CN111138444B

CN111138444B - Epothilone B glucoside compounds and enzymatic preparation and application thereof

Info

Publication number: CN111138444B
Application number: CN202010018493.7A
Authority: CN
Inventors: 李越中; 张鹏; 吴长生; 汤亚杰
Original assignee: Shandong University
Current assignee: Shandong University
Priority date: 2020-01-08
Filing date: 2020-01-08
Publication date: 2022-05-03
Anticipated expiration: 2040-01-08
Also published as: CN111138444A

Abstract

The invention discloses a group of epothilone B glucoside compounds, which are epothilone B7-O-beta-D glucoside, epothilone B7-O-beta-D-glucosyl- (1 → 3) -beta-D glucoside, epothilone B7-O-beta-D-glucosyl- (1 → 2) -beta-D glucoside or epothilone B7-O-beta-D-glucosyl- (1 → 2) -beta-D-glucosyl- (1 → 4) -beta-D glucoside. The compound is obtained by the glycosylation reaction of epothilone B and UDP-O-beta-D-glucose with I62A mutant protein of glycosyltransferase Bsgt-1. The invention also discloses application of the epothilone B glucoside compound in preparation of a medicine for preventing and treating liver cancer. Experiments prove that the compound epothilone B7-O-beta-D glucoside has a half-inhibition effect on human liver cancer cells HepG2 when the concentration is 9.84 mu M; and compared with the epothilone B technical product, the toxicity to the normal liver cell HL7702 is reduced by 9430 times. The application value of the epothilone in the antitumor activity is expected to be increased, and the social benefit and the economic value are improved.

Description

Epothilone B glucoside compounds and enzymatic preparation and application thereof

Technical Field

The invention relates to a group of epothilone glycoside compounds and preparation and application thereof, in particular to epothilone B glucose monosaccharide, disaccharide and trisaccharide compounds, an enzymatic preparation method thereof and application of the epothilone B glucose compounds in preparation of medicaments for treating and preventing liver cancer. Belongs to the field of microbial technology, product and application technology.

Background

Sorangium cellulosum belongs to the order Myxococcus, sub-order Sorangium, family Sorangium and genus Sorangium, and is a type of gram-negative bacteria widely distributed in soil. Can produce abundant secondary metabolites.

Epothilones (epothilones) are a class of 16-membered macrolides that are currently derived only from sorangium cellulosum. In terms of action mechanism, although the epothilone and the paclitaxel inhibit the growth of tumors by polymerizing tubulin, the epothilone shows better inhibition activity on multi-drug resistant tumor cells than the paclitaxel, has the potential of large-scale fermentation production, and is considered to be a good substitute of the paclitaxel. The compound has two main products, namely epothilone A and epothilone B, and the structural formula of the compound is as follows:

structural formula of Epothilone (R ═ H, Epothilone A;. R ═ CH)₃，epothilone B)

The chemical structure of epothilones is simpler than paclitaxel, comprising a 16-membered macrolactone ring, a ternary oxygen ring, and a thiazole ring side chain. The structural skeletons of the analogues of the epothilone are basically the same, and the epothilone B has one more methyl group than A on the 12-position carbon of the macrolide, but the inhibitory activity on tumor cells is 4-10 times that of the epothilone A. In 2007, the epothilone B analog Ixabepilone (Ixabepilone) was approved by the FDA for the treatment of breast cancer, and at present, in addition to Ixabepilone, a variety of epothilone analogs have entered various stages of clinical evaluation, e.g., paclitaxel (Patupilone), epothilone D (KOS-862), ZK-EPO, and ABJ 879. Nevertheless, the epothilone analogs reported above have problems of strong neurotoxicity, blood toxicity or poor water solubility, which limits the clinical applications of epothilones. On the basis of the above, reasonable modification of the structure of epothilone is necessary, and therefore, the development of a simple and green (bio) chemical method for relevant modification is particularly urgent.

