctcgccagc cagagccgtg ggctcctcgt 67980 gggggagagc gcggacaggg agctcctcgc cgcgatccgc gcgctcgcca gcgcagatcc 68040 tggcgtgtcg gcggtggggc ggcccctgac gatgcactcc ggtccgcacg aagtcctggt 68100 cgtgctgcgc accgagtccg acgccgcgct cacggcgccc ggggtcgcgg aggcgatcga 68160 gcgcaccgag acccggatac ggagcgagcg acccgacgtg aagcacatct acgtcgaggc 68220 caggtcgctc caccagcgcg cgagggcgtg acgcgccgtg gagagaccgc gcgcggcctc 68280 cgccatcctc cgcggcgccc gggctcaggt ggccctcgca gcagggcgcg cctggcgggc 68340 aaaccgtgca gacgtcgtcc ttcgacgcga ggtacgctgg ttgcaagtcg tcacgccgta 68400 tcgcgaggtc cggcagcgcc ggagcccggg cgggccgggc gcacgaaggc gcggcgagcg 68460 caggcttcga ggggggcgac gtcatgagga aggccagggc gcatggggcg atgctcggcg 68520 ggcgagatga cggctggcgt cgcggcctcc ccggcgccgg cgcgcttcgc gccgcgctcc 68580 agcgcggtcg cccgcgcgat ctcgcccggc gccggctcat cgcctccgtg tccctcgccg 68640 gcggcgccag catggcggtc gtctcgctgt tccagctcgg gatcatcgag cgcctgcccg 68700 atcctccgct tccagggttc gattcggcca aggtgacgag ctccgatatc 68750;&lt;210&gt; 2 &lt;211&gt; 1421;Printed from Mimosa 03/20/2002 15:55:45 page -104-;WO 99/66028;PCT/EP99/04171;-19;&lt;212&gt; PRT;&lt;213&gt; Sorangium cellulosum &lt;400&gt; 2;Val Ala Asp Arg Pro lie Glu Arg Ala Ala Glu Asp Pro lie Ala lie 15 10 15;Val Gly Ala Ser Cys Arg Leu Pro Gly Gly Val lie Asp Leu Ser Gly 20 25 30;Phe Trp Thr Leu Leu Glu Gly Ser Arg Asp Thr Val Gly Arg Val Pro 35 40 45;Ala Glu Arg Trp Asp Ala Ala Ala Trp Phe Asp Pro Asp Pro Asp Ala 50 55 60;Pro Gly Lys Thr Pro Val Thr Arg Ala Ser Phe Leu Ser Asp Val Ala 65 70 75 80;Cys Phe Asd Ala Ser Phe Phe Gly lie Ser Pro Arg Glu Ala Leu Arg 85 90 95;Mec Asp Pro Ala His Arg Leu Leu Leu Glu Val Cys Trp Glu Ala Leu 100 105 110;Glu Asn Ala Ala lie Ala Pro Ser Ala Leu Val Gly Thr Glu Thr Gly 115 120 125;Val Phe lie Gly lie Gly Pro Ser Glu Tyr Glu Ala Ala Leu Pro Gin 130 135 140;Ala Thr Ala Ser Ala Glu He Asp Ala His Gly Gly Leu Gly Thr Met 145 150 155 160;Pro Ser Val Gly Ala Gly Arg lie Ser Tyr Ala Leu Gly Leu Arg Gly 165 170 175;Pro Cys Val Ala Val Asp Thr Ala Tyr Ser Ser Ser Leu Val Ala Val 180 185 190;His Leu Ala Cys Gin Ser Leu Arg Ser Gly Glu Cys Ser Thr Ala Leu 195 200 205;Ala Gly Gly Val Ser Leu Mec Leu Ser Pro Ser Thr Leu Val Trp Leu 210 215 220;Ser Lys Thr Arg Ala Leu Ala Arg Asp Gly Arg Cys Lys Ala Phe Ser 225 230 235 240;Ala Glu Ala Asp Gly Phe Gly Arg Gly Glu Gly Cys Ala Val Val val 245 250 255;Leu Lys Arg Leu Ser Gly Ala Arg Ala Asp Gly Asp Arg lie Leu Ala 260 265 270;Val lie Arg Gly Ser Ala lie Asn His Asp Gly Ala Ser Ser Gly Leu 275 280 285;Thr Val Pro Asn Gly Ser Ser Gin Glu lie Val Leu Lys Arg Ala Leu 290 295 300;Ala Asp Ala Gly Cys Ala Ala Ser Ser Val Gly Tyr Val Glu Ala His 305 310 315 320;Gly Thr Gly Thr Thr Leu Gly Asp Pro lie Glu lie Gin Ala Leu Asn;Printed from Mimosa 03/20/2002 15:55:45 page -105-;WO 99/66028;PCT7EP99/04I71;-20-;325;330;335;Ala Val Tyr Gly Leu Gly Arg Asp Val Ala Thr Pro Leu Leu He Gly 340 345 350;Ser Val Lys Thr Asn Leu Gly His Pro Glu Tyr Ala Ser Gly lie Thr 355 360 365;Gly Leu Leu Lys Val Val Leu Ser Leu Gin His Gly Gin lie Pro Ala 370 375 380;His Leu His Ala Gin Ala Leu Asn Pro Arg lie Ser Trp Gly Asp Leu 385 390 395 400;Arg Leu Thr Val Thr Arg Ala Arg Thr Pro Trp Pro Asp Trp Asn Thr 405 410 415;Pro Arg Arg Ala Gly Val Ser Ser Phe Gly Mec Ser Gly Thr Asn Ala 420 425 430;His Val Val Leu Glu Glu Ala Pro Ala Ala Thr Cys Thr Pro Pro Ala 435 440 445;Pro Glu Arg Pro Ala Glu Leu Leu Val Leu Ser Ala Arg Thr Ala Ser 450 455 460;Ala Leu Asp Ala Gin Ala Ala Arg Leu Arg Asp His Leu Glu Thr Tyr 465 470 475 480;Pro Ser Gin Cys Leu Gly Asp Val Ala Phe Ser Leu Ala Thr Thr Arg 485 490 495;Ser Ala Mec Glu His Arg Leu Ala Val Ala Ala Thr Ser Arg Glu Gly 500 505 510;Leu Arg Ala Ala Leu Asp Ala Ala Ala Gin Gly Gin Thr Ser Pro Gly 515 520 525;Ala Val Arg Ser lie Ala Asd Ser Ser Arg Gly Lys Leu Ala Phe Leu 530 535 540;Phe Thr Gly Gin Gly Ala Gin Thr Leu Gly Mec Gly Arg Gly Leu Tyr 545 550 555 560;Asp Val Trp Ser Ala Phe Arg Glu Ala Phe Asp Leu Cys Val Arg Leu 565 570 575;Phe Asn Gin Glu Leu Asp Arg Pro Leu Arg Glu Val Met Trp Ala Glu 580 585 590;Pro Ala Ser Val Asp Ala Ala Leu Leu Asp Gin Thr Ala Phe Thr Gin 595 600 605;Pro Ala Leu Phe Thr Phe Glu Tyr Ala Leu Ala Ala Leu Trp Arg Ser 610 615 620;Trp Gly Val Glu Pro Glu Leu Val Ala Gly His Ser lie Gly Glu Leu 625 630 635 640;Val Ala Ala Cys Val Ala Gly Val Phe Ser Leu Glu Asp Ala Val Phe 645 650 655;Leu Val Ala Ala Arg Gly Arg Leu Met Gin Ala Leu Pro Ala Gly Gly;660;665;670;Printed from Mimosa 03/20/2002 15:55:45 page -106-;WO 99/66028 PCT/EP99/04171;-21 -;Ala Met Val Ser lie Glu Ala Pro Glu Ala Asp Val Ala Ala Ala Val 675 680 685;Ala Pro His Ala Ala Ser Val Ser lie Ala Ala Val Asn Ala Pro Asp 690 695 700;Gin Val Val lie Ala Gly Ala Gly Gin Pro Val His Ala He Ala Ala 705 710 715 720;Ala Met Ala Ala Arg Gly Ala Arg Thr Lys Ala Leu His Val Ser His 725 730 735;Ala Phe His Ser Pro Leu Met Ala Pro Met Leu Glu Ala Phe Gly Arg 740 745 750;Val Ala Glu Ser Val Ser Tyr Arg Arg Pro Ser lie Val Leu Val Ser 755 760 765;Asn Leu Ser Gly Lys Ala Cys Thr Asp Glu Val Ser Ser Pro Gly Tyr 770 775 780;Trp Val Arg His Ala Arg Glu Val Val Arg Phe Ala Asp Gly Val Lys 785 790 795 800;Ala Leu His Ala Ala Gly Ala Gly Thr Phe Val Glu Val Gly Pro Lys 805 810 815;Ser Thr Leu Leu Gly Leu Val Pro Ala Cys Met Pro Asd Ala Arg Pro 820 825 830;Ala Leu Leu Ala Ser Ser Arg Ala Gly Arg Asp Glu Pro Ala Thr Val 835 840 845;Leu Glu Ala Leu Gly Gly Leu Trp Ala Val Gly Gly Leu Val Ser Trp 850 855 860;Ala Gly Leu Phe Pro Ser Gly Gly Arg Arg Val Pro Leu Pro Thr Tyr 865 870 875 880;Pro Trp Gin Arg Glu Arg Tyr Trp lie Asp Thr Lys Ala Asp Asd Ala 885 890 895;Ala Arg Gly Asp Arg Arg Ala Pro Gly Ala Gly His Asp Glu Val Glu 900 905 910;Glu Gly Gly Ala Val Arg Gly Gly Asp Arg Arg Ser Ala Arg Leu Asp 915 920 925;His Pro Pro Pro Glu Ser Gly Arg Arg Glu Lys Val Glu Ala Ala Gly 930 935 940;Asp Arg Pro Phe Arg Leu Glu He Asp Glu Pro Gly Val Leu Asd His 945 950 955 960;Leu Val Leu Arg Val Thr Glu Arg Arg Ala Pro Gly Leu Gly Glu Val 965 970 975;Glu lie Ala Val Asd Ala Ala Gly Leu Ser Phe Asn Asp Val Gin Leu 980 985 990;Ala Leu Gly Met Val Pro Asp Asp Leu Pro Gly Lys Pro Asn Pro Pro 995 1000 1005;Leu Leu Leu Gly Gly Glu Cys Ala Gly Arg lie Val Ala Val Gly Glu 1010 1015 1020;Printed from Mimosa 03/20/2002 15:55:45 page -107-;WO 99/66028;PCT/EP99/04171;-22-;Gly Val Asn Gly Leu Val Val Gly Gin Pro Val lie Ala Leu Ser Ala 1025 1030 1035 1040;Gly Ala Phe Ala Thr His Val Thr Thr Ser Ala Ala Leu Val Leu Pro 1045 1050 1055;Arg Pro Gin Ala Leu Ser Ala lie Glu Ala Ala Ala Mec Pro Val Ala 1060 1065 1070;Tyr Leu Thr Ala Trp Tyr Ala Leu Asp Arg lie Ala Arg Leu Gin Pro 1075 1080 1085;Gly Glu Arg Val Leu lie Kis Ala Ala Thr Gly Gly Val Gly Leu Ala 1090 1095 1100;Ala Val Gin Trp Ala Gin His Val Gly Ala Glu Val His Ala Thr Ala 1105 1110 1115 1120;Gly Thr Pro Glu Lys Arg Ala Tyr Leu Glu Ser Leu Gly Val Arg Tyr 1125 1130 1135;Val Ser Asp Ser Arg Ser Asp Arg Phe Val Ala Asp Val Arg Ala Trp 1140 1145 1150;Thr Gly Gly Glu Gly Val Asp Val Val Leu Asn Ser Leu Ser Gly Glu 1155 1160 1165;Leu lie Asp Lys Ser Phe Asn Leu Leu Arg Ser His Gly Arg Phe Val 1170 1175 1180;Glu Leu Gly Lys Arg Asp Cys Tyr Ala Asp Asn Gin Leu Gly Leu Arg 1185 1190 1195 1200;Pro Phe Leu Arg Asn Leu Ser Phe Ser Leu Val Asp Leu Arg Gly Mec 1205 1210 1215;Mec Leu Glu Arg Pro Ala Arg Val Arg Ala Leu Leu Glu Glu Leu Leu 1220 1225 1230;Gly Leu lie Ala Ala Gly Val Phe Thr Pro Pro Pro lie Ala Thr Leu 1235 1240 1245;Pro lie Ala Arg Val Ala Asp Ala Phe Arg Ser Mec Ala Gin Ala Gin 1250 1255 1260;His Leu Gly Lys Leu Val Leu Thr Leu Gly Asp Pro Glu Val Gin lie 1265 1270 1275 1280;Arg He Pro Thr His Ala Gly Ala Gly Pro Ser Thr-Gly Asd Arg Asp 1285 1290 1295;Leu Leu Asp Arg Leu Ala Ser Ala Ala Pro Ala Ala Arg Ala Ala Ala 1300 1305 1310;Leu Glu Ala Phe Leu Arg Thr Gin Val Ser Gin Val Leu Arg Thr Pro 1315 1320 1325;Glu lie Lys Val Gly Ala Glu Ala Leu Phe Thr Arg Leu Gly Mec Asp 1330 1335 1340;Ser Leu Mec Ala Val Glu Leu Arg Asn Arg lie Glu Ala Ser Leu Lys 1345 1350 1355 i360;Leu Lys Leu Ser Thr Thr Phe Leu Ser Tiir Ser Pro Asn lie Ala Leu;Printed from Mimosa 03/20/2002 15:55:45 page -108-;WO 99/66028;PCT/EP99/04171;-23-;1365;1370;1375;Leu Ala Gin Asn Leu Leu Asp Ala Leu Ala Thr Ala Leu Ser Leu Glu 1380 1385 1390;Arg Val Ala Ala Glu Asn Leu Arg Ala Gly Val Gin Asn Asp Phe Val 1395 1400 1405;ser Ser Gly Ala Asp Gin Asp Trp Glu lie lie Ala Leu;&lt;210&gt; 3 &lt;211&gt; 1410 &lt;212&gt; PRT;&lt;213&gt; Sorangium cellulosum &lt;400&gt; 3;Mec Thr lie Asn Gin Leu Leu Asn Glu Leu Glu His Gin Gly lie Lys 15 10 15;Leu Ala Ala Asp Gly Glu Arg Leu Gin lie Gin Ala Pro Lys Asn Ala 20 25 30;Leu Asn Pro Asn Leu Leu Ala Arg lie Ser Glu His Lys Ser Thr lie 35 40 45;Leu Thr Mec Leu Arg Gin Arg Leu Pro Ala Glu Ser lie Val Pro Ala 50 55 60;Pro Ala Glu Aro His Ala Pro Phe Pro Leu Thr Asp lie Gin Glu Ser 65 70 75 80;Tyr Trp Leu Gly Arg Thr Gly Ala Phe Thr Val Pro Ser Gly lie His 85 90 95;Ala Tyr Arg Glu Tyr Asp Cys Thr Asp Leu Asp Val Pro Arg Leu Ser 100 105 110;Arg Ala Phe Arg Lys Val Val Ala Arg His Asp Mec Leu Arg Ala His 115 120 125;Thr Leu Pro Asp Mec Mec Gin Val lie Glu Pro Lys Val Asp Ala Asp 130 135 140;lie Glu lie lie Asp Leu Arg Gly Leu Asp Arg Ser Thr Arg Glu Ala 145 150 155 160;Arg Leu Val Ser Leu Arg Asp Ala Met Ser His Arg lie Tyr Asp Thr 165 170 175;Glu Arg Pro Pro Leu Tyr His Val Val Ala Val Arg Leu Asp Glu Arg 180 185 190;Gin Thr Arg Leu Val Leu ser lie Asp Leu lie Asn Val Asp Leu Gly 195 200 205;Ser Leu Ser He He Phe Lys Asp Trp Leu Ser Phe Tyr Glu Asp Pro 210 215 220;Glu Thr Ser Leu Pro Val Leu Glu Leu Ser Tyr Arg Asp Tyr Val Leu 225 230 235 240;Ala Leu Glu Ser Arg Lys Lys Ser Glu Ala His Gin Arg Ser Mec Asp;1410;1415;1420;245;250;255;Printed from Mimosa 03/20/2002 15:55:45 page -109-;WO 99/66028 PCT/EP99/04171;-24-;Tyr Trp Lys Arg Arg lie Ala Glu Leu Pro Pro Pro Pro Thr Leu Pro 260 265 270;Met Lys Ala Asp Pro Ser Thr Leu Lys Glu lie Arg Phe Arg His Thr 275 280 285;Glu Gin Trp Leu Pro Ser Asp Ser Trp Gly Arg Leu Lys Arg Arg Val 290 295 300;Gly Glu Arg Gly Leu Thr Pro Thr Gly Val lie Leu Ala Ala Phe Ser 305 310 315 320;Glu Val lie Gly Arg Trp Ser Ala Ser Pro Arg Phe Thr Leu Asn lie 325 330 335;Thr Leu Phe Asn Arg Leu Pro Val His Pro Arg Val Asn Asp lie Thr 340 345 350;Gly Asp Phe Thr Ser Met Val Leu Leu Asp lie Asp Thr Thr Arg Asp 355 360 365;Lys Ser Phe Glu Gin Arg Ala Lys Arg lie Gin Glu Gin Leu Tro Glu 370 375 380;Ala Met Asp His Cys Asp Val Ser Gly He Glu Val Gin Ara Glu Ala 385 390 395 " 400;Ala Arg Val Leu Gly lie Gin Arg Gly Ala Leu Phe Pro Val Val Leu 405 410 415;Thr Ser Ala Leu Asn Gin Gin Val Val Gly Val Thr Ser Leu Gin Arg 420 425 430;Leu Gly Thr Pro Val Tyr Thr Ser Thr Gin Thr Pro Gin Leu Leu Leu 435 440 445;Asp His Gin Leu Tyr Glu His Asp Gly asd Leu Val Leu Ala Trp Asp 450 455 460;He Val Asp Gly Val Phe Pro Pro Asp Leu Leu Asp Asp Met Leu Glu 465 470 475 480;Ala Tyr Val Val Phe Leu Arg Arg Leu Thr Glu Glu Pro Trp Gly Glu 485 490 495;Gin Val Arg Cys Ser Leu Pro Pro Ala Gin Leu Glu Ala Arg Ala Ser 500 505 510;Ala Asn Ala Thr Asn Ala Leu Leu Ser Glu His Thr Leu His Gly Leu 515 520 525;Phe Ala Ala Arg Val Glu Gin Leu Pro Met Gin Leu Ala Val Val Ser 530 535 540;Ala Arg Lys Thr Leu Thr Tyr Glu Glu Leu Ser Arg Arg Ser Arg Arg 545 550 555 560;Leu Gly Ala Arg Leu Arg Glu Gin Gly Ala Arg Pro Asn Thr Leu Val 565 570 575;Ala Val Val Met Glu Lys Gly Trp Glu Gin Val Val Ala Val Leu Ala 580 535 590;Val Leu Glu Ser Gly Ala Ala Tyr Val Pro lie Asp Ala Asp Leu Pro;Printed from Mimosa 03/20/2002 15:55:45 page -110-;WO 99/66028;PCT/EP99/04171;-25-;595;600;605;Ala Glu Arg lie His Tyr Leu Leu Asp His Gly Glu Val Lys Leu Val 610 615 620;Leu Thr Gin Pro Trp Leu Asp Gly Lys Leu Ser Trp Pro Pro Gly lie 625 630 635 640;Gin Arg Leu Leu Val Ser Glu Ala Gly Val Glu Gly Asp Gly Asp Gin 645 650 655;Pro Pro Met Met Pro lie Gin Thr Pro Ser Asp Leu Ala Tyr Val lie 660 665 670;Tyr Thr Ser Gly Ser Thr Gly Leu Pro Lys Gly Val Met lie Asp His 675 680 685;Arg Gly Ala Val Asn Thr lie Leu Asp lie Asn Glu Arg Phe Glu lie 690 695 700;Gly Pro Gly Asd Arg Val Leu Ala Leu Ser Ser Leu Ser Phe Asp Leu 705 710 715 720;Ser Val Tyr Asp Val Phe Gly lie Leu Ala Ala Gly Gly Thr lie Val 725 730 735;Val Pro Asp Ala Ser Lys Leu Arg Asp Pro Ala His Trp Ala Glu Leu 740 745 750;lie Glu Arg Glu Lys Val Thr Val Trp Asn Ser Val Pro Ala Leu Met 755 760 765;Arg Met Leu Val Glu His Phe Glu Gly Arg Pro Asp Ser Leu Ala Arg 770 775 780;Ser Leu Arg Leu Ser Leu Leu Ser Gly Asp Trp lie Pro Val Gly Leu 785 790 795 800;Pro Gly Glu Leu Gin Ala lie Arg Pro Gly Val Ser Val lie Ser Leu 805 810 815;Gly Gly Ala Thr Glu Ala Ser lie Trp Ser lie Gly Tyr Pro Val Arg 820 825 830;Asn Val Asp Leu Ser Trp Ala Ser lie Pro Tyr Gly Arg Pro Leu Arg B35 840 845;Asn Gin Thr Phe His Val Leu Asp Glu Ala Leu Glu Pro Arg Pro Val 850 855 860;Trp Val Pro Gly Gin Leu Tyr lie Gly Gly Val Gly Leu Ala Leu Gly 865 870 875 880;Tyr Trp Arg Asp Glu Glu Lys Thr Arg Lys Ser Phe Leu Val His Pro 885 890 895;Glu Thr Gly Glu Arg Leu Tyr Lys Thr Gly Asp Leu Gly Arg Tyr Leu 900 905 910;Pro Asp Gly Asn lie Glu Phe Met Gly Arg Glu Asp Asn Gin lie Lys 915 920 925;Leu Arg Gly Tyr Arg Val Glu Leu Gly Glu lie Glu Glu Thr Leu Lys 930 935 940;Printed from Mimosa 03/20/2002 15:55:45 page -111-;WO 99/66028;PCT/EP99/04171;-26-;Ser His Pro Asn Val Arg Asp Ala Val lie Val Pro Val Gly Asn Asp 945 950 955 960;Ala Ala Asn Lys Leu Leu Leu Ala Tyr Val Val Pro Glu Gly Thr Arg 965 970 975;Arg Arg Ala Ala Glu Gin Asp Ala Ser Leu Lys Thr Glu Arg He Asp 980 985 990;Ala Arg Ala His Ala Ala Glu Ala Asp Gly Leu Ser Asp Gly Glu Arg 995 1000 1005;Val Gin Phe Lys Leu Ala Arg His Gly Leu Arg Arg Asp Leu Asp Gly 1010 1015 1020;Lys Pro Val Val Asp Leu Thr Gly Gin Asp Pro Arg Glu Ala Gly Leu 1025 1030 1035 1040;Asp Val Tyr Ala Arg Arg Arg Ser Val Arg Thr Phe Leu Glu Ala Pro 1045 1050 1055;lie Pro Phe Val Glu Phe Gly Arg Phe Leu Ser Cys Leu Ser Ser Val 1060 1065 1070;Glu Pro Asp Gly Ala Thr Leu Pro Lys Phe Arg Tyr Pro Ser Ala Gly 1075 1080 1085;Ser Thr Tyr Pro Val Gin Thr Tyr Ala Tyr Val Lys Ser Gly Arg lie 1090 1095 1100;Glu Gly Val Asp Glu Gly Phe Tyr Tyr Tyr His Pro Phe Glu His Arg 1105 1110 1115 1120;Leu Leu Lys Leu Ser Asp His Gly lie Glu Arg Gly Ala His Val Arg 1125 1130 1135;Gin Asn Phe Asp Val Phe Asp Glu Ala Ala Phe Asn Leu Leu Phe Val 1140 1145 1150;Gly Arg lie Asd Ala lie Glu Ser Leu Tyr Gly Ser Ser Ser Arg Glu 1155 1160 1165;Phe Cys Leu Leu Glu Ala Gly Tyr Met Ala Gin Leu Leu Met Glu Gin 1170 1175 1180;Ala Pro Ser Cys Asn lie Gly Val Cys Pro Val Gly Gin Phe Asn Phe 1185 1190 1195 1200;Glu Gin Val Arg Pro Val Leu Asp Leu Arg His Ser Asp Val Tyr Val 1205 1210 1215;His Gly Met Leu Gly Gly Arg Val Asp Pro Arg Gin Phe Gin Val Cys 1220 1225 1230;Thr Leu Gly Gin Asp Ser Ser Pro Arg Arg Ala Thr Thr Arg Gly Ala 1235 1240 1245;Pro Pro Glv Arg Glu Gin His Phe Ala Asp Met Leu Arg Asp Phe Leu 1250 " 1255 1260;Arg Thr Lys Leu Pro Glu Tyr Met Val Pro Thr Val Phe Val Glu Leu 1265 1270 1275 1280;Asp Ala Leu Pro Leu Thr Ser Asn Gly Lys Val Asp Arg Lys Ala Leu 1285 1290 1295;Printed from Mimosa 03/20/2002 15:55:45 page -112-;WO 99/66028;PCT/EP99/04171;-27-;Arg Glu Arg Lys Asp Thr 1300;Ser Ser Pro Arg 1305;His Ser Gly His Thr Ala 1310;Pro Arg Asp Ala Leu Glu Glu lie Leu Val Ala Val Val Arg Glu Val 1315 1320 1325;Leu Gly Leu Glu Val Val Gly Leu Gin Gin Ser Phe Val Asp Leu Gly 1330 1335 1340;Ala Thr Ser lie His lie Val Arg Met Arg Ser Leu Leu Gin Lys Arg 1345 1350 1355 1360;Leu Asp Arg Glu lie Ala lie Thr Glu Leu Phe Gin Tyr Pro Asn Leu 1365 1370 1375;Gly Ser Leu Ala Ser Gly Leu Arg Arg Asp Ser Arg Asp Leu Asp Gin 1380 1385 1390;Arg Pro Asn Met Gin Asp Arg Val Glu Val Arg Arg Lys Gly Arg Arg 1395 1400 1405;Arg Ser 1410;&lt;210&gt; 4 &lt;211&gt; 1832 &lt;212&gt; PRT;&lt;213&gt; Sorangium cellulosum &lt;400&gt; 4;Met Glu Glu Gin Glu Ser Ser Ala lie Ala Val lie Gly Met Ser Gly 15 10 15;Arg Phe Pro Gly Ala Arg Asp Leu Asp Glu Phe Trp Arg Asn Leu Arg 20 25 30;Asp Gly Thr Glu Ala Val Gin Arg Phe Ser Glu Gin Glu Leu Ala Ala 35 40 45;Ser Gly Val Asp Pro Ala Leu Val Leu Asp Pro Ser Tyr Val Arg Ala 50 55 60;Gly Ser Val Leu Glu Asp Val Asp Arg Phe Asp Ala Ala Phe Phe Gly 65 70 75 80;lie Ser Pro Arg Glu Ala Glu Leu Met Asp Pro Gin His Arg lie Phe 85 90 95;Met Glu Cys Ala Trp Glu Ala Leu Glu Asn Ala Gly Tyr Asp Pro Thr 100 105 110;Ala Tyr Glu Gly Ser lie Gly Val Tyr Ala Gly Ala Asn Met Ser Ser 115 120 125;Tyr Leu Thr Ser Asn Leu His Glu His Pro Ala Met Met Arg Trp Pro 130 135 140;Gly Trp Phe Gin Thr Leu lie Gly Asn Asp Lys Asp Tyr Leu Ala Thr 145 150 155 160;His Val Ser Tyr Arg Leu Asn Leu Arg Gly Pro Ser lie Ser Val Gin;165;170;175;Printed from Mimosa 03/20/2002 15:55:45 page -113-;WO 99/66028 PCT/EP99/04171;-28-;Thr Ala Cys Ser Thr Ser Leu Val Ala Val His Leu Ala Cys Met Ser 180 185 190;Leu Leu Asp Arg Glu Cys Asp Met Ala Leu Ala Gly Gly lie Thr Val 195 200 205;Arg lie Pro His Arg Ala Gly Tyr Val Tyr Ala Glu Gly Gly lie Phe 210 215 220;Ser Pro Asp Gly His Cys Arg Ala Phe Asp Ala Lys Ala Asn Gly Thr 225 230 235 240;lie Met Gly Asn Gly Cys Gly Val Val Leu Leu Lys Pro Leu Asp Arg 245 250 255;Ala Leu Ser Asp Gly Asp Pro Val Arg Ala Val lie Leu Gly Ser Ala 260 265 270;Thr Asn Asn Asp Gly Ala Arg Lys lie Gly Phe Thr Ala Pro Ser Glu 275 280 285;Val Gly Gin Ala Gin Ala lie Met Glu Ala Leu Ala Leu Ala Gly Val 290 295 300;Glu Ala Arg Ser lie Gin Tyr lie Glu Thr His Gly Thr Gly Thr Leu 305 310 315 320;Leu Gly Asp Ala lie Glu Thr Ala Ala Leu Arg Arg Val Phe Gly Arg 325 330 335;Asp Ala Ser Ala Arg Arg Ser Cys Ala lie Gly Ser Val Lys Thr Gly 340 345 350;lie Gly His Leu Glu Ser Ala Ala Gly lie Ala Gly Leu lie Lys Thr 355 360 365;Val Leu Ala Leu