RU2265054C2 - Recombinant cell-host (variants) and bac clone - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention describes recombinant host-cells comprising a chimerical gene involving the heterologous promoter sequence associated functionally with nucleic acid that encodes at least one polypeptide implicated in biosynthesis of epotilons, or polypeptide expressed by recombinant way and implicated in biosynthesis of epotilons, and Bac clones also. Using the invention provides to realize a method for preparing epotilons with high degree of effectiveness.

EFFECT: valuable properties of host-cell.

9 cl, 6 tbl, 15 ex

Description

FIELD OF THE INVENTION

The present invention generally relates to polyketides and genes involved in their synthesis. In particular, the present invention relates to the isolation and characterization of a new polyketide synthase and non-ribosomal acid-amino acid-ligase genes from Sorangium cellulosum, which are necessary for the biosynthesis of epothilones A and B.

BACKGROUND OF THE INVENTION

Polyketides are compounds that are synthesized from elementary units containing two carbon atoms, in which β-carbon always carries a ketogroup, therefore they are called polyketides. These compounds include numerous important antibiotics, immunosuppressants, anti-cancer chemotherapeutic agents, and other compounds with a wide range of biological activities. The extremely large structural diversity is due to the difference in the lengths of the polyketide chains, the difference in the built-in side chains (either at the beginning of the synthesis process as a part of elementary units containing two carbon atoms, or after the formation of the polyketone framework) and the stereochemical structure of such groups. Keto groups can also be reduced to hydroxyls, enoyls or completely removed. Each cycle of adding two carbon atoms is carried out using a complex of enzymes called polyketide synthase (PKS), using a process similar to the biosynthesis of fatty acids.

Genes for biosynthesis, providing an increase in the number of polyketides, were isolated and sequenced. For example, see patents US 5639949, 5693774 and 5716849, all of which are incorporated into this description by reference, in which the genes of sorafen biosynthesis are described. See also the publication by Schupp et al. FEMS Microbiology Letters 159: 201-207 (1998) and WO 98/07868 for rifamycin biosynthesis genes and US Pat. description by reference. Coded proteins are usually divided into two types: type I and type II. Type I proteins are multifunctional with several catalytic domains that carry out various enzymatic steps that are covalently linked to each other (e.g., PKS of erythromycin, sorafen, rifamycin and avermectin (MacNeil et al., In: Industrial Microorganisms: Basic and Applied Molecular Genetics, ( ed. Baltz et al.), American Society for Microbiology, Washington D.C., pp. 245-256 (1993)); while type II proteins are monofunctional (Hutchinson et al., in: Industrial Microorganisms: Basic and Applied Molecular Genetics, (ed. Baltz et al.), American Society for Microbiology, Washington D.C., pp. 203-216 (1993)).

For simple polyketides, such as actinorodine (which is produced by Streptomyces coelicolor), several cycles of addition of two carbon atoms are carried out using PKS enzymes encoded by one set of PKS genes. In contrast, the synthesis of more complex compounds, such as erythromycin and sorafen, includes PKS enzymes that are organized into modules, each module carrying out one cycle of adding two carbon atoms (for a review of the literature see Hopwood et al., In: Industrial Microorganisms : Basic and Applied Molecular Genetics, (ed. Baltz et al.), American Society for Microbiology, Washington D. C., pp. 267-275 (1993)).

Complex polyketides and secondary metabolites can usually contain substructures derived from amino acids rather than simple carboxylic acids. The inclusion of these elementary units is carried out using non-ribosomal acid-amino acid-ligase (NRPSs). NRPSs are polyenzymes organized into modules. Each module is responsible for adding (and, if necessary, additional processing) one elementary amino acid link. NRPSs activate amino acids by forming aminoacyl adenylates and capturing acylated amino acids at the thiol groups of the phosphopantheteinyl prostatic groups of the domains of the peptidyl carrier protein. In addition, NRPSs modify amino acids by epimerization, N-methylation, or optionally cyclization, and catalyze the formation of peptide bonds between enzyme-linked amino acids. NRPSs are responsible for the biosynthesis of peptide secondary metabolites, such as cyclosporine, for the formation of terminating units of the polyketide chain, for example, in rapamycin, or can form mixed systems such as PKS, for example, in the pathway of yersiniabactin biosynthesis.

Epothilones A and B are 16-membered macrocyclic polyketides with an acylcysteine derivative starting unit that are produced by the bacterial strain Sorangium cellulosum So ce90 (Gerth et al., J. Antibiotics 49: 560-563 (1996), the publication is incorporated into this description by as a link). The structure of epothilone A and B, where R is hydrogen (epothilone A) or methyl (epothilone B), is represented by the formula

Epothilones have a narrow spectrum of antifungal activity, and their main feature is high cytotoxicity against animal cell cultures (see, Höfle et al., DE 4138042 (1993), incorporated herein by reference). It is extremely important that epothilones mimic the biological activity of taxol, both in vivo and in cell culture (Bollag et al., Cancer Research 55: 2325-2333 (1995), the publication is incorporated herein by reference). Taxol and Taxotere, which stabilize cell microtubes, are anti-cancer chemotherapeutic agents with high activity against various solid human tumors (Rowinsky et al., J. Natl. Cancer Inst. 83: 1778-1781 (1991)). Competitive studies have established that epothilones act as competitive inhibitors of the binding of taxol to microtubes, which is consistent with the idea that they have the same microtubule binding site and the same affinity for microtubes as taxol. However, epothilones have a significant advantage over taxol, in that epothilones are significantly less effective than taxol in relation to a cell line with multiple drug resistance (Bollag et al. (1995)). In addition, epothilones are exported to a significantly lesser extent than taxol from cells with P-glycoprotein (Gerth et al. (1996)). Moreover, several epothilone analogues have been synthesized that have higher cytotoxicity compared to epothilone A or epothilone B, which is proved by their higher ability to induce polymerization and stabilization of microtubes (WO 98/25929, the document is incorporated into this description by reference) .

Despite the proven promise of epothilones as anticancer agents, their current commercial availability is limited by the problems associated with the preparation of these compounds. The compounds are too complex for industrial chemical synthesis, and therefore they must be obtained by fermentation. Methods of genetic manipulation with myxobacteria, such as Sorangium cellulosum, are described in US Pat. No. 5,686,295, incorporated herein by reference. However, Sorangium cellulosum is known to have poor fermentation ability and, as a result, produces low levels of epothilones. Recombinant production of epothilones in heterologous hosts that have a higher fermentation ability can solve the current problems associated with the production of epothilones. However, genes that encode the polypeptides responsible for epothilone biosynthesis have not yet been identified. In addition, a strain that produces epothilones, i.e. So ce90 also produces at least one additional polyketide, spirangien, which is expected to greatly complicate the isolation of genes directly involved in epothilone biosynthesis.

Thus, in light of the foregoing, one of the objects of the present invention is the isolation of genes that participate in the synthesis of epothilones, especially genes that participate in the synthesis of epothilones A and B in Myxobacteria of the Sorangium / Polyangium group, i.e. in the strain Sorangium cellulosum So ce90. Another object of the invention is a method for the recombinant production of epothilones for the purpose of their use in anticancer compositions.

Summary of the invention

To implement the above and other objects of the invention, when creating the invention, it was unexpectedly possible to overcome the above difficulties and to obtain for the first time a nucleic acid molecule comprising a nucleotide sequence that encodes at least one polypeptide involved in the epothilone biosynthesis. According to a preferred embodiment, the nucleotide sequence is isolated from species belonging to Myxobacteria, most preferably Sorangium cellulosum.

According to another preferred embodiment, the present invention relates to an isolated nucleic acid molecule that comprises a nucleotide sequence encoding at least one polypeptide involved in the epothilone biosynthesis, where the polypeptide contains an amino acid sequence substantially similar to an amino acid sequence selected from the series consisting of: SEQ ID NO: 2, amino acids 11-437 SEQ ID NO: 2, amino acids 543-864 SEQ ID NO: 2, amino acids 974-1273 SEQ ID NO: 2, amino acids 1314-1385 SEQ ID NO: 2, SEQ ID NO: 3 , amino acids 72-81 SEQ ID NO: 3, amino acids 118-125 SEQ ID NO: 3, amino acids 199-212 SEQ ID NO: 3, amino acids 353-363 SEQ ID NO: 3, amino acids 549-565 SEQ ID NO: 3, amino acids 588-603 SEQ ID NO: 3, amino acids 669-684 SEQ ID NO: 3, amino acids 815-821 SEQ ID NO: 3, amino acids 868-892 SEQ ID NO: 3, amino acids 903-912 SEQ ID NO: 3, amino acids 918-940 SEQ ID NO: 3, amino acids 1268-1274 SEQ ID NO: 3, amino acids 1285-1297 SEQ ID NO: 3, amino acids 973-1256 SEQ ID NO: 3, amino acids 1344-1351 SEQ ID NO: 3, SEQ ID NO: 4, amino acids 7-432 SEQ ID NO: 4, amino acids 539-859 SEQ ID NO: 4, amino acids 869-1037 SEQ ID NO: 4, amino acids 1439-1684 SEQ ID NO: 4, amino acids 1722-1792 SEQ ID NO: 4, SEQ ID NO: 5, amino acids 39-457 SEQ ID NO: 5, and amino acids 563-884 SEQ ID NO: 5, amino acids 1147-1399 SEQ ID NO: 5, amino acids 1434-1506 SEQ ID NO: 5, amino acids 1524-1950 SEQ ID NO: 5, amino acids 2056-2377 SEQ ID NO: 5, amino acids 2645-2895 SEQ ID NO: 5, amino acids 2932-3005 SEQ ID NO: 5, amino acids 3024-3449 SEQ ID NO: 5, amino acids 3555-3876 SEQ ID NO: 5, amino acids 3886-4048 SEQ ID NO: 5, amino acids 4433-4719 SEQ ID NO: 5, amino acids 4729-4974 SEQ ID NO: 5, amino acids 5010-5082 SEQ ID NO: 5, amino acids 5103-5525 SEQ ID NO: 5, amino acids 5631-5951 SEQ ID NO: 5, amino acids 5964-6132 SEQ ID NO: 5, amino acids 6542-6837 SEQ ID NO: 5, amino acids 6857-7101 SEQ ID NO: 5, amino acids 7140-7211 SEQ ID NO: 5, SEQ ID NO: 6, amino acids 35-454 SEQ ID NO: 6, amino acids 561-881 S EQ ID NO: 6, amino acids 1143-1393 SEQ ID NO: 6, amino acids 1430-1503 SEQ ID NO: 6, amino acids 1522-1946 SEQ ID NO: 6, amino acids 2053-2373 SEQ ID NO: 6, amino acids 2383-2551 SEQ ID NO: 6, amino acids 2671-3045 SEQ ID NO: 6, amino acids 3392-3636 SEQ ID NO: 6, amino acids 3673-3745 SEQ ID NO: 6, SEQ ID NO: 7, amino acids 32-450 SEQ ID NO: 7, amino acids 556-877 SEQ ID NO: 7, amino acids 887-1051 SEQ ID NO: 7, amino acids 1478-1790 SEQ ID NO: 7, amino acids 1810-2055 SEQ ID NO: 7, amino acids 2093-2164 SEQ ID NO: 7, amino acids 2165-2439 SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 22.

According to a most preferred embodiment, the present invention relates to an isolated nucleic acid molecule that comprises a nucleotide sequence encoding at least one polypeptide involved in the epothilone biosynthesis, where the polypeptide contains an amino acid sequence selected from the series including: SEQ ID NO: 2, amino acids 11-437 SEQ ID NO: 2, amino acids 543-864 SEQ ID NO: 2, amino acids 974-1273 SEQ ID NO: 2, amino acids 1314-1385 SEQ ID NO: 2, SEQ ID NO: 3, amino acids 72-81 SEQ ID NO: 3, amino acids 118-125 SEQ ID NO: 3, amino acids s 199-212 SEQ ID NO: 3, amino acids 353-363 SEQ ID NO: 3, amino acids 549-565 SEQ ID NO: 3, amino acids 588-603 SEQ ID NO: 3, amino acids 669-684 SEQ ID NO: 3, amino acids 815-821 SEQ ID NO: 3, amino acids 868-892 SEQ ID NO: 3, amino acids 903-912 SEQ ID NO: 3, amino acids 918-940 SEQ ID NO: 3, amino acids 1268-1274 SEQ ID NO: 3, amino acids 1285-1297 SEQ ID NO: 3, amino acids 973-1256 SEQ ID NO: 3, amino acids 1344-1351 SEQ ID NO: 3, SEQ ID NO: 4, amino acids 7-432 SEQ ID NO: 4, amino acids 539-859 SEQ ID NO: 4, amino acids 869-1037 SEQ ID NO: 4, amino acids 1439-1684 SEQ ID NO: 4, amino acids 1722-1792 SEQ ID NO: 4, SEQ ID NO: 5, amino acids 39-457 SEQ ID NO: 5, amino acids 563-884 SEQ ID NO: 5, amino acids 1147-1399 SEQ ID NO: 5, amino acids you are 1434-1506 SEQ ID NO: 5, amino acids 1524-1950 SEQ ID NO: 5, amino acids 2056-2377 SEQ ID NO: 5, amino acids 2645-2895 SEQ ID NO: 5, amino acids 2932-3005 SEQ ID NO: 5, amino acids 3024-3449 SEQ ID NO: 5, amino acids 3555-3876 SEQ ID NO: 5, amino acids 3886-4048 SEQ ID NO: 5, amino acids 4433-4719 SEQ ID NO: 5, amino acids 4729-4974 SEQ ID NO: 5, amino acids 5010-5082 SEQ ID NO: 5, amino acids 5103-5525 SEQ ID NO: 5, amino acids 5631-5951 SEQ ID NO: 5, amino acids 5964-6132 SEQ ID NO: 5, amino acids 6542-6837 SEQ ID NO: 5, amino acids 6857-7101 SEQ ID NO: 5, amino acids 7140-7211 SEQ ID NO: 5, SEQ ID NO: 6, amino acids 35-454 SEQ ID NO: 6, amino acids 561-881 SEQ ID NO: 6, amino acids 1143-1393 SEQ ID NO: 6, amino acids 1430-1503 SEQ ID NO: 6, and amino acids 1522-1946 SEQ ID NO: 6, amino acids 2053-2373 SEQ ID NO: 6, amino acids 2383-2551 SEQ ID NO: 6, amino acids 2671-3045 SEQ ID NO: 6, amino acids 3392-3636 SEQ ID NO: 6, amino acids 3673-3745 SEQ ID NO: 6, SEQ ID NO: 7, amino acids 32-450 SEQ ID NO: 7, amino acids 556-877 SEQ ID NO: 7, amino acids 887-1051 SEQ ID NO: 7, amino acids 1478-1790 SEQ ID NO: 7, amino acids 1810-2055 SEQ ID NO: 7, amino acids 2093-2164 SEQ ID NO: 7, amino acids 2165-2439 SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 22.

According to another preferred embodiment, the present invention relates to an isolated nucleic acid molecule that comprises a nucleotide sequence encoding at least one polypeptide involved in the biosynthesis of epothilone, where this nucleotide sequence is almost the same as a nucleotide sequence selected from the series including: complement of nucleotides 1900 -3171 SEQ ID NO: 1, nucleotides 3415-5556 SEQ ID NO: 1, nucleotides 7610-11875 SEQ ID NO: 1, nucleotides 7643-8920 SEQ ID NO: 1, nucleotides 9236-10201 SEQ ID NO: 1, nucle leotides 10529-11428 SEQ ID NO: 1, nucleotides 11549-11764 SEQ ID NO: 1, nucleotides 11872-16104 SEQ ID NO: 1, nucleotides 12085-12114 SEQ ID NO: 1, nucleotides 12223-12246 SEQ ID NO: 1, nucleotides 12466-12507 SEQ ID NO: 1, nucleotides 12928-12960 SEQ ID NO: 1, nucleotides 13516-13566 SEQ ID NO: 1, nucleotides 13633-13680 SEQ ID NO: 1, nucleotides 13876-13923 SEQ ID NO: 1, nucleotides 14313-14334 SEQ ID NO: 1, nucleotides 14473-14547 SEQ ID NO: 1, nucleotides 14578-14607 SEQ ID NO: 1, nucleotides 14623-14692 SEQ ID NO: 1, nucleotides 15673-15693 SEQ ID NO: 1, nucleotides 15724-15762 SEQ ID NO: 1, nucleotides 14788-15639 SEQ ID NO: 1, nucleotides 15901-15924 SEQ ID NO: 1, nucleotides 16251-21749 SEQ ID NO: 1, nucleotides 16269-17546 SEQ ID NO: 1, nucleotides 17865-18827 SEQ ID NO: 1 , nucleotides 18855-19361 SEQ ID NO: 1, nucleotides 20565-21302 SEQ ID NO: 1, nucleotides 21414-21626 SEQ ID NO: 1, nucleotides 21746-43519 SEQ ID NO: 1, nucleotides 21860-23116 SEQ ID NO: 1 , nucleotides 23431-24397 SEQ ID NO: 1, nucleotides 25184-25942 SEQ ID NO: 1, nucleotides 26045-26263 SEQ ID NO: 1, nucleotides 26318-27595 SEQ ID NO: 1, nucleotides 27911-28876 SEQ ID NO: 1 , nucleotides 29678-30429 SEQ ID NO: 1, nucleotides 30539-30759 SEQ ID NO: 1, nucleotides 30815-32092 SEQ ID NO: 1, nucleotides 32408-33373 SEQ ID NO: 1, nucleotides 33401-33889 SEQ ID NO: 1 , nucleotides 35042-35902 SEQ ID NO: 1, nucleotides 35930-36667 SEQ ID NO: 1, nucleotides 36773-36991 SEQ ID NO: 1, nucleotides 37052-38320 SEQ ID NO: 1, nucleotides 38636-39598 SEQ ID NO: 1 nucleotides 39635-40141 SEQ ID NO: 1, nucleotides 41369-42256 SEQ ID NO: 1, nucleotides 42314-43048 SEQ ID NO: 1, nucleotides 43163-43378 SEQ ID NO: 1, nucleotides 43524-54920 SEQ ID NO: 1, nucleotides 43626-44885 SEQ ID NO: 1, nucleotides 45204-46166 SEQ ID NO: 1, nucleotides 46950-47702 SEQ ID NO: 1, nucleotides 47811-48032 SEQ ID NO: 1, nucleotides 48087-49361 SEQ ID NO: 1, nucleotides 49680-50642 SEQ ID NO: 1, nucleotides 50670-51176 SEQ ID NO: 1, nucleotides 51534-52657 SEQ ID NO: 1, nucleotides 53697-54431 SEQ ID NO: 1, nucleotides 54540-54758 SEQ ID NO: 1, nucleotides 54935-62254 SEQ ID NO: 1, nucleotides 55028-56284 SEQ ID NO: 1, nucleotides 56600-57565 SEQ ID NO: 1, nucleotides 57593-58087 SEQ ID NO: 1, nucleotides 59366-60304 SEQ ID NO: 1, nucleotides 60362-61099 SEQ ID NO: 1, nucleotides 61211-6 1426 SEQ ID NO: 1, nucleotides 61427-62254 SEQ ID NO: 1, nucleotides 62369-63628 SEQ ID NO: 1, nucleotides 67334-68251 SEQ ID NO: 1 and nucleotides 1-68750 SEQ ID NO: 1.