Glycosylation modification of natural products catalyzed by glycosyltransferase is widely existed in nature, and the introduced glycosyl group has important improvement effect on water solubility, stability and biological activity of compounds. The reports of glycosylation modification of Epothilone are limited to Epothilone A found in 2010 and Epothilone A7-O-beta-D glucoside (Epothilone A7-O-beta-D glucoside) reported in 2014. However, only the organic chemically synthesized galac glycosylated Epothilone B or Epothilone B3-O-alpha-D arabinopyranoside has been reported for the glycosylation of Epothilone B with better antitumor activity, and other types of glycosylation products have not been reported. In addition, the organic chemical synthesis method for synthesizing the Epothilone B glycosylation product has the defects of complex and tedious steps, a large number of byproducts, difficult separation and purification, higher synthesis cost, high difficulty of the organic chemical synthesis method, high synthesis condition requirement, high toxicity, no environmental protection, difficult selective protection and the like. In view of this, there is an urgent need to find better glycosylation modification substitution methods for epothilone B, an important antitumor drug, and to prepare epothilone B glycosylation products with more abundant varieties.

Disclosure of Invention

Aiming at the defects of the prior art, the invention aims to provide a group of epothilone B glucoside compounds, an enzymatic preparation method thereof and application of the epothilone B glucoside compounds in preparation of medicines for treating and preventing liver cancer.

The group of epothilone B glucoside compounds of the invention are epothilone B glucose monosaccharide, disaccharide and trisaccharide compounds, and are characterized in that the epothilone B glucoside compounds are compound 1: epothilone B7-O- β -D glucoside; or is compound 2: epothilone B7-O- β -D-glucosyl- (1 → 3) - β -D glucoside; or is compound 3: epothilone B7-O- β -D-glucosyl- (1 → 2) - β -D glucoside; or is compound 4: epothilone B7-O- β -D-glucoside- (1 → 2) - β -D-glucoside- (1 → 4) - β -D glucoside; the compound structural formula, the connection mode and the corresponding names are as follows:

wherein: the epothilone B glucoside compound is preferably compound 1: epothilone B7-O-beta-D glucoside.

The enzymatic preparation method of the epothilone B glucoside compound comprises the following steps:

in the following proportions, 50mM Tris-HCl,10mM MgCl₂In the buffer solution environment, carrying out an in vitro enzyme activity reaction experiment by using 10mM epothilone B, 50mM UDP-O-beta-D-glucose and 500 mu g/ml I62A mutein of glycosyltransferase BSgt-1, incubating the reaction mixed solution at 37 +/-1 ℃ for 12 +/-2 hours, adding 3 times of methanol to terminate the reaction, 14000r/min, removing protein precipitate for 30min, carrying out rotary evaporation to dryness treatment on the sample, adding methanol heavy suspension product, centrifuging the reaction mixture for 30min again at 14000r/min, and separating and purifying the product by using a semi-prepared liquid phase; the size specification of the chromatographic column is YMC-Pack Pro C18,250mm multiplied by 10.0mm,5 mu m; mobile phase system: elution with a 35:65 acetonitrile water system, peak time of epothilone B glucoside: compound 1: 13.2 min; compound 2: 10.6 min; compound 3: 7.1 min; compound 4: 5.2 min; the four separated compounds were evaporated to dryness separately and then applied to CD₃OD dissolution, and respectively identifying by using UHPLC-ESI-Q-TOF high-resolution mass spectrum and nuclear magnetic resonance;

wherein, the I62A mutant protein of the glycosyltransferase BsGT-1 takes pET28a-BsGT-1 recombinant plasmid as a template, and a mutant primer F-I62A is designed: CTTGAATgccGATCCTAAGCAAATCAGGGAGATG, respectively; R-I62A: TAGGATCggcATTCAAGGATGTATGATAGATCAATGC, generating linear recombinant mutant plasmid fragments by one-time PCR, and cyclizing by recombination reaction to form I62A mutant pET28a-BsGT-1 recombinant plasmid, and obtaining the recombinant plasmid through transformation of the recombinant plasmid and induced expression of protein.

