CN111205343B - Nitrogen acetyl glucoside or galactoside compound of epothilone B, and enzymatic preparation and application thereof - Google Patents
Nitrogen acetyl glucoside or galactoside compound of epothilone B, and enzymatic preparation and application thereof Download PDFInfo
- Publication number
- CN111205343B CN111205343B CN202010019078.3A CN202010019078A CN111205343B CN 111205343 B CN111205343 B CN 111205343B CN 202010019078 A CN202010019078 A CN 202010019078A CN 111205343 B CN111205343 B CN 111205343B
- Authority
- CN
- China
- Prior art keywords
- epothilone
- compound
- bsgt
- galactoside
- glycosyltransferase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H17/00—Compounds containing heterocyclic radicals directly attached to hetero atoms of saccharide radicals
- C07H17/04—Heterocyclic radicals containing only oxygen as ring hetero atoms
- C07H17/08—Hetero rings containing eight or more ring members, e.g. erythromycins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/44—Preparation of O-glycosides, e.g. glucosides
- C12P19/60—Preparation of O-glycosides, e.g. glucosides having an oxygen of the saccharide radical directly bound to a non-saccharide heterocyclic ring or a condensed ring system containing a non-saccharide heterocyclic ring, e.g. coumermycin, novobiocin
- C12P19/62—Preparation of O-glycosides, e.g. glucosides having an oxygen of the saccharide radical directly bound to a non-saccharide heterocyclic ring or a condensed ring system containing a non-saccharide heterocyclic ring, e.g. coumermycin, novobiocin the hetero ring having eight or more ring members and only oxygen as ring hetero atoms, e.g. erythromycin, spiramycin, nystatin
Abstract
The invention discloses an epothilone B nitrogen acetyl glucoside or galactoside compound, which is epothilone B7-O-beta-D nitrogen acetyl glucoside or epothilone B7-O-beta-D galactoside. The compound is obtained by the glycosylation reaction of epothilone B, UDP-O-alpha-N-acetyl-Dglucose or UDP-O-alpha-D-galactonase and Q318C or M296A mutant protein of glycosyltransferase Bsgt-1. The invention also discloses application of the two compounds in preparing a medicament for preventing and treating liver cancer. Experiments prove that the compound epothilone B7-O-beta-D galactoside has a semi-inhibitory effect on human liver cancer cell HepG2 when the concentration is 1.09 mu M; and compared with epothilone B technical product, the toxicity to normal liver cells HL7702 is reduced by 3116 times. The glucoside is expected to increase the application value of the epothilone in the antitumor activity and improve the social benefit and the economic value.
Description
Technical Field
The invention relates to a group of epothilone B glycoside compounds and enzymatic preparation and application thereof, in particular to nitrogen acetyl glucoside or galactoside compounds of epothilone B and enzymatic preparation thereof, and application of the epothilone B glycoside compounds in preparation of medicaments for treating and preventing liver cancer. Belongs to the field of microbial technology, product and application technology.
Background
Sorangium cellulosum (Sorangium cellulosum) is a group of gram-negative bacteria widely distributed in soil. Can produce abundant secondary metabolites belonging to Myxococcus, Eurotiales, Eurotiaceae and Eurotium.
Epothilones (epothilones) are a class of 16-membered macrolides, currently derived only from Sorangium cellulosum. The epothilone and the paclitaxel inhibit the growth of tumors by polymerizing tubulin, but the epothilone has better inhibition activity on multi-drug resistant tumor cells, particularly paclitaxel resistant tumor cells, has the potential of large-scale fermentation production, and is considered to be a good substitute of the paclitaxel. The compound has two main products, namely epothilone A and epothilone B, and the structural formula of the compound is as follows:
structural formula of epothilones (R ═ H, epothilones A; R ═ CH3，epothilone B)
The chemical structure of epothilones is simpler than paclitaxel, comprising a 16-membered macrolactone ring, a ternary oxygen ring, and a thiazole ring side chain. The structural skeletons of the analogues of the epothilone are basically the same, and the epothilone B has one more methyl group than A on the 12-position carbon of the macrolide, so that the inhibitory activity on tumor cells is obviously improved. Currently, the epothilone B analog Ixabepilone (Ixabepilone) is approved by the FDA for the treatment of breast cancer, and in addition to Ixabepilone, a number of epothilone analogs are subject to various stages of clinical evaluation, e.g., paclitaxel (Patupilone), epothilone D (KOS-862), ZK-EPO, and ABJ 879. However, the epothilone analogs reported above all have strong neurotoxicity, blood toxicity or poor water solubility, which limits the clinical applications of epothilones. Based on this, reasonable post-modification of epothilone structures is essential.