According to a particularly preferred embodiment, the present invention relates to a nucleic acid molecule that comprises a nucleotide sequence encoding at least one polypeptide involved in the epothilone biosynthesis, where the nucleotide sequence is selected from the series including: nucleotide complement 1900-3171 SEQ ID NO: 1, nucleotides 3415-5556 SEQ ID NO: 1, nucleotides 7610-11875 SEQ ID NO: 1, nucleotides 7643-8920 SEQ ID NO: 1, nucleotides 9236-10201 SEQ ID NO: 1, nucleotides 10529-11428 SEQ ID NO: 1, nucleotides 11549-11764 SEQ ID NO: 1, nucleotides 11872-16104 SEQ ID NO: 1, n nucleotides 12085-12114 SEQ ID NO: 1, nucleotides 12223-12246 SEQ ID NO: 1, nucleotides 12466-12507 SEQ ID NO: 1, nucleotides 12928-12960 SEQ ID NO: 1, nucleotides 13516-13566 SEQ ID NO: 1, nucleotides 13633-13680 SEQ ID NO: 1, nucleotides 13876-13923 SEQ ID NO: 1, nucleotides 14313-14334 SEQ ID NO: 1, nucleotides 14473-14547 SEQ ID NO: 1, nucleotides 14578-14607 SEQ ID NO: 1, nucleotides 14623-14692 SEQ ID NO: 1, nucleotides 15673-15693 SEQ ID NO: 1, nucleotides 15724-15762 SEQ ID NO: 1, nucleotides 14788-15639 SEQ ID NO: 1, nucleotides 15901-15924 SEQ ID NO: 1, nucleotides 16251-21749 SEQ ID NO: 1, nucleotides 16269-17546 SEQ ID NO: 1, nucleotides 17865-18827 SEQ ID NO: 1, nucleotides 18855-19361 SEQ ID NO: 1, nucleotides 20565-21302 SEQ ID NO: 1, Nucleotides 21414-21626 SEQ ID NO: 1, nucleotides 21746-43519 SEQ ID NO: 1, nucleotides 21860-23116 of SEQ ID NO: 1, nucleotides 23431-24397 SEQ ID NO: 1, nucleotides 25184-25942 SEQ ID NO: 1, nucleotides 26045-26263 SEQ ID NO: 1, nucleotides 26318-27595 SEQ ID NO: 1, nucleotides 27911-28876 SEQ ID NO: 1, nucleotides 29678-30429 SEQ ID NO: 1, nucleotides 30539-30759 SEQ ID NO: 1, nucleotides 30815-32092 SEQ ID NO: 1, nucleotides 32408-33373 SEQ ID NO: 1, nucleotides 33401-33889 SEQ ID NO: 1, nucleotides 35042-35902 SEQ ID NO: 1, nucleotides 35930-36667 SEQ ID NO: 1, nucleotides 36773-36991 SEQ ID NO: 1, nucleotides 37052-38320 SEQ ID NO: 1, nucleotides 38636-39598 SEQ ID NO: 1, nucleotides 39635-40141 SEQ ID NO: 1, nucleotides 41369-42256 SEQ ID NO: 1, nucleotides 42314-43048 SEQ ID NO: 1, nucleotides 43163-43 378 SEQ ID NO: 1, nucleotides 43524-54920 SEQ ID NO: 1, nucleotides 43626-44885 SEQ ID NO: 1, nucleotides 45204-46166 SEQ ID NO: 1, nucleotides 46950-47702 SEQ ID NO: 1, nucleotides 47811- 48032 SEQ ID NO: 1, nucleotides 48087-49361 SEQ ID NO: 1, nucleotides 49680-50642 SEQ ID NO: 1, nucleotides 50670-51176 SEQ ID NO: 1, nucleotides 51534-52657 SEQ ID NO: 1, nucleotides 53697- 54431 SEQ ID NO: 1, nucleotides 54540-54758 SEQ ID NO: 1, nucleotides 54935-62254 SEQ ID NO: 1, nucleotides 55028-56284 SEQ ID NO: 1, nucleotides 56600-57565 SEQ ID NO: 1, nucleotides 57593- 58087 SEQ ID NO: 1, nucleotides 59366-60304 SEQ ID NO: 1, nucleotides 60362-61099 SEQ ID NO: 1, nucleotides 61211-61426 SEQ ID NO: 1, nucleotides 61427-62254 SEQ ID NO: 1, nucleotides 62369- 63628 SEQ ID NO: 1, nucleotides 67334-68251 SEQ ID NO: 1 and nucleotides 1-68750 SEQ ID NO: 1.

According to another preferred embodiment, the present invention relates to an isolated nucleic acid molecule that comprises a nucleotide sequence encoding at least one polypeptide involved in epothilone biosynthesis, where this nucleotide sequence comprises a region of a nucleotide sequence consisting of 20, 25, 30, 35 , 40, 45 or 50 (preferably 20) consecutive base pairs identical to the region of the nucleotide sequence consisting of 20, 25, 30, 35, 40, 45 or 50 (preferred 20) consecutive base pairs of a nucleotide sequence selected from the series including: complement of nucleotides 1900-3171 SEQ ID NO: 1, nucleotides 3415-5556 SEQ ID NO: 1, nucleotides 7610-11875 SEQ ID NO: 1, nucleotides 7643-8920 SEQ ID NO: 1, nucleotides 9236-10201 SEQ ID NO: 1, nucleotides 10529-11428 SEQ ID NO: 1, nucleotides 11549-11764 SEQ ID NO: 1, nucleotides 11872-16104 SEQ ID NO: 1, nucleotides 12085-12114 SEQ ID NO: 1, nucleotides 12223-12246 SEQ ID NO: 1, nucleotides 12466-12507 SEQ ID NO: 1, nucleotides 12928-12960 SEQ ID NO: 1, nucleotides 13516-13566 SEQ ID NO: 1, nucleotides 13633-13680 SEQ ID NO: 1, nucleotides 13876-13923 SEQ ID NO: 1, nucleotides 14313-14334 SEQ ID NO: 1, nucleotides 14473-14547 SEQ ID NO: 1, nucleotides 14578-14607 SEQ ID NO: 1, nucleotides 14623-14692 SEQ ID NO: 1, nucleotides 15673-15693 SEQ ID NO: 1, nucleotides 15724-15762 SEQ ID NO: 1, nucleotides 14788-15639 SEQ ID NO: 1, nucleotides 15901-15924 SEQ ID NO: 1, nucleotides 16251-21749 SEQ ID NO: 1, nucleotides 16269-17546 SEQ ID NO: 1, nucleotides 17865-18827 SEQ ID NO: 1, nucleotides 18855-19361 SEQ ID NO: 1, nucleotides 20565-21302 SEQ ID NO: 1, nucleotides 21414-21626 SEQ ID NO: 1, nucleotides 21746-43519 SEQ ID NO: 1, nucleotides 21860-23116 SEQ ID NO: 1, nucleotides 23431-24397 SEQ ID NO: 1, nucleotides 25184-25942 SEQ ID NO: 1, nucleotides 26045-26263 of SEQ ID NO: 1, nucleotides 26318-27595 SEQ ID NO: 1, nucleotides 27911-28876 SEQ ID NO: 1, nucleotides 29678-30429 SEQ ID NO: 1, nucleo tides 30539-30759 SEQ ID NO: 1, nucleotides 30815-32092 SEQ ID NO: 1, nucleotides 32408-33373 SEQ ID NO: 1, nucleotides 33401-33889 SEQ ID NO: 1, nucleotides 35042-35902 SEQ ID NO: 1, nucleotides 35930-36667 SEQ ID NO: 1, nucleotides 36773-36991 SEQ ID NO: 1, nucleotides 37052-38320 SEQ ID NO: 1, nucleotides 38636-39598 SEQ ID NO: 1, nucleotides 39635-40141 SEQ ID NO: 1, nucleotides 41369-42256 SEQ ID NO: 1, nucleotides 42314-43048 SEQ ID NO: 1, nucleotides 43163-43378 SEQ ID NO: 1, nucleotides 43524-54920 SEQ ID NO: 1, nucleotides 43626-44885 SEQ ID NO: 1, nucleotides 45204-46166 SEQ ID NO: 1, nucleotides 46950-47702 SEQ ID NO: 1, nucleotides 47811-48032 SEQ ID NO: 1, nucleotides 48087-49361 SEQ ID NO: 1, nucleotides 49680-50642 SEQ ID NO: 1, nucleotides 50670-51176 SEQ ID NO: 1, well Kleotides 51534-52657 SEQ ID NO: 1, nucleotides 53697-54431 SEQ ID NO: 1, nucleotides 54540-54758 SEQ ID NO: 1, nucleotides 54935-62254 SEQ ID NO: 1, nucleotides 55028-56284 SEQ ID NO: 1, nucleotides 56600-57565 SEQ ID NO: 1, nucleotides 57593-58087 SEQ ID NO: 1, nucleotides 59366-60304 SEQ ID NO: 1, nucleotides 60362-61099 SEQ ID NO: 1, nucleotides 61211-61426 SEQ ID NO: 1, nucleotides 61427-62254 SEQ ID NO: 1, nucleotides 62369-63628 SEQ ID NO: 1, nucleotides 67334-68251 SEQ ID NO: 1 and nucleotides 1-68750 SEQ ID NO: 1.

The present invention also relates to a chimeric gene comprising a heterologous promoter sequence operably linked to a nucleic acid molecule of the invention. In addition, the present invention relates to a recombinant vector comprising such a chimeric gene, where the vector has the ability to stably transform the host cell. The present invention also relates to a recombinant host cell comprising such a chimeric gene, wherein the host cell has the ability to express a nucleotide sequence that encodes at least one polypeptide necessary for epothilone biosynthesis. In a preferred embodiment, the recombinant host cell is a bacterium belonging to the Actinomycetales order, and in a more preferred embodiment, the recombinant host cell is a Streptomyces strain. In another preferred embodiment, the recombinant host cell is any other bacterium capable of fermentation, such as pseudomonad or E. coli. In addition, the present invention relates to a clone of you (bacterial artificial chromosome) comprising a nucleic acid molecule of the invention, preferably to you clone of pEPO15.

Another object of the present invention is an isolated nucleic acid molecule comprising a nucleotide sequence that encodes an epothilone synthase domain.

In one embodiment, the epothilone synthase domain is a β-ketoacyl synthase (KS) domain containing an amino acid sequence substantially similar to that selected from amino acids 11-437 of SEQ ID NO: 2, amino acids 7-432 of SEQ ID NO: 4, amino acids 39-457 SEQ ID NO: 5, amino acids 1524-1950 SEQ ID NO: 5, amino acids 3024-3449 SEQ ID NO: 5, amino acids 5103-5525 SEQ ID NO: 5, amino acids 35-454 SEQ ID Amino acids NO: 6, amino acids 1522-1946 of SEQ ID NO: 6 and amino acids 32-450 of SEQ ID NO: 7. According to this embodiment, the KS domain preferably contains an amino acid sequence selected from the series comprising: amino acids 11-437 of SEQ ID NO: 2, amino acids 7-432 of SEQ ID NO: 4, amino acids 39-457 of SEQ ID NO: 5, amino acids 1524 -1950 SEQ ID NO: 5, amino acids 3024-3449 SEQ ID NO: 5, amino acids 5103-5525 SEQ ID NO: 5, amino acids 35-454 SEQ ID NO: 6, amino acids 1522-1946 SEQ ID NO: 6 and amino acids 32 -450 SEQ ID NO: 7. In addition, according to this embodiment, said nucleotide sequence is preferably substantially the same as a nucleotide sequence selected from the series consisting of: nucleotides 7643-8920 SEQ ID NO: 1, nucleotides 16269-17546 SEQ ID NO: 1, nucleotides 21860-23116 SEQ ID NO: 1, nucleotides 26318-27595 SEQ ID NO: 1, nucleotides 30815-32092 SEQ ID NO: 1, nucleotides 37052-38320 SEQ ID NO: 1, nucleotides 43626-44885 SEQ ID NO: 1, nucleotides 48087-49361 SEQ ID NO: 1 and nucleotides 55028-56284 of SEQ ID NO: 1. According to this embodiment, this nucleotide sequence more preferably comprises a region of a nucleotide sequence consisting of 20, 25, 30, 35, 40, 45 or 50 (preferably 20) consecutive base pairs identical to the region of a nucleotide sequence consisting of 20, 25, 30, 35, 40, 45 or 50 (preferably 20) consecutive base pairs of a nucleotide sequence selected from the series including: nucleotides 7643-8920 SEQ ID NO: 1, nucleotides 16269-17546 SEQ ID NO: 1, nucleotides 21860-23116 SEQ ID NO : 1, nucleotides 26318-27595 SEQ ID NO: 1, nucleot rows 30815-32092 SEQ ID NO: 1, nucleotides 37052-38320 SEQ ID NO: 1, nucleotides 43626-44885 SEQ ID NO: 1, nucleotides 48087-49361 SEQ ID NO: 1 and nucleotides 55028-56284 SEQ ID NO: 1. In addition, according to this embodiment, this nucleotide sequence is most preferably selected from the series including: nucleotides 7643-8920 SEQ ID NO: 1, nucleotides 16269-17546 SEQ ID NO: 1, nucleotides 21860-23116 SEQ ID NO: 1, nucleotides 26318 -27595 SEQ ID NO: 1, nucleotides 30815-32092 SEQ ID NO: 1, nucleotides 37052-38320 SEQ ID NO: 1, nucleotides 43626-44885 SEQ ID NO: 1, nucleotides 48087-49361 SEQ ID NO: 1 and nucleotides 55028 -56284 SEQ ID NO: 1.

In yet another embodiment, the epothilone synthase domain is an acyltransferase (AT) domain comprising an amino acid sequence substantially similar to an amino acid sequence selected from a series including; amino acids 543-864 SEQ ID NO: 2, amino acids 539-859 SEQ ID NO: 4, amino acids 563-884 SEQ ID NO: 5, amino acids 2056-2377 SEQ ID NO: 5, amino acids 3555-3876 SEQ ID NO: 5, amino acids 5631-5951 SEQ ID NO: 5, amino acids 561-881 SEQ ID NO: 6, amino acids 2053-2373 SEQ ID NO: 6 and amino acids 556-877 SEQ ID NO: 7. According to this embodiment, this AT domain preferably contains an amino acid sequence selected from the series comprising: amino acids 543-864 SEQ ID NO: 2, amino acids 539-859 SEQ ID NO: 4, amino acids 563-884 SEQ ID NO: 5, amino acids 2056-2377 SEQ ID NO: 5, amino acids 3555-3876 SEQ ID NO: 5, amino acids 5631-5951 SEQ ID NO: 5, amino acids 561-881 SEQ ID NO: 6, amino acids 2053-2373 SEQ ID NO: 6 and amino acids 556-877 SEQ ID NO: 7. In addition, according to this embodiment, said nucleotide sequence is substantially the same as a nucleotide sequence selected from the series consisting of: nucleotides 9236-10201 SEQ ID NO: 1, nucleotides 17865-18827 SEQ ID NO: 1, nucleotides 23431-24397 SEQ ID NO: 1 , nucleotides 27911-28876 SEQ ID NO: 1, nucleotides 32408-33373 SEQ ID NO: 1, nucleotides 38636-39598 SEQ ID NO: 1, nucleotides 45204-46166 SEQ ID NO: 1, nucleotides 49680-50642 SEQ ID NO: 1 and nucleotides 56600-57565 SEQ ID NO: 1. According to this embodiment, this nucleotide sequence more preferably comprises a region of a nucleotide sequence consisting of 20, 25, 30, 35, 40, 45 or 50 (preferably 20) consecutive base pairs identical to the region of a nucleotide sequence consisting of 20, 25, 30, 35, 40, 45 or 50 (preferably 20) consecutive base pairs of a nucleotide sequence selected from the series including: nucleotides 9236-10201 SEQ ID NO: 1, nucleotides 17865-18827 SEQ ID NO: 1, nucleotides 23431-24397 SEQ ID NO : 1, nucleotides 27911-28876 SEQ ID NO: 1, nucle CHIDA 32408-33373 SEQ ID NO: 1, nucleotides 38636-39598 SEQ ID NO: 1, nucleotides 45204-46166 SEQ ID NO: 1, nucleotides 49680-50642 SEQ ID NO: 1 and nucleotides 56600-57565 SEQ ID NO: 1.

In addition, according to this embodiment, this nucleotide sequence is most preferably selected from the series including: nucleotides 9236-10201 SEQ ID NO: 1, nucleotides 17865-18827 SEQ ID NO: 1, nucleotides 23431-24397 SEQ ID NO: 1, nucleotides 27911 -28876 SEQ ID NO: 1, nucleotides 32408-33373 SEQ ID NO: 1, nucleotides 38636-39598 SEQ ID NO: 1, nucleotides 45204-46166 SEQ ID NO: 1, nucleotides 49680-50642 SEQ ID NO: 1 and nucleotides 56600 -57565 SEQ ID NO: 1.

According to yet another embodiment, the epothilone synthase domain is an enoyl reductase (ER) domain comprising an amino acid sequence substantially similar to that selected from amino acids 974-1273 of SEQ ID NO: 2, amino acids 4433-4719 of SEQ ID NO: 5, amino acids 6542-6837 of SEQ ID NO: 5 and amino acids 1478-1790 of SEQ ID NO: 7. According to this embodiment, this ER domain preferably contains an amino acid sequence selected from the series comprising: amino acids 974-1273 of SEQ ID NO: 2, amino acids 4433-4719 of SEQ ID NO: 5, amino acids 6542-6837 of SEQ ID NO: 5, and amino acids 1478-1790 SEQ ID NO: 7. In addition, according to this embodiment, said nucleotide sequence is preferably substantially similar to a nucleotide sequence selected from the series consisting of: nucleotides 10529-11428 SEQ ID NO: 1, nucleotides 35042-35902 SEQ ID NO: 1, nucleotides 41369-42256 SEQ ID NO: 1 and nucleotides 59366-60304 of SEQ ID NO: 1. According to this embodiment, this nucleotide sequence more preferably comprises a region of a nucleotide sequence consisting of 20, 25, 30, 35, 40, 45 or 50 (preferably 20) consecutive base pairs identical to the region of a nucleotide sequence consisting of 20, 25, 30, 35, 40, 45 or 50 (preferably 20) consecutive base pairs of a nucleotide sequence selected from the series including: nucleotides 10529-11428 SEQ ID NO: 1, nucleotides 35042-35902 SEQ ID NO: 1, nucleotides 41369-42256 SEQ ID NO : 1 and nucleotides 59366-60304 SEQ ID NO: 1. In addition, according to this embodiment, this nucleotide sequence is most preferably selected from the series including: nucleotides 10529-11428 SEQ ID NO: 1, nucleotides 35042-35902 SEQ ID NO: 1, nucleotides 41369-42256 SEQ ID NO: 1 and nucleotides 59366 -60304 SEQ ID NO: 1.