Glu His Arg Gin Leu Pro Pro Ser Leu Asn Phe Glu 370 375 380;Ser Pro Asn Pro Ser lie Asp Phe Ala Ser Ser Pro Phe Tyr Val Asn 385 390 395 400;Thr Ser Leu Lys Asp Trp Asn Thr Gly Ser Thr Pro Arg Arg Ala Gly 405 410 415;Val Ser Ser Phe Gly lie Gly Gly Thr Asn Ala His Val Val Leu Glu 420 425 430;Glu Ala Pro Ala Ala Lys Leu Pro Ala Ala Ala Pro Ala Arg Ser Ala 435 440 445;Glu Leu Phe Val Val Ser Ala Lys Ser Ala Ala Ala Leu Asp Ala Ala 450 455 460;Ala Ala Arg Leu Arg Asp His Leu Gin Ala His Gin Gly lie Ser Leu 465 470 475 480;Gly Asp Val Ala Phe Ser Leu Ala Thr Thr Arg Ser Pro Met Glu His 485 490 495;Arg Leu Ala Met Ala Ala Pro Ser Arg Glu Ala Leu Arg Glu Gly Leu 500 505 510;Asp Ala Ala Ala Arg Gly Gin Thr Pro Pro Gly Ala Val Arg Gly Arg 515 520 525;Printed from Mimosa 03/20/2002 15:55:45 page -114-;WO 99/66028 PCT/EP99/04171;-29-;Cys Ser Pro Gly Asn Val Pro Lys Val Val Phe Val Phe Pro Gly Gin 530 535 540;Gly Ser Gin Trp Val Gly Met Gly Arg Gin Leu Leu Ala Glu Glu Pro 545 550 555 560;Val Phe His Ala Ala Leu Ser Ala Cys Asp Arg Ala lie Gin Ala Glu 565 570 575;Ala Gly Trp Ser Leu Leu Ala Glu Leu Ala Ala Asp Glu Gly Ser Ser 580 585 590;Gin Leu Glu Arg lie Asp Val Val Gin Pro Val Leu Phe Ala Leu Ala 595 600 605;Val Ala Phe Ala Ala Leu Trp Arg Ser Trp Gly Val Ala Pro Asp Val 610 615 620;Val lie Gly His Ser Met Gly Glu Val Ala Ala Ala His Val Ala Gly 625 630 635 640;Ala Leu Ser Leu Glu Asp Ala Val Ala lie lie Cys Arg Arg Ser Arg 645 650 655;Leu Leu Arg Arg lie Ser Gly Gin Gly Glu Met Ala Val Thr Glu Leu 660 665 670;Ser Leu Ala Glu Ala Glu Ala Ala Leu Arg Gly Tyr Glu Asp Arg Val 675 680 685;Ser Val Ala Val Ser Asn Ser Pro Arg Ser Thr Val Leu Ser Gly Glu 690 695 700;Pro Ala Ala lie Gly Glu Val Leu Ser Ser Leu Asn Ala Lys Gly Val 705 710 715 720;Phe Cys Arg Arg Val Lys Val Asp Val Ala Ser His Ser Pro Gin Val 725 730 735;Asp Pro Leu Arg Glu Asp Leu Leu Ala Ala Leu Gly Gly Leu Arg Pro 740 745 750;Gly Ala Ala Ala Val Pro Met Arg Ser Thr Val Thr Gly Ala Met Val 755 760 765;Ala Gly Pro Glu Leu Gly Ala Asn Tyr Trp Met Asn Asn Leu Arg Gin 770 775 780;Pro Val Arg Phe Ala Glu Val Val Gin Ala Gin Leu Gin Gly Gly His 785 790 795 800;Gly Leu Phe Val Glu Met Ser Pro His Pro He Leu Thr Thr Ser Val 805 810 815;Glu Glu Met Arg Arg Ala Ala Gin Arg Ala Gly Ala Ala Val Gly Ser 820 825 830;Leu Arg Arg Gly Gin Asp Glu Arg Pro Ala Met Leu Glu Ala Leu Gly 835 840 845;Thr Leu Trp Ala Gin Gly Tyr Pro Val Pro Trp Gly Arg Leu Phe Pro 850 855 860;Ala Gly Gly Arg Arg Val Pro Leu Pro Thr Tyr Pro Trp Gin Arg Glu;Printed from Mimosa 03/20/2002 15:55:45 page -115-;WO 99/66028;PCT/EP99/04171;30-;865;870;875;880;Arg Tyr Trp lie Glu Ala Pro Ala Lys Ser Ala Ala Gly Asp Arg Arg 885 890 895;Gly Val Arg Ala Gly Gly His Pro Leu Leu Gly Glu Met Gin Thr Leu 900 905 910;Ser Thr Gin Thr Ser Thr Arg Leu Trp Glu Thr Thr Leu Asp Leu Lys 915 920 925;Arg Leu Pro Trp Leu Gly Asp His Arg Val Gin Gly Ala Val Val Phe 930 935 940;Pro Gly Ala Ala Tyr Leu Glu Met Ala lie Ser Ser Gly Ala Glu Ala 945 950 955 960;Leu Gly Asp Gly Pro Leu Gin lie Thr Asp Val Val Leu Ala Glu Ala 965 970 975;Leu Ala Phe Ala Gly Asp Ala Ala Val Leu Val Gin Val Val Thr Thr 980 985 990;Glu Gin Pro Ser Gly Arg Leu Gin Phe Gin lie Ala Ser Arg Ala Pro 995 1000 1005;Gly Ala Gly His Ala Ser Phe Arg Val His Ala Arg Gly Ala Leu Leu 1010 1015 1020;Arg Val Glu Arg Thr Glu Val Pro Ala Gly Leu Thr Leu Ser Ala Val 1025 1030 1035 1040;Arg Ala Arg Leu Gin Ala Ser lie Pro Ala Ala Ala Thr Tyr Ala Glu 1045 1050 1055;Leu Thr Glu Met Gly Leu Gin Tyr Gly Pro Ala Phe Gin Gly lie Ala 1060 1065 1070;Glu Leu Tro Arg Gly Glu Gly Glu Ala Leu Gly Arg Val Arg Leu Pro 1075 1080 1085;Asp Ala Ala Gly Ser Ala Ala Glu Tyr Arg Leu His Pro Ala Leu Leu 1090 1095 1100;Asp Ala Cys Phe Gin lie Val Gly Ser Leu Phe Ala Arg Ser Gly Glu 1105 1110 1115 1120;Ala Thr Pro Trp Val Pro Val Glu Leu Gly Ser Leu Arg Leu Leu Gin 1125 1130 1135;Arg Pro Ser Gly Glu Leu Trp Cys His Ala Arg Val Val Asn His Gly 1140 1145 1150;His Gin Thr Pro Asp Arg Gin Gly Ala Asp Phe Trp Val Val Asp Ser 1155 1160 - 1165;Ser Gly Ala Val Val Ala Glu Val Cys Gly Leu Val Ala Gin Arg Leu 1170 1175 1180;Pro Gly Gly Val Arg Arg Arg Glu Glu Asp Asp Trp Phe Leu Glu Leu 1185 1190 1195 1200;Glu Trp Glu Pro Ala Ala Val Gly Thr Ala Lys Val Asn Ala Gly Arg;1205;1210;1215;Printed from Mimosa 03/20/2002 15:55:45 page -116-;WO 99/66028 PCT/EP99/04I71;-31 -;Trp Leu Leu Leu Gly Gly Gly Gly Gly Leu Gly Ala Ala Leu Arg Ala 1220 1225 1230;Met Leu Glu Ala Gly Gly His Ala Val Val His Ala Ala Glu Asn Asn 1235 1240 1245;Thr Ser Ala Ala Gly val Arg Ala Leu Leu Ala Lys Ala Phe Asp Gly 1250 1255 1260;Gin Ala Pro Thr Ala Val Val His Leu Gly Ser Leu Asp Gly Gly Gly 1265 1270 1275 1280;Glu Leu Asp Pro Gly Leu Gly Ala Gin Gly Ala Leu Asp Ala Pro Arg 1285 1290 1295;Ser Ala Asp Val Ser Pro Asp Ala Leu Asp Pro Ala Leu Val Arg Gly 1300 1305 1310;Cys Asp Ser Val Leu Trp Thr Val Gin Ala Leu Ala Gly Met Gly Phe 1315 1320 1325;Arg Asp Ala Pro Arg Leu Trp Leu Leu Thr Arg Gly Ala Gin Ala Val 1330 1335 1340;Gly Ala Gly Asp Val Ser Val Thr Gin Ala Pro Leu Leu Gly Leu Gly 1345 1350 1355 1360;Arg Val lie Ala Met Glu His Ala Asp Leu Arg Cys Ala Arg Val Asp 1365 1370 1375;Leu Asp Pro Ala Arg Pro Glu Gly Glu Leu Ala Ala Leu Leu Ala Glu 1380 1385 1390;Leu Leu Ala Asp Asp Ala Glu Ala Glu Val Ala Leu Arg Gly Gly Glu 1395 1400 1405;Arg Cys Val Ala Arg lie Val Arg Arg Gin Pro Glu Thr Arg Pro Arg 1410 1415 1420;Gly Arg lie Glu Ser Cys Val Pro Thr Asp Val Thr lie Arg Ala Asp 1425 1430 1435 1440;Ser Thr Tyr Leu Val Thr Gly Gly Leu Gly Gly Leu Gly Leu Ser Val 1445 1450 1455;Ala Gly Trp Leu Ala Glu Arg Gly Ala Gly His Leu Val Leu Val Gly 1460 1465 1470;Arg Ser Gly Ala Ala Ser Val Glu Gin Arg Ala Ala Val Ala Ala Leu 1475 1480 1485;Glu Ala Arg Gly Ala Arg Val Thr Val Ala Lys Ala Asp Val Ala Asp 1490 1495 1500;Arg Ala Gin Leu Glu Arg lie Leu Arg Glu Val Thr Thr Ser Gly Met 1505 1510 1515 1520;Pro Leu Arg Gly Val Val His Ala Ala Gly lie Leu Asp Asp Gly Leu 1525 1530 1535;Leu Met Gin Gin Thr Pro Ala Arg Phe Arg Lys Val Met Ala Pro Lys 1540 1545 1550;Val Gin Gly Ala Leu His Leu His Ala Leu Thr Arg Glu Ala Pro Leu 1555 1560 1565;Printed from Mimosa 03/20/2002 15:55:45 page -117-;WO 99/66028;PCT/EP99/04171;-32-;Ser Phe Phe Val Leu Tyr Ala Ser Gly Val Gly Leu Leu Gly Ser Pro 1570 1575 1580;Gly Gin Gly Asn Tyr Ala Ala Ala Asn Thr Phe Leu Asp Ala Leu Ala 1585 1590 1595 1600;His His Arg Arg Ala Gin Gly Leu Pro Ala Leu Ser Val Asp Trp Gly 1605 1610 1615;Leu Phe Ala Glu Val Gly Met Ala Ala Ala Gin Glu Asp Arg Gly Ala 1620 1625 1630;Arg Leu Val Ser Arg Gly Met Arg Ser Leu Thr Pro Asp Glu Gly Leu 1635 1640 1645;Ser Ala Leu Ala Arg Leu Leu Glu Ser Gly Arg Ala Gin Val Gly Val 1650 1655 1660;Met Pro Val Asn Pro Arg Leu Trp Val Glu Leu Tyr Pro Ala Ala Ala 1665 1670 1675 1680;Ser Ser Arg Met Leu Ser Arg Leu Val Thr Ala His Arg Ala Ser Ala 1685 1690 1695;Gly Gly Pro Ala Gly Asp Gly Asp Leu Leu Arg Arg Leu Ala Ala Ala , 1700 1705 1710;Glu Pro Ser Ala Arg Ser Ala Leu Leu Glu Pro Leu Leu Arg Ala Gin 1715 1720 1725;lie Ser Gin Val Leu Arg Leu Pro Glu Gly Lys lie Glu Val Asp Ala 1730 1735 1740;Pro Leu Thr Ser Leu Gly Met Asn Ser Leu Met Gly Leu Glu Leu Arg 1745 1750 1755 1760;Asn Arg lie Glu Ala Met Leu Gly lie Thr Val Pro Ala Thr Leu Leu 1765 1770 1775;Trp Thr Tyr Pro Thr Val Ala Ala Leu Ser Gly His Leu Ala Arg Glu 1780 1785 1790;Ala Cys Glu Ala Ala Pro Val Glu Ser Pro His Thr Thr Ala Asp Ser 1795 1800 1805;Ala Val Glu He Glu Glu Met Ser Gin Asp Asp Leu Thr Gin Leu lie 1810 1815 1820;Ala Ala Lys Phe Lys Ala Leu Thr 1825 1830;&lt;210&gt; 5 &lt;211&gt; "257 &lt;212&gt; PP.T;&lt;213&gt; Sorangium cellulosum &lt;400&gt; 5;Met Thr Thr Arg Gly Pro Thr Ala Gin Gin Asn Pro Leu Lys Gin Ala 15 10 15;Ala lie lie lie Gin Arg Leu Glu Glu Arg Leu Ala Gly Leu Ala Gin 20 25 30;Printed from Mimosa 03/20/2002 15:55:45 page -118-;WO 99/66028 PCT/EP99/04171;■33;Ala Glu Leu Glu Arg Thr Glu Pro lie Ala lie Val Gly lie Gly Cys 35 40 45;Arg Phe Pro Gly Gly Ala Asp Ala Pro Glu Ala Phe Trp Glu Leu Leu 50 55 60;Asp Ala Glu Arg Asp Ala Val Gin Pro Leu Asp Met Arg Trp Ala Leu 65 70 75 80;Val Gly Val Ala Pro Val Glu Ala Val Pro His Trp Ala Gly Leu Leu 85 90 95;Thr Glu Pro lie Asp Cys Phe Asp Ala Ala Phe Phe Gly lie Ser Pro 100 105 110;Arg Glu Ala Arg Ser Leu Asp Pro Gin His Arg Leu Leu Leu Glu Val 115 120 125;Ala Trp Glu Gly Leu Glu Asp Ala Gly lie Pro Pro Arg Ser lie Asd 130 135 140;Gly Ser Arg Thr Gly Val Phe Val Gly Ala Phe Thr Ala Asp Tyr Ala 145 150 155 160;Arg Thr Val Ala Arg Leu Pro Arg Glu Glu Arg Asp Ala Tyr Ser Ala 165 170 175;Thr Gly Asn Met Leu Ser lie Ala Ala Gly Arg Leu Ser Tyr Thr Leu 180 185 190;Gly Leu Gin Gly Pro Cys Leu Thr Val Asp Thr Ala Cys Ser Ser Ser 195 200 205;Leu Val Ala lie His Leu Ala Cys Arg Ser Leu Arg Ala Gly Glu Ser 210 215 220;Asp Leu Ala Leu Ala Gly Gly Val Ser Ala Leu Leu Ser Pro Asp Met 225 230 235 240;Met Glu Ala Ala Ala Arg Thr Gin Ala Leu Ser Pro Asp Gly Arg Cys 245 250 255;Arg Thr Phe Asp Ala Ser Ala Asn Gly Phe Val Arg Gly Glu Gly Cys 260 265 270;Gly Leu Val Val Leu Lys Arg Leu Ser Asp Ala Gin Arg Asp Gly Asp 275 280 285;Arg lie Trp Ala Leu lie Arg Gly Ser Ala lie Asn His Asp Gly Arg 290 295 300;Ser Thr Gly Leu Thr Ala Pro Asn Val Leu Ala Gin Glu Thr Val Leu 305 310 315 320;Arg Glu Ala Leu Arg Ser Ala His Val Glu Ala Gly Ala Val Asp Tyr 325 330 335;Val Glu Thr His Gly Thr Gly Thr Ser Leu Gly Asd Pro He Glu Val 340 345 350;Glu Ala Leu Arg Ala Thr Val Gly Pro Ala Arg Ser Asp Gly Thr Arg 355 360 365;Cys Val Leu Gly Ala Val Lys Thr Asn lie Gly His Leu Glu Ala Ala 370 375 380;Printed from Mimosa 03/20/2002 15:55:45 page -119-;WO 99/66028;PCT/EP99/04171;-34-;Ala Gly Val Ala Gly Leu lie Lys Ala Ala Leu Ser Leu Thr His Glu 3B5 390 395 400;Arg lie Pro Arg Asn Leu Asn Phe Arg Thr Leu Asn Pro Arg lie Arg 405 410 415;Leu Glu Gly Ser Ala Leu Ala Leu Ala Thr Glu Pro Val Pro Trp Pro 420 425 430;Arg Thr Asp Arg Pro Arg Phe Ala Gly Val Ser Ser Phe Gly Mec Ser 435 440 445;Gly Thr Asn Ala His Val Val Leu Glu Glu Ala Pro Ala Val Glu Leu 450 455 460;Trp Pro Ala Ala Pro Glu Arg Ser Ala Glu Leu Leu Val Leu Ser Gly 465 470 475 480;Lys Ser Glu Gly Ala Leu Asp Ala Gin Ala Ala Arg Leu Arg Glu His 485 490 495;Leu Asp Mec His Pro Glu Leu Gly Leu Gly Asp Val Ala Phe Ser Leu 500 505 510;Ala Thr Thr Arg Ser Ala Mec Ser His Arg Leu Ala Val Ala Val Thr 515 520 525;Ser Arg Glu Gly Leu Leu Ala Ala Leu Ser Ala Val Ala Gin Gly Gin 530 535 540;Thr Pro Ala Gly Ala Ala Arg Cys lie Ala Ser Ser Ser Arg Gly Lys 545 550 555 560;Leu Ala Phe Leu Phe Thr Gly Gin Gly Ala Gin Thr Pro Gly Met Gly 565 570 575;Arg Gly Leu Cys Ala Ala Trp Pro Ala Phe Arg Glu Ala Phe Asp Arg 580 585 590;Cys Val Ala Leu Phe Asp Arg Glu Leu Asp Arg Pro Leu Arg Glu Val 595 600 605;Mec Trp Ala Glu Ala Gly Ser Ala Glu Ser Leu Leu Leu Asp Gin Thr 610 615 620;Ala Phe Thr Gin Pro Ala Leu Phe Ala Val Glu Tyr Ala Leu Thr Ala 625 630 635 640;Leu Trp Arg Ser Trp Gly Val Glu Pro Glu Leu Leu Val Gly His Ser 645 650 655;lie Gly Glu Leu Val Ala Ala Cys Val Ala Gly Val Phe Ser Leu Glu 660 665 670;Asp Gly Val Arg Leu Val Ala Ala Arg Gly Arg Leu Mec Gin Gly Leu 675 680 685;Ser Ala Gly Gly Ala Mec Val Ser Leu Gly Ala Pro Glu Ala Glu Val 690 695 700;Ala Ala Ala Val Ala Pro His Ala Ala Ser Val Ser lie Ala Ala Val 705 710 715 720;Asn Gly Pro Glu Gin Val Val lie Ala Gly Val Glu Gin Ala Val Gin;Printed from Mimosa 03/20/2002 15:55:45 page -120-;WO 99/66028;PCT/EP99/04171;-35-;725;730;735;Ala lie Ala Ala Gly Phe Ala Ala Arg Gly Ala Arg Thr Lys Arg Leu 740 745 750;His Val Ser His Ala Phe His Ser Pro Leu Met Glu Pro Met Leu Glu 755 760 765;Glu Phe Gly Arg Val Ala Ala Ser Val Thr Tyr Arg Arg Pro Ser Val 770 775 780;Ser Leu Val Ser Asn Leu Ser Gly Lys Val Val Thr Asp Glu Leu Ser 785 790 795 BOO;Ala Pro Gly Tyr Trp Val Arg His Val Arg Glu Ala Val Arg Phe Ala 805 810 815;Asp Gly Val Lys Ala Leu His Glu Ala Gly Ala Gly Thr Phe Val Glu 820 825 830;Val Gly Pro Lys Pro Thr Leu Leu Gly Leu Leu Pro Ala Cys Leu Pro 835 840 845;Glu Ala Glu Pro Thr Leu Leu Ala Ser Leu Arg Ala Gly Arg Glu Glu 850 855 860;Ala Ala Gly Val Leu Glu Ala Leu Gly Arg Leu Trp Ala Ala Gly Gly 865 870 875 880;Ser Val Ser Trp Pro Gly Val Phe Pro Thr Ala Gly Arg Arg Val Pro 885 890 895;Leu Pro Thr Tyr Pro Trp Gin Arg Gin Arg Tyr Trp lie Glu Ala Pro 900 905 910;Ala Glu Gly Leu Gly Ala Thr Ala Ala Asp Ala Leu Ala Gin Trp Phe 915 920 925;Tyr Arg Val Asp Trp Pro Glu Met Pro Arg Ser Ser Val Asp Ser Arg 930 935 940;Arg Ala Arg Ser Gly Gly Trp Leu Val Leu Ala Asp Arg Gly Gly Val 945 950 955 960;Gly Glu Ala Ala Ala Ala Ala Leu Ser Ser Gin Gly Cys Ser Cys Ala 965 970 975;Val Leu His Ala Pro Ala Glu Ala Ser Ala Val Ala Glu Gin Val Thr 980 985 990;Gin Ala Leu Gly Gly Arg Asn Asp Trp Gin Gly Val Leu Tyr Leu Trp 995 1000 1005;Gly Leu Asp Ala Val Val Glu Ala Gly Ala Ser Ala Glu Glu Val Ala 1010 1015 1020;Lys Val Thr His Leu Ala Ala Ala Pro Val Leu Ala Leu lie Gin Ala 1025 1030 1035 1040;Leu Gly Thr Gly Pro Arg Ser Pro Arg Leu Trp lie Val Thr Arg Gly 1045 1050 1055;Ala Cys Thr Val Gly Gly Glu Pro Asp Ala Ala Pro Cys Gin Ala Ala;1060;1065;1070;Printed from Mimosa 03/20/2002 15:55:45 page -121-;WO 99/66028 PCT/EP99/04171;-36-;Leu Trp Gly Met Gly Arg Val Ala Ala Leu Glu His Pro Gly Ser Trp 1075 1080 1085;Gly Gly Leu Val Asp Leu Asp Pro Glu Glu Ser Pro Thr Glu Val Glu 1090 1095 1100;Ala Leu Val Ala Glu Leu Leu Ser Pro Asp Ala Glu Asp Gin Leu Ala 1105 1110 1115 1120;Phe Arg Gin Gly Arg Arg Arg Ala Ala Arg Leu Val Ala Ala Pro Pro 1125 1130 1135;Glu Gly Asn Ala Ala Pro Val Ser Leu Ser Ala Glu Gly Ser Tyr Leu 1140 1145 1150;Val Thr Gly Gly Leu Gly Ala Leu Gly Leu Leu Val Ala Arg Trp Leu 1155 1160 1165;Val Glu Arg Gly Ala Gly His Leu Val Leu lie Ser Arg His Gly Leu 1170 1175 1180;Pro Asp Arg Glu Glu Trp Gly Arg Asp Gin Pro Pro Glu Val Arg Ala 1185 1190 1195 1200;Arg lie Ala Ala lie Glu Ala Leu Glu Ala Gin Gly Ala Arg Val Thr 1205 1210 1215;Val Ala Ala Val Asp Val Ala Asd Ala Glu Gly Met Ala Ala Leu Leu 1220 1225 1230;Ala Ala Val Glu Pro Pro Leu Arg Gly Val Val His Ala Ala Gly Leu 1235 1240 1245;Leu Asp Asp Gly Leu Leu Ala His Gin Asp Ala Gly Arg Leu Ala Arg;1250 1255 1260;Val Leu Arg Pro Lys Val Glu Gly Ala Trp Val Leu His Thr Leu Thr 1265 1270 1275 1280;Arg Glu Gin Pro Leu Asp Leu Phe Val Leu Phe Ser Ser Ala Ser Gly 1285 1290 1295;Val Phe Gly Ser lie Gly Gin Gly Ser Tyr Ala Ala Gly Asn Ala Phe 1300 1305 1310;Leu Asp Ala Leu Ala Asp Leu Arg Arg Thr Gin Gly Leu Ala Ala Leu 1315 1320 1325;Ser lie Ala Trp Gly Leu Trp Ala Glu Gly Gly Met Gly Ser Gin Ala 1330 1335 1340;Gin Arg Arg Glu His Glu Ala Ser Gly lie Trp Ala Met Pro Thr Ser 1345 1350 1355 1360;Arg Ala Leu Ala Ala Met Glu Trp Leu Leu Gly Thr Arg Ala Thr Gin 1365 1370 1375;Arg Val Val lie Gin Met Asp Trp Ala His Ala Gly Ala Ala Pro Arg 1380 1385 1390;Asp Ala Ser Arg Gly Arg Phe Trp Asp Arg Leu Val Thr Ala Thr Lys 1395 1400 1405;Glu Ala Ser Ser Ser Ala Val Pro Ala Val Glu Arg Trp Arg Asn Ala 1410 1415 1420;Printed from Mimosa 03/20/2002 15:55:45 page -122-;WO 99/66028;PCT/EP99/04171;-37-;Ser Val Val Glu Thr Arg Ser Ala Leu Tyr Glu Leu Val Arg Gly Val 1425 1430 1435 1440;Val Ala Gly Val Met Gly Phe Thr Asp Gin Gly Thr Leu Asp Val Arg 1445 1450 1455;Arg Gly Phe Ala Glu Gin Gly Leu Asp Ser Leu Met Ala Val Glu lie 1460 1465 1470;Arg Lys Arg Leu Gin Gly Glu Leu Gly Met Pro Leu Ser Ala Thr Leu 1475 1480 1485;Ala Phe Asp His Pro Thr Val Glu Arg Leu Val Glu Tyr Leu Leu Ser 1490 1495 1500;Gin Ala Leu Glu Leu Gin Asp Arg Thr Asp Val Arg Ser Val Arg Leu 1505 1510 1515 1520;Pro Ala Thr Glu Asp Pro lie Ala lie Val Gly Ala Ala Cys Arg Phe 1525 1530 1535;Pro Gly Gly Val Glu Asp Leu Glu Ser Tyr Trp Gin Leu Leu Thr Glu 1540 1545 1550;Gly Val Val Val Ser Thr Glu Val Pro Ala Asp Arg Trp Asn Gly Ala 1555 1560 1565;Asp Gly Arg Val Pro Gly Ser Gly Glu Ala Gin Arg Gin Thr Tyr Val 1570 1575 1580;Pro Arg Gly Gly Phe Leu Arg Glu Val Glu Thr Phe Asp Ala Ala Phe 1585 1590 1595 1600;Phe His lie Ser Pro Arg Glu Ala Met Ser Leu Asp Pro Gin Gin Arg 1605 1610 1615;Leu Leu Leu Glu Val Ser Trp Glu Ala lie Glu Arg Ala Gly Gin Asp 1620 1625 1630;Pro Ser Ala Leu Arg Glu Ser Pro Thr Gly Val Phe Val Gly Ala Gly 1635 1640 1645;Pro Asn Glu Tyr Ala Glu Arg Val Gin Glu Leu Ala Asp Glu Ala Ala 1650 1655 1660;Gly Leu Tyr Ser Gly Thr Gly Asn Met Leu Ser Val Ala Ala Gly Arg 1665 1670 1675 1680;Leu Ser Phe Phe Leu Gly Leu His Gly Pro Thr Leu Ala Val Asp Thr 1685 1690 1695;Ala Cys Ser Ser Ser Leu Val Ala Leu His Leu Gly Cys Gin Ser Leu 1700 1705 1710;Arg Arg Gly Glu Cys Asp Gin Ala Leu Val Gly Gly Val Asn Met Leu 1715 1720 1725;Leu Ser Pro Lys Thr Phe Ala Leu Leu Ser Arg Met His Ala Leu Ser 1730 1735 1740;Pro Gly Gly Arg Cys Lys Thr Phe Ser Ala Asp Ala Asp Gly Tyr Ala 1745 1750 1755 1760;Arg Ala Glu Gly Cys Ala Val Val Val Leu Lys Arg Leu Ser Asp Ala;Printed from Mimosa 03/20/2002 15:55:45 page -123-;WO 99/66028;PCT/EP99/04171;- 38-;1765 1770 1775;Gin Arg Asp Arg Asp Pro lie Leu Ala Val lie Arg Gly Thr Ala lie 1780 1785 1790;Asn His Asp Gly Pro Ser Ser Gly Leu Thr Val Pro Ser Gly Pro Ala 1795 1800 1805;Gin Glu Ala Leu Leu Arg Gin Ala Leu Ala His Ala Gly Val Val Pro 1810 1815 1820;Ala Asp Val Asp Phe Val Glu Cys His Gly Thr Gly Thr Ala Leu Gly 1825 1830 1835 1840;Asp Pro lie Glu Val Arg Ala Leu Ser Asp Val Tyr Gly Gin Ala Arg 1845 1850 1855;Pro Ala Asp Arg Pro Leu lie Leu Gly Ala Ala Lys Ala Asn Leu Gly 1860 1865 1870;His Met Glu Pro Ala Ala Gly Leu Ala Gly Leu Leu Lys Ala Val Leu 1875 1880 1885;Ala Leu Gly Gin Glu Gin lie Pro Ala Gin Pro Glu Leu Gly Glu Leu 1890 1895 1900;Asn Pro Leu Leu Pro Trp Glu Ala Leu Pro Val Ala Val Ala Arg Ala 1905 1910 1915 1920;Ala Val Pro Trp Pro Arg Thr Asp Arg Pro Arg Phe Ala Gly Val