Glycosylation modification of natural products catalyzed by glycosyltransferase is widely existed in nature, and the introduced glycosyl group has important improvement effect on water solubility, stability and biological activity of compounds. The reports of glycosylation modification of Epothilone are limited to Epothilone A found in 2010 and Epothilone A7-O-beta-D glucoside (Epothilone A7-O-beta-D glucoside) reported in 2014. However, only the organic chemically synthesized galac glycosylated Epothilone B or Epothilone B3-O-alpha-D arabinopyranoside has been reported for the glycosylation of Epothilone B with better antitumor activity, and other types of glycosylation products have not been reported. In addition, the step of synthesizing the glycosylation product of the Epothilone B by the organic chemical method is complicated (additional derivative groups are introduced in the chemical synthesis process of the glycosylated Epothilone B), the byproducts are many, the separation and the purification are difficult, and the defects of high difficulty of the organic chemical synthesis method, high synthesis condition requirement, difficulty in selective protection and the like exist. In view of this, there is an urgent need to find better various glycosylation modification alternatives to epothilone B, an important antitumor drug, and to prepare epothilone B glycosylation products of more abundant varieties.
Disclosure of Invention
Aiming at the defects of the prior art, the invention aims to provide a nitrogen acetyl glucoside or galactoside compound of epothilone B, an enzymatic preparation thereof and application of the epothilone B glucoside compound in preparation of a medicament for treating and preventing liver cancer.
The nitrogen acetyl glucoside or galactoside compound of the epothilone B is characterized in that the nitrogen acetyl glucoside compound of the epothilone B is a compound 1: epothilone B7-O- β -D azaacetylglucoside; the galactoside compound of epothilone B is compound 2: epothilone B7-O-beta-D galactoside; the compound structural formula, the connection mode and the corresponding names are as follows:
wherein: the galactoside compound of epothilone B is preferably compound 2: epothilone B7-O-beta-D galactoside.
The method for preparing the epothilone B nitrogen acetyl glucoside or the epothilone B galactoside by the enzyme method comprises the following steps:
the preparation of the epothilone B nitrogen acetyl glucoside by an enzyme method comprises the following steps: in the following proportions, 50mM Tris-HCl,10mM MgCl2In the buffer solution environment, the in vitro enzyme activity reaction experiment is carried out by using epothilone B with the final concentration of 10mM, UDP-O-alpha-D N-acetyl-glucose with the final concentration of 50mM and Q318C mutant protein of glycosyltransferase Bsgt-1 with the concentration of 500 mu g/ml;
and (3) preparing the epothilone B galactoside by an enzyme method: in the following proportions, 50mM Tris-HCl,10mM MgCl2In the buffer solution environment, the in vitro enzyme activity reaction experiment is carried out by using epothilone B with the final concentration of 10mM, UDP-O-alpha-D-galactonase with the final concentration of 50mM and M296A mutant protein of glycosyltransferase Bsgt-1 with the concentration of 500 mu g/ml;
respectively incubating the reaction mixed liquor at 37 +/-1 ℃ for 12 +/-2 hours, then adding 3 times of methanol in volume to terminate the reaction, removing protein precipitates at 14000r/min for 30min, carrying out rotary evaporation treatment on the sample, adding a methanol heavy suspension product, centrifuging at 14000r/min for 30min again, and separating and purifying the product by a semi-preparative liquid phase; the size specification of the chromatographic column is YMC-Pack Pro C18,250mm multiplied by 10.0mm,5 mu m; mobile phase system: elution with a 35:65 acetonitrile water system, peak time of epothilone B glycoside: compound 1: 13.9 min; compound 2: 14.4 min; the separated glycoside compounds are evaporated to dryness, respectively, and then dried with CD3OD dissolution, and respectively identifying by using UHPLC-ESI-Q-TOF high-resolution mass spectrum and nuclear magnetic resonance;
wherein the Q318C mutant protein of the glycosyltransferase BsGT-1 takes pET28a-BsGT-1 recombinant plasmid as a template, and a mutant primer is designed as follows:
F-Q318C：GTATGAGtgcGAGCTCACTGCAAATCGGGTTG；
R-Q318C：TGAGCTCgcaCTCATACATTTGCGGAATGACG；
generating a linear recombinant mutant plasmid fragment by one-time PCR, carrying out recombination reaction and cyclization to form a Q318C mutant pET28a-BsGT-1 recombinant plasmid, and carrying out transformation of the recombinant plasmid, induced expression of protein and purification to obtain the recombinant plasmid.