According to another embodiment, the epothilone synthase domain is an acyl carrier protein domain (ACP) comprising an amino acid sequence substantially similar to an amino acid sequence selected from the series consisting of: amino acids 1314-1385 SEQ ID NO: 2, amino acids 1722-1792 SEQ ID NO: 4, amino acids 1434-1506 SEQ ID NO: 5, amino acids 2932-3005 SEQ ID NO: 5, amino acids 5010-5082 SEQ ID NO: 5, amino acids 7140-7211 SEQ ID NO: 5, amino acids 1430-1503 SEQ ID NO: 6. amino acids 3673-3745 of SEQ ID NO: 6; and amino acids 2093-2164 of SEQ ID NO: 7. According to this embodiment, this ACP domain preferably contains an amino acid sequence selected from the series including: amino acids 1314-1385 SEQ ID NO: 2, amino acids 1722-1792 SEQ ID NO: 4, amino acids 1434-1506 SEQ ID NO: 5, amino acids 2932-3005 SEQ ID NO: 5, amino acids 5010-5082 SEQ ID NO: 5, amino acids 7140-7211 SEQ ID NO: 5, amino acids 1430-1503 SEQ ID NO: 6, amino acids 3673-3745 SEQ ID NO: 6 and amino acids 2093-2164 SEQ ID NO: 7. In addition, according to this embodiment, said nucleotide sequence is substantially similar to a nucleotide sequence selected from the series including: nucleotides 11549-11764 SEQ ID NO: 1, nucleotides 21414-21626 SEQ ID NO: 1, nucleotides 26045-26263 SEQ ID NO: 1 , nucleotides 30539-30759 SEQ ID NO: 1, nucleotides 36773-36991 SEQ ID NO: 1, nucleotides 43163-43378 SEQ ID NO: 1, nucleotides 47811-48032 SEQ ID NO: 1, nucleotides 54540-54758 SEQ ID NO: 1 and nucleotides 61211-61426 of SEQ ID NO: 1. According to this embodiment, this nucleotide sequence more preferably comprises a region of a nucleotide sequence consisting of 20, 25, 30, 35, 40, 45 or 50 (preferably 20) consecutive base pairs identical to the region of a nucleotide sequence consisting of 20, 25, 30, 35, 40, 45 or 50 (preferably 20) consecutive base pairs of a nucleotide sequence selected from the series including: nucleotides 11549-11764 SEQ ID NO: 1, nucleotides 21414-21626 SEQ ID NO: 1, nucleotides 26045-26263 SEQ ID NO : 1, nucleotides 30539-30759 SEQ ID NO: 1, nucleo ides 36773-36991 SEQ ID NO: 1, nucleotides 43163-43378 SEQ ID NO: 1, nucleotides 47811-48032 SEQ ID NO: 1, nucleotides 54540-54758 SEQ ID NO: 1 and nucleotides 61211-61426 SEQ ID NO: 1. In addition, according to this embodiment, this nucleotide sequence is most preferably selected from the series including: nucleotides 11549-11764 SEQ ID NO: 1, nucleotides 21414-21626 SEQ ID NO: 1, nucleotides 26045-26263 SEQ ID NO: 1, nucleotides 30539 -30759 SEQ ID NO: 1, nucleotides 36773-36991 SEQ ID NO: 1, nucleotides 43163-43378 SEQ ID NO: 1, nucleotides 47811-48032 SEQ ID NO: 1, nucleotides 54540-54758 SEQ ID NO: 1, nucleotides 61211 -61426 SEQ ID NO: 1.

According to another embodiment, the epothilone synthase domain is a dehydratase (DH) domain comprising an amino acid sequence substantially similar to an amino acid sequence selected from the series consisting of: amino acids 869-1037 SEQ ID NO: 4, amino acids 3886-4048 SEQ ID NO: 5, amino acids 5964-6132 of SEQ ID NO: 5, amino acids 2383-2551 of SEQ ID NO: 6, and amino acids 887-1051 of SEQ ID NO: 7. According to this embodiment, this DH domain preferably contains an amino acid sequence selected from the series comprising: amino acids 869-1037 SEQ ID NO: 4, amino acids 3886-4048 SEQ ID NO: 5, amino acids 5964-6132 SEQ ID NO: 5, amino acids 2383-2551 SEQ ID NO: 6 and amino acids 887-1051 SEQ ID NO: 7. In addition, according to this embodiment, said nucleotide sequence is preferably substantially the same as a nucleotide sequence selected from the series consisting of: nucleotides 18855-19361 SEQ ID NO: 1, nucleotides 33401-33889 SEQ ID NO: 1, nucleotides 39635-40141 SEQ ID NO: 1, nucleotides 50670-51176 of SEQ ID NO: 1 and nucleotides 57593-58087 of SEQ ID NO: 1. According to this embodiment, this nucleotide sequence more preferably comprises a region of a nucleotide sequence consisting of 20, 25, 30, 35, 40, 45 or 50 (preferably 20) consecutive base pairs identical to the region of a nucleotide sequence consisting of 20, 25, 30, 35, 40, 45 or 50 (preferably 20) consecutive base pairs of a nucleotide sequence selected from the series including: nucleotides 18855-19361 SEQ ID NO: 1, nucleotides 33401-33889 SEQ ID NO: 1, nucleotides 39635-40141 SEQ ID NO : 1, nucleotides 50670-51176 SEQ ID NO: 1 and nucle CHIDA 57593-58087 SEQ ID NO: 1. In addition, according to this embodiment, this nucleotide sequence is most preferably selected from the series including: nucleotides 18855-19361 SEQ ID NO: 1, nucleotides 33401-33889 SEQ ID NO: 1, nucleotides 39635-40141 SEQ ID NO: 1, nucleotides 50670 -51176 SEQ ID NO: 1 and nucleotides 57593-58087 SEQ ID NO: 1.

According to yet another embodiment, the epothilone synthase domain is a β-ketoreductase (KR) domain comprising an amino acid sequence substantially similar to an amino acid sequence selected from the series consisting of: amino acids 1439-1684 SEQ ID NO: 4, amino acids 1147-1399 SEQ ID NO: 5, amino acids 2645-2895 SEQ ID NO: 5, amino acids 4729-4974 SEQ ID NO: 5, amino acids 6857-7101 SEQ ID NO: 5, amino acids 1143-1393 SEQ ID NO: 6, amino acids 3392-3636 SEQ ID NO: 6 and amino acids 1810-2055 SEQ ID NO: 7. According to this embodiment, the KR domain preferably contains an amino acid sequence selected from the series comprising: amino acids 1439-1684 SEQ ID NO: 4, amino acids 1147-1399 SEQ ID NO: 5, amino acids 2645-2895 SEQ ID NO: 5, amino acids 4729 -4974 SEQ ID NO: 5, amino acids 6857-7101 SEQ ID NO: 5, amino acids 1143-1393 SEQ ID NO: 6, amino acids 3392-3636 SEQ ID NO: 6 and amino acids 1810-2055 SEQ ID NO: 7. In addition, according to this embodiment, said nucleotide sequence is preferably substantially the same as a nucleotide sequence selected from the series comprising: nucleotides 20565-21302 SEQ ID NO: 1, nucleotides 25184-25942 SEQ ID NO: 1, nucleotides 29678-30429 SEQ ID NO: 1, nucleotides 35930-36667 SEQ ID NO: 1, nucleotides 42314-43048 SEQ ID NO: 1, nucleotides 46950-47702 SEQ ID NO: 1, nucleotides 53697-54431 SEQ ID NO: 1 and nucleotides 60362-61099 SEQ ID NO: 1. According to this embodiment, this nucleotide sequence more preferably comprises a region of a nucleotide sequence consisting of 20, 25, 30, 35, 40, 45 or 50 (preferably 20) consecutive base pairs identical to the region of a nucleotide sequence consisting of 20, 25, 30, 35, 40, 45 or 50 (preferably 20) consecutive base pairs of a nucleotide sequence selected from the series including: nucleotides 20565-21302 SEQ ID NO: 1, nucleotides 25184-25942 SEQ ID NO: 1, nucleotides 29678-30429 SEQ ID NO : 1, nucleotides 35930-36667 SEQ ID NO: 1, nucleo ides 42314-43048 SEQ ID NO: 1, nucleotides 46950-47702 SEQ ID NO: 1, nucleotides 53697-54431 SEQ ID NO: 1 and nucleotides 60362-61099 SEQ ID NO: 1. In addition, according to this embodiment, this nucleotide sequence is most preferably selected from the series including: nucleotides 20565-21302 SEQ ID NO: 1, nucleotides 25184-25942 SEQ ID NO: 1, nucleotides 29678-30429 SEQ ID NO: 1, nucleotides 35930 -36667 SEQ ID NO: 1, nucleotides 42314-43048 SEQ ID NO: 1, nucleotides 46950-47702 SEQ ID NO: 1, nucleotides 53697-54431 SEQ ID NO: 1 and nucleotides 60362-61099 SEQ ID NO: 1.

According to a further embodiment, the epothilone synthase domain is a methyltransferase (MT) domain containing an amino acid sequence substantially similar to amino acids 2671-3045 of SEQ ID NO: 6. According to this embodiment, the MT domain preferably contains amino acids 2671-3045 of SEQ ID NO: 6. Furthermore, according to this embodiment, said nucleotide sequence is preferably substantially the same as nucleotides 51534-52657 of SEQ ID NO: 1. According to this embodiment, this nucleotide sequence more preferably comprises a region of a nucleotide sequence consisting of 20, 25, 30, 35, 40, 45 or 50 (preferably 20) consecutive base pairs identical to the region of a nucleotide sequence consisting of 20, 25, 30, 35, 40, 45 or 50 (preferably 20) consecutive base pairs of the nucleotide sequence represented by nucleotides 51534-52657 SEQ ID NO: 1. Furthermore, according to this embodiment, this nucleotide sequence is most preferably nucleotides 51534-52657 of SEQ ID NO: 1.

In yet another embodiment, the epothilone synthase domain is a thioesterase (TE) domain containing an amino acid sequence substantially similar to amino acids 2165-2439 of SEQ ID NO: 7. According to this embodiment, the TE domain preferably contains amino acids 2165-2439 of SEQ ID NO: 7. In addition, according to this embodiment, said nucleotide sequence is preferably substantially the same as nucleotides 61427-62254 of SEQ ID NO: 1. According to this embodiment, this nucleotide sequence more preferably comprises a region of a nucleotide sequence consisting of 20, 25, 30, 35, 40, 45 or 50 (preferably 20) consecutive base pairs identical to the region of a nucleotide sequence consisting of 20, 25, 30, 35, 40, 45 or 50 (preferably 20) consecutive base pairs of the nucleotide sequence represented by nucleotides 61427-62254 of SEQ ID NO: 1. Furthermore, according to this embodiment, this nucleotide sequence is most preferably nucleotides 61427-62254 of SEQ ID NO: 1.

According to another embodiment, the present invention relates to an isolated nucleic acid molecule comprising a nucleotide sequence that encodes a non-ribosomal acid-amino acid-ligase, where the amino acid sequence of this non-ribosomal acid-amino acid-ligase contains an amino acid sequence substantially similar to an amino acid sequence selected from the series comprising: SEQ ID NO: 3, amino acids 72-81 SEQ ID NO: 3, amino acids 118-125 SEQ ID NO: 3, amino acids 199-212 SEQ ID NO: 3, amino acids you are 353-363 SEQ ID NO: 3, amino acids 549-565 SEQ ID NO: 3, amino acids 588-603 SEQ ID NO: 3, amino acids 669-684 SEQ ID NO: 3, amino acids 815-821 SEQ ID NO: 3, amino acids 868-892 SEQ ID NO: 3, amino acids 903-912 SEQ ID NO: 3, amino acids 918-940 SEQ ID NO: 3, amino acids 1268-1274 SEQ ID NO: 3, amino acids 1285-1297 SEQ ID NO: 3, amino acids 973-1256 of SEQ ID NO: 3; and amino acids 1344-1351 of SEQ ID NO: 3. According to this embodiment, the non-ribosomal acid-amino acid-ligase preferably contains an amino acid sequence selected from the series including: SEQ ID NO: 3, amino acids 72-81 SEQ ID NO: 3, amino acids 118-125 SEQ ID NO: 3, amino acids 199- 212 SEQ ID NO: 3, amino acids 353-363 SEQ ID NO: 3, amino acids 549-565 SEQ ID NO: 3, amino acids 588-603 SEQ ID NO: 3, amino acids 669-684 SEQ ID NO: 3, amino acids 815- 821 SEQ ID NO: 3, amino acids 868-892 SEQ ID NO: 3, amino acids 903-912 SEQ ID NO: 3, amino acids 918-940 SEQ ID NO: 3, amino acids 1268-1274 SEQ ID NO: 3, amino acids 1285- 1297 SEQ ID NO: 3, amino acids 973-1256 SEQ ID NO: 3 and amino acids lots 1344-1351 SEQ ID NO: 3. In addition, according to this embodiment, said nucleotide sequence is preferably substantially similar to a nucleotide sequence selected from the series consisting of: nucleotides 11872-16104 SEQ ID NO: 1, nucleotides 12085-12114 SEQ ID NO: 1, nucleotides 12223-12246 SEQ ID NO: 1, nucleotides 12466-12507 SEQ ID NO: 1, nucleotides 12928-12960 SEQ ID NO: 1, nucleotides 13516-13566 SEQ ID NO: 1, nucleotides 13633-13680 SEQ ID NO: 1, nucleotides 13876-13923 SEQ ID NO: 1, nucleotides 14313-14334 SEQ ID NO: 1, nucleotides 14473-14547 SEQ ID NO: 1, nucleotides 14578-14607 SEQ ID NO: 1, nucleotides 14623-14692 SEQ ID NO: 1, nucleotides 15673-15693 SEQ ID NO: 1, nucleotides 15724-15762 SEQ ID NO: 1, nucleotides 14788-15639 SEQ ID NO: 1 and nucleotides 15901-15924 SEQ ID NO: 1. According to this embodiment, this nucleotide sequence more preferably comprises a region of a nucleotide sequence consisting of 20, 25, 30, 35, 40, 45 or 50 (preferably 20) consecutive base pairs identical to the region of a nucleotide sequence consisting of 20, 25, 30, 35, 40, 45 or 50 (preferably 20) consecutive base pairs of a nucleotide sequence selected from the series including: nucleotides 11872-16104 SEQ ID NO: 1, nucleotides 12085-12114 SEQ ID NO: 1, nucleotides 12223-12246 SEQ ID NO : 1, nucleotides 12466-12507 SEQ ID NO: 1, nucleo IDs 12928-12960 SEQ ID NO: 1, nucleotides 13516-13566 SEQ ID NO: 1, nucleotides 13633-13680 SEQ ID NO: 1, nucleotides 13876-13923 SEQ ID NO: 1, nucleotides 14313-14334 SEQ ID NO: 1, nucleotides 14473-14547 SEQ ID NO: 1, nucleotides 14578-14607 SEQ ID NO: 1, nucleotides 14623-14692 SEQ ID NO: 1, nucleotides 15673-15693 SEQ ID NO: 1, nucleotides 15724-15762 SEQ ID NO: 1, nucleotides 14788-15639 of SEQ ID NO: 1 and nucleotides 15901-15924 of SEQ ID NO: 1. In addition, according to this embodiment, this nucleotide sequence is most preferably selected from the series including: nucleotides 11872-16104 SEQ ID NO: 1, nucleotides 12085-12114 SEQ ID NO: 1, nucleotides 12223-12246 SEQ ID NO: 1, nucleotides 12466 -12507 SEQ ID NO: 1, nucleotides 12928-12960 SEQ ID NO: 1, nucleotides 13516-13566 SEQ ID NO: 1, nucleotides 13633-13680 SEQ ID NO: 1, nucleotides 13876-13923 SEQ ID NO: 1, nucleotides 14313 -14334 SEQ ID NO: 1, nucleotides 14473-14547 SEQ ID NO: 1, nucleotides 14578-14607 SEQ ID NO: 1, nucleotides 14623-14692 SEQ ID NO: 1, nucleotides 15673-15693 SEQ ID NO: 1, nucleotides 15724 -15762 SEQ ID NO: 1, nucleotides 14788-15639 SEQ ID NO: 1 and nucleotides 15901-15924 SEQ ID NO :1.

The present invention also relates to an isolated nucleic acid molecule comprising a nucleotide sequence that encodes a polypeptide containing an amino acid sequence selected from the series comprising the sequences of SEQ ID NO: 2-23.

Another object of the invention are methods for producing recombinant polyketides, such as epothilones, in quantities large enough so that they can be purified and used in pharmaceutical compositions, for example, for the treatment of cancer. The main advantage of these production methods is the chirality of the obtained molecules; production in transgenic organisms avoids the formation of racemic mixtures in populations in which some enantiomers may have reduced activity. In particular, the present invention relates to a method for heterologously expressing epothilone in a heterologous host, which comprises: (a) introducing into the host a chimeric gene comprising a heterologous promoter sequence operably linked to a nucleic acid molecule of the invention that comprises a nucleotide sequence that encodes at least at least one polypeptide involved in epothilone biosynthesis, and (b) growing a host under conditions that allow epothilo biosynthesis on in the host. The present invention also relates to a method for producing epothilone, comprising: (a) expressing epothilone in a recombinant host using the above method, and (b) extracting epothilone from a recombinant host.

Another object of the invention is an isolated polypeptide comprising an amino acid sequence that contains an epothilone synthase domain.

According to another embodiment, the epothilone synthase domain is a β-ketoacyl synthase (KS) domain containing an amino acid sequence substantially similar to that selected from amino acids 11-437 of SEQ ID NO: 2, amino acids 7-432 of SEQ ID NO: 4, amino acids 39-457 SEQ ID NO: 5, amino acids 1524-1950 SEQ ID NO: 5, amino acids 3024-3449 SEQ ID NO: 5, amino acids 5103-5525 SEQ ID NO: 5, amino acids 35-454 SEQ ID Amino acids NO: 6, amino acids 1522-1946 of SEQ ID NO: 6 and amino acids 32-450 of SEQ ID NO: 7. According to this embodiment, the KS domain preferably contains an amino acid sequence selected from the series comprising: amino acids 11-437 of SEQ ID NO: 2, amino acids 7-432 of SEQ ID NO: 4, amino acids 39-457 of SEQ ID NO: 5, amino acids 1524 -1950 SEQ ID NO: 5, amino acids 3024-3449 SEQ ID NO: 5, amino acids 5103-5525 SEQ ID NO: 5, amino acids 35-454 SEQ ID NO: 6, amino acids 1522-1946 SEQ ID NO: 6 and amino acids 32 -450 SEQ ID NO: 7.

According to yet another embodiment, the epothilone synthase domain is an acyltransferase (AT) domain comprising an amino acid sequence substantially similar to an amino acid sequence selected from the series consisting of: amino acids 543-864 SEQ ID NO: 2, amino acids 539-859 SEQ ID NO: 4, amino acids 563-884 SEQ ID NO: 5, amino acids 2056-2377 SEQ ID NO: 5, amino acids 3555-3876 SEQ ID NO: 5, amino acids 5631-5951 SEQ ID NO: 5, amino acids 561-881 SEQ ID NO: 6, amino acids 2053-2373 of SEQ ID NO: 6 and amino acids 556-877 of SEQ ID NO: 7. According to this embodiment, the AT domain preferably contains an amino acid sequence selected from the series including: amino acids 543-864 SEQ ID NO: 2, amino acids 539-859 SEQ ID NO: 4, amino acids 563-884 SEQ ID NO: 5, amino acids 2056 -2377 SEQ ID NO: 5, amino acids 3555-3876 SEQ ID NO: 5, amino acids 5631-5951 SEQ ID NO: 5, amino acids 561-881 SEQ ID NO: 6, amino acids 2053-2373 SEQ ID NO: 6 and amino acids 556 -877 SEQ ID NO: 7.