Ser 1925 1930 1935;Ser Phe Gly Met Ser Gly Thr Asn Ala His Val Val Leu Glu Glu Ala 1940 1945 1950;Pro Ala Val Glu Leu Trp Pro Ala Ala Pro Glu Arg Ser Ala Glu Leu 1955 1960 1965;Leu Val Leu Ser Gly Lys Ser Glu Gly Ala Leu Asp Ala Gin Ala Ala 1970 1975 1980;Arg Leu Arg Glu His Leu Asp Met His Pro Glu Leu Gly Leu Gly Asp 1985 1990 1995 2000;Val Ala Phe Ser Leu Ala Thr Thr Arg Ser Ala Met Asn His Arg Leu 2005 2010 2015;Ala Val Ala Val Thr Ser Arg Glu Gly Leu Leu Ala Ala Leu Ser Ala 2020 2025 2030;Val Ala Gin Gly Gin Thr Pro Pro Gly Ala Ala Arg Cys lie Ala Ser 2035 2040 2045;Ser Ser Arg Gly Lys Leu Ala Phe Leu Phe Thr Gly Gin Gly Ala Gin 2050 2055 2060;Thr Pro Gly Met Gly Arg Gly Leu Cys Ala Ala Trp Pro Ala Phe Arg 2065 2070 2075 2080;Glu Ala Phe Asp Arg Cys Val Ala Leu Phe Asp Arg Glu Leu Asp Arg 2085 2090 2095;Pro Leu Arg Glu Val Met Trp Ala Glu Pro Gly Ser Ala Glu Ser Leu 2100 2105 2110;Printed from Mimosa 03/20/2002 15:55:45 page -124-;WO 99/66028 PCT/EP99/04171;-39-;Leu Leu Asp Gin Thr Ala Phe Thr Gin Pro Ala Leu Phe Thr Val Glu 2115 2120 2125;Tyr Ala Leu Thr Ala Leu Trp Arg Ser Trp Gly Val Glu Pro Glu Leu 2130 2135 2140;Val Ala Gly His Ser Ala Gly Glu Leu Val Ala Ala Cys Val Ala Gly 2145 2150 2155 2160;Val Phe Ser Leu Glu Asp Gly Val Arg Leu Val Ala Ala Arg Gly Arg 2165 2170 2175;Leu Met Gin Gly Leu Ser Ala Gly Gly Ala Met Val Ser Leu Gly Ala 2180 2185 2190;Pro Glu Ala Glu Val Ala Ala Ala Val Ala Pro His Ala Ala Ser Val 2195 2200 2205;Ser lie Ala Ala Val Asn Gly Pro Glu Gin Val Val lie Ala Gly Val 2210 2215 2220;Glu Gin Ala Val Gin Ala lie Ala Ala Gly Phe Ala Ala Arg Gly Ala 2225 2230 2235 2240;Arg Thr Lys Arg Leu His Val Ser His Ala Ser His Ser Pro Leu Met 2245 2250 2255;Glu Pro Met Leu Glu Glu Phe Gly Arg Val Ala Ala Ser Val Thr Tyr 2260 2265 2270;Arg Arg Pro Ser Val Ser Leu Val Ser Asn Leu Ser Gly Lys Val Val 2275 2280 2285;Ala Asp Glu Leu Ser Ala Pro Gly Tyr Trp Val Arg His Val Arg Glu 2290 2295 2300;Ala Val Arg Phe Ala Asp Gly Val Lys Ala Leu His Glu Ala Gly Ala 2305 2310 2315 2320;Gly Thr Phe Val Glu Val Gly Pro Lys Pro Thr Leu Leu Gly Leu Leu 2325 2330 2335;Pro Ala Cys Leu Pro Glu Ala Glu Pro Thr Leu Leu Ala Ser Leu Arg 2340 2345 2350;Ala Gly Arg Glu Glu Ala Ala Gly Val Leu Glu Ala Leu Gly Arg Leu 2355 2360 2365;Trp Ala Ala Gly Gly Ser Val Ser Trp Pro Gly Val Phe Pro Thr Ala 2370 2375 2380;Gly Arg Arg Val Pro Leu Pro Thr Tyr Pro Trp Gin Arg Gin Arg Tyr 2385 2390 2395 2400;Trp Pro Asp lie Glu Pro Asp Ser Arg Arg His Ala Ala Ala Asp Pro 2405 2410 2415;Thr Gin Gly Trp Phe Tyr Arg Val Asp Trp Pro Glu lie Pro Arg Ser 2420 2425 2430;Leu Gin Lys Ser Glu Glu Ala Ser Arg Gly Ser Trp Leu Val Leu Ala 2435 2440 2445;Asp Lys Gly Gly Val Gly Glu Ala Val Ala Ala Ala Leu Ser Thr Arg 2450 2455 2460;Printed from Mimosa 03/20/2002 15:55:45 page -125-;WO 99/66028 PCT/EP99/04I71;-40-;Gly Leu Pro Cys Val Val Leu His Ala Pro Ala Glu Thr Ser Ala Thr 2465 2470 2475 2480;Ala Glu Leu Val Thr Glu Ala Ala Gly Gly Arg Ser Asp Trp Gin Val 2485 2490 2495;Val Leu Tyr Leu Trp Gly Leu Asp Ala Val Val Gly Ala Glu Ala Ser 2500 2505 2510;lie Asp Glu lie Gly Asp Ala Thr Arg Arg Ala Thr Ala Pro Val Leu 2515 2520 2525;Gly Leu Ala Arg Phe Leu Ser Thr Val Ser Cys Ser Pro Arg Leu Trp 2530 2535 2540;Val Val Thr Arg Gly Ala Cys lie Val Gly Asp Glu Pro Ala lie Ala 2545 2550 2555 2560;Pro Cys Gin Ala Ala Leu Trp Gly Met Gly Arg Val Ala Ala Leu Glu 2565 2570 2575;His Pro Gly Ala Trp Gly Gly Leu Val Asp Leu Asp Pro Arg Ala Ser 2580 2585 2590;Pro Pro Gin Ala Ser Pro lie Asp Gly Glu Met Leu Val Thr Glu Leu 2595 2600 2605;Leu Ser Gin Glu Thr Glu Asp Gin Leu Ala Phe Arg His Gly Arg Arg 2610 2615 2620;His Ala Ala Arg Leu Val Ala Ala Pro Pro Gin Gly Gin Ala Ala Pro 2625 2630 2635 2640;Val Ser Leu Ser Ala Glu Ala Ser Tyr Leu Val Thr Gly Gly Leu Gly 2645 2650 2555;Gly Leu Gly Leu lie Val Ala Gin Trp Leu Val Glu Leu Gly Ala Arg 2660 2665 2670;His Leu Val Leu Thr Ser Arg Arg Gly Leu Pro Asp Arg Gin Ala Trp 2675 2680 2685;Cys Glu Gin Gin Pro Pro Glu lie Arg Ala Arg lie Ala Ala Val Glu 2690 2695 2700;Ala Leu Glu Ala Arg Gly Ala Arg Val Thr Val Ala Ala Val Asp Val 2705 2710 2715 2720;Ala Asp Val Glu Pro Met Thr Ala Leu Val Ser Ser Val Glu Pro Pro 2725 2730 2735;Leu Arg Gly Val Val His Ala Ala Gly Val Ser Val Met Arg Pro Leu 2740 2745 2750;Ala Glu Thr Asp Glu Thr Leu Leu Glu Ser Val Leu Arg Pro Lys Val 2755 2760 2765;Ala Gly Ser Trp Leu Leu His Arg Leu Leu His Gly Arg Pro Leu Asp 2770 2775 2780;Leu Phe Val Leu Phe Ser Ser Gly Ala Ala Val Trp Gly Ser His Ser 2785 2790 2795 2800;Gin Gly Ala Tyr Ala Ala Ala Asn Ala Phe Leu Asp Gly Leu Ala His;Printed from Mimosa 03/20/2002 15:55:45 page -126-;WO 99/66028 PCT/EP99/04171;.41 -;2805 2B10 2815;Leu Arg Arg Ser Gin Ser Leu Pro Ala Leu Ser Val Ala Trp Gly Leu 2820 2825 2830;Trp Ala Glu Gly Gly Met Ala Asp Ala Glu Ala His Ala Arg Leu Ser 2835 2840 2845;Asp lie Gly Val Leu Pro Met Ser Thr Ser Ala Ala Leu Ser Ala Leu 2850 2855 2860;Gin Arg Leu Val Glu Thr Gly Ala Ala Gin Arg Thr Val Thr Arg Met 2865 2870 2875 2880;Asp Tro Ala Arg Phe Ala Pro Val Tyr Thr Ala Arg Gly Arg Arg Asn 2885 2890 2895;Leu Leu Ser Ala Leu Val Ala Gly Arg Asp lie lie Ala Pro Ser Pro 2900 2905 2910;Pro Ala Ala Ala Thr Arg Asn Trp Arg Gly Leu Ser Val Ala Glu Ala 2915 2920 2925;Arg Val Ala Leu His Glu lie Val His Gly Ala Val Ala Arg Val Leu 2930 2935 2940;Gly Phe Leu Asp Pro Ser Ala Leu Asp Pro Gly Met Gly Phe Asn Glu 2945 2950 2955 2960;Gin Gly Leu Asp Ser Leu Met Ala Val Glu He Arg Asn Leu Leu Gin 2965 2970 2975;Ala Glu Leu Asp Val Arg Leu Ser Thr Thr Leu Ala Phe Asp His Pro 2980 2985 2990;Thr Val Gin Arg Leu Val Glu His Leu Leu Val Asp Val Leu Lys Leu 2995 3000 3005;Glu Aso Arg Ser Asp Thr Gin His Val Arg Ser Leu Ala Ser Asp Glu 3010 3015 3020;Pro lie Ala lie Val Gly Ala Ala Cys Arg Phe Pro Gly Gly Val Glu 3025 3030 3035 3040;Asp Leu Glu Ser Tyr Trp Gin Leu Leu Ala Glu Gly Val Val Val Ser 3045 3050 3055;Ala Glu Val Pro Ala Asp Arg Trp Asp Ala Ala Asp Trp Tyr Asp Pro 3060 3065 3070;Asp Pro Glu lie Pro Gly Arg Thr Tyr Val Thr Lys Gly Ala Phe Leu 3075 3080 3085;Arg Asp Leu Gin Arg Leu Asp Ala Thr Phe Phe Arg lie Ser Pro Arg 3090 3095 3100;Glu Ala Met Ser Leu Asp Pro Gin Gin Arg Leu Leu Leu Glu Val Ser 3105 3110 3115 3120;Trp Glu Ala Leu Glu Ser Ala Gly lie Ala Pro Asp Thr Leu Arg Asp 3125 3130 3135;Ser Pro Thr Gly Val Phe Val Gly Ala Gly Pro Asn Glu Tyr Tyr Thr 3140 3145 3150;Printed from Mimosa 03/20/2002 15:55:45 page -127-;WO 99/66028 PCT/EP99/04171;-42-;Gln Arg Leu Arg Gly Phe Thr Asp Gly Ala Ala Gly Leu Tyr Gly Gly 3155 3160 3165;Thr Gly Asn Met Leu Ser Val Thr Ala Gly Arg Leu Ser Phe Phe Leu 3170 3175 3180;Gly Leu His Gly Pro Thr Leu Ala Met Asp Thr Ala Cys Ser Ser Ser 3185 3190 3195 3200;Leu Val Ala Leu His Leu Ala Cys Gin Ser Leu Arg Leu Gly Glu Cys 3205 3210 3215;Asp Gin Ala Leu Val Gly Gly Val Asn Val Leu Leu Ala Pro Glu Thr 3220 3225 3230;Phe Val Leu Leu Ser Arg Met Arg Ala Leu Ser Pro Asp Gly Arg Cys 3235 3240 3245;Lys Thr Phe Ser Ala Asp Ala Asp Gly Tyr Ala Arg Gly Glu Gly Cys 3250 3255 3260;Ala Val Val Val Leu Lys Arg Leu Arg Asp Ala Gin Arg Ala Gly Asp 3265 3270 3275 3280;Ser lie Leu Ala Leu lie Arg Gly Ser Ala Val Asn His Asp Gly Pro 3285 3290 3295;Ser Ser Gly Leu Thr Val Pro Asn Gly Pro Ala Gin Gin Ala Leu Leu 3300 3305 3310;Arg Gin Ala Leu Ser Gin Ala Gly Val Ser Pro Val Asp Val Asp Phe 3315 3320 3325;Val Glu Cys His Gly Thr Gly Thr Ala Leu Gly Asp Pro lie Glu Val 3330 3335 3340;Gin Ala Leu Ser Glu Val Tyr Gly Pro Gly Arg Ser Gly Asp Arg Pro 3345 3350 3355 3360;Leu Val Leu Gly Ala Ala Lys Ala Asn Val Ala His Leu Glu Ala Ala 3365 3370 3375;Ser Gly Leu Ala Ser Leu Leu Lys Ala Val Leu Ala Leu Arg His Glu 3380 3385 3390;Gin lie Pro Ala Gin Pro Glu Leu Gly Glu Leu Asn Pro His Leu Pro 3395 3400 3405;Trp Asn Thr Leu Pro Val Ala Val Pro Arg Lys Ala Val Pro Trp Gly 3410 3415 3420;Arg Gly Ala Arg Pro Arg Arg Ala Gly Val Ser Ala Phe Gly Leu Ser 3425 3430 3435 3440;Gly Thr Asn 'Val His Val Val Leu Glu Glu Ala Pro Glu Val Glu Pro 3445 3450 3455;Ala Pro Ala Ala Pro Ala Arg Pro Val Glu Leu Val Val Leu Ser Ala 3460 3465 3470;Lys Ser Ala Ala Ala Leu Asp Ala Ala Ala Ala Arg Leu Ser Ala His 3475 3480 3485;Leu Ser Ala His Pro Glu Leu Ser Leu Gly Asp Val Ala Phe Ser Leu 3490 3495 3500;Printed from Mimosa 03/20/2002 15:55:45 page -128-;WO 99/66028;PCT/EP99/04171;-43-;Ala Thr Thr Arg Ser Pro Met Glu His Arg Leu Ala lie Ala Thr Thr 3505 3510 3515 3520;Ser Arg Glu Ala Leu Arg Gly Ala Leu Asp Ala Ala Ala Gin Gin Lys 3525 3530 3535;Thr Pro Gin Gly Ala Val Arg Gly Lys Ala Val Ser Ser Arg Gly Lys 3540 3545 3550;Leu Ala Phe Leu Phe Thr Gly Gin Gly Ala Gin Met Pro Gly Met Gly 3555 3560 3565;Arg Gly Leu Tyr Glu Thr Tro Pro Ala Phe Arg Glu Ala Phe Asp Arg 3570 3575 3580;Cys Val Ala Leu Phe Asp Arg Glu lie Asp Gin Pro Leu Arg Glu Val 3585 3590 3595 3600;Met Trp Ala Ala Pro Gly Leu Ala Gin Ala Ala Arg Leu Asp Gin Thr 3605 3610 3615;Ala Tyr Ala Gin Pro Ala Leu Phe Ala Leu Glu Tyr Ala Leu Ala Ala 3620 3625 3630;Leu Trp Arg Ser Trp Gly Val Glu Pro His Val Leu Leu Gly His Ser 3635 3640 3645;lie Gly Glu Leu val Ala Ala Cys Val Ala Gly Val Phe Ser Leu Glu 3650 3655 3660;Asp Ala Val Arg Leu Val Ala Ala Arg Gly Arg Leu Met Gin Ala Leu 3665 3670 3675 3680;Pro Ala Gly Gly Ala Met Val Ala He Ala Ala Ser Glu Ala Glu Val 3685 3690 3695;Ala Ala Ser Val Ala Pro His Ala Ala Thr Val Ser lie Ala Ala Val 3700 3705 3710;Asn Gly Pro Asp Ala Val Val lie Ala Gly Ala Glu Val Gin Val Leu 3715 3720 3725;Ala Leu Gly Ala Thr Phe Ala Ala Arg Gly lie Arg Thr Lys Arg Leu 3730 3735 3740;Ala Val Ser His Ala Phe His Ser Pro Leu Met Asp Pro Met Leu Glu 3745 3750 3755 3760;Asp Phe Gin Arg Val Ala Ala Thr lie Ala Tyr Arg Ala Pro Asp Arg 3765 3770 3775;Pro Val Val Ser Asn Val Thr Gly His Val Ala Gly Pro Glu lie Ala 3780 3785 3790;Thr Pro Glu Tyr Trp Val Arg His Val Arg Ser Ala Val Arg Phe Gly 3795 3800 3805;Asp Gly Ala Lys Ala Leu His Ala Ala Gly Ala Ala Thr Phe Val Glu 3810 3815 3B20;Val Gly Pro Lys Pro Val Leu Leu Gly Leu Leu Pro Ala Cys Leu Gly 3825 3830 3835 3840;Glu Ala Asp Ala Val Leu Val Pro Ser Leu Arg Ala Asp Arg Ser Glu;Printed from Mimosa 03/20/2002 15:55:45 page -129-;WO 99/66028 PCT/EP99/04171;-44-;3845 3850 3855;Cys Glu Val Val Leu Ala Ala Leu Gly Ala Trp Tyr Ala Trp Gly Gly 3860 3865 3870;Ala Leu Asp Trp Lys Gly Val Phe Pro Asp Gly Ala Arg Arg Val Ala 3875 3880 3885;Leu Pro Met Tyr Pro Trp Gin Arg Glu Arg His Trp Met Asp Leu Thr 3890 3895 3900;Pro Arg Ser Ala Ala Pro Ala Gly lie Ala Gly Arg Trp Pro Leu Ala 3905 3910 3915 3920;Gly Val Gly Leu Cys Met Pro Gly Ala Val Leu His His Val Leu Ser 3925 3930 3935;lie Gly Pro Arg His Gin Pro Phe Leu Gly Asd His Leu Val Phe Gly 3940 3945 " 3950;Lys Val Val Val Pro Gly Ala Phe His Val Ala Val lie Leu Ser lie 3955 3960 3965;Ala Ala Glu Arg Trp Pro Glu Arg Ala lie Glu Leu Thr Gly Val Glu 3970 3975 3980;Phe Leu Lys Ala lie Ala Met Glu Pro Asp Gin Glu Val Glu Leu His 3985 3990 3995 4000;Ala Val Leu Thr Pro Glu Ala Ala Gly Asp Gly Tyr Leu Phe Glu Leu 4005 4010 4C15;Ala Thr Leu Ala Ala Pro Glu Thr Glu Arg Arg Trp Thr Thr His Ala 4020 4025 4030;Arg Gly Arg Val Gin Pro Thr Asp Gly Ala Pro Gly Ala Leu Pro Arg 4035 4040 4045;Leu Glu Val Leu Glu Asp Arg Ala lie Gin Pro Leu Asp Phe Ala Gly 4050 4055 4060;Phe Leu Asp Arg Leu Ser Ala Val Arg lie Gly Trp Gly Pro Leu Trp 4065 4070 4075 4080;Arg Trp Leu Gin Asp Gly Arg Val Gly Asp Glu Ala Ser Leu Ala Thr 4085 4090 4095;Leu Val Pro Thr Tyr Pro Asn Ala His Asp Val Ala Pro Leu His Pro 4100 4105 4110;lie Leu Leu Asp Asn Gly Phe Ala Val Ser Leu Leu Ser Thr Arg Ser 4115 4120 4125;Glu Pro Glu Asp Asp Gly Thr Pro Pro Leu Pro Phe Ala Val Glu Arg 4130 4135 4140;Val Arg Trp Trp Arg Ala Pro Val Gly Arg Val Arg Cys Gly Gly Val 4145 4150 4155 4160;Pro Arg Ser Gin Ala Phe Gly Val Ser Ser Phe Val Leu Val Asp Glu 4165 4170 4175;Thr Gly Glu Val Val Ala Glu Val Glu Gly Phe Val Cys Arg Arg Ala 4180 4185 4190;Printed from Mimosa 03/20/2002 15:55:45 page -130-;WO 99/66028 PCT/EP99/04171;-45-;Pro Arg Glu Val Phe Leu Arg Gin Glu Ser Gly Ala Ser Thr Ala Ala 4195 4200 4205;Leu Tyr Arg Leu Asp Trp Pro Glu Ala Pro Leu Pro Asp Ala Pro Ala 4210 4215 4220;Glu Arg lie Glu Glu Ser Trp Val Val Val Ala Ala Pro Gly Ser Glu 4225 4230 4235 4240;Mec Ala Ala Ala Leu Ala Thr Arg Leu Asn Arg Cys Val Leu Ala Glu 4245 4250 4255;Pro Lys Gly Leu Glu Ala Ala Leu Ala Gly Val Ser Pro Ala Gly Val 4260 4265 4270;lie Cys Leu Trp Glu Ala Gly Ala His Glu Glu Ala Pro Ala Ala Ala 4275 4280 4285;Gin Arg Val Ala Thr Glu Gly Leu Ser Val Val Gin Ala Leu Arg Asp 4290 4295 4300;Arg Ala Val Arg Leu Trp Trp Val Thr Mec Gly Ala Val Ala Val Glu 4305 4310 4315 4320;Ala Gly Glu Arg Val Gin Val Ala Thr Ala Pro Val Trp Gly Leu Gly 4325 4330 4335;Arg Thr Val MeC Gin Glu Arg Pro Glu Leu Ser Cys Thr Leu Val Asp 4340 4345 4350;Leu Glu Pro Glu Ala Asp Ala Ala Arg Ser Ala Asp Val Leu Leu Arg 4355 4360 4365;Glu Leu Gly Arg Ala Asp Asp Glu Thr Gin Val Ala Phe Arg Ser Gly 4370 4375 4380;Lys Arg Arg Val Ala Arg Leu Val Lys Ala Thr Thr Pro Glu Gly Leu 4385 4390 4395 4400;Leu Val Pro Asp Ala Glu Ser Tyr Aro Leu Glu Ala Gly Gin Lys Gly 4405 ~4410 4415;Thr Leu Asp Gin Leu Arg Leu Ala Pro Ala Gin Arg Arg Ala Pro Gly 4420 4425 4430;Pro Gly Glu Val Glu lie Lys Val Thr Ala Ser Gly Leu Asn Phe Arg 4435 4440 4445;Thr Val Leu Ala Val Leu Gly Met Tyr Pro Gly Asp Ala Gly Pro Met 4450 4455 4460;Gly Gly Asp Cys Ala Gly Val Ala Thr Ala Val Gly Gin Gly Val Arg 4465 4470 4475 4480;His Val Ala Val Gly Asp Ala Val Mec Thr Leu Gly Thr Leu His Arg 4485 4490 4495;Phe Val Thr Val Asp Ala Arg Leu Val Val Arg Gin Pro Ala Gly Leu 4500 4505 4510;Thr Pro Ala Gin Ala Ala Thr Val Pro Val Ala Phe Leu Thr Ala Trp 4515 4520 4525;Leu Ala Leu His Asp Leu Gly Asn Leu Arg Arg Gly Glu Arg Val Leu 4530 4535 4540;Printed from Mimosa 03/20/2002 15:55:45 page -131-;WO 99/66028;PCT/EP99/04171;-46-;Ile His Ala Ala Ala Gly Gly Val Gly Mec Ala Ala Val Gin lie Ala 4545 4550 4555 4560;Arg Trp lie Gly Ala Glu Val Phe Ala Thr Ala Ser Pro Ser Lys Trp 4565 4570 4575;Ala Ala Val Gin Ala MeC Gly Val Pro Arg Thr His lie Ala Ser Ser 4580 45B5 4590;Arg Thr Leu Glu Phe Ala Glu Thr Phe Arg Gin Val Thr Gly Gly Arg 4595 4600 4605;Gly Val Asp Val Val Leu Asn Ala Leu Ala Gly Glu Phe Val Asp Ala 4610 4615 4620;Ser Leu Ser Leu Leu Ser Thr Gly Gly Arg Phe Leu Glu Mec Gly Lys 4625 4630 4635 4640;Thr Asp lie Arg Asp Arg Ala Ala Val Ala Ala Ala His Pro Gly Val 4645 4650 4655;Arg Tyr Arg Val Phe Asp lie Leu Glu Leu Ala Pro Asp Arg Thr Arg 4660 4665 4670;Glu lie Leu Glu Arg Val Val Glu Gly Phe Ala Ala Gly His Leu Arg 4675 4680 4685;Ala Leu Pro Val His Ala Phe Ala lie Thr Lys Ala Glu Ala Ala Phe 4690 4695 4700;Arg Phe MeC Ala Gin Ala Arg His Gin Gly Lys Val Val Leu Leu Pro 4705 4710 4715 4720;Ala Pro Ser Ala Ala Pro Leu Ala Pro Thr Gly Thr Val Leu Leu Thr 4725 4730 4735;Gly Gly Leu Gly Ala Leu Gly Leu His Val Ala Arg Trp Leu Ala Gin 4740 4745 4750;Gin Gly Val Pro His Mec Val Leu Thr Gly Arg Arg Gly Leu Asp Thr 4755 4760 4765;Pro Gly Ala Ala Lys Ala Val Ala Glu lie Glu Ala Leu Gly Ala Arg 4770 4775 4780;Val Thr lie Ala Ala Ser Asp Val Ala Asp Arg Asn Ala Leu Glu Ala 4785 4790 4795 4800;Val Leu Gin Ala lie Pro Ala Glu Trp Pro Leu Gin Gly Val lie His 4805 4810 4815;Ala Ala Gly Ala Leu Asp Asp Gly Val Leu Asp Glu Gin Thr Thr Asp 4820 4825 4830;Arg Phe Ser Arg Val Leu Ala Pro Lys Val Thr Gly Ala Trp Asn Leu 4835 4840 4845;His Glu Leu Thr Ala Gly Asn Asp Leu Ala Phe Phe Val Leu Phe Ser 4850 4855 4860;Ser Met Ser Gly Leu Leu Gly Ser Ala Gly Gin Ser Asn Tyr Ala Ala 4865 4870 4875 4880;Ala Asn Thr Phe Leu Asp Ala Leu Ala Ala His Arg Arg Ala Glu Gly;Printed from Mimosa 03/20/2002 15:55:45 page -132-;WO 99/66028;PCT/EP99/04171;-47-;4885 4890 4895;Leu Ala Ala Gin Ser Leu Ala Trp Gly Pro Trp Ser Asp Gly Gly Met 4900 4905 4910;Ala Ala Gly Leu Ser Ala Ala Leu Gin Ala Arg Leu Ala Arg His Gly 4915 4920 4925;Met Gly Ala Leu Ser Pro Ala Gin Gly Thr Ala Leu Leu Gly Gin Ala 4930 4935 4940;Leu Ala Arg Pro Glu Thr Gin Leu Gly Ala Met Ser Leu Asp Val Arg 4945 4950 4955 4960;Ala Ala Ser Gin Ala Ser Gly Ala Ala Val Pro Pro Val Trp Arg Ala 4965 4970 4975;Leu Val Arg Ala Glu Ala Arg His Thr Ala Ala Gly Ala Gin Gly Ala 4980 4985 4990;Leu Ala Ala Arg Leu Gly Ala Leu Pro Glu Ala Arg Arg Ala Asp Glu 4995 5000 5005;Val Arg Lys Val Val Gin Ala Glu lie Ala Arg Val Leu Ser Trp Ser 5010 5015 5020;Ala Ala Ser Ala Val Pro Val Asp Arg Pro Leu Ser Asp Leu Gly Leu 5025 5030 5035 5040;Asp Ser Leu Thr Ala Val Glu Leu Arg Asn Val Leu Gly Gin Arg Val 5045 5050 5055;Gly Ala Thr Leu Pro Ala Thr Leu Ala Phe Asp His Pro Thr Val Asp 5060 5065 5070;Ala Leu Thr Arg Trp Leu Leu Asp Lys Val Leu Ala Val Ala Glu Pro 5075 5080 5085;Ser Val Ser Ser Ala Lys Ser Ser Pro Gin Val Ala Leu Asp Glu Pro 5090 5095 5100;lie Ala lie lie Gly lie Gly Cys Arg Phe Pro Gly Gly Val Ala Asp 5105 5110 5115 5120;Pro Glu Ser Phe Trp Arg Leu Leu Glu Glu Gly Ser Asp Ala Val Val 5125 5130 5135;Glu Val Pro His Glu Arg Trp Asp lie Asp Ala Phe Tyr Asp Pro Asp 5140 5145 5150;Pro Asp Val Arg Gly Lys Met Thr Thr Arg Phe Gly Gly Phe Leu Ser 5155 5160 5165;Asp lie Asp Arg Phe Asp Pro Ala Phe Phe Gly lie Ser Pro Arg Glu 5170 5175 5180;Ala Thr Thr Met Asp Pro Gin Gin Arg Leu Leu Leu Glu Thr Ser Trp 5185 5190 5195 5200;Glu Ala Phe Glu Arg Ala Gly lie Leu Pro Glu Arg Leu Met Gly Ser 5205 5210 5215;Asp Thr Gly Val Phe Val Gly Leu Phe Tyr Gin Glu Tyr Ala Ala Leu 5220 5225 5230;Printed from Mimosa 03/20/2002 15:55:45 page -133-;WO 99/66028;PCT/EP99/04171;-48-;Ala Gly Gly lie Glu Ala Phe Asp Gly Tyr Leu Gly Thr Gly Thr Thr 5235 5240 5245;Ala Ser Val Ala Ser Gly Arg lie Ser Tyr Val Leu Gly Leu Lys Gly 5250 5255 5260;Pro Ser Leu Thr Val Asp Thr Ala Cys Ser Ser Ser Leu Val Ala