Similarly, the acquisition of the M296A mutein of glycosyltransferase Bsgt-1 was consistent with the acquisition of the Q318C mutein of glycosyltransferase Bsgt-1, and the mutant primers were designed as follows:
F-M296A：GGGgcaAACAGTACGATGGAAGCGATGAACGC；
R-M296A：ATCGTACTGTTtgcCCCGCCATGAGAGATGAACA；
the protein sequence of the glycosyltransferase BsGT-1(CUB50191) is published, and the glycosyltransferase BsGT-1 is obtained by extracting a B.subtilis JRS11 genome, designing a primer (F-BamHI: CGCGGATCCATGAAAAAGTACCATATTTCGAT; R-SalI: ACGCGTCGACTTACTGCGGGACAGCGGATTTTT), performing double enzyme digestion and connection to form a pET28a-BsGT-1 recombinant plasmid, and transforming Escherichia coli BL21(DE3) by a recombinant vector to induce and express.
The method for preparing the epothilone B nitrogen acetyl glucoside or the epothilone B galactosidase comprises the following steps: the molar ratio of epothilone B to UDP-O-alpha-N-acetyl-Dglucose or UDP-O-alpha-D-galactonase is preferably 1:5, and the reaction mixture for the glycosyltransferase Bsgt-1Q 318C or M296A mutein-mediated glycosylation reaction is preferably incubated at 37 ℃ for 12 hours.
The invention relates to application of an epothilone B nitrogen acetyl glucoside or epothilone B galactoside compound in preparation of a medicine for preventing and treating liver cancer.
The experiment proves that: the epothilone B nitrogen acetyl glucoside or epothilone B galactoside compound provided by the invention has prevention and treatment effects on liver cancer. Wherein, when the concentration of the epothilone B N-acetyl glucoside compound 1 is 19.76 mu M, the epothilone B N-acetyl glucoside compound has a half-inhibition effect on human liver cancer cells HepG 2; and the toxicity to normal liver cells HL7702 is reduced by 10604 times compared with the epothilone B technical product. Further comparative experiments showed that: when the concentration of the epothilone B galactoside compound 2 is 1.09 mu M, the compound has a semi-inhibitory effect on human liver cancer cells HepG 2; and compared with epothilone B technical product, the toxicity to normal liver cells HL7702 is reduced by 3116 times. The superiority of the compound 2 in the preparation of related pharmaceutical preparations is suggested. Therefore, compound 2: the epothilone B galactoside is used as a candidate drug of a low-toxicity and high-efficiency inhibitor for liver cancer cells, or is used as an effective component for preparing a pharmaceutical preparation related to preventing and treating liver cancer.
The invention discloses a nitrogen acetyl glucoside or galactoside compound of epothilone B and a method for preparing the compound by an enzymatic method, wherein the nitrogen acetyl glucoside or galactoside compound of epothilone B is synthesized by a mild enzymatic method, and the transformation of the nitrogen acetyl glucoside or the galactoside of epothilone B is realized in one step; the in vitro glycosylation reaction can recycle the raw materials; the enzyme is used as a mild catalyst and has strong plasticity, mutation is introduced into the enzyme to generate mutant enzyme with new function, thereby being beneficial to generating epothilone diversified glucoside. With the discovery and development of anticancer drugs, the clinical demand for novel anticancer drugs with low toxicity and high activity is increasing. The various novel epothilone B glycosides obtained by the invention are expected to gain the application value of the epothilone B glycosides in the antitumor activity, thereby generating good social benefit and economic value.
Drawings
FIG. 1: HPLC analysis chromatogram of mutant proteins Q318C and M296A for epothilone B glycosylation
Wherein, the peak time of two epothilone B glycosides is: compound 1: 13.9 min; compound 2: 14.4 min; the peak time of the Epothilone B standard (Epothilone B) was 28.4 min.
FIG. 2: compound 1: high-resolution mass spectrogram of epothilone B7-O-beta-D N-acetyl glucoside, and excimer ion peak [ M + H ]]+Is m/z 711.3395.
FIG. 3: compound 2: high resolution mass spectrogram of epothilone B7-O-beta-D galactoside, and excimer ion peak [ M + H ]]+Is m/z 670.3127.
Detailed Description
The present invention will be described in detail with reference to specific examples. The following examples are merely illustrative of the preferred embodiments of the present invention and are not intended to limit the present invention in any way, and any simple modifications, equivalent changes and modifications made to the embodiments according to the technical spirit of the present invention fall within the scope of the technical solution of the present invention.
The reagents, plasmids, strains, cells or experimental devices used in the present invention are all commercially available products.