According to a further embodiment, the epothilone synthase domain is an enoyl reductase (ER) domain containing an amino acid sequence substantially similar to an amino acid sequence selected from the series consisting of: amino acids 974-1273 SEQ ID NO: 2, amino acids 4433-4719 SEQ ID NO: 5 amino acids 6542-6837 of SEQ ID NO: 5; and amino acids 1478-1790 of SEQ ID NO: 7. According to this embodiment, the ER domain preferably contains an amino acid sequence selected from the series comprising: amino acids 974-1273 of SEQ ID NO: 2, amino acids 4433-4719 of SEQ ID NO: 5, amino acids 6542-6837 of SEQ ID NO: 5, and amino acids 1478 -1790 SEQ ID NO: 7.

According to another embodiment, the epothilone synthase domain is an acyl carrier protein domain (ACP) comprising an amino acid sequence substantially similar to an amino acid sequence selected from the series consisting of: amino acids 1314-1385 SEQ ID NO: 2, amino acids 1722-1792 SEQ ID NO: 4, amino acids 1434-1506 SEQ ID NO: 5, amino acids 2932-3005 SEQ ID NO: 5, amino acids 5010-5082 SEQ ID NO: 5, amino acids 7140-7211 SEQ ID NO: 5, amino acids 1430-1503 SEQ Amino acids 3673-3745; SEQ ID NO: 6; and amino acids 2093-2164; SEQ ID NO: 7. According to this embodiment, the ACP domain preferably contains an amino acid sequence selected from the series including: amino acids 1314-1385 SEQ ID NO: 2, amino acids 1722-1792 SEQ ID NO: 4, amino acids 1434-1506 SEQ ID NO: 5, amino acids 2932 -3005 SEQ ID NO: 5, amino acids 5010-5082 SEQ ID NO: 5, amino acids 7140-7211 SEQ ID NO: 5, amino acids 1430-1503 SEQ ID NO: 6, amino acids 3673-3745 SEQ ID NO: 6 and amino acids 2093 -2164 SEQ ID NO: 7.

According to another embodiment, the epothilone synthase domain is a dehydratase (DH) domain comprising an amino acid sequence substantially similar to an amino acid sequence selected from the series consisting of: amino acids 869-1037 SEQ ID NO: 4, amino acids 3886-4048 SEQ ID NO: 5, amino acids 5964-6132 of SEQ ID NO: 5, amino acids 2383-2551 of SEQ ID NO: 6, and amino acids 887-1051 of SEQ ID NO: 7. According to this embodiment, the DH domain preferably contains an amino acid sequence selected from the series comprising: amino acids 869-1037 SEQ ID NO: 4, amino acids 3886-4048 SEQ ID NO: 5, amino acids 5964-6132 SEQ ID NO: 5, amino acids 2383 -2551 SEQ ID NO: 6 and amino acids 887-1051 SEQ ID NO: 7.

And according to yet another embodiment, the epothilone synthase domain is a β-ketoreductase (KR) domain containing an amino acid sequence substantially similar to an amino acid sequence selected from the series consisting of: amino acids 1439-1684 SEQ ID NO: 4, amino acids 1147-1399 SEQ ID NO: 5, amino acids 2645-2895 SEQ ID NO: 5, amino acids 4729-4974 SEQ ID NO: 5, amino acids 6857-7101 SEQ ID NO: 5, amino acids 1143-1393 SEQ ID NO: 6, amino acids 3392-3636 SEQ ID NO: 6 and amino acids 1810-2055 SEQ ID NO: 7. According to this embodiment, the KR domain preferably contains an amino acid sequence selected from the series comprising: amino acids 1439-1684 SEQ ID NO: 4, amino acids 1147-1399 SEQ ID NO: 5, amino acids 2645-2895 SEQ ID NO: 5, amino acids 4729 -4974 SEQ ID NO: 5, amino acids 6857-7101 SEQ ID NO: 5, amino acids 1143-1393 SEQ ID NO: 6, amino acids 3392-3636 SEQ ID NO: 6 and amino acids 1810-2055 SEQ ID NO: 7.

According to a further embodiment, the epothilone synthase domain is a methyltransferase (MT) domain containing an amino acid sequence substantially similar to amino acids 2671-3045 of SEQ ID NO: 6. According to this embodiment, the MT domain preferably contains amino acids 2671-3045 of SEQ ID NO: 6.

According to another embodiment, the epothilone synthase domain is a thioesterase (TE) domain containing an amino acid sequence substantially similar to amino acids 2165-2439 of SEQ ID NO: 7. According to this embodiment, the TE domain preferably contains amino acids 2165-2439 of SEQ ID NO: 7.

Other objects and advantages of the present invention will become apparent to those skilled in the art after studying the following description of the invention and non-limiting examples.

Definitions

In the description of the present invention, the following concepts are used, which have the following meanings.

“Functionally linked / linked to”: Refers to two DNA sequences that are physically or functionally linked. For example, it is said that a promoter or regulatory DNA sequence is “linked” to a DNA sequence that encodes an RNA or protein if the two sequences are functionally linked or arranged so that the regulatory DNA sequence can affect the expression level of the coding or structural DNA sequence.

Chimeric gene: A recombinant DNA sequence in which a promoter or regulatory DNA sequence is operably linked or connected to a DNA sequence that encodes mRNA or that is expressed as a protein, so that the regulatory DNA sequence has the ability to regulate the transcription or expression of a linked DNA sequence. The regulatory DNA sequence of a chimeric gene is not functionally linked or linked to the DNA sequence as it does in vivo.

DNA coding sequence: A DNA sequence that is translated into the body to form a protein.

Domain: Part of polyketide synthase necessary for the manifestation of a certain activity. Examples include the carrier protein domains of acyl (ACP), β-ketosynthase (KS), acyl transferase (AT), β-ketoreductase (KR), dehydratase (DH), enoyl reductase (ER) and thioesterase (TE).

Epothilones: 16-membered macrocyclic polyketides, which are naturally produced by the strain of the bacterium Sorangium cellulosum So ce90, resembling taxol in biological activity. In the present description, the term “epothilone” refers to a class of polyketides that includes epothilone A and epothilone B, as well as their analogs, which are described in WO 98/25929.

Epothilone synthase: Polyketide synthase responsible for epothilone biosynthesis.

Gene: A certain region that is localized within the genome and which, in addition to the above coding DNA sequence, includes other, primarily regulatory DNA sequences, responsible for controlling expression, i.e. for transcription and translation of the coding region.

Heterologous DNA sequence: A DNA sequence that is not found naturally in the host cell into which it is introduced, including non-naturally occurring multiple copies of the naturally occurring DNA sequence.

Homologous nucleotide sequence: A DNA sequence that occurs naturally in the host cell into which it is introduced.

Homologous recombination: Reciprocal exchange of DNA fragments between homologous DNA molecules.

Isolated: in the context of the present invention, an isolated nucleic acid molecule or an isolated enzyme refers to a nucleic acid molecule or enzyme which, thanks to humans, exists outside their natural environment and, therefore, are not natural products. An isolated nucleic acid molecule or enzyme may exist in purified form or may exist in an unnatural environment, such as, for example, a recombinant host cell.

Module: A genetic element encoding all the different types of activities necessary for one cycle of polyketide biosynthesis, i.e. one stage of condensation and all related stages of processing β-carbonyl. Each module encodes the activity of ACP, KS, and AT, which are necessary for the implementation of the stage of condensation of the biosynthesis pathway and certain activities necessary for the implementation of the subsequent stages of β-carbonyl processing.

NRPS: A non-ribosomal acid-amino acid-ligase, which is a complex of enzymatic activities responsible for the incorporation of amino acids into secondary metabolites, including, for example, the domains of amino acid adenylation, epimerization, N-methylation, cyclization, peptidyl carrier protein and condensation. Functionally active NRPS catalyzes the incorporation of an amino acid into a secondary metabolite.

NRPS gene: One or more genes encoding NRPS, resulting in functionally active secondary metabolites, such as epothilones A and B, when they are under the control of one or more compatible control elements.

Nucleic acid molecule: A linear segment of single or double stranded DNA or RNA that can be isolated from any source. In the context of the present invention, the nucleic acid molecule is preferably a DNA segment.

ORF: Open reading frame

PKS: Polyketide synthase, which is a complex of enzymatic activities (domains) responsible for the biosynthesis of polyketides, including, for example, ketoreductase, dehydratase, acyl carrier protein, enoyl reductase, ketoacyl ACP synthase and acyltransferase. The functionally active PKS is a synthase that catalyzes the synthesis of polyketide.

PKS genes: One or more genes encoding the various polypeptides necessary to produce functionally active polyketides, such as epothilones A and B, when they are under the control of one or more compatible control elements.

Almost the same: in relation to nucleic acids, it refers to a nucleic acid molecule, the sequence of which is at least 60% identical to the nucleic acid molecule with which the comparison is made. In a preferred embodiment, the substantially similar DNA molecule is at least 80% identical to the DNA molecule being compared; in a more preferred embodiment, the substantially similar DNA molecule is 90% identical to the DNA molecule being compared; and in a most preferred embodiment, the substantially similar DNA molecule is at least 95% identical to the DNA molecule being compared. A substantially similar DNA sequence preferably encodes a protein or peptide having substantially the same activity as the protein or peptide encoded by the DNA sequence to be compared. A practically similar nucleotide sequence, as a rule, hybridizes with the nucleic acid molecule to be compared, or with its fragment under the following conditions: hybridization in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO ₄ , pH 7.0, 1 mM EDTA at 50 ° C; washing with double SSC (2xSSC), 1% SDS at 50 ° C. For proteins or peptides, a substantially similar amino acid sequence denotes an amino acid sequence that is at least 90% identical to the amino acid sequence of the protein or peptide being compared and has almost the same activity as the activity of the protein or peptide being compared .

Transformation: The process of introducing a heterologous nucleic acid into a host cell or organism.

Transformed / transgenic / recombinant: Refers to a host organism, such as a bacterium, into which a heterologous nucleic acid molecule is introduced. The nucleic acid molecule may be stably integrated into the host genome, or the nucleic acid molecule may also be present as an extrachromosomal molecule. Such an extrachromosomal molecule may be a self-replicating molecule. It is understood that the concept of transformed cells, tissues or plants includes not only the end product of the transformation process, but also their transgenic offspring. The terms “non-transformed”, “non-transgenic” or “non-recombinant” host means a wild-type organism, for example a bacterium that does not contain a heterologous nucleic acid molecule.

Nucleotides are labeled based on the following standard abbreviations: adenine (A), cytosine (C), thymine (T), and guanine (G). Amino acids are also indicated by the following standard abbreviations: alanine (Ala; A), arginine (Arg; R), asparagine (Asn; N), aspartic acid (Asp; D), cysteine (Cys; C), glutamine (Gln; Q), glutamic acid (Glu; E), glycine (Gly; G), histidine (His; H), isoleucine (Ile; I), leucine (Leu; L), lysine (Lys; K), methionine (Met, M), phenylalanine (Phe, F); proline (Pro, P); serine (Ser, S); threonine (Thr, T); tryptophan (Trp; W), tyrosine (Tyr; Y) and valine (Val; V). In addition, (Haa; X) denotes any amino acid.

Description of the sequences listed in the sequence listing

SEQ ID NO: 1 is a nucleotide sequence with a length of 68,750 base pairs in the form of a sequence of fragments containing 22 open reading frames (ORF), which includes genes for the biosynthesis of epothilone.

SEQ ID NO: 2 is a Type I polyketide synthase protein sequence (EPOS A) encoded by EPO (nucleotides 7610-11875 of SEQ ID NO: 1).

SEQ ID NO: 3 is the sequence of the non-ribosomal acid-amino acid ligase (EPOS P) protein encoded by EPO (nucleotides 11872-16104 of SEQ ID NO: 1).

SEQ ID NO: 4 is a Type I polyketide synthase protein sequence (EPOS B) encoded by EPO (nucleotides 16251-21749 of SEQ ID NO: 1).

SEQ ID NO: 5 is a Type I polyketide synthase protein sequence (EPOS C) encoded by EPO (nucleotides 21746-43519 of SEQ ID NO: 1).

SEQ ID NO: 6 is a Type I polyketide synthase protein sequence (EPOS D) encoded by epoD (nucleotides 43524-54920 of SEQ ID NO: 1).

SEQ ID NO: 7 is a Type I polyketide synthase protein sequence (EPOS E) encoded by EPO (nucleotides 54935-62254 of SEQ ID NO: 1).

SEQ ID NO: 8 is the cytochrome P450 oxidase (EPOS F) homolog protein sequence encoded by epoF (nucleotides 62369-63628 of SEQ ID NO: 1).

SEQ ID NO: 9 is a protein sequence (partial Orf 1) encoded by orf1 (nucleotides 1-1826 of SEQ ID NO: 1).

SEQ ID NO: 10 is a protein sequence (Orf 2) encoded by orf2 (nucleotides 3171-1900 on the reverse complementary chain of SEQ ID NO: 1).

SEQ ID NO: 11 is a protein sequence (Orf 3) encoded by orf3 (nucleotides 3415-5556 of SEQ ID NO: 1).

SEQ ID NO: 12 is a protein sequence (Orf 4) encoded by orf4 (nucleotides 5992-5612 of the reverse complementary chain of SEQ ID NO: 1).

SEQ ID NO: 13 is a protein sequence (Orf 5) encoded by orf5 (nucleotides 6226-6675 of SEQ ID NO: 1).

SEQ ID NO: 14 is a protein sequence (Orf 6) encoded by orf6 (nucleotides 63779-64333 of SEQ ID NO: 1).

SEQ ID NO: 15 is a protein sequence (Orf 7) encoded by orf7 (nucleotides 64290-63853 of the reverse complementary chain of SEQ ID NO: 1).

SEQ ID NO: 16 is a protein sequence (Orf 8) encoded by orf8 (nucleotides 64363-64920 of SEQ ID NO: 1).

SEQ ID NO: 17 is a protein sequence (Orf 9) encoded by orf9 (nucleotides 64727-64287 of the reverse complementary chain of SEQ ID NO: 1).

SEQ ID NO: 18 is a protein sequence (Orf 10) encoded by orf10 (nucleotides 65063-65767 of SEQ ID NO: 1).

SEQ ID NO: 19 is a protein sequence (Orf 11) encoded by orf11 (nucleotides 65874-65008 of the reverse complementary chain of SEQ ID NO: 1).

SEQ ID NO: 20 is a protein sequence (Orf 12) encoded by orf12 (nucleotides 66338-65871 of the reverse complementary chain of SEQ ID NO: 1).

SEQ ID NO: 21 is a protein sequence (Orf 13) encoded by orf13 (nucleotides 66667-67137 SEQ ID NO: 1).

SEQ ID NO: 22 is a protein sequence (Orf 14) encoded by encoded by orf14 (nucleotides 67334-68251 of SEQ ID NO: 1).

SEQ ID NO: 23 is a partial protein sequence (partial Orf 15) encoded by orf15 (nucleotides 68346-68750 of SEQ ID NO: 1).

SEQ ID NO: 24 is a universal reverse sequence (providing synthesis against the course of transcription) of a PCR primer.

SEQ ID NO: 25 represents the sequence of universal "direct" (providing synthesis along the transcription) PCR primer.

SEQ ID NO: 26 is the sequence of the PCR primer "B" of the NH24 end.

SEQ ID NO: 27 is the sequence of the PCR primer "A" of the NH2 end.

SEQ ID NO: 28 represents the sequence of the PCR primer "B" of the NH2 end.

SEQ ID NO: 29 represents the sequence of the PCR primer "B" of the pEPO15-NH6 end.

SEQ ID NO: 30 is the sequence of the PCR primer "A" pEPO15-H2.7 end.

Deposit Information

The following products were deposited with the Agricultural Research Service, Patent Culture Collection (NRRL), 1815 North University Street, Peoria, Illinois 61604, in accordance with the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of the Patent Procedure (the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure). All restrictions on the availability of the deposited product must be irrevocably removed after the grant of a patent.

Deposited product Registration number Date of deposit PEPO15 NRRL B-30033 July 11, 1998 pEPO32 NRRL B-30119 April 16, 1999

DETAILED DESCRIPTION OF THE INVENTION

Genes involved in the biosynthesis of epothilones can be isolated using the methods of the present invention. According to the most preferred procedure for isolating epothilone biosynthesis genes, it is necessary to isolate genomic DNA from an organism identified as a producer of epothilones A and B, and transfer the isolated DNA using suitable plasmids or vectors to a host that normally does not produce polyketide, followed by identification of colonies transformed host, which is given the ability to produce epothilone. Using a technique such as λ :: Tn5 transposon mutagenesis (de Bruijn and Lupski, Gene 27: 131-149 (1984)), a specific transforming region responsible for the synthesis of DNA epothilone can be more accurately determined. In an alternative or additional embodiment, transforming, causing the synthesis of epothilone DNA, can be split into smaller fragments and the smallest of them, which retains the ability to cause the synthesis of epothilone, can be further characterized. While the host organism, deprived of the ability to produce epothilone, may be species other than the organism from which the polyketide is derived, a variation of this method involves the transformation of the DNA of the host of the same host, in which the ability to produce epothilone is impaired by mutagenesis. According to this variant of the method, an epothilone-producing organism is mutated and mutants that are not able to produce epothilone are isolated. Then they are subjected to complementation using genomic DNA isolated from the epothilone-producing parent strain.

Another example of a method that can be used to isolate the genes necessary for epothilone biosynthesis is based on transposon mutagenesis to obtain mutants of the epothilone-producing organism that, after mutagenesis, lose the ability to produce polyketide. For example, the region of the host genome responsible for the production of epothilone is labeled with a transposon, and it can be isolated and used as a probe to isolate native genes from the parent strain. PKS genes that are necessary for the synthesis of polyketides and which are similar to known PKS genes can be isolated on the basis of the homology of their sequence with biosynthesis genes, the sequence of which is known, for example, with rifamycin or sorafen biosynthesis genes. Methods suitable for homology isolation include standard screening of the library by DNA hybridization.

A DNA fragment that can be obtained from a gene or other DNA sequence that plays a role in the synthesis of a known polyketide is preferred for use as a probe molecule. A preferred probe molecule includes a 1.2 kb Smal DNA fragment encoding the ketosyntase domain of the fourth PKS module of sorafen (US Pat. No. 5,716,849), and a more preferred probe molecule includes β-ketoacyl synthase domains from the first and second PKS modules rifamycin (Schupp et al., FEMS Microbiology Letters 159: 201-207 (1998)). They can be used as a probe in the gene library of an epothilone-producing microorganism to isolate the PKS genes responsible for epothilone biosynthesis.

Despite the well-known difficulties associated with the isolation of PKS genes in general, and despite the difficulties that are expected to be associated with the isolation of epothilone biosynthesis genes, in particular, using the methods presented in the present description, it was unexpectedly found that the genes for the biosynthesis of epothilones A and B can be cloned from a polyketide-producing microorganism. Using methods for manipulating genes and producing recombinants as described herein, cloned PKS genes can be modified and expressed in transgenic host organisms.

Isolated epothilone biosynthesis genes can be expressed in heterologous hosts that have the ability to produce polyketide with increased efficiency compared to what would be expected in native hosts. Techniques for such genetic manipulations are specific to the various hosts available and are known in the art. For example, heterologous genes can be expressed in Streptomyces and in other actinomycetes using methods described by McDaniel et al., Science 262: 1546-1550 (1993) and Kao et al., Science 265: 509-512 (1994), both publications incorporated by reference, see also Rowe et al., Gene 216: 215-223 (1998); Holmes et al., EMBO Journal 12 (8); 3183-3191 (1993) and Bibb et al., Gene 38: 215-226 (1985), all publications are incorporated herein by reference.