Val 5265 5270 5275 5280;His Leu Ala Cys Gin Ala Leu Arg Arg Gly Glu Cys Ser Val Ala Leu 5285 5290 5295;Ala Gly Gly Val Ala Leu Met Leu Thr Pro Ala Thr Phe Val Glu Phe 5300 5305 5310;Ser Arg Leu Arg Gly Leu Ala Pro Asp Gly Arg Cys Lys Ser Phe Ser 5315 5320 5325;Ala Ala Ala Asp Gly Val Gly Trp Ser Glu Gly Cys Ala Met Leu Leu 5330 5335 5340;Leu Lys Fro Leu Arg Asp Ala Gin Arg Asp Gly Asp Pro lie Leu Ala 5345 5350 5355 5360;Val lie Arg Gly Thr Ala Val Asn Gin Asp Gly Arg Ser Asn Gly Leu 5365 5370 5375;Thr Ala Pro Asn Gly Ser Ser Gin Gin Glu Val lie Arg Arg Ala Leu 5380 5385 5390;Glu Gin Ala Gly Leu Ala Pro Ala Asp Val Ser Tyr Val Glu Cys His 5395 5400 5405;Gly Thr Gly Thr Thr Leu Gly Asp Pro lie Glu Val Gin Ala Leu Gly;5410 5415 5420;Ala Val Leu Ala Gin Gly Arg Pro Ser Asp Arg Pro Leu Val lie Gly 5425 5430 5435 5440;Ser Vai Lys Ser Asn lie Gly His Thr Gin Ala Ala Ala Gly Val Ala 5445 5450 5455;Gly Val lie Lys Val Ala Leu Ala Leu Glu Arg Gly Leu lie Pro Arg 5460 5465 5470;Ser Leu His Phe Asp Ala Pro Asn Pro His lie Pro Trp Ser Glu Leu 5475 5480 5485;Ala Val Gin Val Ala Ala Lys Pro Val Glu Trp Thr Arg Asn Gly Val 5490 5495 5500;Pro Arg Arg Ala Gly Val Ser Ser Phe Gly Val Ser Gly Thr Asn Ala 5505 5510 5515 5520;His Val Val Leu Glu Glu Ala Pro Ala Ala Ala Phe Ala Pro Ala Ala 5525 5530 5535;Ala Arg Ser Ala Glu Leu Phe Val Leu Ser Ala Lys Ser Ala Ala Ala 5540 5545 5550;Leu Asp Ala Gin Ala Ala Arg Leu Ser Ala His Val Val Ala His Pro 5555 5560 5565;Glu Leu Gly Leu Gly Asp Leu Ala Phe Ser Leu Ala Thr Thr Arg Ser 5570 5575 5580;Printed from Mimosa 03/20/2002 15:55:45 page -134-;WO 99/66028;PCT/EP99/04171;■49.;Pro Met Thr Tyr Arg Leu Ala Val Ala Ala Thr Ser Arg Glu Ala Leu 5585 5590 5595 5600;Ser Ala Ala Leu Asp Thr Ala Ala Gin Gly Gin Ala Pro Pro Ala Ala 5605 5610 5615;Ala Arg Gly His Ala Ser Thr Gly Ser Ala Pro Lys Val Val Phe Val 5620 5625 5630;Phe Pro Gly Gin Gly Ser Gin Trp Leu Gly Met Gly Gin Lys Leu Leu 5635 5640 5645;Ser Glu Glu Pro Val Phe Arg Asp Ala Leu Ser Ala Cys Asp Arg Ala 5650 5655 5660;lie Gin Ala Glu Ala Gly Trp Ser Leu Leu Ala Glu Leu Ala Ala Asp 5665 5670 5675 5680;Glu Thr Thr Ser Gin Leu Gly Arg lie Asp Val Val Gin Pro Ala Leu 5685 5690 5695;Phe Ala lie Glu Val Ala Leu Ser Ala Leu Trp Arg Ser Trp Gly Val 5700 5705 5710;Glu Pro Asp Ala Val Val Gly His Ser Met Gly Glu Val Ala Ala Ala 5715 5720 5725;His Val Ala Gly Ala Leu Ser Leu Glu Asp Ala Val Ala lie lie Cys 5730 5735 5740;Arg Arg Ser Leu Leu Leu Arg Arg He Ser Gly Gin Gly Glu Met Ala 5745 5750 5755 5760;Val Val Glu Leu Ser Leu Ala Glu Ala Glu Ala Ala Leu Leu Gly Tyr 5765 5770 5775;Glu Asp Arg Leu Ser Val Ala Val Ser Asn Ser Pro Arg Ser Thr Val 5780 5785 5790;Leu Ala Gly Glu Pro Ala Ala Leu Ala Glu Val Leu Ala lie Leu Ala 5795 5800 5805;Ala Lys Gly Val Phe Cys Arg Arg Val Lys Val Asp Val Ala Ser His 5810 5815 5820;Ser Pro Gin lie Asp Pro Leu Arg Asp Glu Leu Leu Ala Ala Leu Gly 5825 5830 5835 5840;Glu Leu Glu Pro Arg Gin Ala Thr Val Ser Met Arg Ser Thr Val Thr 5845 5850 5855;Ser Thr lie Met Ala Gly Pro Glu Leu Val Ala Ser Tyr Trp Ala Asp 5860 5865 5870;Asn Val Arg Gin Pro Val Arg Phe Ala Glu Ala Val Gin Ser Leu Met 5875 5880 5885;Glu Asp Gly His Gly Leu Phe Val Glu Met Ser Pro His Pro lie Leu 5890 5895 5900;Thr Thr Ser Val Glu Glu lie Arg Arg Ala Thr Lys Arg Glu Gly Val 5905 5910 5915 5920;Ala Val Gly Ser Leu Arg Arg Gly Gin Asp Glu Arg Leu Ser Met Leu;Printed from Mimosa 03/20/2002 15:55:45 page -135-;WO 99/66028;PCT/EP99/04171;-50-;5925 5930 5935;Glu Ala Leu Gly Ala Leu Trp Val His Gly Gin Ala Val Gly Trp Glu 5940 5945 5950;Arg Leu Phe Ser Ala Gly Gly Ala Gly Leu Arg Arg Val Pro Leu Pro 5955 5960 5965;Thr Tyr Pro Trp Gin Arg Glu Arg Tyr Trp Val Asp Ala Pro Thr Gly 5970 5975 5980;Gly Ala Ala Gly Gly Ser Arg Phe Ala His Ala Gly Ser His Pro Leu 5985 5990 5995 6000;Leu Gly Glu Met Gin Thr Leu Ser Thr Gin Arg Ser Thr Arg Val Trp 6005 6010 6015;Glu Thr Thr Leu Asp Leu Lys Arg Leu Pro Trp Leu Gly Asp His Arg 6020 6025 6030;Val Gin Gly Ala Val Val Phe Pro Gly Ala Ala Tyr Leu Glu Met Ala 6035 6040 6045;Leu Ser Ser Gly Ala Glu Ala Leu Gly Asp Gly Pro Leu Gin Val Ser 6050 6055 6060;Asp Val Val Leu Ala Glu Ala Leu Ala Phe Ala Asp Asp Thr Pro Ala 6065 6070 6075 6080;Ala Val Gin Val Met Ala Thr Glu Glu Arg Pro Gly Arg Leu Gin Phe 6085 6090 6095;His Val Ala Ser Arg Val Pro Gly His Gly Gly Ala Ala Phe Arg Ser 6100 6105 6110;His Ala Arg Gly Val Leu Arg Gin lie Glu Arg Ala Glu Val Pro Ala 6115 6120 6125;Arg Leu Asp Leu Ala Ala Leu Arg Ala Arg Leu Gin Ala Ser Ala Pro 6130 6135 6140;Ala Ala Ala Thr Tyr Ala Ala Leu Ala Glu Met Gly Leu Glu Tyr Gly 6145 6150 6155 6160;Pro Ala Phe Gin Gly Leu Val Glu Leu Trp Arg Gly Glu Gly Glu Ala 6165 6170 6175;Leu Gly Arg Val Arg Leu Pro Glu Ala Ala Gly Ser Pro Ala Ala Cys 6180 6185 6190;Arg Leu His Pro Ala Leu Leu Asp Ala Cys Phe His Val Ser Ser Ala 6195 6200 6205;Phe Ala Asp Arg Gly Glu Ala Thr Pro Trp Val Pro Val Glu lie Gly 6210 6215 6220;Ser Leu Arg Trp Phe Gin Arg Pro Ser Gly Glu Leu Trp Cys His Ala 6225 6230 6235 6240;Arg Ser Val Ser His Gly Lys Pro Thr Pro Asp Arg Arg Ser Thr Asp 6245 6250 6255;Phe Trp val Val Asp Ser Thr Gly Ala lie Val Ala Glu lie Ser Gly 6260 6265 6270;Printed from Mimosa 03/20/2002 15:55:45 page -136-;WO 99/66028 PCT/EP99/04171;-51 -;Leu Val Ala Gin Arg Leu Ala Gly Gly Val Arg Arg Arg Glu Glu Asp 6275 6280 6285;Asp Trp Phe Met Glu Pro Ala Trp Glu Pro Thr Ala Val Pro Gly Ser 6290 6295 6300;Glu Val Met Ala Gly Arg Trp Leu Leu lie Gly Ser Gly Gly Gly Leu 6305 6310 6315 6320;Gly Ala Ala Leu His Ser Ala Leu Thr Glu Ala Gly His Ser Val Val 6325 6330 6335;His Ala Thr Gly Arg Gly Thr Ser Ala Ala Gly Leu Gin Ala Leu Leu 6340 6345 6350;Thr Ala Ser Phe Asp Gly Gin Ala Pro Thr Ser Val Val His Leu Gly 6355 6360 6365;Ser Leu Asp Glu Arg Gly Val Leu Asp Ala Asp Ala Pro Phe Asd Ala 6370 6375 6380;Asp Ala Leu Glu Glu Ser Leu Val Arg Gly Cys Asp Ser Val Leu Trp 6385 6390 6395 6400;Thr Val Gin Ala Val Ala Gly Ala Gly Phe Arg Asp Pro Pro Arg Leu 6405 6410 6415;Trp Leu Val Thr Arg Gly Ala Gin Ala lie Gly Ala Gly Asp Val Ser 6420 6425 6430;Val Ala Gin Ala Pro Leu Leu Gly Leu Gly Arg Val lie Ala Leu Glu 6435 6440 6445;His Ala Glu Leu Arg Cys Ala Arg lie Asp Leu Asp Pro Ala Arg Arg 6450 6455 6460;Asp Gly Glu Val Asp Glu Leu Leu Ala Glu Leu Leu Ala Asp Asp Ala 6465 6470 6475 6480;Glu Glu Glu Val Ala Phe Arg Gly Gly Glu Arg Arg Val Ala Arg Leu 6485 6490 6495;Val Arg Arg Leu Pro Glu Thr Asp Cys Arg Glu Lys lie Glu Pro Ala 6500 6505 6510;Glu Gly Arg Pro Phe Arg Leu Glu He Asp Gly Ser Gly Val Leu Asp 6515 6520 6525;Asp Leu Val Leu Arg Ala Thr Glu Arg Arg Pro Pro Gly Pro Gly Glu 6530 6535 6540;Val Glu lie Ala Val Glu Ala Ala Gly Leu Asn Phe Leu Asp Val Met 6545 6550 6555 6560;Arg Ala Met Gly lie Tyr Pro Gly Pro Gly Asp Gly Pro Val Ala Leu 6565 6570 6575;Gly Ala Glu Cys Ser Gly Arg lie Val Ala Met Gly Glu Gly Val Glu 6580 6585 6590;Ser Leu Arg lie Gly Gin Asp Val Val Ala Val Ala Pro Phe Ser Phe 6595 6600 6605;Gly Thr His Val Thr lie Asp Ala Arg Met Leu Ala Pro Arg Pro Ala 6610 6615 6620;Printed from Mimosa 03/20/2002 15:55:45 page -137-;WO 99/66028;PCT/EP99/04171;-52-;Ala Leu Thr Ala Ala Gin Ala Ala Ala Leu Pro Val Ala Phe Met Thr 6625 6630 6635 6640;Ala Trp Tyr Gly Leu Val His Leu Gly Arg Leu Arg Ala Gly Glu Arg 6645 6650 6655;val Leu lie His Ser Ala Thr Gly Gly Thr Gly Leu Ala Ala Val Gin 6660 6665 6670;lie Ala Arg His Leu Gly Ala Glu lie Phe Ala Thr Ala Gly Thr Pro 6675 6680 6685;Glu Lys Arg Ala Trp Leu Arg Glu Gin Gly lie Ala His Val Met Asp 6690 6695 6700;Ser Arg Ser Leu Asp Phe Ala Glu Gin Val Leu Ala Ala Thr Lys Gly 6705 6710 6715 6720;Glu Gly Val Asp Val Val Leu Asn Ser Leu Ser Gly Ala Ala lie Asp 6725 6730 6735;Ala Ser Leu Ser Thr Leu Val Pro Asp Gly Arg Phe lie Glu Leu Gly 6740 6745 6750;Lys Thr Asp lie Tyr Ala Asp Arg Ser Leu Gly Leu Ala His Phe Arg 6755 6760 6765;Lys Ser Leu Ser Tyr Ser Ala Val Asp Leu Ala Gly Leu Ala Val Arg 6770 6775 6780;Arg Pro Glu Arg Val Ala Ala Leu Leu Ala Glu Val Val Asp Leu Leu 6785 6790 6795 6800;Ala Arg Gly Ala Leu Gin Pro Leu Pro Val Glu lie Phe Pro Leu Ser 6805 6810 6815;Arg Ala Ala Asp Ala Phe Arg Lys Met Ala Gin Ala Gin His Leu Gly 6820 6825 6830;Lys Leu Val Leu Ala Leu Glu Asp Pro Asp Val Arg lie Arg Val Pro 6835 6840 6845;Gly Glu Ser Gly Val Ala lie Arg Ala Asp Gly Ala Tyr Leu Val Thr 6850 6855 6860;Gly Gly Leu Gly Gly Leu Gly Leu Ser Val Ala Gly Trp Leu Ala Glu 6865 6870 6875 6880;Gin Gly Ala Gly His Leu Val Leu Val Gly Arg Ser Gly Ala Val Ser 6885 6890 6895;Ala Glu Gin Gin Thr Ala Val Ala Ala Leu Glu Ala His Gly Ala Arg 6900 6905 6910;Val Thr Val Ala Arg Ala Asp Val Ala Asp Arg Ala Gin Met Glu Arg 6915 6920 6925;lie Leu Arg Glu Val Thr Ala Ser Gly Met Pro Leu Arg Gly Val Val 6930 6935 6940;His Ala Ala Gly lie Leu Asp Asp Gly Leu Leu Met Gin Gin Thr Pro 6945 6950 6955 6960;Ala Arg Phe Arg Ala Val Met Ala Pro Lys Val Arg Gly Ala Leu His;Printed from Mimosa 03/20/2002 15:55:45 page -138-;WO 99/66028;PCT/EP99/04171;-53-;6965;6970;6975;Leu His Ala Leu Thr Arg Glu Ala Pro Leu Ser Phe Phe Val Leu Tyr 6980 6985 6990;Ala Ser Gly Ala Gly Leu Leu Gly Ser Pro Gly Gin Gly Asn Tyr Ala 6995 7000 7005;Ala Ala Asn Thr Phe Leu Asp Ala Leu Ala His His Arg Arg Ala Gin 7010 7015 7020;Gly Leu Pro Ala Leu Ser lie Asp Trp Gly Leu Phe Ala Asp Val Gly 7025 7030 7035 7040;Leu Ala Ala Gly Gin Gin Asn Arg Gly Ala Arg Leu Val Thr Arg Gly 7045 7050 7055;Thr Arg Ser Leu Thr Pro Asp Glu Gly Leu Trp Ala Leu Glu Arg Leu 7060 7065 7070;Leu Asp Gly Asp Arg Thr Gin Ala Gly Val Met Pro Phe Asp Val Arg 7075 7080 7085;Gin Trp Val Glu Phe Tyr Pro Ala Ala Ala Ser Ser Arg Arg Leu Ser 7090 7095 7100;Arg Leu Met Thr Ala Arg Arg Val Ala Ser Gly Arg Leu Ala Gly Asp 7105 7110 7115 7120;Arg Asd Leu Leu Glu Arg Leu Ala Thr Ala Glu Ala Gly Ala Arg Ala 7125 7130 7135;Gly Met Leu Gin Glu Val Val Arg Ala Gin Val Ser Gin Val Leu Arg 7140 7145 7150;Leu Ser Glu Gly Lys Leu Asp Val Asp Ala Pro Leu Thr Ser Leu Gly 7155 7160 7165;Met Asd Ser Leu Met Gly Leu Glu Leu Arg Asn Arg He Glu Ala Val 7170 7175 7180;Leu Gly lie Thr Met Pro Ala Thr Leu Leu Trp Thr Tyr Pro Thr Val 7185 7190 7195 7200;Ala Ala Leu Ser Ala His Leu Ala Ser His Val Val Ser Thr Gly Asp 7205 7210 7215;Gly Glu Ser Ala Arg Pro Pro Asp Thr Gly Ser Val Ala Pro Thr Thr 7220 7225 7230;His Glu Val Ala Ser Leu Asp Glu Asp Gly Leu Phe Ala Leu lie Asp 7235 7240 7245;Glu Ser Leu Ala Arg Ala Gly Lys Arg 7250 7255;&lt;210&gt; 6 &lt;211&gt; 3798 &lt;212&gt; PRT;&lt;213&gt; Sorangium cellulosum &lt;400&gt; 6;Val Thr Asp Arg Glu Gly Gin Leu Leu Glu Arg Leu Arg Glu Val Thr 15 10 15;Printed from Mimosa 03/20/2002 15:55:45 page -139-;WO 99/66028;PCT /EP99/04171;-54-;Leu Ala Leu Arg Lys Thr Leu Asn Glu Arg Asp Thr Leu Glu Leu Glu 20 25 30;Lys Thr Glu Pro lie Ala lie Val Gly lie Gly Cys Arg Phe Pro Gly 35 40 45;Gly Ala Gly Thr Pro Glu Ala Phe Trp Glu Leu Leu Asp Asp Gly Arg 50 55 60;Asp Ala lie Arg Pro Leu Glu Glu Arg Trp Ala Leu Val Gly Val Asp 65 70 75 80;Pro Gly Asp Asp Val Pro Arg Trp Ala Gly Leu Leu Thr Glu Ala lie 85 90 95;Asp Gly Phe Asp Ala Ala Phe Phe Gly lie Ala Pro Arg Glu Ala Arg 100 105 110;Ser Leu Asp Pro Gin His Arg Leu Leu Leu Glu Val Ala Trp Glu Gly 115 120 125;Phe Glu Asp Ala Gly lie Pro Pro Arg Ser Leu Val Gly Ser Arg Thr 130 135 140;Gly Val Phe Val Gly Val Cys Ala Thr Glu Tyr Leu His Ala Ala Val 145 150 155 160;Ala His Gin Pro Arg Glu Glu Arg Asd Ala Tyr Ser Thr Thr Gly Asn 165 170 175;Met Leu Ser lie Ala Ala Gly Arg Leu Ser Tyr Thr Leu Gly Leu Gin 180 185 190;Gly Pro Cys Leu Thr Val Asp Thr Ala Cys Ser Ser Ser Leu Val Ala 195 200 205;lie His Leu Ala Cys Arg Ser Leu Arg Ala Arg Glu Ser Asp Leu Ala 210 215 220;Leu Ala Gly Gly Val Asn Met Leu Leu Ser Pro Asp Thr Met Arg Ala 225 230 235 240;Leu Ala Arg Thr Gin Ala Leu Ser Pro Asn Gly Arg Cys Gin Thr Phe 245 250 255;Asp Ala Ser Ala Asn Gly Phe Val Arg Gly Glu Gly Cys Gly Leu lie 260 265 270;Val Leu Lys Arg Leu Ser Asp Ala Arg Arg Asp Gly Asp Arg lie Trp 275 280 285;Ala Leu lie Arg Gly Ser Ala lie Asn Gin Asp Gly Arg Ser Thr Gly 290 295 300;Leu Thr Ala Pro Asn Val Leu Ala Gin Gly Ala Leu Leu Arg Glu Ala 305 310 315 320;Leu Arg Asn Ala Gly Val Glu Ala Glu Ala lie Gly Tyr lie Glu Thr 325 330 335;His Gly Ala Ala Thr Ser Leu Gly Asp Pro lie Glu lie Glu Ala Leu 340 345 350;Arg Ala Val Val Gly Pro Ala Arg Ala Asp Gly Ala Arg Cys Val Leu;Printed from Mimosa 03/20/2002 15:55:45 page -140-;WO 99/66028;PCT/EP99/04171;-55-;355;360;365;Gly Ala Val Lys Thr Asn Leu Gly His Leu Glu Gly Ala Ala Gly Val 370 375 380;Ala Gly Leu lie Lys Ala Thr Leu Ser Leu His His Glu Arg lie Pro 385 390 395 400;Arg Asn Leu Asn Phe Arg Thr Leu Asn Pro Arg lie Arg lie Glu Gly 405 410 415;Thr Ala Leu Ala Leu Ala Thr Glu Pro Val Pro Trp Pro Arg Thr Gly 420 425 430;Arg Thr Arg Phe Ala Gly Val Ser Ser Phe Gly Met Ser Gly Thr Asn 435 440 445;Ala His Val Val Leu Glu Glu Ala Pro Ala Val Glu Pro Glu Ala Ala 450 455 460;Ala Pro Glu Arg Ala Ala Glu Leu Phe Val Leu Ser Ala Lys Ser Ala 465 470 475 480;Ala Ala Leu Asp Ala Gin Ala Ala Arg Leu Arg Asp His Leu Glu Lys 485 490 495;His Val Glu Leu Gly Leu Gly Asp Val Ala Phe Ser Leu Ala Thr Thr 500 505 510;Arg Ser Ala Met Glu His Arg Leu Ala Val Ala Ala Ser Ser Arg Glu 515 520 525;Ala Leu Arg Gly Ala Leu Ser Ala Ala Ala Gin Gly His Thr Pro Pro 530 535 540;Gly Ala Val Arg Gly Arg Ala Ser Gly Gly Ser Ala Pro Lys Val Val 545 550 555 560;Phe Val Phe Pro Gly Gin Gly Ser Gin Trn Val Gly Met Gly Arg Lys 565 570 575;Leu Met Ala Glu Glu Pro Val Phe Arg Ala Ala Leu Glu Gly Cys Asp 580 585 590;Arg Ala lie Glu Ala Glu Ala Gly Trp Ser Leu Leu Gly Glu Leu Ser 595 600 605;Ala Asp Glu Ala Ala Ser Gin Leu Gly Arg lie Asp Val Val Gin Pro 610 615 620;Val Leu Phe Ala Met Glu Val Ala Leu Ser Ala Leu Trp Arg Ser Trp 625 630 635 640;Gly Val Glu Pro Glu Ala Val Val Gly His Ser Met Gly Glu Val Ala 645 650 655;Ala Ala His Val Ala Gly Ala Leu Ser Leu Glu Asp Ala Val Ala lie 660 665 670;lie Cys Arg Arg Ser Arg Leu Leu Arg Arg lie Ser Gly Gin Gly Glu 675 680 685;Met Ala Leu Val Glu Leu Ser Leu Glu Glu Ala Glu Ala Ala Leu Arg 690 695 700;Printed from Mimosa 03/20/2002 15:55:45 page -141-;WO 99/66028;PCT/EP99/04171;-56-;Gly His Glu Gly Arg Leu Ser Val Ala Val Ser Asn Ser Pro Arg Ser 705 710 715 720;Thr Val Leu Ala Gly Glu Pro Ala Ala Leu Ser Glu Val Leu Ala Ala 725 730 735;Leu Thr Ala Lys Gly Val Phe Trp Arg Gin Val Lys Val Asp Val Ala 740 745 750;Ser His Ser Pro Gin Val Asp Pro Leu Arg Glu Glu Leu lie Ala Ala 755 760 765;Leu Gly Ala lie Arg Pro Arg Ala Ala Ala Val Pro Mec Arg Ser Thr 770 775 780;Val Thr Gly Gly Val lie Ala Gly Pro Glu Leu Gly Ala Ser Tyr Trp 785 790 795 800;Ala Asd Asn Leu Arg Gin Pro Val Arg Phe Ala Ala Ala Ala Gin Ala 805 810 815;Leu Leu Glu Gly Gly Pro Ala Leu Phe lie Glu Met Ser Pro His Pro B20 825 830;lie Leu Val Pro Pro Leu Asp Glu lie Gin Thr Ala Ala Glu Gin Gly 835 840 845;Gly Ala Ala Val Gly Ser Leu Arg Arg Gly Gin Asp Glu Arg Ala Thr 850 855 860;Leu Leu Glu Ala Leu Gly Thr Leu Trp Ala Ser Gly Tyr Pro Val Ser 865 870 875 880;Trp Ala Arg Leu Phe Pro Ala Gly Gly Arg Arg Val Pro Leu Pro Thr 885 890 895;Tyr Pro Trp Gin His Glu Arg Cys Trp lie Glu Val Glu Pro Asp Ala 900 905 910;Arg Arc Leu Ala Ala Ala Asp Pro Thr Lys Asd Trp Phe Tyr Arg Thr 915 920 925;Asp Trp Pro Glu Val Pro Arg Ala Ala Pro Lys Ser Glu Thr Ala His 930 935 940;Gly Ser Trp Leu Leu Leu Ala Asp Arg Gly Gly Val Gly Glu Ala Val 945 950 955 960;Ala Ala Ala Leu Ser Thr Arg Gly Leu Ser Cys Thr Val Leu His Ala 965 970 975;Ser Ala Asp Ala Ser Thr Val Ala Glu Gin Val Ser Glu Ala Ala Ser 980 985 990;Arg Arg Asn Asp Trp Gin Gly Val Leu Tyr Leu Trp Gly Leu Asp Ala 995 1000 1005;Val Val Asp Ala Gly Ala Ser Ala Asp Glu Val Ser Glu Ala Thr Arg 1010 1015 1020;Arg Ala Thr Ala Pro Val Leu Gly Leu Val Arg Phe Leu Ser Ala Ala 1025 1030 1035 1040;Pro His Pro Pro Arg Phe Trp Val Val Thr Arg Gly Ala Cys Thr Val 1045 1050 1055;Printed from Mimosa 03/20/2002 15:55:45 page -142-;WO 99/66028;PCT/EP99/04171;-57-;Gly Gly Glu Pro Glu Ala Ser Leu Cys Gin Ala Ala Leu Trp Gly Leu 1060 1065 1070;Ala Arg Val Ala Ala Leu Glu His Pro Ala Ala Trp Gly Gly Leu Val 1075 1080 1085 .;Asp Leu Asp Pro Gin Lys Ser Pro Thr Glu lie Glu Pro Leu Val Ala 1090 1095 1100;Glu Leu Leu Ser Pro Asp Ala Glu Asp Gin Leu Ala Phe Arg Ser Gly 1105 1110 1115 1120;Arg Arg His Ala Ala Arg Leu Val Ala Ala Pro Pro Glu Gly Asp Val 1125 1130 1135;Ala Pro lie Ser Leu Ser Ala Glu Gly Ser Tyr Leu Val Thr Gly Gly 1140 1145 1150;Leu Gly Gly Leu Gly Leu Leu Val Ala Arg Trp Leu Val Glu Arg Gly 1155 1160 1165;Ala Arg His Leu Val Leu Thr Ser Arg His Gly Leu Pro Glu Arg Gin 1170 1175 1180;Ala Ser Gly Gly Glu Gin Pro Pro Glu Ala Arg Ala Arg lie Ala Ala 1185 1190 1195 1200;Val Glu Gly Leu Glu Ala Gin Gly Ala Arg Val Thr Val Ala Ala Val 1205 1210 1215;Asp Val Ala Glu Ala Asp Pro Met Thr Ala Leu Leu Ala Ala lie Glu 1220 1225 1230;Pro Pro Leu Arg Gly Val Val His Ala Ala Gly Val Phe Pro Val Arg 1235 1240 1245;His Leu Ala Glu Thr Asp Glu Ala Leu Leu Glu Ser Val Leu Arg Pro 1250 1255 1260;Lys Val Ala Gly Ser Trp Leu Leu His Arg Leu Leu Arg Asp Arg Pro 1265 1270 1275 1280;Leu Asp Leu Phe Val Leu Phe Ser Ser Gly Ala Ala Val Trp Gly Gly 1285 1290 1295;Lys Gly Gin Gly Ala Tyr Ala Ala Ala Asn Ala Phe Leu Asp Gly Leu 1300 1305 1310;Ala His His Arg Arg Ala His Ser Leu Pro Ala Leu Ser Leu Ala Trp 1315 1320 1325;Gly Leu Trp Ala Glu Gly Gly Met Val Asp Ala Lys Ala His Ala Arg 1330 1335 1340;Leu Ser Asp lie Gly Val Leu Pro Met Ala Thr Gly Pro Ala Leu Ser 1345 1350 1355 1360;Ala Leu Glu Arg Leu Val Asn Thr Ser Ala Val Gin Arg Ser Val Thr 1365 1370 1375;Arg Met Asp Trp Ala Arg Phe Ala Pro Val Tyr Ala Ala Arg Gly Arg 1380 1385 1390;Arg Asn Leu Leu Ser Ala Leu Val Ala Glu Asp Glu Arg Ala Ala