Example 1 preparation of epothilone glycosyltransferase Bsgt-1 recombinant plasmids, construction of Q318C and M296A mutant recombinant plasmids, expression of Q318C and M296A mutant proteins, and preparation of two epothilone B glycosides
The inventor experimentally screens and determines a glycosyltransferase BsGT-1(CUB50191) capable of efficiently glycosylating epothilone B, and the protein sequence of the glycosyltransferase is published. The method for obtaining the recombinant plasmid of the epothilone glycosyltransferase BsGT-1 and expressing the recombinant plasmid to obtain the glycosyltransferase BsGT-1 comprises the following steps:
a gene fragment encoding glycosyltransferase BsGT-1 was obtained by extracting B.subtilis JRS11 genomic DNA, and a double enzyme digestion primer (F-BamHI: CGCGGATCCATGAAAAAGTACCATATTTCGAT; R-SalI: ACGCGTCGACTTACTGCGGGACAGCGGATTTTT) was designed using
Max Super-Fidelity DNA Polymerase high Fidelity Polymerase (PCR) is carried out, and the reaction system is as follows: 0.5 mu l of subtilis JRS11 genome DNA; 2 × Phanta Max Buffer 25 μ l; dNTP Mix (10mM each) 1. mu.l; 2. mu.l of F-BamHI (10. mu.M); R-SalI (10. mu.M) 2. mu.l; phanta Max Super-Fidelity DNA Polymerase 1. mu.l; sterile water was added to 50. mu.l. The PCR product was recovered by cutting gel, and double-digested with the pET28a plasmid using the restriction enzymes BamHI and SalI at 37 ℃ for 4 hours. And (3) re-cutting and recovering the digested PCR fragment and the linear fragment of the pET28a plasmid, then using T4 DNA ligase to perform overnight connection according to the molar ratio of the PCR product to the plasmid fragment of 1:5 at 16 ℃, then transforming the connection product into escherichia coli DH5 alpha, selecting a monoclonal shake bacterium, then sequencing, correctly determining the sequence as the pET28a-BsGT-1 recombinant plasmid, and transforming escherichia coli BL21(DE3) to induce and express to obtain the glycosyltransferase BsGT-1.
The inventors mutated glutamine at position 318 of the glycosyltransferase BsGT-1 to cysteine (Q318C) and methionine at position 296 to alanine (M296A), and expressed Q318C and M296A muteins using recombinant plasmids constructed with mutations of Q318C and M296A. The method for introducing mutation into glycosyltransferase Bsgt-1 comprises the following steps:
F-Q318C：GTATGAGtgcGAGCTCACTGCAAATCGGGTTG；
R-Q318C：TGAGCTCgcaCTCATACATTTGCGGAATGACG；
F-M296A：GGGgcaAACAGTACGATGGAAGCGATGAACGC；
R-M296A：ATCGTACTGTTtgcCCCGCCATGAGAGATGAACA；
By using
Carrying out PCR by using the MaxSuper-FidelityDNApolymerase high-fidelity enzyme and the recombinant plasmid pET28a-BsgT-1 as a template to form a linear fragment, wherein the reaction system comprises the following components: recombinant plasmid pET28a-BsgT-1 DNA 0.5 ul; 2X Phanta Max Buffer 25. mu.l; dNTP Mix (10mM each) 1. mu.l; 2. mu.l of F-Q318C (or F-M296A, 10. mu.M); 2 μ l of R-Q318C (or R-M296A, 10 μ M); phanta Max Super-Fidelity DNA Polymerase 1. mu.l; sterile water was added to 50. mu.l. Then, the system was demethylated (37 ℃ C., 1h) with DpnI to remove the template recombinant plasmid (reduce the generation of false positive), and then the recombinant cyclization was completed by recombinase ExnaseII, and further sequencing verification was performed. The pET28 a-BstGT-1 recombinant plasmid with correct sequencing mutation is transformed into Escherichia coli BL21(DE3), the transformant is transferred to 20ml LB culture medium added with kanamycin (the final concentration is 40 mu g/ml), the culture is carried out for 12 hours at 37 ℃ at 200r/min, then 20ml of seed liquid is respectively transferred to 1000ml of LB culture medium (added with 100 mu l of kanamycin with the concentration of 40 mg/ml), the amplification culture is carried out at 37 ℃, when the OD value reaches 0.6-0.8, IPTG with the final concentration of 0.1mM is added, then the culture is transferred to a shaking table at 16 ℃ and 200r/min, the culture is carried out for 24 hours, and the cells are collected by centrifugation for 5 minutes at 4 ℃ and 8000 r/min. The collected cells were resuspended in 100ml of Tris-HCl buffer (50mM Tris-HCl, pH 7.5), the resuspended cells were sonicated for 5min (5S sonication, 10S pause) in an ice-water mixture, the sonicated cells were centrifuged (12000r/min, 30min at 4 ℃), the supernatant and the pellet were separated, and then examined by SDS-PAGEThe expression of the mutant protein was determined.