Alternatively, the genes responsible for the biosynthesis of polyketides, i.e. epothilone biosynthesis genes can also be expressed in other host organisms, such as pseudomonads and E. coli. Techniques for such genetic manipulations are specific to the various hosts available and are known in the art. For example, PKS genes were successfully expressed in E. coli using the pT7-7 vector, which uses the T7 phage promoter (see Tabor et al., Proc. Natl. Acad. Sci. USA 82: 1074-1078 (1985 ), publications are incorporated herein by reference. In addition, pKK.223-3 and pKK.223-2 expression vectors can be used to express heterologous genes in E. coli, either in transcriptional or translational fusion, under the control of a promoter tac or trc. For the expression of operons encoding multiple ORFs, the simplest method is based on embedding the operon in a vector such as p K223-3, in transcriptional fusion, which allows the use of related ribosome binding sites for heterologous genes Overexpression methods in gram-positive species such as Bacillus are also known in the art and can be used according to the present invention (Quax et al., In: Industrial Microorganisms : Basic and Applied Molecular Genetics, ed. Baltz et al., American Society for Microbiology, Washington (1993)).

Other expression systems that can be used with the epothilone biosynthesis genes of the invention include yeast and baculovirus expression systems (see, for example, "The Expression of Recombinant Proteins in Yeasts", Sudbery, PE, Curr. Opin. Biotechnol. 7 (5) : 517-524 (1996); "Methods for Expressing Recombinant Proteins in Yeast, Mackay, et al., Ed .: Carey, Paul R., Protein Eng. Des. 105-153, Publisher: Academic, San Diego, Calif ( 1996); "Expression of heterologous gene products in yeast", Pichuantes et al., Ed .: Cleland, JL, Craik, CS, Protein Eng. 129-161, Publisher: Wiley-Liss, New York, N. Y ( 1996); WO 98/27203; Kealey et al., Proc. Natl. Acad. Sci. USA 95: 505-509 (1998); "Insect Cell Culture: Recent Advances, Bioengineering Challenges And Implications In Protein Production", Palomares, et al.: Galindo, Enri que; Ramirez, Octavio T., Adv. Bioprocess Eng. Vol.II, Invited Pap.Int. Symp., 2nd (1998) 25-52, ed .: Kluwer, Dordrecht, Neth; "Baculovirus Expression Vectors", Jarvis, Donald L., ed: Miller, Lots K., Baculoviruses 389-431, ed .: Plenum, New York, NY (1997); "Production Of Heterologous Proteins Using The Baculovirus / Insect Expression System", Grittiths, et al., Methods Mol. Biol. (Totowa, NJ) 75 (Basic Cell Culture Protocols (2nd ed.) 427-440 (1997); and Insect Cell Expression Technology, Luckow, Verne A., Protein Eng. 183-218, ed .: Wiley -Liss, New York, NY (1996); all of these publications are incorporated herein by reference.

Another important factor for the expression of PKS genes in a heterologous host is the need for enzymes for post-translational modification of PKS enzymes by phosphopantheteinylation before they can synthesize polyketides. However, the enzymes responsible for modifying PKS type I enzymes, phosphopantheteinyl (P-pant) transferases, are not normally present in many hosts, such as E. coli. This problem can be solved by co-expression of P-pant transferase and PKS genes in a heterologous host, as described by Kealey et al., Proc. Natl. Acad. Sci. USA 95: 505-509 (1998), a publication is incorporated herein by reference.

Thus, to obtain polyketides, important criteria for choosing a host organism are the ease of manipulation with it, rapid growth (i.e., fermentation), the presence or suitability of the molecular mechanism for processes such as post-translational modification, and its lack of sensitivity to polyketide overproduction. Most preferred organisms are actinomycetes, such as Streptomyces strains. Other preferred host organisms are Pseudomonads and E. coli. The above methods for producing polyketides have significant advantages compared to the currently known methods used to obtain these compounds. These advantages include significantly lower production costs, the ability to produce large amounts of compounds, and the ability to produce compounds as enantiomers preferred in terms of biological activity, as opposed to racemic mixtures inevitably obtained by organic synthesis. Compounds that are produced by heterologous hosts can be used in medical (for example, for the treatment of cancer in the case of epothilones), as well as in agricultural practice.

experimental part

The invention is further described with reference to the following detailed examples. These examples are given for illustrative purposes only and are not intended to limit in any way the scope of the invention, unless otherwise indicated. The standard recombinant DNA and molecular cloning techniques employed are well known in the art and are described by Ausubel (eds.), Current Protocols in Molecular Biology, John Wiley and Sons, Inc. (1994); T. Maniatis, E. F. Fritsch, and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor laboratory, Cold Spring Harbor, NY (1989); and T.J. Silhavy, M.L. Berman and L.W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984).

Example 1: Cultivation of an Epothilone-producing Sorangium cellulosum strain

The strain Sorangium cellulosum strain 90 (DSM 6773, German collection of microorganisms and cell cultures, Braunschweig (Deutsche Sammlung von Mikroorganismen und Zellkulturen, Braunschweig)) is streaked and grown (30 ° C) on an agar plate in SolE medium (0.35% glucose) 0.05% tryptone, 0.15% MgSO ₄ · 7H ₂ O, 0.05% ammonium sulfate, 0.1% CaCl ₂ , 0.006% K ₂ NRA ₄ , 0.01% sodium dithionate, 0.0008% Fe -EDTA, 1.2% HEPES, 3.5% [v / v] supernatant of a sterilized stationary culture S.cellulosum) pH up to 7.4. Cells were taken from an area of about 1 cm ² and inoculated in 5 ml of G51t liquid medium (0.2% glucose, 0.5% starch, 0.2% tryptone, 0.1% probion S, 0.05% CaCl ₂ · 2H ₂ O, 0.05% MgSO ₄ · H ₂ O, 1.2% HEPES, pH up to 7.4) and incubated at 30 ° C with stirring at a speed of 225 rpm After 4 days, the culture was transferred to 50 ml of G51t medium and incubated under the above conditions for 5 days. This culture was used to inoculate 500 ml of G51t and incubated under the above conditions for 6 days. The culture is centrifuged for 10 min at 4000 rpm and the cell debris is resuspended in 50 ml of G51t medium.

Example 2: Obtaining a library of bacterial artificial chromosome (you)

To obtain a library of you, S.cellulosum cells cultured as described in Example 1 above are introduced into agarose blocks, lysed, and the released genomic DNA is partially digested with HindIII restriction enzyme. The digested DNA is separated on an agarose gel by electrophoresis in alternating current. Large (approximately 90-150 kb) DNA fragments are isolated from the agarose gel and inserted by ligation into the pBelobacII vector. pBelobacII contains a gene encoding resistance to chloramphenicol, a multiple cloning site and the lacZ gene, which allows the selection of blue / white colonies on the appropriate medium, as well as the genes necessary for replication and maintenance of the presence of 1 or 2 copies of the plasmid per cell. A mixture of ligation is used to transform Escherichia coli DH10B electrocompetent cells according to standard electroporation methods. Chloramphenicol-resistant recombinant colonies (white, lacZ mutant) are transferred to a positively charged filter in the form of a 384 3 × 3 format nylon membrane. The colonies are lysed and the crosshair DNA is crosslinked with filters. The same colonies are also stored as liquid cultures at -80 ° C.

Example 3: Screening of the Sorangium cellulosum 90 library of you in the presence of sequences related to type I polyketide synthase

Library filters probe you using standard Southern hybridization. The DNA probes used encode β-ketoacyl synthase domains from the first and second modules of rifamycin polyketide synthase (Schupp et al., FEMS Microbiology Letters 159: 201-207 (1998)). DNA probes were obtained by PCR using primers flanking each ketosynthase domain and plasmid pNE95 as template (pNE95 corresponds to cosmid 2 described by Schupp et al. (1998)). 25 ng of PCR amplified DNA was isolated from a 0.5% agarose gel and tagged with ³² R-dTTP using a random priming labeling kit (Gibco-BRL, Bethesda, Maryland, USA) according to the manufacturer's instructions. Hybridization is carried out at 65 ° C for 36 h and the membranes are washed under stringent conditions (3 times with 0.1 × SSC and 0.5% SDS for 20 min at 65 ° C). The labeled blot is exposed to a phosphorus isotope-sensitive screen and signals are detected using a Phospholmager 445SI device (Molecular Dynamics screen and 445SI device). This procedure results in the hybridization of certain clones of you with probes. These clones were selected and cultured overnight in 5 ml of Luria broth (LB) at 37 ° C. The DNA of you from the clones of interest is isolated using the usual miniprep procedure. Cells are resuspended in 200 μl of lysozyme solution (50 mM glucose, 10 mM EDTA, 25 mM Tris-HCl, 5 mg / ml lysozyme), lysed in 400 μl lysis solution (0.2 N NaOH and 2% SDS), proteins precipitated (3.0 M sodium acetate, the pH of which was adjusted to 5.2 with acetic acid) and DNA is precipitated with isopropanol. DNA was resuspended in 20 μl of nuclease-free distilled water, digested with BamHI (New England Biolabs, Inc.) and separated on a 0.7% agarose gel. The gel is blotted with Southern hybridization as described above and probed under the conditions described above using a 1.2 kb SmaI DNA fragment as a probe that encodes the ketosyntase domain in the fourth sorafen polyketide synthase module (see US patent 5716849). Five different hybridization patterns were discovered. One clone characteristic of each of the five schemes is selected and designated as pEPO15, pEPO20, pEPO30, pEPO31 and pEPO33, respectively.

Example 4: Subcloning of BamHI fragments from pEPO15, pEPO20, pEPO30, pEPO31 and pEPO33

The DNA of the five selected clones is cleaved with BamHI and random fragments are subcloned into pBluescript II SK + (Stratagene) at the BamHI site. Subclones carrying inserts ranging in size from 2 to 10 kb are selected for sequencing of the flanking ends of the inserts and also probed with a 1.2 kb Smal probe as described above. Subclones for which a high level of sequence homology with known polyketide synthases and / or a high level of hybridization with the sorafen ketosynthase domain is found are used for gene disruption experiments.

Example 5: Preparation of streptomycin-resistant random mutants of the strain Sorangium cellulosum So ce90

0.1 ml of a three-day culture of Sorangium cellulosum So ce90 strain grown in liquid medium (0.2% yeast extract, 0.2% fat-free soy flour, 0.8% potato starch, 0.2% glucose, 0.1% MgSO ₄ · 7H ₂ O, 0.1% CaCl ₂ · 2H ₂ O, 0.008% Fe-EDTA, pH up to 7.4 with KOH), seeded on agar plates with SolE medium supplemented with 100 μg / ml streptomycin. The plates are incubated at 30 ° C for 2 weeks. The colonies grown on this medium are streptomycin-resistant mutants that are streaked and re-cultured on the same agar medium with streptomycin for purification. One of these streptomycin-resistant mutants was selected and designated as ALL28 / 2.

Example 6: Disruption of genes in Sorangium cellulosum BCE28 / 2 using subcloned BamHI fragments

BamHI inserts from subclones obtained, as described above, from five selected You clones, are isolated and inserted by leading to the unique BamHI site of plasmid pCIB132 (see, US Pat. No. 5,716,849). The pCIB132 derivatives bearing the inserts transform the Escherichia coli strain ED8767 containing the helper plasmid pUZ8 (Hedges and Matthew, Plasmid 2: 269-278 (1979). Transformants are used as donors in conjugation experiments using Sorangium / cellulosum 2 2 recipients as recipients For conjugation of 5-10 × 10 ⁹ Sorangium cellulosum BCE28 / 2 cells from a culture in the early stationary phase (at a concentration of approximately 5 × 10 ⁸ cells / ml) grown at 30 ° C in G51b liquid medium (G51b corresponds to medium G51t, in which tryptone is replaced by peptone), mixed at a ratio and 1: 1 cells with a late logarithmic culture (in LB liquid medium) of E. coli strain ED8767 containing pCIB132 derivatives that carry subcloned BamHI fragments and helper plasmid pUZ8, then mixed cells are centrifuged at 4000 rpm for 10 min and resuspended in 0.5 ml of G51b medium.This cell suspension is then added dropwise to the center of the Sol plate with E-agar containing 50 mg / l kanamycin. The cells obtained after incubation for 24 hours at 30 ° C are collected and resuspended in 0.8 ml of G51bd medium and 0.1-0.3 ml of this suspension are placed on solid SolE selection medium that contains phleomycin (30 mg / l), streptomycin (300 mg / l) and kanamycin (50 mg / l). Counter-selection of the donor strain Escherichia coli occurs when streptomycin is added. Colonies that grow on this selection medium after incubation for 8-12 days at a temperature of 30 ° C are isolated using a plastic loop and streaked and cultured on the same agar medium for a second selection and purification cycle. Colonies obtained from cultures that grow on this agar medium for selection after incubation for 7 days at a temperature of 30 ° C are transconjugates with the strain Sorangium cellulosum BCE28 / 2, which has acquired resistance to phleomycin as a result of transfer through conjugation of pCIB132 derivatives, bearing subcloned BamHI fragments.

The integration of plasmids obtained from pCIB132 into the Sorangium cellulosum BCE28 / 2 chromosome by homologous recombination is confirmed by Southern hybridization. For this experiment, the total DNA of their 5-10 transconjugates per 1 transferred BamHI fragment (from 10 ml of cultures grown in G52-H medium for 3 days) was isolated using the method described by Pospiech and Neumann, Trends Genet. 11: 217 (1995). For Southern blotting, the DNA isolated as described above was digested with BglII, ClaI or NotI restriction enzymes and the corresponding BamHI inserts or pCIB132 were used as ³² P-labeled probes.

Example 7: Analysis of the impact of integrated BamHI fragments on the production of Sorangium cellulosum epothilone after gene destruction

Transconjugate cells grown on about 1 cm ^{2 of the} surface of the plates with SolE selection medium in the second selection cycle (see Example 6) are transferred using a sterile plastic loop in 10 ml of G52-H medium to a 50 ml Erlenmeyer flask. After incubation at 30 ° C and 180 rpm for 3 days, the culture is transferred into 50 ml of G52-H medium into a 200 ml Erlenmeyer flask. After incubation at 30 ° C and 180 rpm for 4-5 days, 10 ml of this culture is transferred to 50 ml of 23B3 medium (0.2% glucose, 2% potato starch, 1.6% fat-free soy flour, 0.0008 % Fe-EDTA, sodium salt, 0.5% HEPES (4- (2-hydroxyethyl) piperazine-1-ethanesulfonic acid), 2 vol.% XAD16 polystyrene resin (Rohm and Haas), pH adjusted to 7.8 using NaOH) into a 200 ml Erlenmeyer flask.

Quantitative determination of the production of epothilone is carried out after incubation of cultures at 30 ° C and 180 rpm for 7 days. The complete culture broth is filtered under vacuum through a nylon filter with a pore size of 150 μm. The resin remaining on the filter is then resuspended in 10 ml of isopropanol and extracted by shaking the suspension at 180 rpm for 1 h. 1 ml is taken from this suspension and centrifuged at 12000 rpm on an Eppendorf microcentrifuge. The number of epothilones A and B in it is determined by HPLC and detected at 250 nm using a UV-DAD type detector (HPLC on a Waters-Symetry C18 column and in a gradient of 0.02% phosphoric acid from 60% to 0% and acetonitrile from 40% to 100%).

Transconjugates with three different integrated BamHI fragments, subcloned from pEPO15, i.e. transconjugates with a BamHI fragment of plasmid pEPO15-21, transconjugates with a BamHI fragment of plasmid pEPO15-4-5 and transconjugates with a BamHI fragment of plasmid pEPO15-4-1, are tested by the method described above. HPLC analysis showed that all transconjugates could no longer produce epothilone A or B. In contrast, epothilone A and B were found at a concentration of 2-4 mg / L in transconjugates with BamHI fragments obtained from pEPO20, pEPO30, pEPO31, pEPO33, in the parent strain ALL28 / 2.

Example 8: Determination of the nucleotide sequence of cloned fragments and the construction of sets of sequences of fragments

A. BamHI insert of plasmid pEPO15-21

Plasmid DNA was isolated from Escherichia coli strain DH10B [pEPO15-21] and the nucleotide sequence of the BamHI insert of 2.3 kb was determined. in pERO15-21. Automatic DNA sequencing is carried out using a double-stranded DNA matrix as a method based on breaking the dideoxynucleotide chain using Sequencers Applied Biosystems, model 377. The primers used are a universal “reverse” primer (5'-GGA AAC AGC TAT GAC CAT G-3 '( SEQ ID NO: 24)) and a universal “direct” primer (5'-GTA AAA CGA CGG CCA GT-3 '(SEQ ID NO: 25)). In subsequent sequences of sequencing reactions, the oligonucleotides synthesized in the usual way designed for the 3 ′ ends of previously defined sequences are used to extend and join sets of fragment sequences. Both chains are fully sequenced and each nucleotide is sequenced at least twice. The nucleotide sequence is compiled using Sequencher vers. 3.0 (Gene Codes Corporation) and analyzed using programs developed by the University of Wisconsin's genetic computer group (University of Wisconsin Genetics Computer Group). The nucleotide sequence of the insert size of 2213 base pairs corresponds to nucleotides 20779-22991 SEQ ID NO: 1.

B. BamHI insert of plasmid pEPO15-4-1

Plasmid DNA was isolated from Escherichia coli strain DH10B [pEP015-4-1] and the nucleotide sequence of the BamHI insert 3.9 kbp. in pEPO15-4-1 is determined as described above in section (A). The nucleotide sequence of the insert size of 3909 base pairs corresponds to nucleotides 16876-20784 SEQ ID NO: 1.

B. BamHI insert of plasmid pEPO15-4-5

Plasmid DNA was isolated from Escherichia coli strain DH10B [pEPO15-4-5] and the nucleotide sequence of the 2.3 kb BamHI insert in pEPO15-4-5 was determined as described above in section (A). The nucleotide sequence of the insert size of 2233 base pairs corresponds to nucleotides 42528-44760 SEQ ID NO: 1.

Example 9: Subcloning and location of DNA fragments of plasmid pEPO15 containing epothilone biosynthesis genes

pEPO15 was completely digested with HindIII restriction enzyme and the resulting fragments were subcloned into pBluescript II SK- or pNEB193 (New England Biolabs), previously digested with HindIII and dephosphorylated with alkaline phosphatase from the calf intestine. Get 6 different clones, which are designated as pEPO15-NH1, pEPO15-NH2, pEPO15-NH6, pEPO15-NH24 (the basis of all is pNEB193) and pEPO15-H2.7 and pEP015-H3.0 (the basis of both is pBluescript II SK-) .

The pERO15-21 BamHI insert was isolated and labeled with DIG (Boehringer Mannheim non-radioactive labeling and DNA detection system) and used as a probe in DNA hybridization experiments under stringent conditions with pEPO15-NH1, pEPO15-NH2, pEPO15-NH6, pEPO15-NH24, pEPO15-H2.7 and pEPO15-H3.0. A strong hybridization signal was detected for pEPO15-NH24, indicating that pEPO15-21 is contained within pEPO15-NH24.

The bamHI insert pEPO15-4-1 was isolated and labeled with DIG as described above, and used as a probe in DNA hybridization experiments under stringent conditions with pEPO15-NH1, pEPO15-NH2, pEPO15-NH6, pEPO15-NH24, pEPO15 -H2.7 and pERO15-H3.0. Strong hybridization signals were detected for pEPO15-NH24 and pEPO15-H2.7. The nucleotide sequence data obtained for one of the ends of each clone pEPO15-NH24 and pEPO15-H2.7 are also completely consistent with the data on the structure of the previously determined sequence of the BamHI insert pEPO15-4-1. These experiments indicate that pEPO15-4-1 (which contains one internal HindIII site) overlaps pEPO15-H2.7 and pEPO15-NH24 and that pEPO15-H2.7 and pEPO15-NH24 are adjacent in location.