Ser;Printed from Mimosa 03/20/2002 15:55:45 page -143-;WO 99/66028;PCT/EP99/04171;-58-;1395 1400 1405;Pro Pro Val Pro Thr Ala Asn Arg lie Trp Arg Gly Leu Ser Val Ala 1410 1415 1420;Glu Ser Arg Ser Ala Leu Tyr Glu Leu Val Arg Gly lie Val Ala Arg 1425 1430 1435 1440;Val Leu Gly Phe Ser Asp Pro Gly Ala Leu Asp Val Gly Arg Gly Phe 1445 1450 1455;Ala Glu Gin Gly Leu Asp Ser Leu Met Ala Leu Glu lie Arg Asn Arg 1460 1465 1470;Leu Gin Arg Glu Leu Gly Glu Arg Leu Ser Ala Thr Leu Ala Phe Asp 1475 1480 14B5;His Pro Thr Val Glu Arg Leu Val Ala His Leu Leu Thr Asp Val Leu 1490 1495 1500;Lys Leu Glu Asp Arg Ser Asd Thr Arg His lie Arg Ser Val Ala Ala 1505 1510 " 1515 1520;Asp Asp Asp lie Ala lie Val Gly Ala Ala Cys Arg Phe Pro Gly Gly 1525 1530 1535;Asp Glu Gly Leu Glu Thr Tyr Trp Arg His Leu Ala Glu Gly Met Val 1540 1545 1550;Val Ser Thr Glu Val Pro Ala Asp Arg Trp Arg Ala Ala Asp Trp Tyr 1555 1560 1565;Asp Pro Asp Pro Glu Val Pro Gly Arg Thr Tyr Val Ala Lys Gly Ala 1570 1575 1580;Phe Leu Arg Asp Val Arg Ser Leu Asp Ala Ala Phe Phe Ala lie Ser 1585 1590 1595 1600;Pro Arg Glu Ala Met Ser Leu Asd Pro Gin Gin Arg Leu Leu Leu Giu 1605 1610 1615;Val Ser Trp Glu Ala lie Glu Arg Ala Gly Gin Asp Pro Met Ala Leu 1620 1625 1630;Arg Glu Ser Ala Thr Gly Val Phe Val Gly Met He Gly Ser Glu His 1635 1640 1645;Ala Glu Arg Val Gin Gly Leu Asp Asp Asp Ala Ala Leu Leu Tyr Gly 1650 1655 1660;Thr Thr Gly Asn Leu Leu Ser Val Ala Ala Gly Arg Leu Ser Phe Phe 1665 1670 1675 1680;Leu Gly Leu His Gly Pro Thr Met Thr Val Asp Thr Ala Cys Ser Ser 1685 1690 1695;Ser Leu Val Ala Leu His Leu Ala Cys Gin Ser Leu Arg Leu Gly Glu 1700 1705 1710;Cys Asp Gin Ala Leu Ala Gly Gly Ser Ser Val Leu Leu Ser Pro Arg 1715 1720 1725;Ser Phe Val Ala Ala Ser Arg Met Arg Leu Leu Ser Pro Asp Gly Arg 1730 1735 1740;Printed from Mimosa 03/20/2002 15:55:45 page -144-;WO 99/66028;PCT/EP99/0417I;59-;Cys Lys Thr Phe Ser Ala Ala Ala Asp Gly Phe Ala Arg Ala Glu Gly 1745 1750 1755 1760;Cys Ala Val Val Val Leu Lys Arg Leu Arg Asp Ala Gin Arg Asp Arg 1765 1770 1775;Asp Pro lie Leu Ala Val Val Arg Ser Thr Ala lie Asn His Asp Gly 1780 1785 1790;Pro Ser Ser Gly Leu Thr Val Pro Ser Gly Pro Ala Gin Gin Ala Leu 1795 1800 1805;Leu Arg Gin Ala Leu Ala Gin Ala Gly Val Ala Pro Ala Glu Val Asp 1810 1815 1820;Phe Val Glu Cys His Gly Thr Gly Thr Ala Leu Gly Asp Pro lie Glu 1825 1830 1835 1840;Val Gin Ala Leu Gly Ala Val Tyr Gly Arg Gly Arg Pro Ala Glu Arg 1845 1850 1855;Pro Leu Trp Leu Gly Ala Val Lys Ala Asn Leu Gly His Leu Glu Ala 1860 1865 1870;Ala Ala Gly Leu Ala Gly Val Leu Lys Val Leu Leu Ala Leu Glu His 1875 1880 1885;Glu Gin lie Pro Ala Gin Pro Glu Leu Asp Glu Leu Asn Pro His lie 1890 1895 1900;Pro Trp Ala Glu Leu Pro Val Ala Val Val Arg Arg Ala Val Pro Trp 1905 1910 1915 1920;Pro Arg Gly Ala Arg Pro Arg Arg Ala Gly Val Ser Ala Phe Gly Leu 1925 1930 1935;Ser Gly Thr Asn Ala His Val Val Leu Glu Glu Ala Pro Ala Val Glu 1940 1945 1950;Pro Val Ala Ala Ala Pro Glu Arg Ala Ala Glu Leu Phe Val Leu Ser 1955 1960 1965;Ala Lys Ser Ala Ala Ala Leu Asp Ala Gin Ala Ala Arg Leu Arg Asp 1970 1975 1980;His Leu Glu Lys His Val Glu Leu Gl'y Leu Gly Asp Val Ala Phe Ser 1985 1990 1995 2000;Leu Ala Thr Thr Arg Ser Ala Met Glu His Arg Leu Ala Val Ala Ala 2005 2010 2015;Ser Ser Arg Glu Ala Leu Arg Gly Ala Leu Ser Ala Ala Ala Gin Gly 2020 2025 2030;His Thr Pro Pro Gly Ala Val Arg Gly Arg Ala Ser Gly Gly Ser Ala 2035 2040 2045;Pro Lys Val Val Phe Val Phe Pro Gly Gin Gly Ser Gin Trp Val Gly 2050 2055 2060;Met Gly Arg Lys Leu Met Ala Glu Glu Pro Val Phe Arg Ala Ala Leu 2065 2070 2075 2080;Glu Gly Cys Asp Arg Ala lie Glu Ala Glu Ala Gly Trp Ser Leu Leu 2085 2090 2095;Printed from Mimosa 03/20/2002 15:55:45 page -145-;WO 99/66028;PCT/EP99/04171;-60-;Gly Glu Leu Ser Ala Asp Glu Ala Ala Ser Gin Leu Gly Arg lie Asp 2100 2105 2110;Val Val Gin Pro Val Leu Phe Ala Met Glu Val Ala Leu Ser Ala Leu 2115 2120 2125;Trp Arg Ser Trp Gly Val Glu Pro Glu Ala Val Val Gly His Ser Met 2130 2135 2140;Gly Glu Val Ala Ala Ala His Val Ala Gly Ala Leu Ser Leu Glu Asp 2145 2150 2155 2160;Ala Val Ala lie lie Cys Arg Arg Ser Arg Leu Leu Arg Arg lie Ser 2165 2170 2175;Gly Gin Gly Glu Met Ala Leu Val Glu Leu Ser Leu Glu Glu Ala Glu 2180 2185 2190;Ala Ala Leu Arg Gly His Glu Gly Arg Leu Ser Val Ala Val Ser Asn 2195 2200 2205;Ser Pro Arg Ser Thr Val Leu Ala Gly Glu Pro Ala Ala Leu Ser Glu 2210 2215 2220;Val Leu Ala Ala Leu Thr Ala Lys Gly Val Phe Trp Arg Gin Val Lys 2225 2230 2235 2240;Val Asp Val Ala Ser His Ser Pro Gin Val Asp Pro Leu Arg Glu Glu 2245 2250 2255;Leu He Ala Ala Leu Gly Ala lie Arg Pro Arg Ala Ala Ala Val Pro 2260 2265 2270;Met Arg Ser Thr Val Thr Gly Gly Val lie Ala Gly Pro Glu Leu Gly 2275 2280 2285;Ala Ser Tyr Trp Ala Asp Asn Leu Arg Gin Pro Val Arg Phe Ala Ala 2290 2295 2300;Ala Ala Gin Ala Leu Leu Glu Gly Gly Pro Ala Leu Phe lie Glu Met 2305 2310 2315 2320;Ser Pro His Pro lie Leu Val Pro Pro Leu Asp Glu lie Gin Thr Ala 2325 2330 2335;Ala Glu Gin Gly Gly Ala Ala Val Gly Ser Leu Arg Arg Gly Gin Asp 2340 2345 2350;Glu Arg Ala Thr Leu Leu Glu Ala Leu Gly Thr Leu Trp Ala Ser Gly 2355 2360 2365;Tyr Pro Val Ser Trp Ala Arg Leu Phe Pro Ala Gly Gly Arg Arg Val . 2370 2375 ■ 2380;Pro Leu Pro Thr Tyr Pro Trp Gin His Glu Arg Tyr Trp lie Glu Asp 2385 2390 2395 2400;Ser Val His Gly Ser Lys Pro Ser Leu Arg Leu Arg Gin Leu Arg Asn 2405 2410 2415;Gly Ala Thr Asp His Pro Leu Leu Gly Ala Pro Leu Leu Val Ser Ala 2420 2425 2430;Arg Pro Gly Ala His Leu Trp Glu Gin Ala Leu Ser Asp Glu Arg Leu;Printed from Mimosa 03/20/2002 15:55:45 page -146-;WO 99/66028;PCT/EP99/04I71;-61 -;2435 2440 2445;Ser Tyr Leu Ser Glu His Arg Val His Gly Glu Ala Val Leu Pro Ser 2450 2455 2460;Ala Ala Tyr Val Glu Met Ala Leu Ala Ala Gly Val Asp Leu Tyr Gly 24E5 2470 2475 2480;Thr Ala Thr Leu Val Leu Glu Gin Leu Ala Leu Glu Arg Ala Leu Ala 2485 2490 2495;Val Pro Ser Glu Gly Gly Arg lie Val Gin Val Ala Leu Ser Glu Glu 2500 2505 2510;Gly Pro Gly Arg Ala Ser Phe Gin Val Ser Ser Arg Glu Glu Ala Gly 2515 2520 2525;Arg Ser Trp Val Arg His Ala Thr Gly His Val Cys Ser Gly Gin Ser 2530 2535 2540;Ser Ala Val Gly Ala Leu Lys Glu Ala Pro Trp Glu lie Gin Arg Arg 2545 2550 2555 2560;Cys Pro Ser Val Leu Ser Ser Glu Ala Leu Tyr Pro Leu Leu Asn Glu 2565 2570 2575;His Ala Leu Asp Tyr Gly Pro Cys Phe Gin Gly Val Glu Gin Val Trp 2580 2585 2590;Leu Gly Thr Gly Glu Val Leu Gly Arg Val Arg Leu Pro Gly Asp Met 2595 2600 2605;Ala Ser Ser Ser Gly Ala Tyr Arg lie His Pro Ala Leu Leu Asp Ala 2610 2615 2620;Cys Phe Gin Val Leu Thr Ala Leu Leu Thr Thr Pro Glu Ser lie Glu 2625 2630 2635 2640;lie Arg Arg Arg Leu Thr Asp Leu His Glu Pro Asp Leu Pro Arg Ser 2645 2650 2655;Arg Ala Pro Val Asn Gin Ala Val Ser Asp Thr Trp Leu Trp Asp Ala 2660 2665 2670;Ala Leu Asp Gly Gly Arg Arg Gin Ser Ala Ser Val Pro Val Asp Leu 2675 2680 2685;Val Leu Gly Ser Phe His Ala Lys Trp Glu Val Met Glu Arg Leu Ala 2690 2695 2700;Gin Ala Tyr lie lie Gly Thr Leu Arg lie Trp Asn Val Phe Cys Ala 2705 2710 2715 2720;Ala Gly Glu Arg His Thr lie Asp Glu Leu Leu Val Arg Leu Gin lie 2725 2730 2735;Ser Val Val Tyr Arg Lys Val lie Lys Arg Trp Met Glu His Leu Val 2740 2745 2750;Ala He Gly lie Leu Val Gly Asp Gly Glu His Phe Val Ser Ser Gin 2755 2760 2765;Pro Leu Pro Glu Pro Asp Leu Ala Ala Val Leu Glu Glu Ala Gly Arg 2770 2775 2780;Printed from Mimosa 03/20/2002 15:55:45 page -147-;WO 99/66028;PCT/EP99/04171;-62-;Val Phe Ala Asp Leu Pro Val Leu Phe Glu Trp Cys Lys Phe Ala Gly 2785 2790 2795 2800;Glu Arg Leu Ala Asp Val Leu Thr Gly Lys Thr Leu Ala Leu Glu lie 2805 2810 2815;Leu Phe Pro Gly Gly Ser Phe Asp Met Ala Glu Arg lie Tyr Arg Asp 2820 2825 2830;Ser Pro lie Ala Arg Tyr Ser Asn Gly lie Val Arg Gly Val Val Glu 2835 2840 2845;Ser Ala Ala Arg Val Val Ala Pro Ser Gly Met Phe Ser lie Leu Glu 2850 2855 2860;lie Gly Ala Gly Thr Gly Ala Thr Thr Ala Ala Val Leu Pro Val Leu 2865 2870 2875 2880;Leu Pro Asp Arg Thr Glu Tyr His Phe Thr Asp Val Ser Pro Leu Phe 2885 2890 2895;Leu Ala Arg Ala Glu Gin Arg Phe Arg Asp Tyr Pro Phe Leu Lys Tyr 2900 2905 2910;Gly lie Leu Asp Val Asp Gin Glu Pro Ala Gly Gin Gly Tyr Ala His 2915 2920 2925;Gin Arg Phe Asp Val lie Val Ala Ala Asn Val lie His Ala Thr Arg 2930 2935 2940;Asp lie Arg Ala Thr Ala Lys Arg Leu Leu Ser Leu Leu Ala Pro Gly 2945 2950 2955 2960;Gly Leu Leu Val Leu Val Glu Gly Thr Gly His Pro lie Trp Phe Asp 2965 2970 2975;lie Thr Thr Gly Leu lie Glu Gly Trp Gin Lys Tyr Glu Asp Asp Leu 2980 2985 2990;Arg He Asp His Pro Leu Leu Pro Ala Arg Thr Trp Cys Asp Val Leu 2995 3000 3005;Arg Arg Val Gly Phe Ala Asp Ala Val Ser Leu Pro Gly Asp Gly Ser 3010 3015 3020;Pro Ala Gly lie Leu Gly Gin His Val lie Leu Ser Arg Ala Pro Gly 3025 3030 3035 3040;lie Ala Gly Ala Ala Cys Asp Ser Ser Gly Glu Ser Ala Thr Glu Ser 3045 3050 3055;Pro Ala Ala Arg Ala Val Arg Gin Glu Trp Ala Asp Gly Ser Ala Asp 3060 3065 3070;Val val His Arg Met Ala Leu Glu Arg Met Tyr Phe His Arg Arg Pro 3075 3080 3085;Gly Arg Gin Val Trp Val His Gly Arg Leu Arg Thr Gly Gly Gly Ala 3090 3095 3100;Phe Thr Lys Ala Leu Ala Gly Asp Leu Leu Leu Phe Glu Asp Thr Gly 3105 3110 3115 3120;Gin Val Val Ala Glu Val Gin Gly Leu Arg Leu Pro Gin Leu Glu Ala 3125 3130 3135;Printed from Mimosa 03/20/2002 15:55:45 page -148-;WO 99/66028;PCT/EP99/04171;63-;Ser Ala Phe Ala Pro Arg Asp Pro Arg Glu Glu Trp Leu Tyr Ala Leu 3140 3145 3150;Glu Trp Gin Arg Lys Asp Pro lie Pro Glu Ala Pro Ala Ala Ala Ser 3155 3160 3165;Ser Ser Ser Ala Gly Ala Trp Leu Val Leu Met Asp Gin Gly Gly Thr 3170 3175 3180;Gly Ala Ala Leu Val Ser Leu Leu Glu Gly Arg Gly Glu Ala Cys Val 3185 3190 .3195 3200;Arg Val lie Ala Gly Thr Ala Tyr Ala Cys Leu Ala Pro Gly Leu Tyr 3205 3210 3215;Gin Val Asp Pro Ala Gin Pro Asp Gly Phe His Thr Leu Leu Arg Asp 3220 3225 3230;Ala Phe Gly Glu Asp Arg lie Cys Arg Ala Val Val Kis Met Trp Ser 3235 3240 3245;Leu Asp Ala Thr Ala Ala Gly Glu Arg Ala Thr Ala Glu Ser Leu Gin 3250 3255 3260;Ala Asp Gin Leu Leu Gly Ser Leu Ser Ala Leu Ser Leu Val Gin Ala 3265 3270 3275 3280;Leu Val Arg Arg Arg Trp Arg Asn Met Pro Arg Leu Trp Leu Leu Thr 3285 3290 3295;Arg Ala Val His Ala Val Gly Ala Glu Asp Ala Ala Ala Ser Val Ala 3300 3305 3310;Gin Ala Pro Val Trp Gly Leu Gly Arg Thr Leu Ala Leu Glu His Pro 3315 3320 3325;Glu Leu Arg Cys Thr Leu Val Asp Val Asn Pro Ala Pro Ser Pro Glu 3330 3335 3340;Asp Ala Ala Ala Leu Ala Val Glu Leu Gly Ala Ser Asp Arg Glu Asp 3345 3350 3355 3360;Gin Val Ala Leu Arg Ser Asp Gly Arg Tyr Val Ala Arg Leu Val Arg 3365 3370 3375;Ser Ser Phe Ser Gly Lys Pro Ala Thr Asp Cys Gly lie Arg Ala Asp 3380 3385 3390;Gly Ser Tyr Val lie Thr Asp Gly Met Gly Arg Val Gly Leu Ser Val 3395 3400 3405;Ala Gin Trp Met Val Met Gin Gly Ala Arg His Val Val Leu Val Asp 3410 3415 3420;Arg Gly Gly Ala Ser Glu Ala Ser Arg Asp Ala Leu Arg Ser Met Ala 3425 3430 3435 3440;Glu Ala Gly Ala Glu Val Gin lie Val Glu Ala Asp Val Ala Arg Arg 3445 3450 3455;Asp Asp Val Ala Arg Leu Leu Ser Lys lie Glu Pro Ser Met Pro Pro 3460 3465 3470;Leu Arg Gly lie Val Tyr Val Asp Gly Thr Phe Gin Gly Asp Ser Ser;Printed from Mimosa 03/20/2002 15:55:45 page -149-;WO 99/66028;PCT/EP99/04171;-64-;3475 3480 3485;Met Leu Glu Leu Asp Ala Arg Arg Phe Lys Glu Trp Met Tyr Pro Lys 3490 3495 3500;Val Leu Gly Ala Trp Asn Leu His Ala Leu Thr Arg Asp Arg Ser Leu 3505 3510 3515 3520;Asp Phe Phe Val Leu Tyr Ser Ser Gly Thr Ser Leu Leu Gly Leu Pro 3525 3530 3535;Gly Gin Gly Ser Arg Ala Ala Gly Asp Ala Phe Leu Asp Ala lie Ala 3540 3545 3550;His His Arg Cys Lys Val Gly Leu Thr Ala Met Ser lie Asn Trp Gly 3555 3560 3565;Leu Leu Ser Glu Ala Ser Ser Pro Ala Thr Pro Asn Asp Gly Gly Ala 3570 3575 3580;Arg Leu Glu Tyr Arg Gly Met Glu Gly Leu Thr Leu Glu Gin Gly Ala 3585 3590 3595 3600;Ala Ala Leu Gly Arg Leu Leu Ala Arg Pro Arg Ala Gin Val Gly Val 3605 3610 3615;Met Arg Leu Asn Leu Arg Gin Trp Leu Glu Phe Tyr Pro Asn Ala Ala 3620 3625 3630;Arg Leu Ala Leu Trp Ala Glu Leu Leu Lys Glu Arg Asp Arg Ala Asp 3635 3640 3645;Arg Gly Ala Ser Asn Ala Ser Asn Leu Arg Glu Ala Leu Gin Ser Ala 3650 3655 3660;Arg Pro Glu Asp Arg Gin Leu lie Leu Glu Lys His Leu Ser Glu Leu 3665 3670 3675 3680;Leu Gly Arg Gly Leu Arg Leu Pro Pro Glu Arg lie Glu Arg His Val 3685 3690 3695;Pro Phe Ser Asn Leu Gly Met Asp Ser Leu lie Gly Leu Glu Leu Arg 3700 3705 3710;Asn Arg He Glu Ala Ala Leu Gly lie Thr Val Pro Ala Thr Leu Leu 3715 3720 3725;Trp Thr Tyr Pro Asn Val Ala Ala Leu Ser Gly Ser Leu Leu Asp lie 3730 3735 3740;Leu Phe Pro Asn Ala Gly Ala Thr His Ala Pro Ala Thr Glu Arg Glu 3745 3750 3755 3760;Lys Ser Phe Glu Asn Asp Ala Ala Asp Leu Glu Ala Leu Arg Gly Met 3765 3770 3775;Thr Asp Glu Gin Lys Asp Ala Leu Leu Ala Glu Lys Leu Ala Gin Leu 3780 3785 3790;Ala Gin lie Val Gly Glu 3795;&lt;210&gt; 7 &lt;211&gt; 2439;Printed from Mimosa 03/20/2002 15:55:45 page -150-;WO 99/66028;PCT/EP99/04I71;-65-;&lt;212&gt; PRT;&lt;213&gt; Sorangium cellulosum &lt;400&gt; 7;Met Ala Thr Thr Asn Ala Gly Lys Leu Glu His Ala Leu Leu Leu Met 15 10 15;Asp Lys Leu Ala Lys Lys Asn Ala Ser Leu Glu Gin Glu Arg Thr Glu 20 25 30;Pro lie Ala lie Val Gly lie Gly Cys Arg Phe Pro Gly Gly Ala Asp 35 40 45;Thr Pro Glu Ala Phe Trp Glu Leu Leu Asp Ser Gly Arg Asp Ala Val 50 55 60;Gin Pro Leu Asp Arg Arg Trp Ala Leu Val Gly Val His Pro Ser Glu 65 70 75 80;Glu Val Pro Arg Trp Ala Gly Leu Leu Thr Glu Ala Val Asp Gly Phe 85 90 95;Asp Ala Ala Phe Phe Gly Thr Ser Pro Arg Glu Ala Arg Ser Leu Asp 100 105 110;Pro Gin Gin Arg Leu Leu Leu Glu Val Thr Trp Glu Gly Leu Glu Asp 115 120 125;Ala Gly lie Ala Pro Gin Ser Leu Asp Gly Ser Arg Thr Gly Val Phe 130 135 140;Leu Gly Ala Cys Ser Ser Asp Tyr Ser His Thr Val Ala Gin Gin Arg 145 150 155 160;Arg Glu Glu Gin Asp Ala Tyr Asp lie Thr Gly Asn Thr Leu Ser Val 165. 170 175;Ala Ala Gly Arg Leu Ser Tyr Thr Leu Gly Leu Gin Gly Pro Cys Leu 180 185 190;Thr Val Asd Thr Ala Cys Ser Ser Ser Leu Val Ala Xle His Leu Ala 195 200 205;Cys Arg Ser Leu Arg Ala Arg Glu Ser Asp Leu Ala Leu Ala Gly Gly 21C 215 220;Val Asn Met Leu Leu Ser Ser Lys Thr Met lie Met Leu Gly Arg lie 225 230 235 240;Glr. Ala Leu Ser Pro Asp Gly His Cys Arg Thr Phe Asp Ala Ser Ala 245 250 255;Asn Gly Phe Val Arg Gly Glu Gly Cys Gly Met Val Val Leu Lys Arg 260 265 270;Leu Ser Asp Ala Gin Arg His Gly Asp Arg lie Trp Ala Leu lie Arg 275 280 285;Gly Ser Ala Met Asn Gin Asp Gly Arg Ser Thr Gly Leu Met Ala Pro 290 295 300;Asn Val Leu Ala Gin Glu Ala Leu Leu Arg Glu Ala Leu Gin Ser Ala 305 310 315 320;Arg Val Asp Ala Gly Ala lie Gly Tyr Val Glu Thr His Gly Thr Gly;Printed from Mimosa 03/20/2002 15:55:45 page -151-;WO 99/66028;PCT/EP99/04171;-66-;325 330 335;Thr Ser Leu Gly Asp Pro lie Glu Val Glu Ala Leu Arg Ala Val Leu 340 345 350;Gly Pro Ala Arg Ala Asp Gly Ser Arg Cys Val Leu Gly Ala Val Lys 355 360 365;Thr Asn Leu Gly His Leu Glu Gly Ala Ala Gly Val Ala Gly Leu lie 370 375 380;Lys Ala Ala Leu Ala Leu His His Glu Leu lie Pro Arg Asn Leu His 385 350 395 400;Phe His Thr Leu Asn Pro Arg lie Arg lie Glu Gly Thr Ala Leu Ala 405 410 415;Leu Ala Thr Glu Pro Val Pro Trp Pro Arg Ala Gly Arg Pro Arg Phe 420 425 430;Ala Gly Val Ser Ala Phe Gly Leu Ser Gly Thr Asn Val His Val Val 435 440 445;Leu Glu Glu Ala Pro Ala Thr Val Leu Ala Pro Ala Thr Pro Gly Arg 450 455 460;Ser Ala Glu Leu Leu Val Leu Ser Ala Lys Ser Ala Ala Ala Leu Asp 465 470 475 480;Ala Gin Ala Ala Arg Leu Ser Ala His lie Ala Ala Tyr Pro Glu Gin 485 490 495;Gly Leu Gly Asp Val Ala Phe Ser Leu Val Ser Thr Arg Ser Pro Mec 500 505 510;Glu His Arg Leu Ala Val Ala Ala Thr Ser Arg Glu Ala Leu Arg Ser 515 520 525;Ala Leu Glu Val Ala Ala Gin Gly Gin Thr Pro Ala Gly Ala Ala Arg 530 535 540;Gly Arg Ala Ala Ser Ser Pro Gly Lys Leu Ala Phe Leu Phe Ala Giy 545 550 555 560;Gin Gly Ala Gin Val Pro Gly Mec Gly Arg Gly Leu Trp Glu Ala Trp 565 570 575;Pro Ala Phe Arg Glu Thr Phe Asp Arg Cys Val Thr Leu Phe Asp Arg 580 585 590;Glu Leu His Gin Pro Leu Cys Glu Val Met Trp Ala Glu Pro Gly Ser 595 600 605;Ser Arg Ser Ser Leu Leu Asp Gin Thr Ala Phe Thr Gin Pro Ala Leu 610 615 620;Phe Ala Leu Glu Tyr Ala Leu Ala Ala Leu Phe Arg Ser Trp Gly Val 625 630 635 640;Glu Pro Glu Leu Val Ala Gly His Ser Leu Gly Glu Leu Val Ala Ala 645 650 655;Cys Val Ala Gly Val Phe Ser Leu Glu Asp Ala Val Arg Leu Val Val 660 665 670;Printed from Mimosa 03/20/2002 15:55:45 page -152-;WO 99/66028;PCT/EP99/04171;-67-;Ala Arg Gly Arg Leu Met Gin Ala Leu Pro Ala Gly Gly Ala Met Val 675 680 685;Ser lie Ala Ala Pro Glu Ala Asp Val Ala Ala Ala Val Ala Pro His 690 695 700;Ala Ala Leu Val Ser lie Ala Ala Val Asn Gly Pro Glu Gin Val Val 705 710 715 720;lie Ala Gly Ala Glu Lys Phe Val Gin Gin lie Ala Ala Ala Phe Ala 725 730 735;Ala Arg Gly Ala Arg Thr Lys Pro Leu His Val Ser His Ala Phe His 740 745 750;Ser Pro Leu Met Asp Pro Met Leu Glu Ala Phe Arg Arg Val Thr Glu 755 760 765;Ser Val Thr Tyr Arg Arg Pro Ser lie Ala Leu Val Ser Asn Leu Ser 770 775 780;Gly Lys Pro Cys Thr Asp Glu Val Ser Ala Pro Gly Tyr Trp Val Arg 785 790 795 800;His Ala Arg Glu Ala Val Arg Phe Ala Asp Gly Val Lys Ala Leu His 805 810 815;Ala Ala Gly Ala Gly Leu Phe Val Glu Val Gly Pro Lys Pro Thr Leu 820 825 830;Leu Gly Leu Val Pro Ala Cys Leu Pro Asp Ala Arg Pro Val Leu Leu 835 840 845;Pro Ala Ser Arg Ala Gly Arg Asp Glu Ala Ala Ser Ala Leu Glu Ala 850 855 860;Leu Gly Gly Phe Trp Val Val Gly Gly Ser Val Thr Trp Ser Gly Val 865 870 875 880;Phe Pro Ser Gly Gly Arg Arg Val Pro Leu Pro Thr Tyr Pro Trp Gin 885 890 895;Arg Glu Arg Tyr Trp lie Glu Ala Pro Val Asp Arg Glu Ala Asp Gly 900 905 910;Thr Gly Arg Ala Arg Ala Gly Gly His Pro Leu Leu Gly Glu Val Phe 915 920 925;Ser Val Ser Thr His Ala Gly Leu Arg Leu Trp Glu Thr Thr Leu Asp 930 935 940;Arg Lys Arg Leu Pro Trp Leu Gly Glu His Arg Ala Gin Gly Glu Val 945 950 955 960;Val Phe Pro Gly Ala Gly Tyr Leu Glu Met Ala Leu Ser Ser Gly Ala 