The Q318C and M296A mutant proteins are purified by using nickel filler, the supernatant after ultrasonication is added into the nickel filler which is balanced by buffer (50mM Tris-HCl, pH 7.5) in advance, then the nickel filler is incubated for 12 hours at 4 ℃ overnight, then the incubated mixed solution is added into a purification column, the filler is naturally settled, after the buffer is washed and balanced, Tris-HCl buffer solutions (20mM,50mM,100mM,150mM,200mM and 250mM imidazole, 50mM Tris-HCl, pH 7.5) with different concentrations of imidazole are respectively used for elution into a centrifugal tube of 1.5ml, and then the proteins are collected and detected by SDS-PAGE. The collected purified protein was subjected to imidazole removal using a 30kDa ultrafiltration tube and concentrated, and a sample of the concentrated protein (Q318C and M296A mutant protein) was subjected to the next glycosylation reaction.
The separated and purified Q318C and M296A mutant protein of glycosyltransferase BsGT-1 are utilized to respectively prepare epothilone B7-O-beta-D nitrogen acetyl glucoside and epothilone B7-O-beta-D galactoside, and the preparation method and the reaction conditions are as follows:
4ml in vitro enzyme-activated reaction systems respectively comprise Q318C or M296A mutant proteins (500. mu.g/ml) of glycosyltransferase Bsgt-1, Tris-HCl buffer (50mM Tris-HCl,10mM MgCl)2) Epothilone B (10mM final concentration in DMSO, approximately 20mg) and UDP-O-. alpha. -D N-acetyl-glucose (or UDP-. alpha. -D-galactose, 50mM final concentration in water) were subjected to in vitro enzyme activity assays. Incubating the reaction mixed liquor at 37 ℃ for 12 hours, adding 3 times of methanol to terminate the reaction, removing protein precipitate within 30min at 14000r/min, carrying out rotary evaporation to dryness on the sample, adding methanol heavy suspension product, centrifuging again at 14000r/min for 30min, and separating and purifying the product by a semi-preparative liquid phase.
Preparation of the two epothilone B glycosides described above Using a YMC column (YMC-Pack Pro C18, 250mm. times.10.0 mm,5 μm), mobile phase system: acetonitrile water system elution (35:65), time to peak of four epothilone B glucosides: compound 1: 13.9 min; compound 2: 14.4 min. Evaporating the separated two compounds to dryness, and using CD3OD dissolution is carried out, and then UHPLC-ESI-Q-TOF high-resolution mass spectrum and nuclear magnetic resonance are respectively used for identification.
EXAMPLE 2 structural characterization of Compound 1
According to FIG. 2, UHPLC-ESI-Q-TOF high resolution mass spectrum shows the excimer peak [ M + H ] of compound 1]+M/z711.3395, suggesting that Compound 1 is a monoglycoside of acetoacetylglucose of epothilone B. Meanwhile, the monosaccharide can also be obtained from the NMR spectrum of the compound 1: (1H NMR) and carbon Spectroscopy (13C NMR) was confirmed. In the HMBC spectrum, H-7 is related to C-1 'and H-1' is related to C-7, so that the hydroxyl at the 7-position of the skeleton of epothilone B macrolide is determined to be connected with the N-acetylglucosamine. Larger coupling constant (J) between terminal protons H-1 'and H-2' on the sugar1',2'8.4Hz) and a terminal proton high field chemical shift value of 4.65ppm, revealing that the glycosyl donor and epothilone B acceptor are linked by a β -D glycosidic bond. Thus, compound 1 is Epothilone B7-O- β -D N-acetyl-glucoside, the specific nuclear magnetic data of which are shown in Table 1.
TABLE 1 nuclear magnetic data assignment for Compound 1
EXAMPLE 3 structural characterization of Compound 2
According to FIG. 3, the high resolution mass spectrum shows the excimer peak [ M + H ] of Compound 2]+At m/z670.3127, it is presumed to be the galactoside of epothilone B. Meanwhile, nuclear magnetic resonance hydrogen spectrum of Compound 2: (1H NMR) and carbon Spectroscopy (13C NMR) was further identified as epothilone B monoglycoside. In HMBC spectra, H-7 correlates with C-1 'and H-1' correlates with C-7, thus confirming that the N-acetylglucosyl group is linked to the hydroxyl group at position 7 of the epothilone B macrolide backbone. Sugar top terminal proton HLarger coupling constant (J) between-1' and H-21',2'7.2Hz) and a terminal proton high field chemical shift value of 4.42ppm, revealing that the glycosyl donor and epothilone B acceptor are linked by a β -D glycosidic bond. Thus, compound 2 is Epothilone B7-O-. beta. -D galactoside, with the nuclear magnetic data being reported in Table 2.
TABLE 2. nuclear magnetic data assignment for Compound 2.