The bamHI insert pEPO15-4-5 was isolated and labeled with DIG as described above, and used as a probe in DNA hybridization experiments under stringent conditions with pEPO15-NH1, pEPO15-NH2, pEPO15-NH6, pEPO15-NH24, pEPO15 -H2.7 and pERO15-H3.0. A strong hybridization signal was detected for pEPO15-NH2, indicating that pEPO15-21 is contained within pEPO15-NH2.

Nucleotide sequence data is obtained for both ends of pEPO15-NH2 and for the end of pEPO15-NH24, which does not overlap pEPO15-4-1. Based on these sequences, PCR primers are created, i.e. “B” for the NH24 end: GTGACTGGCGCCTGGAATCTGCATGAGC (SEQ ID NO: 26), “A” for the NH2 end: AGCGGGAGCTTGCTAGACATTCTGTTTC (SEQ ID NO: 27), and “B” for the NH2 end: GACGCGCCCGGGA 28CCA GCCA ), designated relative to HindIII sites, and are used in amplification reactions using pEPO15, and in other experiments using Sorangium cellulosum So ce90 genomic DNA as matrices. Specific amplification was detected using a pair of primers “B” for the NH24 end and “A” for the NH2 end with both matrices. The amplification fragments (amplimers) are cloned into pBluescript II SK- and completely sequenced. The sequences of the amplified fragments are identical and also fully correspond to the ends of the sequences pEPO15-NH24 and pEPO15-NH2 fused to the HindIII site, which indicates that the HindIII fragments of pEPO15-NH2 and pEPO15-NH24 are adjacent in their arrangement.

The HmdIII insert of pEPO15-H2.7 was incubated and labeled with DIG as described above and used as a probe in DNA hybridization experiments under stringent conditions with pEP015 digested with NotI. For a NotI fragment of approximately 9 kbp strong hybridization was detected and then subcloned into pBluescript II SK-, previously cleaved with NotI and dephosphorylated with alkaline phosphatase from the calf intestine, obtaining pEPO15-N9-16. The NotI insert pEPO15-N9-16 was isolated and labeled with DIG as described above and used as a probe in DNA hybridization experiments under stringent conditions with pEPO15-NH1, pEPO15-NH2, pEPO15-NH6, pEPO15-NH24, pEPO15 -H2.7 and pERO15-H3.0. Strong hybridization signals were detected for pEPO15-NH6, and also, as expected, for the clones pEPO15-H2.7 and pEPO15-NH24. Nucleotide sequence data is obtained for both ends of pEPO15-NH6 and for the end of pEPO15-H2.7, which does not overlap pEPO15-4-1. The PCR primers designated relative to the HindIII sites were constructed and used for amplification reactions using pEPO15, and in other experiments using Sorangium cellulosum So ce90 genomic DNA as templates. Specific amplification was detected using a pair of primers “B” for the pEPO15-NH6 end: CACCGAAGCGTCGATCTGGTCCATC (SEQ ID NO: 29) and “A” for the pEPO15-H2.7 end: CGGTCAGATCGACGACGGGCCTTTCC (SEQ ID NO: 30). Amplified fragments are cloned into Bluescript II SK and completely sequenced. The sequences of the amplified fragments are identical and also fully correspond to the ends of the sequences pEPO15-NH6 and pEPO15-H2.7 fused to the HindIII site, which indicates that the HindIII fragments of pEPO15-NH6 and pEPO15-H2.7 are adjacent in their arrangement.

All these experiments, taken together, allow us to determine the set of sequences of HindIII fragments, covering an area of approximately 55 kbp. and consisting of HindIII inserts pEPO15-NH6, pEPO15-H2.7, pEPO15-NH24 and pEPO15-NH2 arranged in this order. The inserts of the two remaining HindIII subclones, i.e. pEPO15-NH1 and pEPO15-H3.0 are not part of this set of fragment sequences.

Example 10: Additional lengthening of the subclone of the set of sequence of fragments that overlap the genes of epothilone biosynthesis

BamHI - HindIII fragment obtained from the transcriptional end of the pEPO15-NH2 insert and, thus, representing the transcriptional end of the subclone of the sequence of fragments described in Example 9, isolated, labeled with DIG and used in experiments on Southern hybridization with pEPO15 and pEPO15-NH2 DNA digested with several enzymes. In all cases, strongly hybridizing bands have the same size for two target DNAs, which indicates that the Sorangium cellulosum So ce90 genomic DNA fragment cloned into pEPO15 ends with the HindIII site at the transcriptional end of pEPO15-NH2.

Using conventional procedures, a cosmid DNA library of Sorangium cellulosum So ce90 is created in pScosTriplex-II (Ji et al., Genomics 31: 185-192 (1996)). Briefly, the method consists in the following: the high molecular weight genomic DNA of Sorangium cellulosum So ce90 is partially digested with the restriction enzyme Sau3AI to obtain fragments with an average size of about 40 kb and inserted by ligation into the pScosTriplex-II plasmid digested with BamHI and XbaI. The ligation mixture was packaged in Gigapack III XL (Stratagene) and used to transfect E. coli XL1 Blue MR cells.

The cosmid library was screened using a BamHI-HindIII fragment of approximately 2.2 kbp obtained from the downstream end of the pEPO15-NH2 insert as a colony hybridization probe. A clone was selected for which a strong hybridization signal, designated pEPO4E7, was detected.

The pEPO4E7 clone DNA was isolated, digested with restriction enzymes and probed in a Southern hybridization experiment using a 2.2 kb BamHI-HindIII fragment. A 9 kb Notl fragment was selected for which a strong hybridization signal was detected, and subcloned into pBluescript II SK- to give pEPO4E7-N9-8. Additional experiments using Southern hybridization indicate that the Notl insert is approximately 9 kb in size. pEPO4E7-N9-8 overlaps the NotI - HindIII fragment with a length of over 6 kb. pEPO15-NH2, while the remaining HindIII - NotI fragment of approximately 3 kbp was expected to overlap the subclone of the sequence of fragments described in Example 9. However, the final sequencing showed that pEPO4E7 located along the transcription The -N9-8 insert contains a BamHI-NotI-polylinker pScosTriplex-II, which indicates that the pEP04E7 genomic DNA insert ends in the Sau3AI saiga inside the HindIII-NotI extension fragment and that the NotI site is derived from pScosTriplex-II.

PstI is a SalI fragment of about 1.6 kb in size, derived from an extension of HindIII - NotI is a subfragment of about 3 kb. pEPO4E7-N9-8, which contains only sequences without a vector derived from Sorangium cellulosum So ce90, is used as a probe for the bacterial artificial chromosome library described in Example 2. In addition to the previously isolated clone EPO15, it was found that you clone designated EPO32 hybridizes strongly with the probe. pEPO32 is isolated, digested using several restriction enzymes and hybridized with a PstI-SalI probe of approximately 1.6 kbp. HindIII was found to be an EcoRV fragment of approximately 13 kbp. gives a strong hybridization signal to the probe and is subcloned into pBluescript II SK-, digested with HindIII and Hindi to give pEPO32-HEV15.

Oligonucleotide primers are constructed based on the transposed pEPO15-NH2 end sequence and the upstream transcriptional (HindIII) end sequence obtained from pEPO32-HEV15 and used in sequencing reactions with pEPO4E7-N9-8 as a template. The sequences make it possible to detect the presence of a small HindIII fragment (EPO4E7-H0.02) of 24 base pairs, which could not be detected using standard restriction assays separating the HindIII site at the upstream end of pEPO15-NH2 from the HindIII site at the opposite end transcription end pEPO32-HEV15.

Thus, the subclone of the sequence of fragments described in Example 9 is extended, including the HindIII fragment of EPO4E7-H0.02 and the pEPO32-HEV15 insert, as a result of which it contains the inserts: pEPO15-NH6, pEPO15-H2.7, pEPO15- NH24, pEPO15-NH2, EPO4E7-H0.02 and pEPO32-HEV15, arranged in this order.

Example 11: Determination of the nucleotide sequence of a subclone of a set of fragment sequences that overlap the epothilone biosynthesis genes

The nucleotide sequences of the subclone of the sequence of fragments described in example 10 are determined as follows:

pEPO15-H2.7. Plasmid DNA was isolated from the Escherichia coli strain DH10B [pEPO15-H2.7] and the nucleotide sequence of the BamHI insert in pEPO15-H2.7 of 2.7 kb was determined. Automatic DNA sequencing is carried out using a double-stranded DNA matrix as a method based on breaking the dideoxynucleotide chain using Sequencers Applied Biosystems, model 377. The primers used are a universal “reverse” primer (5'-GGA AAC AGC TAT GAC CAT G-3 '( SEQ ID NO: 24)) and a universal “direct” primer (5'-GTA AAA CGA CGG CCA GT-3 '(SEQ ID NO: 25)). In subsequent sequences of sequencing reactions, the oligonucleotides synthesized in the usual way designed for the 3 ′ ends of previously defined sequences are used to extend and join sets of fragment sequences.

pEPO15-NH6, pEPO15-NH24 and pEPO15-NH2. HmdIII - inserts of these plasmids are isolated and randomly fragmented using a Hydroshear device (Genomic Instrumentation Services, Inc.) to obtain fragments with an average size of 1-2 kb. The ends of the fragments are repaired using T4 phage DNA polymerase and Klenov DNA polymerase in the presence of deoxynucleotide triphosphates and phosphorylated using T4 phage DNA kinase in the presence of ribo-ATP. Fragments ranging in size from 1.5 to 2.2 kb isolated from agarose gels and inserted by ligation into the pBluescript II SK- vector, pre-digested with EcoRV and dephosphorylated. Arbitrary subclones are sequenced using universal “reverse” and universal “forward” primers.

pEPO32-HEV15. pEPO32-HEV15 was digested with HindIII and SspI and a fragment of approximately 13.3 kbp was isolated which contains the HindIII - EcoRV insert from So. cellulosum So ce90 ~ 13 kbp, and Hindi - SspI - a fragment from pBluescript II SK - 0.3 kbp. and partially digested with HaeIII to give fragments whose average size is 1-2 kb. Fragments of 1.5-2.2 kbp isolated from agarose gels and inserted by ligation into the Bluescript II SK- vector, pre-digested with EcoRV and desforylated. Arbitrary subclones are sequenced using universal “reverse” and universal “forward” primers.

Chromatograms are analyzed and combined into sets of fragment sequences using the programs Phred, Phrap and Consed (Ewing et al., Genome Res. 8 (3); 175-185 (1998); Ewing et al., Genome Res. 8 (3): 186-194 (1998); Gordon et al., Genome Res. 8 (3): 195-202 (1998)). Gaps in the sets of sequences of fragments are filled, conflicting sequences are split, and regions for which insufficiently reliable data are obtained are re-sequenced using oligonucleotide primers designed in the usual way for sequencing either the original subclones or clones selected from random subclone libraries. Both chains are completely sequenced and each base pair is characterized by at least a minimum generalized Fred score of Phred equal to 40 (significance level 99.99%).

The nucleotide sequence of the sequence sequence of fragments of 68,750 base pairs is presented in SEQ ID NO: 1.

Example 12: Analysis of the nucleotide sequence of the epothilone biosynthesis genes

It is established that SEQ ID NO: 1 contains 22 ORF, which is presented in detail below in table 1:

Table 1 ORF Start codon Stop codon Homology derived protein Estimated Protein Function Orf1 out of sequence range 1826 orf2 * 3171 1900 Hypothetical protein SP: Q11037; DD peptidase SP: P15555 orf3 3415 5556 Na / H Antiporter PID: D1017724 transport orf4 * 5992 5612 orf5 6226 6675 epoA 7610 11875 polyketide synthase type I Epothilone synthase: thiazole ring formation epoP 11872 16104 non-ribosomal acid-amino acid ligase Epothilone synthase: thiazole ring formation epoB 16251 21749 polyketide synthase type I Epothilone synthase: polyketide scaffold formation epoC 21746 43519 polyketide synthase type I Epothilone synthase: polyketide scaffold formation epoD 43524 54920 polyketide synthase type I Epothilone synthase: polyketide scaffold formation epoE 54935 62254 polyketide synthase type I Epothilone synthase: polyketide scaffold formation epoF 62369 63628 cytochrome P450 Epothilone Macrolactic Oxidase orf6 63779 64333 orf7 * 64290 63853 orf8 64363 64920

ORF Start codon Stop codon Homology derived protein Estimated Derived Protein Function orf9 * 64727 64287 orf10 65063 65767 orf11 * 65874 65008 orf12 * 66338 65871 orf13 66667 67137 orf14 67334 68251 hypothetical protein GI: 3293544; cation exit system protein GI: 2623026 transport orf15 68346 out of sequence range * On the reverse circuit complementary. Numbering according to SEQ ID NO: 1.

eroA (nucleotides 7610-11875 SEQ ID NO: 1) encodes EPOS A (SEQ ID NO: 2), a type I polyketide synthase consisting of one module and bearing the following domains: β-ketoacyl synthase (KS) (nucleotides 7643-8920 SEQ ID NO: 1, amino acids 11-437 SEQ ID NO: 2); acyltransferases (AT) (nucleotides 9236-10201 SEQ ID NO: 1, amino acids 543-864 SEQ ID NO: 2); enoyl reductases (ER) (nucleotides 10529-11428 SEQ ID NO: 1, amino acids 974-1273 SEQ ID NO: 2) and a domain homologous to the domain of the acyl carrier protein (ACP) (nucleotides 11549-11764 SEQ ID NO: 1, amino acids 1314 -1385 SEQ ID NO: 2). Comparison of sequences and analysis of motifs (Haydock et al. FEBS Lett. 374: 246-248 (1995); Tang et al., Gene 216: 255-265 (1998)) suggests that AT encoded by EPOS A is malonyl -COA-specific. EPOS A should be included in the initiation of epothilone biosynthesis by introducing an acetate unit into the multienzyme complex, which should eventually form part of the 2-methylthiazole ring (C26 and C20).

epop (nucleotides 11872-16104 SEQ ID NO: 1) encodes EPOS P (SEQ ID NO: 3), a non-ribosomal acid-amino acid ligase containing one module. EPOS P carries the following domains:

- peptide bond formation domain corresponding to motive K (amino acids 72-81 [FPLTDIQESY] SEQ ID NO: 3, corresponding to nucleotides 12085-12114 SEQ ID NO: 1); L motif (amino acids 118-125 [VVARHDML] SEQ ID NO: 3, corresponding to nucleotides 12223-12246 SEQ ID NO: 1); motive M (amino acids 199-212 [SIDLINVDLGSLSI] SEQ ID NO: 3, corresponding to nucleotides 12466-12507 SEQ ID NO: 1), and motive O (amino acids 353-363 [GDFTSMVLLDI] SEQ ID NO: 3, corresponding to nucleotides 12928-12960 SEQ ID NO: 1);

- the formation domain of aminoacyl adenylate corresponding to motive A (amino acids 549-565 [LTYEELSRRSRRLGARL] SEQ ID NO: 3, corresponding to nucleotides 13516-13566 SEQ ID NO: 1); motive B (amino acids 588-603 [VAVLAVLESGAAYVPI] SEQ ID NO: 3, corresponding to nucleotides 13633-13680 SEQ ID NO: 1); motive C (amino acids 669-684 [AYVIYTSGSTGLPKGV] SEQ ID NO: 3 corresponding to nucleotides 13876-13923 of SEQ ID NO: 1); motif D (amino acids 815-821 [SLGGATE] SEQ ID NO: 3, corresponding to nucleotides 14313-14334 SEQ ID NO: 1); motive E (amino acids 868-892 [GQLYIGGVGLALGYWRDEEKTRKSF] SEQ ID NO: 3, corresponding to nucleotides 14473-14547 SEQ ID NO: 1); motif F (amino acids 903-912 [YKTGDLGRYL] SEQ ID NO: 3, corresponding to nucleotides 14578-14607 SEQ ID NO: 1); motif G (amino acids 918-940 [EFMGREDNQIKLRGYRVELGEIE] SEQ ID NO: 3 corresponding to nucleotides 14623-14692 SEQ ID NO: 1); motive H (amino acids 1268-1274 [LPEYMVP] SEQ ID NO: 3, corresponding to nucleotides 15673-15693 SEQ ID NO: 1), and motive I (amino acids 1285-1297 [LTSNGKVDRKALR] SEQ ID NO: 3, corresponding to nucleotides 15724-15762 SEQ ID NO: 1);

- an unknown domain inserted between the G and H motifs of the aminoacyladenylate formation domain (amino acids 973-1256 of SEQ ID NO: 3 corresponding to nucleotides 14788-15639 of SEQ ID NO: 1); and

- a domain homologous to the domain of the peptidyl carrier protein (PCP) corresponding to motive J (amino acids 1344-1351 [GATSIHIV] SEQ ID NO: 3, corresponding to nucleotides 15901-15924 of SEQ ID NO: 1).

EPOS P is believed to be involved in the activation of cysteine by adenylation, the binding of activated cysteine as aminoacyl-S-PCP, the formation of a peptide bond between the linked cysteine enzyme and acetyl-S-ACP supplied by EPOS A, and the formation of an initial thiazoline ring via intramolecular heterocyclization . The unknown EPOS P domain has very weak homologies with NAD (P) H oxidases and reductases of Bacillus species. Thus, the unknown domain and / or ER domain of EPOS A can be involved in the oxidation of the initial 2-methylthiazoline ring to form 2-methylthiazole.