965 970 975;Glu lie Leu Gly Asp Gly Pro lie Gin Val Thr Asp Val Val Leu lie 980 985 990;Glu Thr Leu Thr Phe Ala Gly Asp Thr Ala Val Pro Val Gin Val Val 995 1000 1005;Thr Thr Glu Glu Arg Pro Gly Arg Leu Arg Phe Gin Val Ala Ser Arg 1010 1015 1020;Printed from Mimosa 03/20/2002 15:55:45 page -153-;WO 99/66028;PCT/EP99/04171;-68-;Glu Pro Gly Glu Arg Arg Ala Pro Phe Arg lie His Ala Arg Gly Val 1025 1030 1035 1040;Leu Arg Arg lie Gly Arg Val Glu Thr Pro Ala Arg Ser Asn Leu Ala 1045 1050 1055;Ala Leu Arg Ala Arg Leu His Ala Ala Val Pro Ala Ala Ala lie Tyr 1060 1065 1070;Gly Ala Leu Ala Glu Met Gly Leu Gin Tyr Gly Pro Ala Leu Arg Gly 1075 1080 1085;Leu Ala Glu Leu Trp Arg Gly Glu Gly Glu Ala Leu Gly Arg Val Arg 1090 1095 1100;Leu Pro Glu Ala Ala Gly Ser Ala Thr Ala Tyr Gin Leu His Pro Val 1105 1110 1115 1120;Leu Leu Asp Ala Cys Val Gin Met lie Val Gly Ala Phe Ala Asp Arg 1125 1130 1135;Asp Glu Ala Thr Pro Trp Ala Pro Val Glu Val Gly Ser Val Arg Leu 1140 1145 1150;Phe Gin Arg Ser Pro Gly Glu Leu Trp Cys His Ala Arg Val Val Ser 1155 1160 1165;Asp Gly Gin Gin Ala Ser Ser Arg Trp Ser Ala Asp Phe Glu Leu Met 1170 1175 1180;Asp Gly Thr Gly Ala Val Val Ala Glu lie Ser Arg Leu Val Val Glu 1135 1190 1195 1200;Arg Leu Ala Ser Gly Val Arg Arg Arg Asp Ala Asp Asp Trp Phe Leu 1205 1210 1215;Glu Leu Asp Trp Glu Pro Ala Ala Leu Gly Gly Pro Lys lie Thr Ala 1220 1225 1230;Gly Arg Trp Leu Leu Leu Gly Glu Gly Gly Gly Leu Gly Arg Ser Leu 1235 1240 1245;Cvs Ser Ala Leu Lys Ala Ala Gly His Val Val Val His Ala Ala Gly 1250 1255 1260;Asp Asp Thr Ser Thr Ala Gly Met Arg Ala Leu Leu Ala Asn Ala Phe 12S5 1270 1275 1280;Asp Gly Gin Ala Pro Thr Ala Val Val His Leu Ser Ser Leu Asp Gly 1285 1290 1295;Gly Gly Gin Leu Gly Pro Gly Leu Gly Ala Gin Gly Ala Leu Asp Ala 1300 1305 1310;Pro Arg Ser Pro Asp Val Asp Ala Asp Ala Leu Glu Ser Ala Leu Met 1315 1320 1325;Arg Gly Cys Asp Ser Val Leu Ser Leu Val Gin Ala Leu Val Gly Met 1330 1335 1340;Asp Leu Arg Asn Ala Pro Arg Leu Trs Leu Leu Thr Arg Gly Ala Gin 1345 1350 " 1355 1360;Ala Ala Ala Ala Gly Asp Val Ser Val Val Gin Ala Pro Leu Leu Gly;Printed from Mimosa 03/20/2002 15:55:45 page -154-;WO 99/66028;PCT/EP99/04171;-69-;1365 1370 1375;Leu Gly Arg Thr lie Ala Leu Glu His Ala Glu Leu Arg Cys lie Ser 1380 1385 1390;Val Asp Leu Asp Pro Ala Glu Pro Glu Gly Glu Ala Asp Ala Leu Leu 1395 1400 1405;Ala Glu Leu Leu Ala Asp Asp Ala Glu Glu Glu Val Ala Leu Arg Gly 1410 1415 1420;Gly Asp Arg Leu Val Ala Arg Leu Val His Arg Leu Pro Asp Ala Gin 1425 1430 1435 1440;Arg Arg Glu Lys Val Glu Pro Ala Gly Asp Arg Pro Phe Arg Leu Glu 1445 1450 1455;lie Asp Glu Pro Gly Ala Leu Asp Gin Leu Val Leu Arg Ala Thr Gly 1460 1465 1470;Arg Arg Ala Pro Gly Pro Gly Glu Val Glu lie Ser Val Glu Ala Ala 1475 1480 1485;Gly Leu Asp Ser lie Asp lie Gin Leu Ala Leu Gly Val Ala Pro Asn 1490 1495 1500;Asp Leu Pro Gly Glu Glu lie Glu Pro Leu Val Leu Gly Ser Glu Cys 1505 1510 1515 1520;Ala Gly Arg lie Val Ala Val Gly Glu Gly Val Asn Gly Leu Val Val 1525 1530 1535;Gly Gin Pro Val lie Ala Leu Ala Ala Gly Val Phe Ala Thr His Val 1540 1545 1550;Thr Thr Ser Ala Thr Leu Val Leu Pro Arg Pro Leu Gly Leu Ser Ala 1555 1560 1565;Thr Glu Ala Ala Ala Met Pro Leu Ala Tyr Leu Thr Ala Trp Tyr Ala 1570 1575 1580;Leu Asp Lys Val Ala His Leu Glr. Ala Gly Glu Arg Val Leu lie His 1585 1590 1595 1600;Ala Glu Ala Gly Gly Val Gly Leu Cys Ala Val Arg Trp Ala Gin Arg 1605 1610 1615;Val Gly Ala Glu Val Tyr Ala Thr Ala Asp Thr Pro Glu Asn Arg Ala 1620 1625 1630;Tyr Leu Glu Ser Leu Gly Val Arg Tyr Val Ser Asp Ser Arg Ser Gly 1635 1640 1645;Arg Phe Val Thr Asp Val His Ala Trp Thr Asp Gly Glu Gly Val Asp 1650 1655 1660;Val Val Leu Asp Ser Leu Ser Gly Glu Arg lie Asp Lys Ser Leu Met 1665 1670 1675 1680;Val Leu Arg Ala Cys Gly Arg Leu Val Lys Leu Gly Arg Arg Asp Asp 1685 1690 1695;Cys Ala Asp Thr Gin Pro Gly Leu Pro Pro Leu Leu Arg Asn Phe Ser 1700 1705 1710;Printed from Mimosa 03/20/2002 15:55:45 page -155-;WO 99/66028;PCT/EP99/04171;-70-;Phe Ser Gin Val Asp Leu Arg Gly Met Met Leu Asp Gin Pro Ala Arg 1715 1720 1725;lie Arg Ala Leu Leu Asp Glu Leu Phe Gly Leu Val Ala Ala Gly Ala 1730 1735 1740;lie Ser Pro Leu Gly Ser Gly Leu Arg Val Gly Gly Ser Leu Thr Pro 1745 1750 1755 1760;Pro Pro Val Glu Thr Phe Pro lie Ser Arg Ala Ala Glu Ala Phe Arg 1765 1770 1775;Arg Met Ala Gin Gly Gin His Leu Gly Lys Leu Val Leu Thr Leu Asp 1780 1785 1790;Asp Pro Glu Val Arg lie Arg Ala Pro Ala Glu Ser Ser Val Ala Val 1795 1800 1805;Arg Ala Asp Gly Thr Tyr Leu Val Thr Gly Gly Leu Gly Gly Leu Gly 1810 1815 1820;Leu Arg Val Ala Gly Trp Leu Ala Glu Arg Gly Ala Gly Gin Leu Val 1825 1830 1835 1840;Leu Val Gly Arg Ser Gly Ala Ala Ser Ala Glu Gin Arg Ala Ala Val 1845 1850 1855;Ala Ala Leu Glu Ala His Gly Ala Arg Val Thr Val Ala Lys Ala Asp 1860 1865 1870;Val Ala Asp Arg Ser Gin lie Glu Arg Val Leu Arg Glu Val Thr Ala 1875 1880 1885;Ser Gly Met Pro Leu Arg Gly Val Val His Ala Ala Gly Leu Val Asp 1890 1895 1900;Asp Gly Leu Leu Met Gin Gin Thr Pro Ala Arg Phe Arg Thr Val Met 1905 1910 1915 1920;Gly Pro Lys Val Gin Gly Ala Leu His Leu His Thr Leu Thr Arg Glu 1925 1930 1935;Ala Pro Leu Ser Phe Phe Val Leu Tyr Ala Ser Ala Ala Gly Leu Phe 1940 1945 1950;Giy Ser Pro Gly Gin Gly Asn Tyr Ala Ala Ala Asn Ala Phe Leu Asp 1955 1960 1965;Ala Leu Ser His His Arg Arg Ala Gin Gly Leu Pro Ala Leu Ser lie 1970 1975 1980;Asp Trp Gly Met Phe Thr Glu Val Gly Met Ala Val Ala Gin Glu Asn 1985 1990 1995 2000;Arg Gly Ala Arg Gin lie Ser Arg Gly Met Arg Gly lie Thr Pro Asp 2005 2010 2015;Glu Gly Leu Ser Ala Leu Ala Arg Leu Leu Glu Gly Asp Arg Val Gin 2020 2025 2030;Thr Gly Val lie Pro lie Thr Pro Arg Gin Trp Val Glu Phe Tyr Pro 2035 2040 2045;Ala Thr Ala Ala Ser Arg Arg Leu Ser Arg Leu Val Thr Thr Gin Arg 2050 2055 2060;Printed from Mimosa 03/20/2002 15:55:45 page -156-;WO 99/66028;PCT/EP99/04171;-71 -;Ala Val Ala Asp Arg Thr Ala Gly Asp Arg Asp Leu Leu Glu Gin Leu 2065 2070 2075 2080;Ala Ser Ala Glu Pro Ser Ala Arg Ala Gly Leu Leu Gin Asp Val Val 2085 2090 2095;Arg Val Gin Val Ser His Val Leu Arg Leu Pro Glu Asp Lys lie Glu 2100 2105 2110;Val Asp Ala Pro Leu Ser Ser Met Gly Met Asp Ser Leu Met Ser Leu 2115 2120 2125;Glu Leu Arg Asn Arg lie Glu Ala Ala Leu Gly Val Ala Ala Pro Ala 2130 2135 2140;Ala Leu Gly Tip Thr Tyr Pro Thr Val Ala Ala lie Thr Arg Trp Leu 2145 2150 2155 2160;Leu Asp Asp Ala Leu Val Val Arg Leu Gly Gly Gly Ser Asp Thr Asp 2165 2170 2175;Glu Ser Thr Ala Ser Ala Gly Ser Phe Val His Val Leu Arg Phe Arg 2180 2185 2190;Pro Val Val Lys Pro Arg Ala Arg Leu Phe Cys Phe His Gly Ser Gly 2195 2200 2205;Gly Ser Pro Glu Gly Phe Arg Ser Trp Ser Glu Lys Ser Glu Trp Ser 2210 2215 2220;Asp Leu Glu lie Val Ala Met Trp His Asp Arg Ser Leu Ala Ser Glu 2225 2230 2235 2240;Asp Ala Pro Gly Lys Lys Tyr Val Gin Glu Ala Ala Ser Leu lie Gin 2245 2250 2255;His Tyr Ala Asp Ala Pro Phe Ala Leu Val Gly Phe Ser Leu Gly Val 2260 2265 2270;Arg Phe Val Met Gly Thr Ala Val Glu Leu Ala Ser Arg Ser Gly Ala 2275 2280 2285;Pro Ala Pro Leu Ala Val Phe Thr Leu Gly Gly Ser Leu lie Ser Ser 2290 2295 2300;Ser Glu lie Thr Pro Glu Met Glu Thr Asp lie lie Ala Lys Leu Phe 2305 2310 2315 2320;Phe Arg Asn Ala Ala Gly Phe Val Arg Ser Thr Gin Gin Val Gin Ala 2325 2330 2335;Asp Ala Arg Ala Asp Lys Val lie Thr Asp Thr Met Val Ala Pro Ala 2340 2345 2350;Pro Gly Asp Ser Lys Glu Pro Pro Val Lys lie Ala Val Pro lie Val 2355 2360 2365;Ala lie Ala Gly Ser Asp Asp Val lie Val Pro Pro Ser Asp Val Gin 2370 2375 2380;Asp Leu Gin Ser Arg Thr Thr Glu Arg Phe Tyr Met His Leu Leu Pro 2385 2390 2395 2400;Gly Asp His Glu Phe Leu Val Asp Arg Gly Arg Glu lie Met His lie;Printed from Mimosa 03/20/2002 15:55:45 page -157-;WO 99/66028;PCT/EP99/04171;-72-;2405;2410;2415;Val Asp Ser His Leu Asn Pro Leu Leu Ala Ala Arg Thr Thr Ser Ser 2420 2425 2430;Gly Pro Ala Phe Glu Ala Lys;&lt;210&gt; 8 &lt;211&gt; 419 &lt;212&gt; PRT;&lt;213&gt; Sorangium cellulosum &lt;400&gt; 8;Met Thr Gin Glu Gin Ala Asn Gin Ser Glu Thr Lys Pro Ala Phe Asp 15 10 15;Phe Lys Pro Phe Ala Pro Gly Tyr Ala Glu Asp Pro Phe Pro Ala lie 20 25 30;Glu Arg Leu Arg Glu Ala Thr Pro lie Phe Tyr Trp Asp Glu Gly Arg 35 40 45;Ser Trp Val Leu Thr Arg Tyr His Asp Val Ser Ala Val Phe Arg Asp 50 55 60;Glu Arg Phe Ala Val Ser Arg Glu Glu Trp Glu Ser Ser Ala Glu Tyr 65 70 75 80;Ser Ser Ala lie Pro Glu Leu Ser Asp Met Lys Lys Tyr Gly Leu Phe 85 90 95;Gly Leu Pro Pro Glu Asp His Ala Arg Val Arg Lys Leu Val Asn Pro 100 105 110;Ser Phe Thr Ser Arg Ala lie Asp Leu Leu Arg Ala Glu lie Gin Arg 115 120 125;Thr Val Asp Gin Leu Leu Asp Ala Arg Ser Gly Gin Glu Glu Phe Asp 130 135 140;Val Val Arg Asp Tyr Ala Glu Gly lie Pro Met Arg Ala lie Ser Ala 145 150 155 160;Leu Leu Lys Val Pro Ala Glu Cys Asp Glu Lys Phe Arg Arg Phe Gly 165 170 175;Ser Ala Thr Ala Arg Ala Leu Gly Val Gly Leu Val Pro Gin Val Asp 180 185 190;Glu Glu Thr Lys Thr Leu Val Ala Ser Val Thr Glu Gly Leu Ala Leu 195 200 205;Leu His Asp Val Leu Asp Glu Arg Arg Arg Asn Pro Leu Glu Asn Asp 210 215 220;Val Leu Thr Mec Leu Leu Gin Ala Glu Ala Asp Gly Ser Arg Leu Ser 225 230 235 240;Thr Lys Glu Leu Val Ala Leu Val Gly Ala lie lie Ala Ala Gly Thr 245 250 255;Asp Thr Thr lie Tyr Leu lie Ala Phe Ala Val Leu Asn Leu Leu Arg;2435;260;265;270;Printed from Mimosa 03/20/2002 15:55:45 page -158-;WO 99/66028;-73-;PCT/EP99/04171;Ser Pro Glu Ala Leu Glu Leu Val Lys Ala Glu Pro Gly Leu Met Arg 275 280 285;Asn Ala Leu Asp Glu Val Leu Arg Phe Asp Asn lie Leu Arg lie Gly 290 295 300;Thr Val Arg Phe Ala Arg Gin Asp Leu Glu Tyr Cys Gly Ala Ser lie 305 310 315 320;Lys Lys Gly Glu Met Val Phe Leu Leu lie Pro Ser Ala lieu Arg Asp 325 330 335;Gly Thr Val Phe Ser Arg Pro Asp Val Phe Asp Val Arg Arg Asp Thr 340 345 350;Gly Ala Ser Leu Ala Tyr Gly Arg Gly Pro His Val Cys Pro Gly Val 355 360 365;Ser Leu Ala Arg Leu Glu Ala Glu He Ala Val Gly Thr lie Phe Arg 370 375 380;Arg Phe Pro Glu Met Lys Leu Lys Glu Thr Pro Val Phe Gly Tyr His 385 390 395 400;Pro Ala Phe Arg Asn lie Glu Ser Leu Asn Val lie Leu Lys Pro Ser 405 410 415;Lys Ala Gly;&lt;210&gt; 9 &lt;211&gt; 607 &lt;212&gt; PRT;&lt;213&gt; Sorangium cellulosum &lt;400&gt; 9;Ala Ser Leu Asp Ala Leu Phe Ala Arg Ala Thr Ser Ala Arg Val Leu 15 10 15;Asp Asp Gly His Gly Arg Ala Thr Glu Arg His Val Leu Ala Glu Ala 20 25 30;Arg Gly lie Glu Asp Leu Arg Ala Leu Arg Glu His Leu Arg lie Gin 35 40 45;Glu Gly Gly Pro Ser Phe His Cys Met Cys Leu Gly Asp Leu Thr Val 50 55 60;Glu Leu Leu Ala His Asp Gin Pro Leu Ala Ser lie Ser Phe His His 65 70 75 80;Ala Arg Ser Leu Arg His Pro Asp Trp Thr Ser Asp Ala Met Leu Val 85 90 95;Asp Gly Pro Ala Leu Val Arg Trp Leu Ala Ala Arg Gly Ala Pro Gly 100 105 110;Pro Leu Arg Glu Tyr Glu Glu Glu Arg Glu Arg Ala Arg Thr Ala Gin 115 120 125;Glu Ala Arg Arg Leu Trp Leu Ala Ala Ala Pro Pro Cys Phe Ala Pro 130 135 140;Printed from Mimosa 03/20/2002 15:55:45 page -159-;WO 99/66028;PCT/EP99/04171;-74-;Asp Leu Pro Arg Phe Glu Asp Asp Ala Asn Gly Leu Pro Leu Gly Pro 145 150 155 160;Met Ser Pro Glu Val Ala Glu Ala Glu Arg Arg Leu Arg Ala Ser Tyr 165 170 175;Ala Thr Pro Glu Leu Ala Cys Ala Ala Leu Leu Ala Trp Leu Gly Thr 180 185 190;Gly Ala Gly Pro Trp Ser Gly Tyr Pro Ala Tyr Glu Met Leu Pro Glu 195 200 205;Asn Leu Leu Leu Gly Phe Gly Leu Pro Thr Ala lie Ala Ala Ala Ser 210 215 220;Ala Pro Gly Thr Ser Glu Ala Ala Leu Arg Gly Ala Ala Arg Leu Phe 225 230 235 240;Ala Ser Trp Glu Val Val Ser Ser Lys Lys Ser Gin Leu Gly Asn lie 245 250 255;Pro Glu Ala Leu Trp Glu Arg Leu Arg Thr lie Val Arg Ala Met Gly 260 265 270;Asn Ala Asp Asn Leu Ser Arg Phe Glu Arg Ala Glu Ala lie Ala Ala;280;285;Glu Val Arg Arg Leu Arg Ala Gin Pro Ala Pro Phe Ala Ala Gly Ala 290 295 300;Gly Leu Ala Val Ala Gly Val Ser Ser Ser Gly Arg Leu Ser Gly Leu 305 310 315 320;Val Thr Asp Gly Asp Ala Leu Tyr Ser Gly Asp Gly Asn Asp lie Val 325 330 335;Met Phe Gin Pro Gly Arg lie Ser Pro Val Val Leu Leu Ala Gly Thr 340 345 350;Asd Pro Phe Phe Glu Leu Ala Pro Pro Leu Ser Gin Met Leu Phe Val 355 360 365;Ala His Ala Asn Ala Gly Thr lie Ser Lys Val Leu Thr Glu Gly Ser 370 375 380;Pro Leu lie Val Met Ala Arg Asn Gin Ala Arg Pro Mec Ser Leu Val 3=5 390 395 400;His Ala Arg Gly Phe Met Ala Trp Val Asn Gin Ala Met Val Pro Asp 405 410 ■ 415;Pro Glu Arg Gly Ala Pro Phe Val Val Gin Arg Ser Thr lie Mec Glu 420 425 430;Phe Glu His Pro Thr Pro Arg Cys Leu His Glu Pro Ala Gly Ser Ala 435 440 445;Phe Ser Leu Ala Cys Asp Glu Glu His Leu Tyr Trp Cys Glu Leu Ser 450 455 460;Ala Gly Arg Leu Glu Leu Tro Arg His Pro His His Arg Pro Gly Ala 465 470 475 480;Pro Ser Arg Phe Ala Tyr Leu Gly Glu His Pro lie Ala Ala Thr Trp 485 490 495;Printed from Mimosa 03/20/2002 15:55:45 page -160-;WO 99/66028;PCT/EP99/04171;-75-;Tyr Pro Ser Leu Thr Leu Asn Ala Thr His Val Leu Trp Ala Asd Pro 500 505 510;Asp Arg Arg Ala lie Leu Gly Val Asp Lys Arg Thr Gly Val Glu Pro 515 520 525;lie Val Leu Ala Glu Thr Arg His Pro Pro Ala His Val Val Ser Glu 530 535 540;Asp Arg Asp lie Phe Ala Leu Thr Gly Gin Pro Asp Ser Arg Asp Trp;545 550 555 560;His Val Glu His lie Arg Ser Gly Ala Ser Thr Val Val Ala Asp Tyr 565 570 575;Gin Arg Gin Leu Trp Asp Arg Pro Asp Met Val Leu Asn Arg Arg Gly 5B0 585 590;Leu Phe Phe Thr Thr Asn Asp Arg lie Leu Thr Leu Ala Arg Ser;&lt;210&gt; 10 &lt;211&gt; 423 &lt;212&gt; PR?;&lt;213&gt; Sorangium cellulosum &lt;400&gt; 10;Met Gly Ala Leu lie Ser Val Ala Ala Pro Gly Cys Ala Leu Gly Gly 15 10 15;Ala Glu Glu Glu Gly Gin Pro Gly Gin Asp Ala Gly Ala Gly Ala Leu 20 25 30;Ala Pro Ala Arg Glu Val Met Ala Ala Glu Val Ala Ala Gly Gin Met 35 40 45;Pro Gly Ala Val Trp Leu Val Ala Ara Gly Asp Asp Val His Val Asp 50 55 60;Ala Val Gly Val Thr Glu Leu Gly Gly Ser Ala Pro Met Arg Arg Asp 65 70 75 80;Thr lie Phe Arg lie Ala Ser Met Thr Lys Ala Val Thr Ala Thr Ala 85 90 95;Val Met Met Leu Val Glu Glu Gly Lys Leu Asp Leu Asp Ser Pro Val 100 105 110;Asp Arg Trp Leu Pro Glu Leu Ala Asn Arg Lys Val Leu Ala Arg lie 115 120 125;Asp Gly Pro lie Asp Glu Thr Val Pro Ala Glu Arg Pro lie Thr Val 130 135 140;Arg Asp Leu Met Thr Phe Thr Met Gly Phe Gly lie Ser Phe Asp Ala 145 150 155 160;Ser Ser Pro lie Gin Arg Ala lie Asp Glu Leu Gly Leu Val Asn Ala 165 170 175;Gin Pro Val Pro Met Thr Pro His Gly Pro Asp Glu Trp lie Arg Arg;595;600;605;180;185;190;Printed from Mimosa 03/20/2002 15:55:45 page -161-;WO 99/66028;PCT/EP99/04171;-76-;Leu Gly Thr Leu Pro Leu Met His Gin Pro Gly Ala Gin Trp Met Tyr 195 200 205;Asn Thr Gly Ser Leu Val Gin Gly Val Leu Val Gly Arg Ala Ala Asp 210 215 220;Gin Gly Phe Asp Ala Phe Val Arg Glu Arg lie Leu Ala Pro Leu Gly 225 230 235 240;Met Arg Asp Thr Asp Phe His Val Pro Ala Asp Lys Leu Ala Arg Phe 245 250 255;Ala Gly Cys Gly Tyr Phe Thr Asp Glu Gin Thr Gly Glu Lys Thr Arg 260 265 270;Met Asp Arg Asp Gly Ala Glu Ser Ala Tyr Ala Ser Pro Pro Ala Phe 275 280 285;Pro Ser Gly Ala Ala Gly Leu Val Ser Thr Val Asp Asp Tyr Leu Leu 290 295 300;Phe Ala Arg Met Leu Met Asn Gly Gly Val His Glu Gly Arg Arg Leu 305 310 315 320;Leu Ser Ala Ala Ser Val Arg Glu Met Thr Ala Asp Kis Leu Thr Pro 325 330 335;Ala Glr. lys Ala Ala Ser Ser Phe Phe Pro Gly Phe Phe Glu Thr His 340 345 350;Gly Trp Gly Tyr Gly Met Ala Val Val Thr Ala Pro Asp Ala Val Ser 355 360 365;Glu Val Pro Gly Arg Tyr Gly Trp Asp Gly Gly Phe Gly Thr Ser Trp 370 375 380;lie Asn Asp Pro Gly Arg Glu Leu lie Gly lie Val Met Thr Gin Ser 385 390 395 400;Ala Gly Phe Leu Phe Ser Gly Ala Leu Glu Arg Phe Trp Arg Ser Val 405 410 415;Tyr Val Ala Thr Glu Ser Ala 420;&lt;210&gt; 11 &lt;211&gt; 713 &lt;212&gt; P?.T;&lt;213&gt; Sorangium cellulosum &lt;400&gt; 11;Met His Gly Leu Thr Glu Arg Gin Val Leu Leu Ser Leu Val Thr Leu 15 10 15;Ala Leu lie Leu Val Thr Ala Arg Ala Ser Gly Glu Leu Ala Arg Arg 20 25 30;Leu Arg Gin Pro Glu Val Leu Gly Glu Leu Phe Gly Gly Val Val Leu 35 40 45;Gly Pro Ser Val Val Gly Ala Leu Ala Pro Gly Phe His Arg Ala Leu 50 55 60;Phe Gin Glu Pro Ala Val Gly Val Val Leu Ser Gly lie Ser Trp lie;Printed from Mimosa 03/20/2002 15:55:45 page -162-;WO 99/66028;PCT/EP99/04171;-77;65;70;75;80;Gly Ala Leu Leu Leu Leu Leu Met Ala Gly lie Glu Val Asp Val Gly 85 90 95;lie Leu Arg Lys Glu Ala Arg Pro Gly Ala Leu Ser Ala Leu Gly Ala 100 105 110;lie Ala Pro Pro Leu Ala Ala Gly Ala Ala Phe Ser Ala Leu Val Leu 115 120 125;Asp Arg Pro Leu Pro Ser Gly Leu Phe Leu Gly lie Val Leu Ser Val 130 135 140;Thr Ala Val Ser Val lie Ala Lys Val Leu lie Glu Arg Glu Ser Met 145 150 155 160;Arg Arg Ser Tyr Ala Gin Val Thr Leu Ala Ala Gly Val Val Ser Glu 165 170 175;Val Ala Ala Trp Val Leu Val Ala Met Thr Ser Ser Ser Tyr Gly Ala 180 185 190;Ser Pro Ala Leu Ala Val Ala Arg Ser Ala Leu Leu Ala Ser Gly Phe 195 200 205;Leu Leu Phe Mec Val Leu Val Gly Arg Arg Leu Thr His Leu Ala Met 210 215 220;Arg Trp Val Ala Asp Ala Thr Arg Val Ser Lys Gly Gin Val Ser Leu 225 230 235 240;Val Leu Val Leu Thr Phe Leu Ala Ala Ala Leu Thr Gin Arg Leu Gly 245 250 255;Leu His Pro Leu Leu Gly Ala Phe Ala Leu Gly Val Leu Leu Asn Ser 260 265 270;Ala Pro Arg Thr Asn Arg Pro Leu Leu Asp Gly Val Gin Thr Leu Val 275 280 285;Ala Gly Leu Phe Ala Pro Val Phe Phe Val Leu Ala Gly Met Arg Val 290 295 300;Asp Val Ser Gin Leu Arg Thr Pro Ala Ala Trp Gly Thr Val Ala Leu 305 310 315 320;Leu Leu Ala Thr Ala Thr Ala Ala Lys Val Val Pro Ala Ala Leu Gly 325 330 335;Ala Arg Leu Gly Gly Leu Arg Gly Ser Glu Ala Ala Leu Val Ala Val 340 345 350;Gly Leu Asn Met Lys Gly Gly Thr Asp Leu lie Val Ala lie Val Gly 355 360 365;Val Glu Leu Gly Leu Leu Ser Asn Glu Ala Tyr Thr Met Tyr Ala Val 370 375 380;Val Ala Leu Val Thr Val Thr Ala Ser Pro Ala Leu Leu lie Trp Leu 385 390 395 400;Glu Lys AJrg Ala Pro Pro Thr Gin Glu Glu Ser Ala Arg Leu Glu Arg;405;410;415;Printed from Mimosa 03/20/2002 15:55:45 page -163-;WO 99/66028 PCT/EP99/0417I;-78-;Glu Glu Ala Ala Arg Arg Ala Tyr lie Pro Gly Val Glu Arg lie Leu 420 425 430;Val Pro lie Val Ala His Ala Leu Pro Gly Phe Ala Thr Asp He Val 435 440 445;Glu Ser lie Val Ala Ser Lys Arg Lys Leu Gly Glu Thr Val Asp lie 450 455 460;Thr Glu Leu Ser Val Glu Gin Gin Ala Pro Gly Pro Ser Arg Ala Ala 465 470 475 480;Gly Glu Ala Ser Arg Gly Leu Ala Arg Leu Gly Ala Arg Leu Arg Val 485 490 495;Gly lie Trp Arg Gin Arg Arg Glu Leu Arg Gly Ser lie Gin Ala lie 500 505 510;Leu Arg Ala Ser Arg Asp His Asp Leu Leu Val lie Gly Ala Arg Ser 515 520 525;Pro Ala Arg Ala Arg Gly Met Ser Phe Gly Arg Leu Gin Asp Ala lie 530 535 540;Val Gin Arg Ala Glu Ser Asn Val Leu Val Val Val Gly Asp Pro Pro 545 550 555 560;Ala Ala Glu Arg Ala Ser Ala Arg Arg lie Leu Val Pro lie lie Gly 565 570 575;Leu Glu Tyr Ser Phe Ala Ala Ala Asp Leu Ala Ala His Val Ala Leu 580 585 590;Ala Trp Asp Ala Glu Leu Val Leu Leu Ser Ser Ala Gin Thr Asp Pro 595 600 605;Gly Ala Val Val Trp Arg Asp Arg Glu Pro Ser Arg Val Arg Ala Val 610 615 620;Ala Arc Ser Val Val Asp Glu Ala Val Phe Arg Gly Arg Arg Leu Gly 625 630 635 640;Val Arg Val Ser Ser Arg Val His Val Gly Ala His Pro Ser Asd Glu 645 650 655;lie Thr Arg Glu Leu Ala Arg Ala Pro Tyr Asp Leu Leu Val Leu Gly 660 665 670;Cys Tyr Asp His Gly Pro Leu Gly Arg Leu Tyr Leu Gly Ser Thr Val 675 680 685;Glu Ser Val Val Val Arg Ser Arg Val Pro Val Ala Leu Leu Val Ala 690 695 70D;His Gly Gly Thr Arg Glu Gin Val Arg 705 710;&lt;210&gt; 12 &lt;211&gt; 126 &lt;212&gt; PRT;&lt;213&gt; Sorangium cellulosum &lt;400&gt; 12;Met Asp Lys Pro lie Gly Arg Thr Arg Cys Ala lie Ala Glu Gly Tyr;Printed from Mimosa 03/20/2002 15:55:45 page -164-;WO 99/66028;PCT/EP99/04171;-79-;15 10 15;lie Pro Gly Gly Ser Asn Gly Pro Glu Pro Gin Met Thr Ser His Glu 20 25 30;Thr Ala Cys Leu Leu Asn Ala Ser Asp Arg Asp Ala Gin Val Ala lie 35 40 45;Thr Val Tyr Phe Ser Asp Arg Asp Pro Ala Gly Pro Tyr Arg Val Thr 50 55 60;Val Pro Ala Arg Arg Thr Arg His Val Arg Phe Asn Asp Leu Thr Glu 65 70 75 80;Pro Glu Pro lie Pro Arg Asp Thr Asp Tyr Ala Ser Val lie Glu Ser 85 90 95;Asp Ala Pro lie Val Val Gin His Thr Arg Leu Asp Ser Arg Gin Ala 100 105 110;Glu Asn Ala Leu Leu Ser Thr lie Ala Tyr Thr Asp Arg Glu 115 120 125;&lt;210&gt; 13 &lt;211&gt; 149 &lt;212&gt; PRT;&lt;213&gt; Sorangium cellulosum &lt;400&gt; 13;Met Lys His Val Asp Thr Gly Arg Arg Phe Gly Arg Arg lie Gly His 15 10 15;Thr Leu Gly Leu Leu Ala Ser Met Ala Leu Ala Gly Cys Gly Gly Pro 20 25 30;Ser Glu Lys Thr Val Gin Gly Thr Arg Leu Ala Pro Gly Ala Asp Ala 35 40 45;Arg Val Thr Ala Asp Val Asp Pro Asp Ala Ala Thr Thr Arg Leu Ala 50 55 60;Val Asp Val Val His Leu Ser Pro Pro Glu Arg Leu Glu Ala Gly Ser 65 70 75 80;Glu Arg Phe Val Val Trp Gin Arg Pro Ser Pro Glu Ser Pro Trp Arg 85 90 95;Arg Val Gly Val Leu Asp Tyr Asn Ala Asp Ser Arg Arg Gly Lys Leu 100 105 110;Ala Glu Thr Thr Val Pro Tyr Ala Asn Phe Glu Leu Leu lie Thr Ala 115 120 125;Glu Lys Gin Ser Ser Pro Gin Ser Pro Ser Ser Ala Ala Val lie Gly 130 135 140;Pro Thr Ser Val Gly 145;&lt;210&gt; 14 &lt;211&gt; 184 &lt;212&gt; PRT;&lt;213&gt; Sorangium cellulosum;Printed from Mimosa 03/20/2002 15:55:45 page -165-;WO 99/66028;PCT/EP99/0417I;-80-;&lt;400&gt; 14;Val Thr Ser Glu Glu Val Pro Gly Ala Ala Leu Gly Ala Gin Ser Ser 15 10 15;Leu Val Arg Ala Gin His Ala Ala Arg His Val Arg Pro Cys Thr Arg 20 25 30;Ala Glu Glu Pro Pro Ala Leu Met His Gly Leu Thr Glu Arg Gin Val 35 40 45;Leu Leu Ser Leu Val Ala Leu Ala Leu Val Leu Leu Thr Ala Arg Ala 50 55 60;Phe Gly Glu Leu Ala Arg Arg Leu Arg Gin Pro Glu Val Leu Gly Glu 65 70 75 80;Leu Phe Gly Gly val Val Leu Gly Pro Ser Val Val Gly Ala Leu Ala 85 90 95;Pro Gly Phe His Arg Val Leu Phe Gin Asp Pro Ala Val Gly Val Val 100 105 110;Leu Ser Gly lie Ser Trp lie Gly Ala Leu Val Leu Leu Leu Met Ala 115 120 125;Gly He Glu Val Asp Val Ser lie Leu Arg Lys Glu Ala Arg Pro Gly 130 135 140;Ala Leu Ser Ala Leu Gly Ala lie Ala Pro Pro Leu Arg Thr Pro Gly 1.45 150 155 160;Pro Leu Val Gin Arg Met Gin Gly Ala Phe Thr Trp Asp Leu Asp Val 165 170 175;Ser Pro Arg Arg Ser Ala Gin Ala 180;&lt;210&gt; Ir &lt;211&gt; 14;;*- 212 &gt; ?r.T<br><br> &lt;213&gt; Sorangium cellulosum &lt;400&gt; 15<br><br> Val Asn Ala Pro Cys Met Arg Cys Thr Ser Gly Pro Gly Val Arg Ser 15 10 15<br><br> Gly Gly Ala lie Ala Pro Ser Ala Glu Ser Ala Pro Gly Arg Ala Ser 20 25 30<br><br> Leu Arg Arg Met Leu Thr Ser Thr Ser lie Pro Ala Met Ser Ser Arg 35 40 45<br><br> Thr Ser Ala Pro lie Gin Glu Met Pro Glu Ser Thr Thr Pro Thr Ala 50 55 60<br><br> Gly Ser Trp Lys Arg Thr Arg Trp Asn Pro Gly Ala Ser Ala Pro Thr 65 70 75 80<br><br> Thr Asp Gly Pro Ser Thr Thr Pro Pro Lys Ser Ser Pro Ser Thr Ser 85 90 95<br><br> Gly Trp Arg Ser Arg Arg Ala Ser Ser Pro Lys Ala Arg Ala Val Arg 100 105 110<br><br> Printed from Mimosa 03/20/2002 15:55:45 page -166-<br><br> WO 99/66028<br><br> PCT/EP99/04171<br><br> -81 -<br><br> Arg Thr Ser Ala Arg Ala Thr Ser Glu Ser Arg Thr Cys Arg Ser Val 115 120 125<br><br> Arg Pro Cys lie Arg Ala Gly Gly Ser Ser Ala Arg Val Gin Gly Arg 130 135 140<br><br> Thr 145<br><br> &lt;210&gt; 16 &lt;211&gt; 185 &lt;212&gt; PRT<br><br> &lt;213&gt; Sorangium cellulosum &lt;400&gt; 16<br><br> Val Leu Ala Pro Pro Ala Asp lie Arg Pro Pro Ala Ala Ala Gin Leu 15 10 15<br><br> Glu Pro Asp Ser Pro Asp Asp Glu Ala Asp Glu Ala Asp Glu Ala Leu 20 25 30<br><br> Arg Pro Phe Arg Asp Ala lie Ala Ala Tyr Ser Glu Ala Val Arg Trp 35 40 45<br><br> Ala Glu Ala Ala Gin Arg Pro Arg Leu Glu Ser Leu Val Arg Leu Ala 50 55 60<br><br> lie Val Arg Leu Gly Lys Ala Leu Asp Lys Val Pro Phe Ala His Thr 65 70 75 80<br><br> Thr Ala Gly Val Ser Gin lie Ala Gly Arg Leu Gin Asn Asp Ala Val 85 90 95<br><br> Trp Phe Asp Val Ala Ala Arg Tyr Ala Ser Phe Arg Ala Ala Thr Glu 100 105 110<br><br> His Ala Leu Arg Asp Ala Ala Ser Ala Met Glu Ala Leu Ala Ala Gly 115 120 125<br><br> Pro Tyr Arg Gly Ser Ser Arg Val Ser Ala Ala Val Gly Glu Phe Arg 130 135 140<br><br> Gly Glu Ala Ala Arg Leu His Pro Ala Asp Arg Val Pro Ala Ser Asp 145 150 155 160<br><br> Gin Gin lie Leu Thr Ala Leu Arg Ala Ala Glu Arg Ala Leu lie Ala 165 170 175<br><br> Leu Tyr Thr Ala Phe Ala Arg Glu Glu ISO 185<br><br> &lt;210&gt; 17 &lt;211&gt; 146 &lt;212&gt; PRT<br><br> &lt;213&gt; Sorangium cellulosum &lt;400&gt; 17<br><br> Met Ala Asp Ala Ala Ser Arg- Ser Ala Cys Ser Val Ala Ala Arg Lys 1 5 10 15<br><br> Leu Ala Tyr Arg Ala Ala Thr Ser Asn Gin Thr Ala Ser Phe Trp Ser 20 25 30<br><br> Printed from Mimosa 03/20/2002 15:55:45 page -167-<br><br> WO 99/66028<br><br> PCT/EP99/04171<br><br> -82-<br><br> Leu Pro Ala lie Trp Glu Thr Pro Ala Val Val Cys Ala Lys Gly Thr 35 40 45<br><br> Leu Ser Ser Ala Leu Pro Ser Arg Thr lie Ala Ser Arg Thr Arg Leu 50 55 60<br><br> Ser Ser Arg Gly Arg Cys Ala Ala Ser Ala His Arg Thr Ala Ser Glu 65 70 75 80<br><br> Tyr Ala Ala lie Ala Ser Arg Asn Gly Arg Ser Ala Ser Ser Ala Ser 85 90 95<br><br> Ser Ala Ser Ser Ser Gly Glu Ser Gly Ser Ser Tip Ala Ala Ala Gly 100 105 110<br><br> Gly Arg Met Ser Ala Gly Gly Ala Ser Thr Gly Glu Val Tyr Glu Gin 115 120 125<br><br> Ala Pro Arg Leu Arg Leu Ala Gin Ser Val Ala Ala Arg Arg Arg Asp 130 135 140<br><br> Pro Thr 145<br><br> &lt;210&gt; 18 &lt;211&gt; 288 &lt;212&gt; PRT<br><br> &lt;213&gt; Sorangium cellulosum &lt;400&gt; 18<br><br> Val Thr Val Ser Ser Met Pro Arg Ser Trp Ser Ser Arg Val Arg Thr 15 10 15<br><br> Val Val Thr Ala Leu Gly Cys Ala Arg Arg Leu Ser Gly Ser lie Ser 20 25 30<br><br> Arg Leu Arg Arg His Pro Glu Ala Gly Arg Ala Pro Arg Ser Arg Leu 35 40 45<br><br> Arg Ala Trp Arg Arg Leu Pro Gin His lie Ser Ser Pro Trp Arg His 50 55 60<br><br> Leu Pro Pro Gly Ala Arg Val Gly Thr Ser Cys Pro Ala Asp Arg Arg 65 70 75 80<br><br> lie Leu Pro Ser His Arg Thr Ala Asp Leu Gly Thr Ser Gly Gly Thr 85 90 95<br><br> Leu Val Ala Arg Met Ser Gly His Val Ala Arg Asn Pro His Ala Ala 100 105 110<br><br> Val Leu Val Gly Asp Gly Ser Ala Arg Gly Arg Arg Arg Leu Ser Asn 115 120 125<br><br> Arg Arg Ala Glu Arg Arg Val Ser Asp Val Thr Cys Arg Glu Gly Gly 130 135 140<br><br> Glu Ala Met Gin Lys lie Ala Gly Lys Leu Val Val Gly Leu lie Ser 145 150 155 160<br><br> Val Ser Gly Met Ser Leu Leu Ala Ala Cys Gly Gly Glu Lys Arg Ser 165 170 175<br><br> Printed from Mimosa 03/20/2002 15:55:45 page -168-<br><br> WO 99/66028 PCT/EP99/04171<br><br> -83-<br><br> Gly Gly Glu Ala Gin Thr Pro Gly Gly Ala Gin Gly Glu Ala Pro Val 180 185 190<br><br> Pro Val Gly Ser Ala Val Asp Ser lie Val Ala Ala Arg Cys Asp Arg 195 200 205<br><br> Glu Ala Arg Cys Asn Asn lie Gly Gin Asp Arg Glu Tyr Ser Ser Lys 210 215 220<br><br> Asp Ala Cys Ser Asn Lys lie Arg Ser Glu Trp Arg Asp Glu Leu Thr 225 230 235 240<br><br> Phe sly Glu Cys Pro Gly Gly He Asp Ala Lys Gin Leu Asn Glu Cys 245 250 255<br><br> Leu Glu Gly lie Arg Asn Glu Gly Cys Gly Asn Pro Phe Asp Thr Leu 260 265 270<br><br> Gly Arg Val Val Ala Cys Arg Ser Ser Asp Leu Cys Arg Asp Ala Arg 275 280 285<br><br> &lt;21C&gt; 19 &lt;211&gt; 288 &lt;212&gt; PRT<br><br> &lt;213&gt; Sorangium cellulosum &lt;400&gt; 19<br><br> Val Thr Val Ser Ser Met Pro Arg Ser Trp Ser Ser Arg Val Arg Thr 1 5 10 15<br><br> Val Val Thr Ala Leu Gly Cys Ala Arg Arg Leu Ser Gly Ser lie Ser 20 25 30<br><br> Arg Leu Arg Arg His Pro Glu Ala Gly Arg Ala Pro Arg Ser Arg Leu 35 40 45<br><br> Arg Ala Trp Arg Arg Leu Pro Gin His He Ser Ser Pro Trp Arg His 50 55 60<br><br> Leu Pro Pro Gly Ala Arg Val Gly Thr Ser Cys Pro Ala Asp Arg Arg 65 70 75 80<br><br> lie Leu Pro Ser His Arg Thr Ala Asp Leu Gly Thr Ser Gly Gly Thr 85 90 95<br><br> Leu Val Ala Arg Met Ser Gly His Val Ala Arg Asn Pro His Ala Ala 100 105 110<br><br> Val Leu Val Gly Asp Gly Ser Ala Arg Gly Arg Arg Arg Leu Ser Asn 115 120 125<br><br> Arg Arg Ala Glu Arg Arg Val Ser Asp Val Thr Cys Arg Glu Gly Gly 130 135 140<br><br> Glu Ala Met Gin Lys lie Ala Gly Lys Leu Val Val Gly Leu lie Ser 145 150 155 160<br><br> Val Ser Gly Met Ser Leu Leu Ala Ala Cys Gly Gly Glu Lys Arg Ser 165 170 175<br><br> Gly Gly Glu Ala Gin Thr Pro Gly Gly Ala Gin Gly Glu Ala Pro Val<br><br> Printed from Mimosa 03/20/2002 15:55:45 page -169-<br><br> WO 99/66028<br><br> PCT/EP99/04171<br><br> -84-<br><br> 180 185 190<br><br> Pro Val Gly Ser Ala Val Asp Ser lie Val Ala Ala Arg Cys Asp Arg 195 200 205<br><br> Glu Ala Arg Cys Asn Asn lie Gly Gin Asp Arg Glu Tyr Ser Ser Lys 210 215 220<br><br> Asp Ala Cys Ser Asn Lys lie Arg Ser Glu Trp Arg Asp Glu Leu Thr 225 230 235 240<br><br> Phe Gly Glu Cys Pro Gly Gly lie Asp Ala Lys Gin Leu Asn Glu Cys 245 250 255<br><br> Leu Glu Gly lie Arg Asn Glu Gly Cys Gly Asn Pro Phe Asp Thr Leu 260 265 270<br><br> Gly Arg Val Val Ala Cys Arg Ser Ser Asp Leu Cys Arg Asp Ala Arg 275 280 285<br><br> &lt;210&gt; 20 ■&lt;211&gt; 155 &lt;212&gt; PRT<br><br> &lt;213&gt; Sorangium cellulosum &lt;400&gt; 20<br><br> .Met Asp Pro Arg Ala Arg Arg Glu Lys Arg Pro Ser Leu Leu Asp Ser 1 5 10 15<br><br> Arg Gly Arg Gin Pro Lys Arg Ser Gin Gin Gly Gly Kis Met Glu Lys 20 25 30<br><br> Pro lie Gly Arg Thr Arg Trp Ala lie Ala Glu Gly Tyr lie Pro Gly 35 40 45<br><br> Arg Ser Asn Gly Pro Glu Pro Gin Met Thr Ser His Glu Thr Ala Cys 50 55 60<br><br> Leu Leu Asn Ala Ser Asp Arg Asp Ala Gin Val Ala lie Thr Val Tyr 65 70 75 80<br><br> Phe Ser Asp Arg Asp Pro Ala Gly Pro Tyr Arg Val Thr Val Pro Ala 85 90 95<br><br> Arg Arg Thr Arg His Val Arg Phe Asn Asp Leu Thr Glu Pro Glu Pro 100 105 110<br><br> lie Pro Arg Asp Thr Asp Tyr Ala Ser Val lie Glu Ser Asp Val Pro 115 120 125<br><br> lie Val Val Gin His Thr Arg Leu Asp Ser Arg Gin Ala Glu Asn Ala 130 135 140<br><br> Leu lie Ser Thr lie Ala Tyr Thr Asp Arg Glu 145 150 155<br><br> &lt;210&gt; 21 &lt;211&gt; 156 &lt;212&gt; PRT<br><br> &lt;213&gt; Sorangium cellulosum<br><br> Printed from Mimosa 03/20/2002 15:55:45 page -170-<br><br> WO 99/66028<br><br> -85-<br><br> PCT/EP99/04171<br><br> &lt;400&gt; 21<br><br> Val Arg Arg Ser Arg Trp Gin Met Lys His Val Asp Thr Gly Arg Arg 15 10 15<br><br> Val Gly Arg Arg lie Gly Leu Thr Leu Gly Leu Leu Ala Ser Met Ala 20 25 30<br><br> Leu Ala Gly Cys Gly Gly Pro Ser Glu Lys lie Val Gin Gly Thr Arg 35 40 45<br><br> Leu Ala Pro Gly Ala Asp Ala His Val Ala Ala Asp Val Asp Pro Asp 50 55 60<br><br> Ala Ala Thr Thr Arg Leu Ala Val Asp Val Val His Leu Ser Pro Pro 65 70 75 80<br><br> Glu Arg lie Glu Ala Gly Ser Glu Arg Phe Val Val Trp Gin Arg Pro 85 90 95<br><br> Ser Ser Glu Ser Pro Trp Gin Arg Val Gly Val Leu Asp Tyr Asn Ala 100 105 110<br><br> Ala Ser Arg Arg Gly Lys Leu Ala Glu Thr Thr Val Pro His Ala Asn 115 120 125<br><br> Phe Glu Leu Leu lie Thr Val Glu Lys Gin Ser Ser Pro Gin Ser Pro 130 135 140<br><br> Ser Ser Ala Ala Val lie Gly Pro Thr Ser Val Gly 145 150 155<br><br> &lt;210&gt; 22 &lt;211&gt; 305 &lt;212&gt; PRT<br><br> &lt;213&gt; Sorangium cellulosum &lt;400&gt; 22<br><br> Met Glu Lys Glu Ser Arg lie Ala lie Tyr Gly Ala lie Ala Ala Asn 15 10 15<br><br> Val Ala lie Ala Ala Val Lys Phe lie Ala Ala Ala Val Thr Gly Ser 20 25 30<br><br> Ser Ala Met Leu Ser Glu Gly Val His Ser Leu Val Asp Thr Ala Asp 35 40 45<br><br> Gly Leu Leu Leu Leu Leu Gly Lys His Arg Ser Ala Arg Pro Pro Asp 50 55 60<br><br> Ala Glu His Pro Phe Gly His Gly Lys Glu Leu Tyr Phe Trp Thr Leu 65 70 75 80<br><br> lie Val Ala lie Met lie Phe Ala Ala Gly Gly Gly Val Ser lie Tyr 85 90 95<br><br> Glu Gly lie Leu His Leu Leu His Pro Arg Gin lie Glu Asp Pro Thr 100 105 110<br><br> Trp Asn Tyr Val Val Leu Gly Ala Ala Ala Val Phe Glu Gly Thr Ser 115 120 125<br><br> Leu lie lie Ser lie His Glu Phe Lys Lys Lys Asp Gly Gin Gly Tyr 130 135 140<br><br> Printed from Mimosa 03/20/2002 15:55:45 page -171-<br><br> WO 99/66028<br><br> PCT/EP99/04171<br><br> -86-<br><br> Leu Ala Ala Met Arg Ser Ser Lys Asp Pro Thr Thr Phe Thr lie Val 145 150 155 160<br><br> Leu Glu Asp Ser Ala Ala Leu Ala Gly Leu Thr lie Ala Phe Leu Gly 165 170 175<br><br> Val Trp Leu Gly His Arg Leu Gly Asn Pro Tyr Leu Asp Gly Ala Ala 180 185 190<br><br> Ser lie Gly lie Gly Leu Val Leu Ala Ala Val Ala Val Phe Leu Ala 195 200 205<br><br> Ser Gin Ser Arg Gly Leu Leu Val Gly Glu Ser Ala Asp Arg Glu Leu 210 215 220<br><br> Leu Ala Ala lie Arg Ala Leu Ala Ser Ala Asp Pro Gly Val Ser Ala 225 230 235 240<br><br> Val Gly Arg Pro Leu Thr Met His Phe Gly Pro His Glu Val Leu Val 245 250 255<br><br> Val Leu Arg lie Glu Phe Asp Ala Ala Leu Thr Ala Ser Gly Val Ala 260 265 270<br><br> Glu Al a He Glu Arg lie Glu Thr Arg lie Arg Ser Glu Arg Pro Asp 275 280 285<br><br> Val Lys His lie Tyr Val Glu Ala Arg Ser Leu His Gin Arg Ala Arg 290 295 300<br><br> &lt;210&gt; 23 &lt;211&gt; 135 &lt;212&gt; PRT<br><br> &lt;213&gt; Sorangium cellulosum &lt;400&gt; 23<br><br> Val Gin Thr Ser Ser Phe Asp Ala Arg Tyr Ala Gly Cys Lys Ser Ser 15 10 15<br><br> Arg Arg lie Ala Arg Ser Gly Ser Ala Gly Ala Arg Ala Gly Arg Ala 20 25 30<br><br> His Glu Gly Ala Ala Ser Ala Gly Phe Glu Gly Gly Asp Val Met Arg 35 40 45<br><br> Lys Ala Arg Ala His Gly Ala Met Leu Gly Gly Arg Asp Asp Gly Trp 50 55 60<br><br> Arg Arg Gly Leu Pro Gly Ala Gly Ala Leu Arg Ala Ala Leu Gin Arg 65 70 75 80<br><br> Gly Arg Ser Arg Asp Leu Ala Arg Arg Arg Leu lie Ala Ser Val Ser 85 90 95<br><br> Leu Ala Gly Gly Ala Ser Met Ala Val Val Ser Leu Phe Gin Leu Gly 100 105 110<br><br> lie lie Glu Arg Leu Pro Asp Pro Pro Leu Pro Gly Phe Asp Ser Ala 115 120 125<br><br> Printed from Mimosa 03/20/2002 15:55:45 page -172-<br><br> WO 99/66028<br><br> -87-<br><br> PCT/EP99/04171<br><br> Lys Val Thr Ser Ser Asp lie 130 135<br><br> &lt;210&gt; 24 &lt;211&gt; 19 &lt;212&gt; DNA<br><br> &lt;213&gt; Artificial Sequence &lt;220&gt;<br><br> &lt;223&gt; Description of Artificial Sequence: universal reverse primer<br><br> &lt;400&gt; 24<br><br> ggaaacagct atgaccatg 19<br><br> &lt;210&gt; 25 &lt;211&gt; 17 &lt;212&gt; DNA<br><br> &lt;213&gt; Artificial Sequence &lt;220&gt;<br><br> &lt;223&gt; Description of Artificial Sequence: universal forward primer<br><br> &lt;400&gt; 25<br><br> gtaaaacgac ggccagt 17<br><br> &lt;21C&gt; 26<br><br> &lt;211&gt; 28<br><br> &lt;212&gt; DNA<br><br> &lt;213&gt; Artificial Sequence &lt;220&gt;<br><br> &lt;223&gt; Description of Artificial Sequence: PCR primer NH24 end "B"<br><br> &lt;400&gt; 26<br><br> gtgactggcg cccggaatct gcatgagc 28<br><br> &lt;210&gt; 27 &lt;211&gt; 28 &lt;212&gt; DNA<br><br> &lt;213&gt; Artificial Sequence &lt;220&gt;<br><br> &lt;223&gt; Description of Artificial Sequence: PCR primer NH2 end "A"<br><br> &lt;400&gt; 27<br><br> agcgggagct tgctagacat tctgtttc 28<br><br> &lt;210&gt; 28 &lt;211&gt; 24 &lt;212&gt; DNA<br><br> &lt;213&gt; Artificial Sequence &lt;220&gt;<br><br> &lt;223&gt; Description of Artificial Sequence: PCR primer NH2 end "B"<br><br> &lt;400&gt; 28<br><br> gacgcgcctc gggcagcgcc ccaa 24<br><br> &lt;210&gt; 29<br><br> Printed from Mimosa 03/20/2002 15:55:45 page -173-<br><br> WO 99/66028<br><br> PCT/EP99/04171<br><br> -88-<br><br> &lt;211&gt; 25 &lt;212&gt; DNA<br><br> &lt;213&gt; Artificial Sequence &lt;220&gt;<br><br> &lt;223&gt; Description of Artificial Sequence: PCR primer PEP015-NH6 end "B"<br><br> &lt;400&gt; 29<br><br> caccgaagcg tcgatctggt ccatc 25<br><br> &lt;210&gt; 30 &lt;211&gt; 25 &lt;212&gt; DNA<br><br> &lt;213&gt; Artificial Sequence &lt;220&gt;<br><br> &lt;223&gt; Description of Artificial Sequence: PCR primer PEP015H2.7 end "A"<br><br> &lt;400&gt; 30<br><br> cggtcagatc gacgacgggc tttcc 25<br><br> Printed from Mimosa 03/20/2002 15:55:45 page -174-<br><br> </p> </div>
NZ508326A 1998-06-18 1998-06-12 A polyketide synthase and non ribosomal peptide synthase genes, isolated from a myxobacterium, necessary for synthesis of epothiones A and B NZ508326A (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US9950498A 1998-06-18 1998-06-18
US10163198P 1998-09-24 1998-09-24
US11890699P 1999-02-05 1999-02-05
PCT/EP1999/004171 WO1999066028A2 (en) 1998-06-18 1999-06-16 Genes for the biosynthesis of epothilones