Example 4 antitumor Activity testing of two epothilone B glycosides
The screening method comprises the following steps: method for reducing tetrazolium salt (MTT)
Cell line: HepG2 human liver cancer and Normal liver cell HL7702
Acting time: 48 hours
The experimental method comprises the following steps:
cells in the logarithmic growth phase were trypsinized, the reaction was stopped by adding a predetermined amount of culture medium, the cells were collected by centrifugation, and the cells were resuspended in 1ml of culture medium. Another sterile gun slot was taken, and the cell suspension was mixed well with fresh culture medium and added to a 96-well plate (marginal wells filled with sterile PBS). And (3) placing the inoculated cell culture plate into an incubator for culture and adherent growth until a cell monolayer is paved on a 96-hole bottom plate, respectively adding four epothilone B glucoside compounds with concentration gradient, wherein each hole is 100 mu l, and 4 parallel experiment multiple holes are arranged. 5% CO2Incubating at 37 deg.C for 48 hr, sucking out supernatant, washing with PBS for 2-3 times, adding 100 μ l MTT solution (0.5mg/ml, 0.5% MTT medium), culturing for 4 hr, discarding supernatant, washing with PBS for 2-3 times, and adding 100 μ l MTT solution into each welll dimethyl sulfoxide (DMSO), and shaking on a shaking bed at low speed for 10min to dissolve the crystals completely. The absorbance of each well was measured at OD 492nm of the microplate reader.
The inhibition rate of four epothilone B glycoside compounds on human liver cancer HepG2 is respectively measured under different drug concentrations:
compound 1: the inhibition rates of epothilone B7-O-beta-D N-acetyl glucoside on human liver cancer HepG2 are respectively 3.52% (0.01 mu M), 0.98% (0.1 mu M), 2.89% (1 mu M), 15.49% (5 mu M), 45.43% (20 mu M), 78.73% (100 mu M) and 83.52% (200 mu M);
compound 2: the inhibition rates of the epothilone B7-O-beta-D galactoside on human liver cancer HepG2 are respectively 2.89% (0.01 mu M), 6.74% (0.1 mu M), 46.78% (1 mu M), 55.82% (5 mu M), 69.93% (20 mu M) and 83.32% (100 mu M);
in response, the inventors determined the IC of two epothilone B glycoside compounds on human hepatoma cell HepG2 by non-linear fitting50Value and IC on inhibition of Normal hepatocytes50The values are as in tables 3 and 4:
TABLE 3 IC of two epothilone B glycosides on human hepatoma cell HepG250Value of
TABLE 4 IC of two epothilone B glycosides on human Normal hepatocyte HL770250Value of
And (4) conclusion: as can be seen from Table 3, epothilone B glycoside compound 2 was present at a concentration of 1.09. mu.M (10)-6M), has half inhibition effect on liver cancer cell HepG2, and as can be seen from Table 4, the toxicity of the compound 2 on normal liver cell HL7702 is reduced by 3116 times compared with epothilone B technical product. Therefore, the compound is expected to be a candidate drug of a low-toxicity and high-efficiency inhibitor aiming at tumor cells such as liver cells.
Claims (2)
1. An enzymatic method for the preparation of an epothilone B nitrogen acetyl glucoside or galactoside compound wherein the epothilone B nitrogen acetyl glucoside compound is compound 1: epothilone B7-O-beta-D azaacetylglucoside, wherein the galactoside compound of epothilone B is compound 2: epothilone B7-O-beta-D galactoside; the preparation steps are as follows:
the preparation of the epothilone B nitrogen acetyl glucoside by an enzyme method comprises the following steps: in the following proportions, 50mM Tris-HCl,10mM MgCl2In the buffer solution environment, the in vitro enzyme activity reaction experiment is carried out by using epothilone B with the final concentration of 10mM, UDP-O-alpha-D N-acetyl-glucose with the final concentration of 50mM and Q318C mutant protein of glycosyltransferase Bsgt-1 with the concentration of 500 mu g/ml;
and (3) preparing the epothilone B galactoside by an enzyme method: in the following proportions, 50mM Tris-HCl,10mM MgCl2In the buffer solution environment, the in vitro enzyme activity reaction experiment is carried out by using epothilone B with the final concentration of 10mM, UDP-O-alpha-D-galactonase with the final concentration of 50mM and M296A mutant protein of glycosyltransferase Bsgt-1 with the concentration of 500 mu g/ml;