EPOB (nucleotides 16251-21749 SEQ ID NO: 1) encodes EPOS B (SEQ ID NO: 4), a type I polyketide synthase consisting of one module and bearing the following domains: KS (nucleotides 16269-17546 SEQ ID NO: 1, amino acids 7-432 of SEQ ID NO: 4); AT (nucleotides 17865-18827 SEQ ID NO: 1, amino acids 539-859 SEQ ID NO: 4); dehydratase (DH) (nucleotides 18855-19361 of SEQ ID NO: 1, amino acids 869-1037 of SEQ ID NO: 4); β-ketoreductases (KR) (nucleotides 20565-21302 SEQ ID NO: 1, amino acids 1439-1684 SEQ ID NO: 4) and ACP (nucleotides 21414-21626 SEQ ID NO: 1, amino acids 1722-1792 SEQ ID NO: 4) . Comparison of sequences and analysis of motifs indicates that AT encoded by EPOS A is methylmalonyl-CoA-specific. EPOS A may be involved in the first extension of the polyketide chain by catalysis of condensation such as the Kleisen reaction of the parent group, i.e. 2-methyl-4-thiazolecarboxyl-S-PCP, with methylmalonyl-S-ACP and subsequent reduction of the C17 b-keto group to enoyl.

epoC (nucleotides 21746-43519 SEQ ID NO: 1) encodes EPOS C (SEQ ID NO: 5), a type I polyketide synthase consisting of 4 modules. The first module carries KS domains (nucleotides 21860-23116 of SEQ ID NO: 1, amino acids 39-457 of SEQ ID NO: 5); malonyl-CoA specific AT (nucleotides 23431-24397 SEQ ID NO: 1, amino acids 563-884 SEQ ID NO: 5); KR (nucleotides 25184-25942 SEQ ID NO: 1, amino acids 1147-1399 SEQ ID NO: 5) and ACP (nucleotides 26045-26263 SEQ ID NO: 1, amino acids 1434-1506 SEQ ID NO: 5). This module includes an acetate extension unit (C14-C13) and restores the β-keto group at position C15 to form a hydroxyl group that takes part in the final lactonization of the macrolactone ring of the epothilone. The second EPOS C module carries KS domains (nucleotides 26318-27595 SEQ ID NO: 1, amino acids 1524-1950 SEQ ID NO: 5); malonyl-CoA-specific AT (nucleotides 27911-28876 SEQ ID NO: 1, amino acids 2056-2377 SEQ ID NO: 5); KR (nucleotides 29678-30429 SEQ ID NO: 1, amino acids 2645-2895 SEQ ID NO: 5) and ACP (nucleotides 30539-30759 SEQ ID NO: 1, amino acids 2932-3005 SEQ ID NO: 5). This module includes an acetate extension unit (C12-C11) and restores the β-keto group at position C13 to form a hydroxyl group. Thus, the resulting polyketide chain of epothilone corresponds to epothilone A, and the inclusion of a methyl side chain at position C12 in epothilone B requires the presence of C-methyltransferase activity after exposure to PKS. The formation of an epoxy ring at positions C13-C12 also requires an oxidation step after exposure to PKS. The third EPOS C module carries KS domains (nucleotides 30815-32092 SEQ ID NO: 1, amino acids 3024-3449 SEQ ID NO: 5); malonyl-CoA-specific AT (nucleotides 32408-33373 SEQ ID NO: 1, amino acids 3555-3876 SEQ ID NO: 5); DH (nucleotides 33401-33889 SEQ ID NO: 1, amino acids 3886-4048 SEQ ID NO: 5); ER (nucleotides 35042-35902 SEQ ID NO: 1, amino acids 4433-4719 SEQ ID NO: 5); KR (nucleotides 35930-36667 SEQ ID NO: 1, amino acids 4729-4974 SEQ ID NO: 5) and ACP (nucleotides 36773-36991 SEQ ID NO: 1, amino acids 5010-5082 SEQ ID NO: 5). This module includes an acetate extension unit (C10-C9) and completely restores the β-keto group at position C11. The fourth EPOS C module carries KS domains (nucleotides 37052-38320 SEQ ID NO: 1, amino acids 5103-5525 SEQ ID NO: 5); methylmalonyl-CoA-specific AT (nucleotides 38636-39598 SEQ ID NO: 1, amino acids 5631-5951 SEQ ID NO: 5); DH (nucleotides 39635-40141 SEQ ID NO: 1, amino acids 5964-6132 SEQ ID NO: 5); ER (nucleotides 41369-42256 SEQ ID NO: 1, amino acids 6542-6837 SEQ ID NO: 5); KR (nucleotides 42314-43048 SEQ ID NO: 1, amino acids 6857-7101 SEQ ID NO: 5) and ACP (nucleotides 43163-43378 SEQ ID NO: 1, amino acids 7140-7211 SEQ ID NO: 5). This module includes a propionate extension unit (C24 and C8-C7) and completely restores the β-keto group at position C9.

epoD (nucleotides 43524-54920 SEQ ID NO: 1) encodes EPOS D (SEQ ID NO: 6), a type I polyketide synthase consisting of 2 modules. The first module carries KS domains (nucleotides 43626-44885 SEQ ID NO: 1, amino acids 35-454 SEQ ID NO: 6); methylmalonyl-CoA-specific AT (nucleotides 45204-46166 SEQ ID NO: 1, amino acids 561-881 SEQ ID NO: 6); KR (nucleotides 46950-47702 SEQ ID NO: 1, amino acids 1143-1393 SEQ ID NO: 6) and ACP (nucleotides 47811-48032 SEQ ID NO: 1, amino acids 1430-1503 SEQ ID NO: 6). This module includes a propionate extension unit (C23 and C6-C5) and restores the β-keto group at position C7 to form a hydroxyl group. The second module carries the KS domains (nucleotides 48087-49361 of SEQ ID NO: 1, amino acids 1522-1946 of SEQ ID NO: 6); methylmalonyl-CoA-specific AT (nucleotides 49680-50642 SEQ ID NO: 1, amino acids 2053-2373 SEQ ID NO: 6); DH (nucleotides 50670-51176 SEQ ID NO: 1, amino acids 2383-2551 SEQ ID NO: 6); methyltransferases (MT, nucleotides 51534-52657 SEQ ID NO: 1, amino acids 2671-3045 SEQ ID NO: 6); KR (nucleotides 53697-54431 SEQ ID NO: 1, amino acids 3392-3636 SEQ ID NO: 6) and ACP (nucleotides 54540-54758 SEQ ID NO: 1, amino acids 3673-3745 SEQ ID NO: 6). This module includes a propionate extension unit (C21 or C22 and C4-C3) and restores the β-keto group at position C5 to form a hydroxyl group. This recovery is somewhat unexpected, since the epothilones contain a keto group at position C5. However, this type of mismatch between the predicted reduction ability of the PKS modules and the reduction-oxidation status of the corresponding positions in the final polyketide products is known from the literature (see, for example, Schwecke et al., Proc. Natl. Acad. Sci. USA 92: 7839-7843 ( 1995) and Schupp et al., FEMS Microbiology Letters 159: 201-207 (1998)). An important feature of epothilones is the presence of hemethyl side groups at position C4 (C21 and C22). The second EPOS D module probably incorporates a propionate unit into the growing polyketide chain, providing one methyl side chain at position C4. This module also contains the methyltransferase domain integrated into the PKS between the DH and KR domains in an orientation similar to that found for yersiniabactin synthase HMWP1 (Gehring AM, DeMoll E., Fetherston JD, Mori I., Mayhew GF, Blattner FR, Walsh CT and Perry , RD: Iron acquisition in plague: modular logic in enzymatic biogenesis of yersiniabactin by Yersinia pestis. Chem. Biol. 5, 573-586, 1998). This MT domain in EPOS D is probably responsible for the inclusion of a second methyl side group (C21 or C22) at position C4.

EPOE (nucleotides 54935-62254 SEQ ID NO: 1) encodes EPOS E (SEQ ID NO: 7), a type I polyketide synthase consisting of one module bearing KS domains (nucleotides 55028-56284 SEQ ID NO: 1, amino acids 32 -450 SEQ ID NO: 7); malonyl-CoA specific AT (nucleotides 56600-57565 SEQ ID NO: 1, amino acids 556-877 SEQ ID NO: 7); DH (nucleotides 57593-58087 SEQ ID NO: 1, amino acids 887-1051 SEQ ID NO: 7); probably not a functionally active ER (nucleotides 59366-60304 SEQ ID NO: 1, amino acids 1478-1790 SEQ ID NO: 7); KR (nucleotides 60362-61099 SEQ ID NO: 1, amino acids 1810-2055 SEQ ID NO: 7), ACP (nucleotides 61211-61426 SEQ ID NO: 1, amino acids 2093-2164 SEQ ID NO: 7) and thioesterase (TE) (nucleotides 61427-62254 of SEQ ID NO: 1, amino acids 2165-2439 of SEQ ID NO: 7). The ER domain in this module carries the site motif with some completely unusual amino acid substitutions, which probably makes this domain inactive. The module includes an acetate extension unit (C2-C1) and restores the β-keto group at position C3 with the formation of an enoyl group. Epothilones contain a hydroxyl group at position C3, so this reduction is probably redundant, as discussed for the second module of EPOS D. The EPOS E domain takes part in the release and cyclization of the growing polyketide chain by the formation of a lactone between the carboxyl group at position C1 and the hydroxyl group in position C15.

In the sequenced region against the course of transcription of epoA, 5 ORFs were detected. Partially sequenced orf1 does not have homologous sequences in the data banks. The derived protein product (Orf 2, SEQ ID NO: 10) orf2 (nucleotides 3171-1900 on the reverse complementary chain of SEQ ID NO: 1) shows noticeable analogies with the hypothetical ORFs from Mycobacterium and Streptomyces coelicolor and more distant analogies with carboxypeptidases and DD peptidases various bacteria. The derived orf3 protein product (nucleotides 3415-5556 SEQ ID NO: 1), Orf 3 (SEQ ID NO: 11), has homology with the Na / H antiporters of various bacteria. Orf 3 may be involved in the export of epothilones from a producer strain. orf4 and orf5 do not have homologous sequences in the databanks.

In the sequenced region, 11 ORFs were detected during transcription of epoE. epoF (nucleotides 62369-63628 SEQ ID NO: 1) encodes EPOS F (SEQ ID NO: 8), an isolated protein having pronounced sequence analogies with cytochrome P450 oxygenases. EPOS F may be involved in the regulation of the redox status of C12, C5 and / or C3 carbon. The derived protein product orf14 (nucleotides 67334-68251 SEQ ID NO: 1), Orf 14 (SEQ ID NO: 22) shows noticeable analogies with GI: 3293544, a hypothetical protein from Streptomyces coelicolor with an unknown function, as well as a human protein from the lungs of the embryo GI: 2654559. It also has a more distant relationship with the proteins of the GI cation exit system: 2623026 from Methanobacterium thermoautotrophicum, so it can also be involved in the export of epothilones from producer cells. The remaining ORFs (orf6-orf13 and orf15) do not have homologous sequences in the data banks.

Example 13: Recombinant expression of epothilone biosynthesis genes

The epothilone synthase genes of the present invention are expressed in heterologous organisms in order to produce epothilone in larger quantities than by fermentation using Sorangium cellulosum. A preferred host for heterologous expression is Streptomyces, for example Streptomyces coelicolor, a species that naturally produces actinorodine polyketide. Recombinant PKS gene expression techniques in this host are described by McDaniel et al., Science 262: 1546-1550 (1993) and Kao et al., Science 265: 509-512 (1994) (see also Holmes et al., EMBO Journal 12 (8): 3183-3191 (1993) and Bibb et al., Gene 38: 215-226 (1985), as well as in US patents 5521077, 5672491 and 5712146, which are incorporated herein by reference.

In one method, a heterologous host strain is constructed having a chromosomal deletion of the actinorodine gene cluster (act). Expression plasmids containing the epothilone synthase genes of the invention are constructed by transferring DNA from a temperature-sensitive donor plasmid to a shuttle (bifunctional) recipient vector in E. coli (McDaniel et al. (1993) and Kao et al. (1994) ), so that synthase genes are obtained by homologous recombination in a vector. Alternatively, the epothilone synthase gene cluster is introduced into the vector by ligation of restriction fragments. After selection, carried out, for example, as described by Kao et al. (1994), DNA from the vector is introduced into the Streptomyces coelicolor act minus strain according to the protocols given by Hopwood et al., Genetic Manipulation of Streptomyces. A Laboratory Manual (John Innes Foundation, Norwich, United Kingdom, 1985), a publication is incorporated herein by reference. The recombinant strain of Streptomyces is grown in R2YE medium (Hopwood et al. (1985)) and epothilones are obtained.

In another embodiment, the epothilone synthase genes of the present invention are expressed in other host organisms such as Pseudomonads, Bacillus, yeast, insect cells and / or E. coli. The PKS and NRPS genes are preferably expressed in E. coli using the pT7-7 vector, which includes the T7 promoter (see Tabor et al., Proc. NatL Acad. Sci. USA 82: 1074-1078 (1985). In another embodiment, for expression of the PKS and NRPS genes in E. coli, in a fusion that provides transcription or translation, under the control of the tac or trc promoter, the pKK223-3 and pKK223-2 expression vectors are used. For the expression of the PKS and NRPS genes in heterologous hosts that in vivo do not have phosphopantetheinyl- (P-pant) -transferases, which are necessary for post-translational modification and PKS enzymes, co-expression in the P-pant transferase host is required, as described by Kealey et al., Proc. NatL Acad. Sci. USA 95: 505-509 (1998).

Example 14: Isolation of Epothilones from Producer Strains

Examples of cultivation, fermentation and extraction methods for isolating polyketides that can be used to extract epothilones from both natural and recombinant hosts of the present invention are given in WO 93/10121, incorporated herein by reference, in Example 57 of US Pat. 5639949 and Gerth et al., J. Antibiotics 49: 560-563 (1996), as well as in patent application SE 396/98, filed February 19, 1998, in patent application US 09/248, 910 (in which also describes preferred mutant strains of Sorangium cellulosum), both applications are hereby incorporated by reference Lki. The following are procedures that can be used to isolate epothilones from cultured strains of Sorangium cellulosum, such as So ce90, and which can also be used to isolate epothilones from recombinant hosts.

A: Cultivation of epothilone-producing strains:

Strain: Sorangium cellulosum Soce-90 or recombinant host strain of the present invention.

Preservation of the strain: In liquid N ₂ .

Wednesday: Pre-crops and Intercultures G52

Main culture: 1B12

G52 environment:

low concentration yeast extract salts (BioSpringer, Maison Alfort, France) 2 g / l MgSO ₄ (7H ₂ O) 1 g / l CaCl ₂ (2H ₂ O) 1 g / l low fat soy flour (Lucas Meyer, Hamburg, Germany)) 2 g / l Noredux potato starch (company Blattmann, Wadenswil, Switzerland) 8 g / l anhydrous glucose 2 g / l Fe-EDTA sodium salt (8 g / l) 1 ml / l

pH 7.4 adjusted using KOH

Sterilization: 20 min at 120 ° C

Wednesday 1B12:

potato starch Noredux A-150 (Blattmann, Wadenswil, Switzerland) 20 g / l fat free soy flour Soyamin 50T (company Lucas Meyer, Hamburg, Germany) 11 g / l sodium salt of Fe (III) -EDTA 8 mg / l

pH 7.8 adjusted with KOH

Sterilization: 20 min at 120 ° C.

Addition of cyclodextrins and cyclodextrin derivatives:

Different concentrations of cyclodextrins (Fluka, Buchs, Switzerland, or Wacker Chemie, Munich, Germany) are sterilized separately and added to 1B12 medium before culture.

Cultivation: 1 ml of the supernatant of the strain Sorangium cellulosum Soce90 VSE33 / 10 from an ampoule with liquid N _{2 is} transferred into 10 ml of G52 medium (in an Erlenmeyer flask with a volume of 50 ml) and incubated for 3 days in a mixer with an offset of 25 mm at a rotation speed of 180 rpm min and at 30 ° C. 5 ml of this culture is transferred into 45 ml of G52 medium (in a 200 ml Erlenmeyer flask) and incubated for 3 days in a mixer with a displacement of 25 mm at a rotation speed of 180 rpm and at 30 ° C. 50 ml of this culture is then added to 450 ml of G52 medium (in a 2 L Erlenmeyer flask) and incubated for 3 days in a mixer with a displacement of 50 mm at a rotation speed of 180 rpm and at 30 ° C.

Maintaining culture: Cultures are reseeded every 3-4 days by adding 50 ml of culture to 450 ml of G52 medium (in a 2 L Erlenmeyer flask). All experiments and fermentation processes are carried out using this supporting culture as a source.

Experiments in the flask:

(I) Pre-culture in shake flask:

Using 500 ml of the supporting culture as the initial one, 1 × 450 ml of G52 medium is seeded with 50 ml of the supporting culture and incubated for 4 days in a mixer with a displacement of 50 mm at a rotation speed of 180 rpm and at 30 ° C.

(II) The main culture in the shake flask:

40 ml of 1 B12 medium plus 5 g / l of 4-morpholine propanesulfonic acid (MOPS) powder (in a 200 ml Erlenmeyer flask) are mixed with 5 ml of a 10-fold concentrated cyclodextrin solution, 10 ml of pre-culture are inoculated and incubated for 5 days in a stirrer with a displacement of 50 mm at a rotation speed of 180 rpm and at 30 ° C.

Fermentation: Fermentation processes are carried out in volumes of 10 l, 100 l and 500 l. Fermentations of 20 L and 100 L serve as an intermediate stage of cultivation. While preliminary cultures and intermediate cultures are sown in the form of a supporting medium at a concentration of 10 vol.%, The main culture is sown with 20 vol.% Intermediate culture. It is important to note: in contrast to culture-agitated, the ingredients of the fermentation media are calculated with respect to the final volume of the culture, including the inoculum. For example, if 18 liters of medium + 2 liters of inoculum are combined, then the substances are weighed at the rate of 20 liters, however, they are mixed only with 18 liters.

Pre-culture in shake flask:

Using the initial 500 ml of supporting culture, 4x450 ml of G52 medium (in an Erlenmeyer flask of 200 ml) is inoculated with 50 ml of this culture and incubated for 4 days in a mixer with a displacement of 50 mm at a rotation speed of 180 rpm and at 30 ° C.

Intermediate culture. 20 liter or 100 liter:

20 liter: 18 L of G52 medium in a fermenter having a total volume of 30 L is seeded with 2 L of pre-culture. Cultivation is continued for 3-4 days under the following conditions; 30 ° C, 250 rpm, 0.5 l of air per 1 l of liquid medium per min, overpressure 0.5 bar, without pH control.

100 liter: 90 liters of G52 medium in a fermenter having a total volume of 150 liters are seeded with 10 liters of a 20 liter pre-culture. Cultivation is continued for 3-4 days under the following conditions: 30 ° C, 150 rpm, 0.5 L of air per 1 L of liquid medium per minute, overpressure 0.5 bar, without pH control.

Main culture, 10-, 100- or 500-liter:

10 liter: The ingredients for 10 l of medium 1B12 are sterilized in 7 l of water, then 1 l of a sterile 10% solution of 2- (hydroxypropyl) -β-cyclodextrin (GP-β-CD) is added and seeded with 2 l of 20 liter intermediate culture. The duration of cultivation of the main culture is 6-7 days under the following conditions: 30 ° C, 250 rpm, 0.5 l of air per 1 l of liquid medium per min, overpressure 0.5 bar, pH control with H ₂ SO ₄ / KOH to a pH of 7.6 ± 0.5 (i.e., no control at a pH of 7.1 to 8.1).

100 L: The ingredients for 100 L of 1B12 medium are sterilized in 70 L of water, then 10 L of a sterile 10% solution of 2- (hydroxypropyl) -β-cyclodextrin is added and seeded with 20 L of a 20 L intermediate culture. The duration of cultivation of the main culture is 6-7 days under the following conditions: 30 ° C, 200 rpm, 0.5 l of air per 1 l of liquid medium per minute, overpressure 0.5 bar, pH control with H ₂ SO ₄ / KOH to pH 7.6 ± 0.5. The sowing sequence for the 100 liter fermenter is schematically shown below:

500 L: Ingredients for 500 L of 1B12 medium are sterilized in 350 L of water, then 50 L of a sterile 10% solution of 2- (hydroxypropyl) -β-cyclodextrin is added and seeded with 100 L of a 100 L intermediate culture. The duration of cultivation of the main culture is 6-7 days under the following conditions: 30 ° C, 120 rpm, 0.5 l of air per 1 l of liquid medium per min, overpressure 0.5 bar, pH control with H ₂ SO ₄ / KOH to pH 7.6 ± 0.5.

Product Analysis:

Sample preparation:

50 ml of samples are mixed with 2 ml of Amberlite XAD16 polystyrene (Rohm and Haas, Frankfurt, Germany) and shaken at 180 rpm for 1 h at 30 ° C. The polystyrene is then filtered using a nylon sieve with a pore size of 150 μm, washed with 1 L of water and then mixed with a filter in a 15 ml Nunc type tube.