Publications (1)

Publication Number Publication Date
NZ508326A true NZ508326A (en) 2003-10-31

Family

ID=27378840

Family Applications (1)

Application Number Title Priority Date Filing Date
NZ508326A NZ508326A (en) 1998-06-18 1998-06-12 A polyketide synthase and non ribosomal peptide synthase genes, isolated from a myxobacterium, necessary for synthesis of epothiones A and B

Country Status (16)

Country Link
EP (1) EP1088078A2 (en)
JP (3) JP2002518004A (en)
KR (1) KR100511233B1 (en)
CN (1) CN100374565C (en)
AU (1) AU753567B2 (en)
BR (1) BR9911349A (en)
CA (1) CA2329774A1 (en)
HU (1) HUP0102186A3 (en)
ID (1) ID29128A (en)
IL (3) IL139735A0 (en)
NO (2) NO20006195L (en)
NZ (1) NZ508326A (en)
PL (1) PL200157B1 (en)
SK (1) SK19242000A3 (en)
TR (1) TR200003759T2 (en)
WO (1) WO1999066028A2 (en)

Families Citing this family (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP4579351B2 (en) 1996-12-03 2010-11-10 スローン−ケッタリング インスティトュート フォア キャンサー リサーチ Synthesis of epothilone and its intermediates and analogs and uses thereof
US6204388B1 (en) 1996-12-03 2001-03-20 Sloan-Kettering Institute For Cancer Research Synthesis of epothilones, intermediates thereto and analogues thereof
FR2775187B1 (en) 1998-02-25 2003-02-21 Novartis Ag USE OF EPOTHILONE B FOR THE MANUFACTURE OF AN ANTIPROLIFERATIVE PHARMACEUTICAL PREPARATION AND A COMPOSITION COMPRISING EPOTHILONE B AS AN IN VIVO ANTIPROLIFERATIVE AGENT
DE19846493A1 (en) * 1998-10-09 2000-04-13 Biotechnolog Forschung Gmbh DNA sequence coding for products involved in the biosynthesis of polyketide or heteropolyketide compounds, especially epothilone
US6303342B1 (en) * 1998-11-20 2001-10-16 Kason Biosciences, Inc. Recombinant methods and materials for producing epothilones C and D
US6410301B1 (en) 1998-11-20 2002-06-25 Kosan Biosciences, Inc. Myxococcus host cells for the production of epothilones
US20030113715A1 (en) * 2000-01-21 2003-06-19 Daniel Santi Method for cloning polyketide synthase genes
US6998256B2 (en) 2000-04-28 2006-02-14 Kosan Biosciences, Inc. Methods of obtaining epothilone D using crystallization and /or by the culture of cells in the presence of methyl oleate
AU2001295195B2 (en) * 2000-04-28 2007-02-01 Kosan Biosciences, Inc. Myxococcus host cells for the production of epothilones
JP2005500974A (en) 2000-10-13 2005-01-13 ザ ユニバーシテイ オブ ミシシッピー Synthesis of epothilones and related analogues
US7257562B2 (en) 2000-10-13 2007-08-14 Thallion Pharmaceuticals Inc. High throughput method for discovery of gene clusters
SI1483251T1 (en) 2002-03-12 2010-03-31 Bristol Myers Squibb Co C3-cyano epothilone derivatives
CN101310022B (en) * 2005-01-31 2013-01-16 默沙东公司 Upstream and a downstream purification process for large scale production of plasmid DNA
AU2012211052A1 (en) 2011-01-28 2013-09-05 Amyris, Inc. Gel-encapsulated microcolony screening
US20140057314A1 (en) 2011-05-13 2014-02-27 Amyris, Inc. Methods and compositions for detecting microbial production of water-immiscible compounds
BR112015002724B1 (en) 2012-08-07 2022-02-01 Total Marketing Services Method for producing a heterologous non-catabolic compound, and, fermentation composition
BR112015023089A2 (en) 2013-03-15 2017-11-21 Amyris Inc host cell, method for producing an isoprenoid, and method for increasing production of acetyl-coa or an acetyl-coa-derived compound
US10563229B2 (en) 2013-08-07 2020-02-18 Amyris, Inc. Methods for stabilizing production of acetyl-coenzyme a derived compounds
CN108474009B (en) 2015-06-25 2022-10-04 阿迈瑞斯公司 Maltose-dependent degreddeterminants, maltose-responsive promoters, stabilized constructs and their use in the production of non-catabolic compounds
CN106916834B (en) * 2015-12-24 2022-08-05 武汉合生科技有限公司 Biosynthetic gene cluster of compounds and application thereof
CN111138444B (en) * 2020-01-08 2022-05-03 山东大学 Epothilone B glucoside compounds and enzymatic preparation and application thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2312695T3 (en) * 1996-11-18 2009-03-01 Gesellschaft Fur Biotechnologische Forschung Mbh (Gbf) EPOTILONES E AND F.

Also Published As

Publication number Publication date
CN100374565C (en) 2008-03-12
JP2002518004A (en) 2002-06-25
NO20006195L (en) 2001-02-16
BR9911349A (en) 2001-03-13
IL139735A0 (en) 2002-02-10
SK19242000A3 (en) 2001-07-10
CA2329774A1 (en) 1999-12-23
NO20091055L (en) 2001-02-16
AU4611699A (en) 2000-01-05
CN1305530A (en) 2001-07-25
WO1999066028A3 (en) 2000-06-29
TR200003759T2 (en) 2001-06-21
HUP0102186A2 (en) 2001-10-28
ID29128A (en) 2001-08-02
PL345579A1 (en) 2001-12-17
WO1999066028A2 (en) 1999-12-23
EP1088078A2 (en) 2001-04-04
NO20006195D0 (en) 2000-12-06
JP2008092958A (en) 2008-04-24
JP2006061166A (en) 2006-03-09
IL190391A0 (en) 2008-11-03
IL139735A (en) 2009-06-15
AU753567B2 (en) 2002-10-24
PL200157B1 (en) 2008-12-31
HUP0102186A3 (en) 2005-10-28
KR100511233B1 (en) 2005-08-31
KR20010052962A (en) 2001-06-25

Similar Documents

Publication Publication Date Title
US6383787B1 (en) Genes for the biosynthesis of epothilones
NZ508326A (en) A polyketide synthase and non ribosomal peptide synthase genes, isolated from a myxobacterium, necessary for synthesis of epothiones A and B
DK2271666T3 (en) NRPS-PKS GROUP AND ITS MANIPULATION AND APPLICABILITY
CN101809030A (en) Thiopeptide precursor protein, gene encoding the same, and use thereof
KR20040099138A (en) Cloning genes from Streptomyces cyaneogriseus subsp. noncyanogenus for biosynthesis of antibiotics and methods of use
CN107794286B (en) Cyclic lipopeptide compound biosynthesis gene cluster and activation method and application thereof
CN101691575B (en) Biosynthetic gene cluster of sanglifehrin
KR20050050146A (en) Genes and proteins for the biosynthesis of the glycopeptide antibiotic a40926
CN100374566C (en) Genes for the biosynthesis of epothilones
US7364877B2 (en) Polynucleotides encoding disorazole polyketide synthase polypeptides
RU2265054C2 (en) Recombinant cell-host (variants) and bac clone
CZ20004693A3 (en) Isolated nucleic acid encoding a polypeptide involved in epothilone biosynthesis, a chimeric gene, a vector, and host cells containing the nucleic acid
MXPA00012342A (en) Genes for the biosynthesis of epothilones
RU2234532C2 (en) Nucleic acid (variants), it using for expression of epotilones, polypeptide (variants), escherichia coli microorganism clone
CA2450691C (en) Genes and proteins involved in the biosynthesis of lipopeptides
KR101736540B1 (en) Synthetic precursor of epothilone for improving production of epothilone and method for preparing epothilone using the same
CN101027395A (en) Biosynthetic gene cluster for the production of a complex polyketide
CN101142313A (en) Gene encoding the synthetic pathway for the production of desoprazoles
CA2412627A1 (en) Genes and proteins involved in the biosynthesis of lipopeptides
HK1114125A (en) Genes encoding the synthetic pathway for the production of disorazole

Legal Events

Date Code Title Description
PSEA Patent sealed
RENW Renewal (renewal fees accepted)
RENW Renewal (renewal fees accepted)
RENW Renewal (renewal fees accepted)
RENW Renewal (renewal fees accepted)
EXPY Patent expired