The protein sequence of the glycosyltransferase BsGT-1(CUB50191) is published, and the glycosyltransferase BsJRS11 is obtained by extracting a B.subtiliss JRS11 genome, designing a primer (F-BamHI: CGCGGATCCATGAAAAAGTACCATATTTCGAT; R-SalI: ACGCGTCGACTTACTGCGGGACAGCGGATTTTT), forming pET28a-BsGT-1 recombinant plasmid through double enzyme digestion and connection, and transforming Escherichia coli BL21(DE3) by a recombinant vector for induced expression.

The method for preparing the epothilone B glucoside compound by the enzyme method comprises the following steps: the molar ratio of epothilone B to UDP-O-beta-D-glucose is preferably 1:5, and the reaction mixture for the glycosylation reaction mediated by the I62A mutein of glycosyltransferase Bsgt-1 is preferably incubated at 37 ℃ for 12 hours.

The invention relates to application of an epothilone B glucoside compound in preparation of a medicine for preventing and treating liver cancer.

The experiment proves that: the epothilone B glucoside compound provided by the invention has prevention and treatment effects on liver cancer. Wherein, the epothilone B glucoside compound 1 has a half-inhibition effect on human liver cancer cells HepG2 when the concentration is 9.84 mu M; and compared with the epothilone B technical product, the toxicity to the normal liver cell HL7702 is reduced by 9430 times. Further comparative experiments showed that: compound 1 according to the present invention: epothilone B7-O-beta-D glucoside has a stronger inhibitory effect on Epothilone A7-O-beta-D glucoside (Epothilone A7-O-beta-D glucoside) reported previously to human liver cancer cell HepG2, and the superiority of compound 1 in preparation of related pharmaceutical preparations is suggested. Therefore, compound 1: the epothilone B7-O-beta-D glucoside is used as a candidate drug of a low-toxicity and high-efficiency inhibitor for liver cancer cells, or is used as an effective component for preparing a pharmaceutical preparation related to preventing and treating liver cancer.

The invention discloses a group of epothilone B glucoside compounds and an enzymatic preparation method thereof, wherein the epothilone B glucoside compounds are synthesized by a mild enzymatic method in the preparation process, complex chemical reactions in organic synthesis are not needed, and the conversion of the epothilone glucoside is realized in one step; all glycosylation reaction processes are carried out in vitro, so that a negative regulation system possibly existing in an in vivo synthesis way is avoided; in vitro glycosylation modification has few compounds participating in the reaction, and is beneficial to the reutilization of raw materials and the separation and purification of new products; the conversion efficiency of the glycosylation reaction is high; the enzyme is used as a mild catalyst and has strong plasticity, mutation is introduced into the enzyme, the original activity of the protein is changed to a certain extent, the enzyme has new characteristics and new functions, and the diversity of products is facilitated. With the increasing abuse of cancer and drug-resistant bacteria, the clinical demand for novel anticancer drugs with novel action targets and high bacteriostatic activity is urgent. The novel epothilone B glucoside obtained by the invention is expected to gain the application value of the epothilone B glucoside in the antitumor activity, thereby generating good social benefit and economic value.

Drawings

FIG. 1: HPLC analysis chromatogram of glycosyltransferase Bsgt-1 on epothilone B glycosylation modification reaction liquid

Wherein, the peak time of four epothilone B glucosides is as follows: compound 1: 13.2 min; compound 2: 10.6 min; compound 3: 7.1 min; compound 4: 5.2 min; the peak time of the Epothilone B standard (Epothilone B) was 28.4 min.

FIG. 2: compound 1: high-resolution mass spectrogram of epothilone B7-O-beta-D glucoside and excimer ion peak [ M + H ]]⁺Is m/z 670.3131.

FIG. 3: compound 2: high resolution mass spectrogram, excimer ion peak [ M + H ] of epothilone B7-O-beta-D-glucosyl- (1 → 3) -beta-D glucoside]⁺Is m/z 832.5618.

FIG. 4: compound 3: high resolution mass spectrogram, excimer ion peak [ M + H ] of epothilone B7-O-beta-D-glucosyl- (1 → 2) -beta-D glucoside]⁺Is m/z 832.5627.

FIG. 5: compound 4: high resolution mass spectrogram of epothilone B7-O-beta-D-glucosyl- (1 → 2) -beta-D-glucosyl- (1 → 4) -beta-D glucoside, and excimer ion peak [ M + H ]]⁺Is m/z 994.4121.

Detailed Description

The present invention will be described in detail with reference to specific examples. The following examples are merely illustrative of the preferred embodiments of the present invention and are not intended to limit the present invention in any way, and any simple modifications, equivalent changes and modifications made to the embodiments according to the technical spirit of the present invention fall within the scope of the technical solution of the present invention.

The reagents, plasmids, strains, cells or experimental devices used in the present invention are all commercially available products.

Example 1 preparation of epothilone glycosyltransferase Bsgt-1 recombinant plasmid, construction of I62A mutant recombinant plasmid, expression of I62A mutant protein, and preparation of epothilone B glucoside

The inventor experimentally screens and determines a glycosyltransferase BsGT-1(CUB50191) capable of efficiently glycosylating epothilone B, and the protein sequence of the glycosyltransferase is published. The method for obtaining the recombinant plasmid of the epothilone glycosyltransferase BsGT-1 and expressing the recombinant plasmid to obtain the glycosyltransferase BsGT-1 comprises the following steps:

a gene fragment encoding glycosyltransferase BsGT-1 was obtained by extracting B.subtilis JRS11 genomic DNA, and a double enzyme digestion primer (F-BamHI: CGCGGATCCATGAAAAAGTACCATATTTCGAT; R-SalI: ACGCGTCGACTTACTGCGGGACAGCGGATTTTT) was designed using

Max Super-Fidelity DNApolymerase high Fidelity polymerase is used for carrying out Polymerase Chain Reaction (PCR), and the reaction system is as follows: 0.5 mu l of subtilis JRS11 genome DNA; 2X Phanta Max Buffer 25. mu.l; dNTP Mix (10mM each) 1. mu.l; 2. mu.l of F-BamHI (10. mu.M); R-SalI (10. mu.M) 2. mu.l; phanta Max Super-Fidelity DNApolymerase 1. mu.l; sterile water was added to 50. mu.l. The PCR product was recovered by cutting gel, and double-digested with the pET28a plasmid using the restriction enzymes BamHI and SalI at 37 ℃ for 4 hours. The PCR fragment after enzyme digestion and the linear fragment of the pET28a plasmid are cut again and recovered, T4 DNA ligase is used for connecting the PCR product and the plasmid fragment according to the molar ratio of 1:5 at 16 ℃ overnight, then the connection product is transformed into escherichia coli DH5 alpha, monoclonal shake bacteria is picked and sequenced, the correct sequencing is determined to be pET28a-BsGT-1 recombinant plasmid, and escherichia coli BL21(DE3) is transformed for induction expression to obtain glycosyl transferThe enzyme BsGT-1.

The inventors mutated isoleucine at position 62 of glycosyltransferase BsGT-1 to alanine (I62A) and expressed the I62A mutein of glycosyltransferase BsGT-1 by constructing a recombinant plasmid with I62A mutation. The method for introducing mutation into glycosyltransferase Bsgt-1 comprises the following steps:

MutExpressIIFastMutageneskitV 2 is selected and used for designing mutation primers

F-I62A：CTTGAATgccGATCCTAAGCAAATCAGGGAGATG；

R-I62A：TAGGATCggcATTCAAGGATGTATGATAGATCAATGC，

By using

Carrying out PCR by using the MaxSuper-FidelityDNApolymerase high-fidelity enzyme and the recombinant plasmid pET28a-BsgT-1 as a template to form a linear fragment, wherein the reaction system comprises the following components: recombinant plasmid pET28a-BsgT-1DNA0.5 ul; 2X Phanta MaxBuffer 25. mu.l; dNTP Mix (10mM each) 1. mu.l; F-I62A (10. mu.M) 2. mu.l; 2. mu.l of R-I62A (10. mu.M); phanta Max Super-Fidelity DNApolymerase 1 u l; sterile water was added to 50. mu.l. Then, the system was demethylated (37 ℃ C., 1h) with DpnI to remove the template recombinant plasmid (reduce the generation of false positive), and then the recombinant cyclization was completed by recombinase ExnaseII, and further sequencing verification was performed. The pET28 a-BstGT-1 recombinant plasmid with the correct determination of the sequencing being I62A mutation is transformed into Escherichia coli BL21(DE3), the transformant is transferred to 20ml LB culture medium added with kanamycin (the final concentration is 40 mu g/ml), cultured for 12 hours at 37 ℃, then 20ml seed liquid is respectively transferred to 1000ml LB culture medium (added with 100 mu l of kanamycin with the concentration of 40 mg/ml), expanded and cultured at 37 ℃, IPTG with the final concentration of 0.1mM is added when the OD value reaches 0.6-0.8, then transferred to a shaking table at 16 ℃, cultured for 24 hours at 200r/min, and centrifuged for 5 minutes at 4 ℃ and 8000r/min, and thallus is collected. The collected cells were resuspended in 100ml of Tris-HCl buffer (50mM Tris-HCl, pH 7.5), the resuspended cells were sonicated for 5min (5S sonication, 10S pause) in an ice-water mixture, the sonicated cells were centrifuged (12000r/min, 30min at 4 ℃), the supernatant and the pellet were separated, and then examined by SDS-PAGEExpression profile of the mutant protein.

The invention uses nickel filler to purify I62A mutant protein, the supernatant after ultrasonication is added into the nickel filler which is balanced by buffer solution (50mM Tris-HCl, pH 7.5) in advance, then the mixture is incubated for 12 hours at 4 ℃, then the incubated mixture is added into a purification column, the filler is naturally settled, after the buffer solution is washed and balanced, Tris-HCl buffer solutions with different concentrations of imidazole (20mM,50mM,100mM,150mM,200mM and 250mM imidazole, 50mM Tris-HCl, pH 7.5) are respectively eluted into a 1.5ml centrifuge tube, and then the protein is collected and detected by SDS-PAGE. The collected purified protein was subjected to imidazole removal using a 30kDa ultrafiltration tube and concentrated, and a sample of the concentrated protein (I62A mutein) was subjected to the next glycosylation reaction.

The I62A mutant protein of glycosyltransferase BsGT-1 which is separated and purified is used for catalyzing and producing the epothilone B glucoside compound, and the preparation method and the reaction conditions are as follows:

4ml in vitro enzyme-activated reaction systems respectively comprise the I62A mutant protein (500. mu.g/ml) of glycosyltransferase BsgT-1, Tris-HCl buffer (50mM Tris-HCl,10mM MgCl)₂) In vitro enzyme activity experiments were performed with epothilone B (10mM final concentration, in DMSO, approximately 20mg) and UDP-O- β -D-glucose (50mM final concentration, in water, approximately 122 mg). Incubating the reaction mixed liquor at 37 ℃ for 12 hours, adding 3 times of methanol to terminate the reaction, removing protein precipitate within 30min at 14000r/min, carrying out rotary evaporation to dryness on the sample, adding methanol heavy suspension product, centrifuging again at 14000r/min for 30min, and separating and purifying the product by a semi-preparative liquid phase.

The above epothilone B glucoside preparation was carried out using a YMC column (YMC-Pack Pro C18, 250mm. times.10.0 mm,5 μm), mobile phase system: acetonitrile water system elution (35:65), time to peak of four epothilone B glucosides: compound 1: 13.2 min; compound 2: 10.6 min; compound 3: 7.1 min; compound 4: 5.2 min. The four separated compounds were evaporated to dryness separately and then applied to CD₃OD dissolution is carried out, and then UHPLC-ESI-Q-TOF high-resolution mass spectrum and nuclear magnetic resonance are respectively used for identification.