Polystyrene Product Elude:

In a test tube with a filter and polystyrene, 10 ml of isopropanol (> 99%) is added. After that, the closed tube was shaken for 30 min at room temperature on a Rota-Mixer type rotary mixer (Labinco BV, Netherlands). Then, 2 ml of the liquid was removed by centrifugation and the supernatant was added by pipette to the HPLC tubes.

HPLC analysis:

Column: Waters-Symetry C18, 100 × 4 mm, 3.3 μm WAT066220 + preliminary column 3.9 × 20 mm WAT054225

Solvents: A: 0.02% phosphoric acid B: acetonitrile (purity for HPLC) Gradient: 41% B from 0 to 7 minutes 100% B from 7.2 minutes to 7.8 minutes 41% B 8 to 12 min

Thermostat temperature: 30 ° C

Definition: 250 nm, UV-DAD determination

The volume of the injected sample: 10 μl

Retention time: epothilone A: 4.30 min; epothilone B: 5.38 min

B. The effect of adding cyclodextrin and cyclodextrin derivatives on the concentration of the resulting epothilones

Cyclodextrins are cyclic (α-1,4) -linked α-D-glucopyranose oligosaccharides with a relatively hydrophobic central cavity and a hydrophilic region on the outer surface.

It should be noted in particular (the numbers in parentheses indicate the number of glucose residues per molecule): α-cyclodextrin (6), β-cyclodextrin (7), γ-cyclodextrin (8), δ-cyclodextrin (9), ε-cyclodextrin (10 ), ζ-cyclodextrin (11), η-cyclodextrin (12), and θ-cyclodextrin (13). Most preferred are δ-cyclodextrin and especially α-cyclodextrin, β-cyclodextrin or γ-cyclodextrin, or mixtures thereof.

The cyclodextrin derivatives are primarily the aforementioned cyclodextrins, especially α-cyclodextrin, β-cyclodextrin or γ-cyclodextrin, especially cyclodextrins, in which one or more up to all hydroxy groups (3 per glucose radical) are converted to form an ether or ester. The ethers are primarily alkyl ethers, preferably lower alkyl ethers, such as methyl or ethyl ether, as well as propyl or butyl ether; and arylhydroxyalkyl ethers, such as phenylhydroxy lower alkyl, preferably phenylhydroxyethyl ether; hydroxyalkyl ethers, in particular hydroxy (lower) alkyl ethers, preferably 2-hydroxyethyl, hydroxypropyl, such as 2-hydroxypropyl, or hydroxybutyl, such as 2-hydroxybutyl ether; carboxyalkyl ethers, in particular carboxy (lower) alkyl ethers, preferably carboxymethyl or carboxyethyl ether; derivatized carboxyalkyl ethers, in particular derivatized carboxy (lower) alkyl ether, in which the derivatized carboxy group is an esterified or amidated carboxy group (especially aminocarbonyl, mono- or di- (lower) alkylaminocarbonyl, morpholino-piperipiperide or alkoxycarbonyl), in particular lower alkoxycarbonyl lower alkyl esters, for example methyloxycarbonylpropyl ether or ethylcarbonylpropyl ether; sulfoalkyl ethers, in particular sulfo (lower) alkyl ethers, preferably sulfobutyl ether; cyclodextrins in which one or more OH groups are esterified with a radical of the formula

-O- [alk-O] _n -H

where alk is alkyl, preferably lower alkyl and n is an integer from 2 to 12, preferably 2-5, in particular 2 or 3; cyclodextrins in which one or more OH groups are esterified with a radical of the formula

where R 'is a hydrogen atom, hydroxy, -O- (alk-O) _z -H, -O- (alk (-R) -O) _p -H or -O- (alk (-R) -O) _q -alk-CO-Y; alk in all cases is alkyl, preferably lower alkyl; m, n, p, q and z are an integer from 1 to 12, preferably 2-5, in particular 2 or 3; and Y is OR ₁ or NR ₂ R ₃ , where R ₁ , R ₂ and R ₃ independently represent a hydrogen atom or lower alkyl or R ₂ and R ₃ together with an attached nitrogen atom represent morpholino, piperidino, pyrrolidino or piperazino; or branched cyclodextrins in which ether groups or acetals are formed with other sugar molecules, preferably glucosyl, diglucosyl (G ₂ -β-cyclodextrin), maltosyl or dimaltosyl cyclodextrin or N-acetylglucosaminyl-glucosaminyl-, N-acetylgalactloctinamines or.

Esters are primarily alkanoyl ethers, in particular lower alkanoyl ethers such as acetyl ethers or cyclodextrins.

It is also possible to use cyclodextrins in which two or more of these different groups of ethers and ester groups are present simultaneously.

Mixtures of two or more of these cyclodextrins and / or cyclodextrin derivatives can also be used.

Particular preference is given to, in particular, α-, β- or γ-cyclodextrins or their lower alkyl esters, such as methyl-β-cyclodextrin or particularly preferably 2,6-di-O-methyl-β-cyclodextrin, or preferably their hydroxy lower alkyl ethers such as 2-hydroxypropyl-α-, 2-hydroxypropyl-β- or 2-hydroxypropyl-γ-cyclodextrin.

Cyclodextrins or cyclodextrin derivatives are added to the culture medium, preferably at a concentration of 0.02-10, preferably 0.05-5, particularly preferably 0.1-4, for example 0.1-2% (w / v).

Cyclodextrins or cyclodextrin derivatives are known or can be obtained using known methods (see, for example, US 3459731; US 4383992; US 4535152; US 4659696; EP 0094157; EP 0149197; EP 0197571; EP 0300526; EP 0320032; EP 0499322; EP 0503710; EP 0818469; WO 90/12035; WO 91/11200; WO 93/19061; WO 95/089993; WO 96/14090; GB 2189245; DE 3118218; DE 3317064 and the references therein that also relate to the synthesis cyclodextrins or cyclodextrin derivatives, or also from T. Loftsson and M.E. Brewster (1996): Pharmaceutical Applications of Cyclodextrins: Drug Solubilization and Stabilization: Journal of Pharmaceutical Science 85 (10): 1017-1025; RARajewski and VJ. Stella (1996) Pharmaceutical Applications of Cyclodextrins: In vivo Drug Del ivery: Journal of Pharmaceutical Science 85 (11): 1142-1168).

All studied cyclodextrin derivatives were obtained from Fluka, Buchs, CH. The experiments are carried out in 200 ml shaken flasks. As controls, flasks with an adsorbent - resin (polystyrene) Amberlite XAD16 (Rohm & Haas, Frankfurt, Germany) and without adding absorbent are used. After incubation for 5 days with the help of HPLC, the following epothilone titers can be determined:

Table 2: Additive Product No. Conc. [%, w / v] ¹ Epothilone A [mg / L] Epothilone B [mg / l] Amberlite XAD16 (V / V) 2.0 vol.% 9.2 3.8

Additive Product No. Conc. [%, w / v] ¹ Epothilone A [mg / L] Epothilone B [mg / l] 2-hydroxypropyl-β-cyclodextrin 56332 0.1 2.7 1.7 2-hydroxypropyl-β-cyclodextrin " 0.5 4.7 3.3 2-hydroxypropyl-β-cyclodextrin " 1,0 4.7 3.4 2-hydroxypropyl-β-cyclodextrin " 2.0 4.7 4.1 2-hydroxypropyl-β-cyclodextrin " 5,0 1.7 0.5 2-hydroxypropyl-α-cyclodextrin 56330 0.5 1,2 1,2 2-hydroxypropyl-α-cyclodextrin " 1,0 1,2 1,2 2-hydroxypropyl-α-cyclodextrin " 5,0 2,5 2,3 β-cyclodextrin 28707 0.1 1,6 1.3 β-cyclodextrin " 0.5 3.6 2,5 β-cyclodextrin " 1,0 4.8 3,7 β-cyclodextrin " 2.0 4.8 2.9 β-cyclodextrin " 5,0 1,2 0.4 methyl β-cyclodextrin 66292 0.5 0.8 <0.3 methyl β-cyclodextrin " 1,0 <0.3 <0.3 methyl β-cyclodextrin " 2.0 <0.3 <0.3 2,6-di-ortho-methyl-β-cyclodextrin 39915 1,0 <0.3 <0.3 2-hydroxypropyl-γ-cyclodextrin 56334 0.1 0.3 <0.3 2-hydroxypropyl-γ-cyclodextrin " 0.5 0.9 0.8

Additive Product No. Conc. [%, w / v] ¹ Epothilone A [mg / L] Epothilone B [mg / l] 2-hydroxypropyl-γ-cyclodextrin " 1,0 1,1 0.7 2-hydroxypropyl-γ-cyclodextrin " 2.0 2.6 0.7 2-hydroxypropyl-γ-cyclodextrin " 5,0 5,0 1,1 without adding 0.5 0.5 ¹⁾ In addition to Amberlite (vol.%) All percentages are: wt./about.

Some of the studied cyclodextrins (2,6-di-ortho-methyl-β-cyclodextrin, methyl-β-cyclodextrin) in the studied concentrations have no effect or have a negative effect on the production of epothilone. As can be seen from the examples, the addition of 1-2% 2-hydroxypropyl-β-cyclodextrin increases the production by 6-8 times in comparison with the production without the use of cyclodextrins.

B: Fermentation of a 10 liter culture with 1% 2-hydroxypropyl-β-cyclodextrin

Fermentation is carried out in a 15 liter glass fermenter. The medium contains 10 g / l of 2- (hydroxypropyl) -β-cyclodextrin obtained from Wacker Chemie, Munich, Germany. The change in product yield during the fermentation process is presented in table 2. The fermentation is completed after 6 days and the product is processed.

Table 3: Change in product yield during 10 liter fermentation The cultivation process (days) Epothilone A (mg / L) Epothilone B (mg / L) 0 0 0 1 0 0 2 0.5 0.3 3 1.8 2,5 4 3.0 5.1

The cultivation process (days) Epothilone A (mg / L) Epothilone B (mg / L) 5 3,7 5.9 6 3.6 5.7

D: Fermentation of a 100 liter culture with 1% 2-hydroxypropyl-β-diclodextrin

Fermentation is carried out in a 150 liter fermenter. The medium contains 10 g / l of 2- (hydroxypropyl) -β-cyclodextrin. The change in product yield during fermentation is presented in table 3. The fermentation is completed after 7 days and the product is processed.

Table 4: Change in product yield during 100 liter fermentation The cultivation process (days) Epothilone A (mg / L) Epothilone B (mg / L) 0 0 0 1 0 0 2 0.3 0 3 0.9 1,1 4 1,5 2,3 5 1,6 3.3 6 1.8 3,7 7 1.8 3,5

D: Fermentation of a 500 liter culture with 1% 2-hydroxypropyl-β-cyclodextrin

Fermentation is carried out in a 750 liter fermenter. The medium contains 10 g / l of 2- (hydroxypropyl) -β-cyclodextrin. The change in product yield during the fermentation process is presented in table 4. The product obtained as a result of fermentation is collected after 7 days and processed.

Table 5: Change in product yield during 500 liter fermentation The cultivation process (days) Epothilone A (mg / L) Epothilone B (mg / L) 0 0 0 1 0 0 2 0 0 3 0.6 0.6 4 1.7 2.2 5 3,1 4,5 6 3,1 5.1

E: A comparative example of the fermentation of a 10 liter culture without the addition of adsorbent

Fermentation is carried out in a 15 liter glass fermenter. The medium does not contain any cyclodextrin or other adsorbent. The change in product yield during the fermentation process is presented in table 5. The product obtained as a result of fermentation is not collected and is not processed.

Table 6: Change in product yield during 10 liter fermentation without adsorbent The cultivation process (days) Epothilone A (mg / L) Epothilone B (mg / L) 0 0 0 1 0 0 2 0 0 3 0 0 4 0.7 0.7 5 0.7 1,0 6 0.8 1.3

F: Epothilone treatment: isolation from a 500 liter primary culture:

The yield of the 500-liter main culture described in Example 2G is 450 L; it is separated using a Westfalia type SA-20-06 cleaning separator (rotational speed of 6500 rpm) into the liquid phase (centrifugate + wash water) and the solid phase ( cells about 15 kg). The main part of epothilones was found in a centrifuge. The cell mass obtained after centrifugation contains <15% of the established amount of epothilones and it was not further processed. A 650 L centrifuge is then placed in a 4000 L stirred tank, mixed with 10 L Amberlite XAD16 (centrifugate: resin (polystyrene) volume ratio = 65: 1) and mixed. After contact for about 2 hours, the resin is removed by centrifugation using a centrifuge with Heine drain (basket capacity 40 l, rotation speed 2800 rpm). The resin is removed from the centrifuge and washed with 10-15 L of deionized water. Desorption is carried out by stirring the resin twice in glass tanks with a 30 L agitator for 30 min, each time using 30 L of isopropanol. The separation of the isopropanol phase from the resin is carried out using a suction filter. Isopropanol is then removed from the combined isopropanol phases by adding 15-20 L of water in a circulating vacuum evaporator (Schmid-Verdampfer) and the resulting aqueous phase of approximately 10 L is extracted three times using 10 L of ethyl acetate each time. The ethyl acetate extract was concentrated to a volume of 3-5 L in a circulating vacuum evaporator (Schmid-Verdampfer) and then concentrated to dryness on a rotary evaporator (type Büchi). The result is 50.2 g of ethyl acetate extract. The ethyl acetate extract was dissolved in 500 ml of methanol, the insoluble fractions were filtered off with a pleated filter and the solution was added to a 10 kg Sephadex LH 20 column (Pharmacia, Ippsala, Sweden) (column diameter 20 cm, filling level approximately 1.2 m). Elution is carried out using methanol as eluent. Epothilones A and B are mainly present in fractions 21-23 (with a fraction size of 1 l). These fractions were concentrated to dryness in vacuo on a rotary evaporator (total weight 9.0 g). Then these Sephadex fractions with the maximum content of epothilones (9.0 g) are dissolved in 92 ml of a mixture of acetonitrile: water: methylene chloride (50: 40: 2), the solution is filtered through a pleated filter and introduced into an RP column (Prepbar 200 device Merck company; 2.0 kg LiChrospher RP-18, Merck, granule size 12 μm, column diameter 10 cm, filling level 42 cm; company Merck, Darmstadt, Germany). The elution is carried out with a mixture of acetonitrile: water (3: 7) (flow rate 500 ml / min; retention time of epothilone A about 51-59 minutes; retention time epothilone A about 60-69 minutes). Fractionation is monitored using a UV detector at a wavelength of 250 nm. Fractions were concentrated to dryness in vacuo using a Büchi rotary evaporator. The mass of epothilone A in the fraction with the maximum content is 700 mg, which, according to those obtained using HPLC (with the internal standard), corresponds to 75.1%. The mass of epothilone B in the fraction with the maximum content is 1980 mg, which, according to those obtained using HPLC (with the internal standard), corresponds to 86.6%. Finally, the epothilone A fraction (700 mg) was crystallized from 5 ml of a mixture of ethyl acetate: toluene (2: 3) and 170 mg of epothilone A were obtained as pure crystallizate [content according to HPLC (area,%) is 94.3%]. The crystallization of epothilone B (1980 mg) was carried out using 18 ml of methanol, obtaining 144 mg of epothilone B in the form of a pure crystallisate [content according to HPLC (area,%) is 99.2%], t _PL (epothilone B): for example, 124 -125 ° C; ¹ H-NMR for epothilone B:

500 MHz NMR, solvent: DMSO-d ₆ . Chemical shift δ in ppm relative to TMS. s is a singlet; d is a doublet; m stands for multiplet

δ (multiplicity) Integral (number of N) 7.34 (s) 1 6.50 (s) 1 5.28 (d) 1 5.08 (d) 1 4.46 (d) 1 4.08 (m) 1 3.47 (m) 1

δ (multiplicity) Integral (number of N) 3.11 (m) 1 2.83 (dd) 1 2.64 (s) 1 2.36 (m) 2 2.09 (s) 3 2.04 (m) 1 1.83 (m) 1 1.61 (m) 1 1.47-1.24 (m) 4 1.18 (s) 6 1.13 (m) 2 1.06 (d) 3 0.89 (d + s, overlap) 6 Σ = 41

Example 15: Medical use of recombinantly prepared epothilones

Pharmaceutical preparations or compositions comprising epothilones are used, for example, for the treatment of malignant diseases, such as various solid tumors in humans. Such anti-cancer compositions contain, for example, epothilone as an active substance in combination with one or more organic or inorganic liquid or solid pharmaceutically acceptable carriers. Such compositions are administered, for example, enterally, nasally, rectally, orally or parenterally, especially intramuscularly or intravenously. The dose of the active substance depends on the body weight, age and physical and pharmacokinetic state of the patient, as well as on the route of administration. Since epothilones resemble the biological effects of taxol, epothilones can be used to replace taxol in compositions and methods of using taxol for treating cancer (see, for example, US Pat. Nos. 5,496,804, 5,565,478 and 5,641,803, which are incorporated herein by reference).

For example, for treatment, epothilone B is delivered in separate 2 ml glass ampoules in the form of a colorless concentrate (1 mg / ml) for intravenous administration. A form of the substance is prepared in polyethylene glycol 300 (PEG 300) and diluted with 50 or 100 ml of 0.9% sodium chloride injection for US Pharmacopoeia (Sodium Chloride Injection, USP) to obtain the desired final concentration of the drug intended for infusion. It is administered as a single 30-minute intravenous infusion every 21 days (3-week treatment) in the form of 6 cycles or as a single 30-minute intravenous infusion every 7 days (weekly treatment).

For weekly treatment, preferably the dose is in the range of from about 0.1 to about 6, preferably from about 0.1 to about 5 mg / m ² , more preferably from about 0.1 to about 3 mg / m ² , even more preferably from 0.1 to 1.7 mg / m ² , most preferably from about 0.3 to about 1 mg / m ² ; for a three-week treatment (treatment every 3 weeks or every third week), the dose is in the range of from about 0.3 to about 18 mg / m ² , preferably from about 0.3 to about 15 mg / m ² , more preferably from about 0, 3 to about 12 mg / m ² , even more preferably from about 0.3 to about 7.5 mg / m ² and even more preferably from about 0.3 to about 5 mg / m ² , most preferably from about 1.0 up to about 3.0 mg / m ² . This dose is preferably administered to a person intravenously (iv) for 2-180 minutes, preferably 2-120 minutes, more preferably for about 5 to about 30 minutes, most preferably for about 10 to about 30 minutes, for example, about 30 minutes

Although the present invention has been described with reference to specific embodiments, it should be apparent that numerous changes, modifications and variations can be made and, therefore, all such changes, modifications and variations fall within the spirit and scope of the invention.

Claims (12)

1. A recombinant host cell comprising a chimeric gene comprising a heterologous promoter sequence operably linked to a nucleic acid molecule that encodes at least one polypeptide involved in epothilone biosynthesis. 2. The recombinant host cell according to claim 1, which is a bacterium. 3. The recombinant host cell according to claim 2, which is Actinomycete. 4. The recombinant host cell according to claim 3, which is Streptomyces. 5. A clone of you, comprising a nucleic acid molecule that encodes at least one polypeptide involved in the biosynthesis of epothilones. 6. Recombinant host cell, comprising a recombinantly expressed polypeptide involved in the biosynthesis of epothilones. 7. The recombinant host cell according to claim 6, which is a bacterium. 8. The recombinant host cell according to claim 7, which is Actinomycete. 9. The recombinant host cell of claim 8, which is Streptomyces. Priority on points: 06/18/1998 according to claims 1-9; 09/24/1998 according to claims 1-9; 02/05/1999 according to claims 1-9.