respectively incubating the reaction mixed liquor at 37 +/-1 ℃ for 12 +/-2 hours, then adding 3 times of methanol in volume to terminate the reaction, removing protein precipitates at 14000r/min for 30min, carrying out rotary evaporation treatment on the sample, adding a methanol heavy suspension product, centrifuging at 14000r/min for 30min again, and separating and purifying the product by a semi-preparative liquid phase; the size specification of the chromatographic column is YMC-Pack Pro C18,250mm multiplied by 10.0mm,5 mu m; mobile phase system: elution with a 35:65 acetonitrile water system, peak time of epothilone B glycoside: compound 1: 13.9 min; compound 2: 14.4 min; the separated glycoside compounds are evaporated to dryness, respectively, and then dried with CD3OD dissolution, and respectively identifying by using UHPLC-ESI-Q-TOF high-resolution mass spectrum and nuclear magnetic resonance;
wherein the Q318C mutant protein of the glycosyltransferase BsGT-1 takes pET28a-BsGT-1 recombinant plasmid as a template, and a mutant primer is designed as follows:
F-Q318C：GTATGAGtgcGAGCTCACTGCAAATCGGGTTG；
R-Q318C：TGAGCTCgcaCTCATACATTTGCGGAATGACG；
generating a linear recombinant mutant plasmid fragment by PCR (polymerase chain reaction), performing cyclization by recombination reaction to form a Q318C mutant pET28a-BsGT-1 recombinant plasmid, and performing transformation of the recombinant plasmid, induced expression of protein and purification to obtain the recombinant plasmid;
similarly, the M296A mutein acquisition of glycosyltransferase Bsgt-1 is consistent with the Q318C mutein acquisition step of glycosyltransferase Bsgt-1, where the mutant primers were designed as:
F-M296A：GGGgcaAACAGTACGATGGAAGCGATGAACGC；
R-M296A：ATCGTACTGTTtgcCCCGCCATGAGAGATGAACA；
the protein sequence of the above glycosyltransferase BsGT-1(CUB50191), which was obtained by extracting b.subtiliss jrs11 genome, designing primer F-BamHI: CGCGGATCCATGAAAAAGTACCATATTTCGAT, respectively; R-SalI: ACGCGTCGACTTACTGCGGGACAGCGGATTTTT, and obtaining the recombinant plasmid pET28a-BsGT-1 through double enzyme digestion connection, and transforming Escherichia coli BL21(DE3) by the recombinant vector for induction expression.
2. The enzymatic process for the preparation of an acetoacetyl glucoside or galactoside compound of epothilone B of claim 1 wherein: the molar ratio of the epothilone B to UDP-O-alpha-N-acetyl-D glucose or UDP-O-alpha-D-galactonase is preferably 1:5, and the reaction mixture is incubated with the reaction mixture of the glycosyltransferase Bsgt-1Q 318C or M296A mutein-mediated glycosylation reaction at 37 ℃ for 12 hours.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010019078.3A CN111205343B (en) | 2020-01-08 | 2020-01-08 | Nitrogen acetyl glucoside or galactoside compound of epothilone B, and enzymatic preparation and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010019078.3A CN111205343B (en) | 2020-01-08 | 2020-01-08 | Nitrogen acetyl glucoside or galactoside compound of epothilone B, and enzymatic preparation and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111205343A CN111205343A (en) | 2020-05-29 |
| CN111205343B true CN111205343B (en) | 2022-06-14 |
Family
ID=70787418
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010019078.3A Active CN111205343B (en) | 2020-01-08 | 2020-01-08 | Nitrogen acetyl glucoside or galactoside compound of epothilone B, and enzymatic preparation and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111205343B (en) |
Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004050089A1 (en) * | 2002-12-05 | 2004-06-17 | Schering Ag | Epothilone analogs for site specific delivery in the treatment of proliferative diseases |
| CN101362784A (en) * | 2008-10-06 | 2009-02-11 | 山东大学 | Ebomycin glycosides compounds, composition using the same as activity component and use thereof |
| CN101643490A (en) * | 2008-08-07 | 2010-02-10 | 浙江海正药业股份有限公司 | Epothilonoside compound, preparation method and application as cytostatics thereof |
| WO2014185717A1 (en) * | 2013-05-15 | 2014-11-20 | 한국생명공학연구원 | Novel epothilone derivative and use thereof |
| KR20150086990A (en) * | 2014-01-21 | 2015-07-29 | 선문대학교 산학협력단 | Novel Epothilone Glycosides and Method for Preparing the Same |
| KR20170005591A (en) * | 2015-07-06 | 2017-01-16 | 선문대학교 산학협력단 | Novel Epothilone A derivatives and Uses Thereof |
| KR20170077422A (en) * | 2015-12-28 | 2017-07-06 | 선문대학교 산학협력단 | New Sialic Acid Derivatives of Epothilone A and Method for Producing the Same |