EXAMPLE 2 structural characterization of Compound 1

According to FIG. 2, UHPLC-ESI-Q-TOF high resolution mass spectrum shows the excimer peak [ M + H ] of compound 1]⁺M/z670.3131, confirming that 1 is the monoglycoside of epothilone B. Meanwhile, the monosaccharide can also be obtained from the NMR spectrum of the compound 1: (¹H NMR) and carbon Spectroscopy (¹³C NMR) was confirmed. In the HMBC spectrum, H-7 is related to C-1 'and H-1' is related to C-7, so that the hydroxyl at the 7-position of the skeleton of epothilone B macrolide is determined by the connection of glucosyl. Larger coupling constant (J) between terminal protons H-1 'and H-2' on the sugar_1',2'7.8Hz) and a terminal proton high field chemical shift value of 4.46ppm, revealing that the glycosyl donor and epothilone B acceptor are linked by a β -D glycosidic bond. Thus, compound 1 is epothiloneB 7-O- β -D glucoside, the specific nuclear magnetic data of which is shown in Table 1.

TABLE 1 nuclear magnetic data assignment for Compound 1

EXAMPLE 3 structural characterization of Compound 2

According to FIG. 3, the high resolution mass spectrum shows the excimer peak [ M + H ] of Compound 2]⁺At m/z832.5618, it is predicted to be the diglucoside of epothilone B. Secondary mass spectrometry of Compound 2 gave fragment ion peaks m/z 670.3120 and 508.2615, and NMR spectra: (¹H NMR) and carbon Spectroscopy (¹³C NMR) gave a clear signal for both sugars, further verifying that 2 is the diglucoside of epothilone B. Also, HMBC and sugar end group proton coupling constant analysis (J)_1',2'7.8Hz), the disaccharide group is determined to be linked to epothilone B via a7-O- β -D glycosidic bond. ToThe connection mode of the beta-1, 3-glucoside bond in the disaccharide is mainly determined by two-dimensional nuclear magnetic resonance experiments, and comprises HSQC, HMBC, COSY and NOESY. Specifically, terminal proton coupling constant analysis (J)_1”,2”7.2Hz) and relatively high field proton chemical shift (δ)_H4.60) the terminal glycosyl group is proved to be beta-D glucose. The direct attached hydrogen on each glycosyl carbon was assigned using HSQC and COSY spectra. In the HMBC spectrum, the occurrence of a key carbon-hydrogen correlation at the 3' position with the 1 "position demonstrates that the order of attachment of the two glucose residues is a 1, 3-glucosidic bond. At the same time, the chemical shift of 86.8ppm of the carbon at the 3' position on the glucose residue directly attached to epothilone B was significantly shifted to the low field, also demonstrating that this position was replaced by a second glucose residue. Thus, compound 2 is Epothilone B7-O-. beta. -D-glucosyl- (1 → 3) - β -D glucoside, with the nuclear magnetic data being reported in Table 2.

Table 2. nuclear magnetic data attribution of compound 2.

EXAMPLE 4 structural characterization of Compound 3

According to FIG. 4, UHPLC-ESI-Q-TOF high resolution mass spectrum gave the excimer peak [ M + H ] of Compound 3]⁺Is m/z832.5627, and by secondary mass fragmentation analysis, 3 is predicted to be the diglucoside of epothilone B, i.e. the isomer of 2. Nuclear magnetic resonance hydrogen spectra of comparative compounds 3 and 2: (¹H NMR) and carbon Spectroscopy (¹³C NMR), it can be confirmed that 3 differs from 2 only in the disaccharide group. Further analysis of the disaccharide groups of the two compounds by HMBC spectral comparison revealed that the disaccharide in 3 was linked by a 1, 2-glucosidic linkage, and that this order of linkage was also possibleVerified with a chemical shift of 82.0ppm from 2' carbon shifted to low field. Thus, compound 3 is Epothilone B7-O- β -D-glucosyl- (1 → 2) - β -D glucoside, and the nuclear magnetic data is presented in Table 3.

TABLE 3. nuclear magnetic data attribution of Compound 3.

EXAMPLE 5 structural characterization of Compound 4

According to FIG. 5, UHPLC-ESI-Q-TOF high resolution mass spectrum gave the excimer peak [ M + H ] of Compound 4]⁺At m/z994.4121, it is predicted to be the triglucoside of epothilone B. Secondary mass spectrometry of Compound 4 gave fragment ion peaks m/z832.3765, 670.3271 and 508.2744, and NMR Hydrogen spectra (M/z)¹H NMR) and carbon Spectroscopy (¹³C NMR) gave significant terminal carbon and hydrogen signals for the three sugars, further demonstrating that 4 is the triglucoside of epothilone B. The coupling constants of the hydrogen signals of the three sugar terminal groups are all 7.8Hz, and the chemical shift values are all around 4.60ppm of the relative high field, which proves that the three sugars are all connected through beta-D glucose glycosidic bonds. In the HMBC spectrum, H-7 is related to C-1 'and H-1' is related to C-7, so that the hydroxyl at the 7-position of the skeleton of epothilone B macrolide is determined by the three glycosyl groups. The order and position of the linkage within the three sugars was determined by HSQC, HMBC, COSY and NOESY. Specifically, H-1 'is related to H-2' in COSY spectra, and C-2 'chemical shift (. delta.) directly linked to H-2' is determined in HSQC spectra_C82.5) was clearly shifted towards low field, demonstrating that the first glucose directly linked to epothilone B was linked to the second intermediate glucose by a 1, 2-glucosidic linkage. 1, 4-Glu for the second glucose and the last third glucoseDetermination of the glycosidic linkage order is based primarily on H-6 'in the HMBC spectra and C-4' (delta) with low field shifts to the chemical shift_C79.6), H-1 '"is associated with C-4", and H-4 "is associated with C-1'". Therefore, compound 4 is Epothilone B7-O-beta-D-glucosyl- (1 → 2) -beta-D-glucosyl- (1 → 4) -beta-D-glucoside, and the nuclear magnetic data are shown in Table 4.

Table 4. nuclear magnetic data attribution of compound 4.

Example 6 antitumor Activity test of epothilone B glucoside

The screening method comprises the following steps: method for reducing tetrazolium salt (MTT)

Cell lines: HepG2 human liver cancer and Normal hepatocyte HL7702

Acting time: 48 hours

The experimental method comprises the following steps:

cells in the logarithmic growth phase were trypsinized, the reaction was stopped by adding a predetermined amount of culture medium, the cells were collected by centrifugation, and the cells were resuspended in 1ml of culture medium. Another sterile gun slot was taken, and the cell suspension was mixed well with fresh culture medium and added to a 96-well plate (marginal wells filled with sterile PBS). And (3) placing the inoculated cell culture plate into an incubator for culture and adherent growth until a cell monolayer is paved on a 96-hole bottom plate, respectively adding four epothilone B glucoside compounds with concentration gradient, wherein each hole is 100 mu l, and 4 parallel experiment multiple holes are arranged. 5% CO₂Incubating at 37 ℃ for 48 hours, sucking out the supernatant, washing with PBS for 2-3 times, adding 100 μ l of MTT solution (5mg/ml, namely 0.5% MTT culture medium), culturing for 4 hours, discarding the supernatant,after washing with PBS for 2-3 times, 100. mu.l of dimethyl sulfoxide (DMSO) was added to each well, and the mixture was shaken on a shaker at a low speed for 10min to dissolve the crystals sufficiently. The absorbance of each well was measured at OD 492nm of the microplate reader.

The inhibition rates of four epothilone B glucoside compounds on human liver cancer HepG2 are respectively measured under different drug concentrations:

compound 1: the inhibition rates of epothilone B7-O-beta-D glucoside on human liver cancer HepG2 are respectively 3.40% (0.01 mu M), 4.02% (0.1 mu M), 13.19% (1 mu M), 29.23% (5 mu M), 62.26% (20 mu M), 83.08% (100 mu M) and 83.38% (200 mu M);

compound 2: the inhibition rate of epothilone B7-O-beta-D-glucosyl- (1 → 3) -beta-D glucoside on human liver cancer HepG2 at 100 mu M is 42.69% (100 mu M), and the IC of epothilone B7-O-beta-D-glucosyl- (1 → 3) -beta-D glucoside is IC of human liver cancer HepG2 at 100 mu M₅₀Values are considered to be greater than 100 μ M;

compound 3: the inhibition rates of epothilone B7-O-beta-D-glucosyl- (1 → 2) -beta-D glucoside on human liver cancer HepG2 are respectively 2.14% (0.01. mu.M), 11.50% (0.1. mu.M), 20.95% (1. mu.M), 40.17% (5. mu.M), 55.83% (20. mu.M), 83.87% (100. mu.M), 89.07% (200. mu.M) and 84.87% (500. mu.M);

compound 4: the inhibition rates of epothilone B7-O-beta-D-glucosyl- (1 → 2) -beta-D-glucosyl- (1 → 4) -beta-D glucoside on human liver cancer HepG2 were 3.40% (0.01. mu.M), 4.02% (0.1. mu.M), 13.19% (1. mu.M), 29.23% (5. mu.M), 62.26% (20. mu.M), 83.08% (100. mu.M), and 83.38% (200. mu.M), respectively.

In response, the inventors obtained the IC of four epothilone B glucoside compounds in human hepatoma cell HepG2 by fitting a curve non-linearly₅₀Value and IC on inhibition of Normal hepatocytes₅₀The values are as in tables 5 and 6:

TABLE 5 IC of epothilone B glucoside on human hepatoma cell HepG2₅₀Value of

TABLE 6 IC of epothilone B glucoside on human Normal hepatocytes HL7702₅₀Value of

And (4) conclusion: as can be seen from Table 5, epothilone B glucoside Compound 1 was present at a concentration of 9.84. mu.M (10)^-6M), has half inhibition effect on hepatoma cell HepG2, the activity is higher than that of Epothilone A7-O-beta-D glucoside (Epothilone A7-O-beta-D glucoside), and as can be seen from Table 6, the toxicity of compound 1 on normal hepatocyte HL7702 is reduced by 9430 times compared with Epothilone B technical product. Therefore, the compound is expected to be a candidate drug of a low-toxicity and high-efficiency inhibitor aiming at tumor cells such as liver cells.

Claims

1. A method for preparing epothilone B glucoside compounds by an enzyme method comprises the following steps:

wherein, the I62A mutant protein of the glycosyltransferase BsGT-1 takes pET28a-BsGT-1 recombinant plasmid as a template, and a mutant primer F-I62A is designed: CTTGAATgccGATCCTAAGCAAATCAGGGAGATG, respectively; R-I62A: TAGGATCggcATTCAAGGATGTATGATAGATCAATGC, generating linear recombinant mutant plasmid fragments through one-time PCR, and carrying out cyclization through recombination reaction to form I62A mutant pET28a-Bsgt-1 recombinant plasmid, and obtaining the recombinant plasmid through transformation of the recombinant plasmid and induced expression of protein; the compound 1 is: epothilone B7-O- β -D glucoside; the compound is 2: epothilone B7-O- β -D-glucosyl- (1 → 3) - β -D glucoside; compound 3 is: epothilone B7-O- β -D-glucosyl- (1 → 2) - β -D glucoside; compound 4 is: epothilone B7-O-beta-D-glucoside- (1 → 2) -beta-D-glucoside- (1 → 4) -beta-D glucoside.

2. The enzymatic preparation method of epothilone B glucosides according to claim 1, wherein: the molar ratio of the mixed epothilone B and UDP-O-beta-D-glucose is 1:5, and the epothilone B and the reaction mixed solution of the glycosylation mediated by the I62A mutant protein of the glycosyltransferase Bsgt-1 are incubated for 12 hours at 37 ℃.