| CN109232684A (en) * | 2018-11-02 | 2019-01-18 | 蚌埠医学院 | 17-AAG glucoside and preparation method thereof and application in preparation of anti-tumor drugs |
-
2020
- 2020-01-08 CN CN202010019078.3A patent/CN111205343B/en active Active
Patent Citations (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004050089A1 (en) * | 2002-12-05 | 2004-06-17 | Schering Ag | Epothilone analogs for site specific delivery in the treatment of proliferative diseases |
| CN101643490A (en) * | 2008-08-07 | 2010-02-10 | 浙江海正药业股份有限公司 | Epothilonoside compound, preparation method and application as cytostatics thereof |
| CN101362784A (en) * | 2008-10-06 | 2009-02-11 | 山东大学 | Ebomycin glycosides compounds, composition using the same as activity component and use thereof |
| WO2014185717A1 (en) * | 2013-05-15 | 2014-11-20 | 한국생명공학연구원 | Novel epothilone derivative and use thereof |
| KR20150086990A (en) * | 2014-01-21 | 2015-07-29 | 선문대학교 산학협력단 | Novel Epothilone Glycosides and Method for Preparing the Same |
| KR20170005591A (en) * | 2015-07-06 | 2017-01-16 | 선문대학교 산학협력단 | Novel Epothilone A derivatives and Uses Thereof |
| KR20170077422A (en) * | 2015-12-28 | 2017-07-06 | 선문대학교 산학협력단 | New Sialic Acid Derivatives of Epothilone A and Method for Producing the Same |
| CN109232684A (en) * | 2018-11-02 | 2019-01-18 | 蚌埠医学院 | 17-AAG glucoside and preparation method thereof and application in preparation of anti-tumor drugs |
Non-Patent Citations (1)
| Title |
|---|
| Prakash Parajuli等.Enzymatic synthesis of lactosylated and sialylated derivatives of epothilone A.《Glycoconj J》.2016,第33卷第137-146页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111205343A (en) | 2020-05-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220168428A1 (en) | Cannabinoid glycoside prodrugs and methods of synthesis | |
| Xu et al. | Nocardiopsistins AC: New angucyclines with anti-MRSA activity isolated from a marine sponge-derived Nocardiopsis sp. HB-J378 | |
| Fan et al. | Switching glycosyltransferase UGT BL 1 regioselectivity toward polydatin synthesis using a semi-rational design | |
| CN111635418A (en) | Maytansinoid derivative and synthetic method and application thereof | |
| Jayasuriya et al. | Isolation and structure elucidation of thiazomycin | |
| Liu et al. | Recent advances in methods of puerarin biotransformation | |
| CN111205343B (en) | Nitrogen acetyl glucoside or galactoside compound of epothilone B, and enzymatic preparation and application thereof | |
| CN112010924B (en) | Novel Nosiheptide glycosylated derivative and preparation method and application thereof | |
| CN112142819B (en) | Application of betulinic acid derivative in preparation of antitumor drugs | |
| Wu et al. | Design, synthesis, and anti-tobacco mosaic virus (TMV) activity of glycoconjugates of phenanthroindolizidines alkaloids | |
| CN111138444B (en) | Epothilone B glucoside compounds and enzymatic preparation and application thereof | |
| Jha et al. | Structural modification of herboxidiene by substrate-flexible cytochrome P450 and glycosyltransferase | |
| CN109985044B (en) | Application of betulin and its derivatives in preparing antitumor drugs | |
| Keller et al. | Persicamidines—Unprecedented sesquarterpenoids with potent antiviral bioactivity against coronaviruses | |
| WO2019227969A1 (en) | Ansamycin all-carbon cycle polyketide-type antibiotic and uses thereof in preparing antimicrobial medications or anti-tumor medications | |
| CN111170975B (en) | Antibiotic lobophorin, preparation method and application thereof | |
| Zhang et al. | Identification of neuroprotective spoxazomicin and oxachelin glycosides via chemoenzymatic glycosyl-scanning | |
| CN112500348B (en) | Geldanamycin derivatives, preparation method thereof and application thereof in preparing antitumor drugs | |
| CN109836433B (en) | Novel LL-D49194 alpha 1 analogue, and preparation method and application thereof | |
| CN108948109B (en) | Raffinolactone glycoside compound and application thereof | |
| Ren et al. | Creating diverse glycosides of 2′-hydroxyflavone through microbial glycosylation | |
| EP0245012A1 (en) | Method for the preparation of 14-hydroxy-6-0-methyl-erythromycin A | |
| CN106916835B (en) | Biosynthetic gene cluster of compounds and application thereof | |
| Kumar et al. | Reagent-controlled chemo/stereoselective glycosylation of ʟ-fucal to access rare deoxysugars | |
| CN113025549B (en) | Biological glycosyl synthesis system of staurosporine framework compound and synthesis method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |