CN113025549B

CN113025549B - Biological glycosyl synthesis system of staurosporine framework compound and synthesis method thereof

Info

Publication number: CN113025549B
Application number: CN202110420198.9A
Authority: CN
Inventors: 李永安; 刁刘洋; 周亚维
Original assignee: Baishi Pharmaceutical Suzhou Co ltd
Current assignee: Baishi Pharmaceutical Suzhou Co ltd
Priority date: 2021-04-19
Filing date: 2021-04-19
Publication date: 2023-06-02
Anticipated expiration: 2041-04-19
Also published as: CN113025549A

Abstract

The invention provides a biological glycosyl synthesis system of a staurosporine skeleton compound and a synthesis method thereof, and in particular relates to L-rhamnosylation. Wherein, the biological glycosyl synthesis system and the synthesis method thereof can be carried out in vitro or in vivo. The synthesis system and the synthesis method thereof can be used for synthesizing a large number of L-rhamnosylation products of staurosporine mother nucleus K252c and derivatives thereof with different structures. The L-rhamnosylated product has similar structure to that of staurosporine, may have kinase inhibiting activity and/or selectivity the same as or better than that of staurosporine, and has important significance in screening kinase inhibiting medicines.

Description

Biological glycosyl synthesis system of staurosporine framework compound and synthesis method thereof

Technical Field

The invention belongs to the technical field of biosynthesis, relates to biosynthesis of staurosporine compounds, and in particular relates to a biological glycosyl synthesis system of a staurosporine skeleton compound and a synthesis method thereof.

Background

Staurosporine (Staurosporine) is a natural product derived from actinomycetes and was originally isolated from Streptomyces Streptomyces staurosporeus by researchers in 1977 and has a broad spectrum potent kinase inhibitory activity. Kinase inhibitory activity is critical to human health, and on the one hand, the causative factor of cancer often results from abnormal activation of kinases in the signaling pathway; on the other hand, autoimmune diseases, neurodegenerative diseases and other common high-incidence chronic diseases are also closely related to abnormal kinase. It is not completely counted that staurosporine can effectively inhibit more than 200 human kinases, and the half inhibition concentration (IC 50) of a plurality of kinases can reach the nM level.

Due to the poor selectivity, only Midostaurin (Midostaurin) is currently marketed in the united states in 2017 for the treatment of acute myelogenous leukemia. At present, antitumor drugs mainly originate from natural product analogues, so that effective synthesis technology of staurosporine analogues is developed, analogue libraries of the staurosporine analogues are constructed, and then high-selectivity compounds are obtained through screening, so that the active compounds are key factors for facilitating wide patent medicine of the compounds. Because of the complex structure, the synthesis of a library of staurosporine analogues by chemical means is more difficult to discover. Thus, biosynthesis of staurosporine analogs and construction of libraries of analogs has become a viable and competitive technique.

The biosynthetic pathway of staurosporine is shown in formula I (R group represents=O or=NH, both of which are reversible), and the core structure of the staurosporine comprises a parent nucleus and glycosyl groups, namely K252c and L-ritosamine (L-ritosamine).

/>

Under the catalysis of various enzymes, L-tryptophan is subjected to biocatalytic synthesis reaction to obtain CPA, K252c and holysine A, and then subsequent modification such as methylation is carried out to obtain the staurosporine. Among them, the staurosporine analogues such as K252c and holysine A also have remarkable kinase inhibitory activity.

Although there are a large number of kinase inhibitors in the lot, there is still a significant unmet clinical need for cancer due to the wide variety of cancers, the wide variety of abnormal kinases involved, and the variety of variation types, and post-use drug resistance. In addition, only about 25 kinases are targeted in the currently marketed drugs, only accounting for 5% of 518 kinases in human bodies, and a large number of kinases are not ready for use, which means that the development space of the kinase inhibition drugs is huge.

Therefore, the biological synthesis system and the synthesis method thereof are provided, and a large number of staurosporine analogues with different structures are synthesized, so that the method has important significance for screening kinase inhibition medicines.

Disclosure of Invention

Aiming at the defects existing in the prior art, the invention aims to provide a biological glycosyl synthesis system of a staurosporine framework compound and a synthesis method thereof. The synthesis system and the synthesis method thereof can synthesize a large number of staurosporine compounds with different structures, construct a staurosporine analogue library, screen out high-selectivity and high-activity compounds from the library, and further develop safe and effective novel kinase inhibitor medicines, thereby meeting the important clinical treatment demands of cancer patients.

To achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the invention provides a recombinant E.coli for the production of StaG, comprising an expression vector for expressing StaG.

Preferably, the amino acid sequence of the glycosyltransferase StaG is shown as SEQ ID NO. 1;

preferably, the nucleotide sequence encoding the glycosyltransferase StaG is shown in SEQ ID NO. 2.

In the present invention, the amino acid sequence of glycosyltransferase StaG is selected from Uniprot ID: q83WG5, the amino acid sequence of which SEQ ID NO.1 is:

MTRVLIATTPAPGHVVSMLEVAGELARRGHEVRWYTGRAFQRQVERVGAHFEPMSPELDFSGRSREEAFPEHAGLSGLTNFKIGVRDIFYRTAPRQMDDLSKILERFPADCLLADDMCYGACFVGERTGIPVAWLANSVYILGSRDTAPLGRGLGPASSPLGRVRNALLRFVCDHVVMRDMRQEADRVRALVGLDRLRSSAMENIARPPALYLLGTVPSFEFPRSDLLPGTHFVGPLLGVPPEHFDPPAWWEDLDGGRPVVLITQGTTANDVDGLLRPALRALADQEVLVVVTTGSDLDVERLRPLPANVRLERFVPYHHLLPRVDAMVTNGGYNGVNAALAQGVPLVVVPGSEEKPDVAARVEWAGAGVVLERRPVSEADLREAVTTVLRDGSHRRRARALAEEHGSVDAPRRAADLIESMADSQGQIPTGGITR

SEQ ID NO.2 is:

atgacccgtgtgctgattgcgaccaccccggcgccgggtcatgtggttagcatgctggaagtggcgggtgaactggcgcgtcgtggtcacgaggttcgttggtacaccggtcgtgcgtttcagcgtcaagtggaacgtgttggcgcgcacttcgagccgatgagcccggaactggactttagcggtcgtagccgtgaggaagcgttcccggagcatgcgggtctgagcggtctgaccaacttcaagatcggcgtgcgtgacatcttctaccgtaccgcgccgcgtcagatggacgatctgagcaaaattctggagcgttttccggcggattgcctgctggcggacgatatgtgctacggtgcgtgcttcgttggcgaacgtaccggtatcccggtggcgtggctggcgaacagcgtttatattctgggtagccgtgacaccgcgccgctgggtcgtggcctgggtccggcgagcagcccgctgggccgtgtgcgtaacgcgctgctgcgtttcgtttgcgaccacgtggttatgcgtgatatgcgtcaagaggcggaccgtgtgcgtgcgctggttggcctggatcgtctgcgtagcagcgcgatggagaacattgcgcgtccgccggcgctgtacctgctgggcaccgtgccgagcttcgaatttccgcgtagcgacctgctgccgggcacccactttgttggtccgctgctgggtgttccgccggagcactttgatccgccggcgtggtgggaagacctggatggtggccgtccggtggttctgattacccagggcaccaccgcgaacgacgttgatggtctgctgcgtccggcgctgcgtgcgctggcggaccaggaagttctggtggtggtgaccaccggtagcgacctggatgttgaacgtctgcgtccgctgccggcgaacgtgcgtctggaacgttttgttccgtaccaccacctgctgccgcgtgtggacgcgatggttaccaacggtggctataacggtgtgaacgcggcgctggcgcagggtgttccgctggttgtggttccgggcagcgaggaaaagccggatgttgcggcgcgtgttgaatgggcgggtgcgggtgtggttctggagcgtcgtccggttagcgaggcggacctgcgtgaagcggtgaccaccgttctgcgtgatggtagccatcgtcgtcgtgcgcgtgcgctggcggaggaacatggcagcgttgatgcgccgcgtcgtgcggcggacctgatcgaaagcatggcggatagccagggtcaaatcccgaccggtggcattacccgttaa

there are numerous glycosyltransferases whose substrate specificity is manifested in two ways, one for the glycosyl donor substrate and one for the glycosyl acceptor substrate. The glycosyltransferase StaG of the present invention needs to be a glycosyl donor substrate which is an activated monosaccharide in dTDP form, for example: dTDP-L-rhamnose; the glycosyl acceptor substrate can be staurosporine mother nucleus K252c and derivatives thereof. The synthesis of activated monosaccharides in the form of dTDP is difficult, commercially difficult, and a few available monosaccharides are extremely expensive, such as dTDP-L-rhamnose. However, escherichia coli, which naturally synthesizes dTDP-L-rhamnose, naturally contains dTDP-L-rhamnose in its cell and is useful as a glycosyl donor substrate for glycosyltransferase StaG.

In the invention, the glycosyltransferase StaG not only can be functionally expressed in escherichia coli, but also can carry out L-rhamnose reaction on the staurosporine mother nucleus K252c and derivatives thereof in an in-vivo or in-vitro mode by relying on dTDP-L-rhamnose generated by escherichia coli, so that the problem of shortage of glycosyl donors in the actual synthesis process can be avoided, and of course, if the yield is further improved, an exogenous glycosyl donor dTDP-L-rhamnose can be properly added in the in-vitro synthesis process.

In a second aspect, the present invention provides a biological glycosylation (glycation) synthesis system of a staurosporine framework compound, the biological glycosylation synthesis system comprising: staG is a staurosporine parent K252c and/or K252c derivative, dTDP-L-rhamnose (2 '-deoxythymidine-5' -diphosphate-L-rhamnose, dTDP-L-rhamnose) and glycosyltransferase (Glycosyl Transferases, GT).

Wherein, the dTDP-L-rhamnose is an important glycosyl donor in a bacterial body and participates in synthesizing various bacterial polysaccharides. Coli such as BL21 (DE 3) strain is capable of synthesizing dTDP-L-rhamnose.

As a preferred embodiment of the present invention, the glycosyltransferase StaG is present in the form of a glycosyltransferase liquid (the synthesis system may be abbreviated as an in vitro synthesis system) or the glycosyltransferase StaG is present in the recombinant E.coli strain according to the first aspect (the synthesis system may be abbreviated as an in vivo synthesis system).

The biological glycosyl synthesis system provided by the invention comprises an in vitro synthesis system and an in vivo synthesis system. For in vitro synthesis systems, the reaction is carried out in vitro and non-cell, i.e. the recombinant bacteria are cultured to obtain the bacterial cells, the bacterial cells are broken and the supernatant is taken to obtain an enzyme solution containing glycosyltransferase StaG, which also contains endogenous dTDP-L-rhamnose, or the glycosyltransferase StaG is purified. Under the catalysis of glycosyltransferase StaG, the L-rhamnosylation reaction of exogenously added staurosporine mother nucleus K252c and analogues thereof is catalyzed in vitro by taking the endogenous dTDP-L-rhamnose additionally added and/or contained in enzyme solution as glycosyl donor; for in vivo synthesis systems, the reaction is carried out in cells, i.e. the L-rhamnosylation of exogenously added staurosporine mother nucleus K252c and derivatives thereof is catalyzed in cells by intracellular synthesis of dTDP-L-rhamnose as a glycosyl donor under the catalysis of intracellular expressed glycosyltransferase StaG. The two are different in that the in-vivo synthesis system directly utilizes the escherichia coli culture to react without cracking escherichia coli or purifying glycosyltransferase StaG, and compared with the in-vitro synthesis system, the in-vivo synthesis system has convenient operation; and dTDP-L-rhamnose is high in price, and an in-vivo synthesis system can utilize dTDP-L-rhamnose endogenous in escherichia coli to effectively reduce cost, so that the in-vivo synthesis system has higher application value.

Natural products tend to be structurally complex, containing multiple chiral centers. Compared to chemical synthesis, biosynthesis is more advantageous due to regio-and stereoselectivity. Especially the increasingly mature principles and techniques of synthetic biology, make efficient synthesis of natural product analogs easy to implement. More importantly, biosynthesis also takes full advantage of the flexibility of chemical synthesis to provide it with structurally diverse synthetic materials, thereby producing structurally diverse non-natural analogs. By constructing a non-natural analogue library, the high-selectivity and high-activity compound is screened out, so that safe and effective novel kinase inhibitor medicines can be developed.

Glycosylation is an important modification step of natural products, and is more difficult to carry out by adopting a chemical method due to the fact that a glycosyl contains a plurality of chiral hydroxyl groups. Glycosyl synthesis is carried out on a substrate by utilizing glycosyltransferase, so that various compounds with similar structures can be obtained, and further, a compound library is enriched to achieve the purpose of screening new tumor drugs.

The glycosyltransferase StaG described in the present invention has different properties compared to other glycosyltransferases such as RebG (UniProt: Q8KHE 4) and the like. For example: in the practical experimental process, the recombinant escherichia coli expression strain of the RebG is constructed, the glycosyl donor can be dTDP-D-glucose, but can not be dTDP-L-rhamnose, and the glycosyl acceptor can be K252c and derivatives thereof such as Arcyriafilavin A. Coli is also capable of naturally synthesizing dTDP-D-glucose, so dTDP-D-glucose is also present in its cells. The experimental procedure is the same as that of StaG, and the experimental result proves that: in vitro glycosylation experiments, rebG was not catalytically active and was unable to D-glycosylate K252c and its derivative arceriaflavin a; however, in vivo glycosylation experiments, rebG is catalytically active and is capable of D-glycosylation of K252c and its derivative arceriaflavin a.

In the invention, the general formula (namely, a staurosporine skeleton) of the staurosporine mother nucleus K252c and/or the K252c derivative is shown as a formula II:

wherein R represents-H or=o, and R1' are any organic groups satisfying the chemical environment thereof.

In the present invention, R1 may represent-H, -F, -CH ₃ 、-OH、-OCH ₃ 、-Cl、-Br、-NH ₂ 、-CN、-NO ₂ Monosubstituted or polysubstituted at positions 4, 5, 6 or 7, R1' may represent-H, -F, -CH ₃ 、-OH、-OCH ₃ 、-Cl、-Br、-NH ₂ 、-CN、-NO ₂ And single or multiple substitutions at positions 4, 5, 6 or 7. In the invention, experiments prove that the glycosylation process can be completed for various groups.

Preferably, the glycosyltransferase solution is a supernatant obtained after disruption of a recombinant strain expressing the glycosyltransferase StaG.

Preferably, the dTDP-L-rhamnose in the biose-based synthesis system comprises additional dTDP-L-rhamnose and/or dTDP-L-rhamnose present in the glycosyltransferase solution.

Preferably, in the biological glycosyl synthesis system, the glycosyltransferases StaG and dTDP-L-rhamnose are present in the recombinant E.coli according to the first aspect.

Preferably, the molar concentration of the staurosporine mother core K252c and/or the K252c derivative in the biosynthesized system (including in vitro synthesis system and in vivo synthesis system) is 100 to 300. Mu.M, and may be, for example, 100. Mu.M, 120. Mu.M, 140. Mu.M, 150. Mu.M, 160. Mu.M, 180. Mu.M, 200. Mu.M, 210. Mu.M, 220. Mu.M, 250. Mu.M, 260. Mu.M, 280. Mu.M, 300. Mu.M, or the like.

Preferably, in the in vitro synthesis system, the total protein mass concentration of the glycosyltransferase solution is 40 to 80mg/mL, and may be, for example, 40mg/mL, 45mg/mL, 50mg/mL, 55mg/mL, 60mg/mL, 65mg/mL, 70mg/mL, 75mg/mL, 80mg/mL, or the like.

Preferably, in the in vitro synthesis system, the molar concentration of the additional activated monosaccharide added is 200 to 600. Mu.M, which may be, for example, 200. Mu.M, 250. Mu.M, 300. Mu.M, 350. Mu.M, 400. Mu.M, 450. Mu.M, 500. Mu.M, 550. Mu.M, 600. Mu.M, etc. On the one hand, the activated monosaccharide cannot penetrate the cell membrane to participate in the reaction, and on the other hand, endogenous activated monosaccharide exists in the escherichia coli, and no additional addition is needed, so that the experimental cost is greatly reduced.

In a third aspect, the present invention also provides a method of biosaccharide synthesis of a staurosporine framework compound, the biosaccharide synthesis method comprising:

preparing an enzyme solution containing glycosyltransferase StaG or purifying to obtain glycosyltransferase StaG to obtain glycosyltransferase solution, mixing with raw materials in proportion to obtain an in-vitro synthesis system in the biological glycosyl synthesis system according to the second aspect, and reacting to obtain the staurosporine skeleton compound;

alternatively, the biological glycosyl synthesis method comprises:

and mixing the staurosporine mother nucleus K252c and derivatives thereof with recombinant escherichia coli cultures expressing glycosyltransferase StaG to obtain an in-vivo synthesis system in the biological glycosyl synthesis system according to the second aspect, and reacting to obtain the staurosporine skeleton compound.

As a preferable embodiment of the present invention, the reaction temperature is 20 to 25℃and may be, for example, 20℃21℃22℃23℃24℃25 ℃.

Preferably, the reaction time is 10 to 20 hours, and may be, for example, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, or the like.

Preferably, the reaction further comprises a step of heating.

Preferably, the heating temperature is 80 to 85 ℃, for example, 80 ℃, 81 ℃, 82 ℃, 83 ℃, 84 ℃, 85 ℃, or the like. The heating may use a metal bath to inactivate enzymes in the synthesis system, and may also be advantageous for subsequent extraction steps.

Preferably, the heating time is 10 to 15min, for example, 10min, 10.5min, 11min, 11.5min, 12min, 12.5min, 13min, 14min or 15min, etc.

Preferably, the reaction is followed by an extraction step.

Preferably, the extractant used for the extraction comprises ethyl acetate.

Preferably, the extraction temperature is 30 to 37 ℃, for example, 30 ℃, 31 ℃, 32 ℃, 33 ℃, 34 ℃, 35 ℃, 36 ℃,37 ℃ or the like.

Preferably, the extraction time is 20-40 min, for example, 20min, 22min, 24min, 25min, 28min, 30min, 32min, 35min, 36min, 38min or 40min, etc.

As a preferred technical scheme of the invention, the enzyme solution containing glycosyltransferase StaG is prepared by adopting the following method:

connecting a nucleotide sequence for encoding the glycosyltransferase StaG to an expression vector, and introducing the expression vector into escherichia coli to obtain recombinant escherichia coli;

culturing the recombinant cells, and expressing the glycosyltransferase StaG through an optional induction step (the induction step is aimed at an induction type expression vector, and the induction step is not needed for a constitutive expression vector), centrifuging the obtained liquid, and taking the supernatant after cell disruption to obtain the enzyme liquid containing the glycosyltransferase StaG;

preferably, the inducer used for the induction comprises 0.05 to 0.5mM IPTG, and may be, for example, 0.05mM, 0.08mM, 0.1mM, 0.15mM, 0.2mM, 0.25mM, 0.3mM, 0.35mM, 0.4mM or 0.5mM, etc.

Preferably, the temperature of the induction is 16 to 25 ℃, and may be, for example, 16 ℃, 17 ℃, 18 ℃, 19 ℃,20 ℃, 21 ℃, 22 ℃, 23 ℃, 24 ℃, 25 ℃, or the like.

Preferably, the induction time is 12 to 20 hours, and may be, for example, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, or the like.

Preferably, the recombinant E.coli culture expressing the glycosyltransferase StaG is prepared by the following method:

culturing the recombinant cells, and expressing the glycosyltransferase StaG through an optional induction step to obtain a recombinant escherichia coli culture for expressing the glycosyltransferase StaG;

preferably, in preparing the recombinant E.coli culture expressing glycosyltransferase StaG, the inducer used for the induction comprises 0.05-0.5 mM IPTG, for example, 0.05mM, 0.08mM, 0.1mM, 0.15mM, 0.2mM, 0.25mM, 0.3mM, 0.35mM, 0.4mM or 0.5mM, etc.

Preferably, in preparing the recombinant E.coli culture expressing glycosyltransferase StaG, the temperature of the induction is 16 to 25℃and may be, for example, 16℃17℃18℃19℃20℃21℃22℃23℃24℃25 ℃.

Preferably, when preparing the recombinant E.coli culture expressing glycosyltransferase StaG, the induction time is 2-3 h, for example, 2h, 2.2h, 2.4h, 2.5h, 2.6h, 2.8h or 3h, etc.

As a preferable technical scheme of the invention, the biological glycosyl synthesis method comprises the following steps:

(1) Connecting a nucleotide sequence for encoding the glycosyltransferase StaG to an expression vector, and introducing the expression vector into escherichia coli to obtain recombinant escherichia coli;

(2) Culturing the recombinant escherichia coli, inducing the recombinant escherichia coli for 12-20 hours at 16-25 ℃ by using 0.05-0.5 mM IPTG, expressing the glycosyltransferase StaG, centrifuging the obtained culture, crushing cells, and taking the supernatant to obtain the enzyme solution containing the glycosyltransferase StaG;

(3) Adding a staurosporine mother nucleus K252c and/or a K252c derivative, optionally adding additional dTDP-L-rhamnose to obtain a biological glycosyl synthesis system, reacting for 10-20 h at 20-25 ℃, heating for 10-15 min at 80-85 ℃, and extracting by adopting ethyl acetate to obtain the staurosporine skeleton compound;

alternatively, the biological glycosyl synthesis method comprises the following steps:

(1') ligating a nucleotide sequence encoding the glycosyltransferase StaG to an expression vector, and introducing the expression vector into escherichia coli to obtain recombinant escherichia coli;

(2') culturing said recombinant E.coli, inducing it with 0.05-0.5 mM IPTG at 16-25℃for 2-3 hours, expressing said glycosyltransferase StaG;

(3') directly adding the staurosporine mother nucleus K252c and/or the K252c derivative into the recombinant escherichia coli culture medium, reacting for 10-20 hours at 20-25 ℃, heating for 10-15 minutes at 80-85 ℃, centrifugally collecting the supernatant, and extracting by adopting ethyl acetate to obtain the staurosporine skeleton compound.

In the invention, a recombinant escherichia coli for expressing glycosyltransferase StaG is constructed by utilizing a protein recombinant expression technology. By culturing recombinant bacteria and lysing the bacteria, an enzyme solution containing glycosyltransferase StaG is obtained, which also contains endogenous dTDP-L-rhamnose.

The StaG enzyme is catalyzed by glycosyltransferase in enzyme liquid, and StaG mother nucleus and analogues thereof can take endogenous dTDP-L-rhamnose added exogenously and/or contained in enzyme liquid as glycosyl donor to carry out glycosylation, so as to convert into different StaG analogues;

alternatively, the staurosporine mother nucleus K252c and analogues thereof are added to a culture of glycosyltransferase StaG expressing bacteria, which is capable of penetrating the cell membrane into the cell, and under the catalysis of glycosyltransferase StaG, is capable of glycosylation with dTDP-L-rhamnose synthesized in vivo, thereby converting into different staurosporine analogues.

In addition, in order to further expand the diversity of staurosporine framework compounds, in the preparation process of the starting staurosporine mother core K252c and/or K252c derivatives, the invention can be prepared by adopting the following catalytic system:

l-tryptophan and/or L-tryptophan derivatives are used as synthesis raw materials, and L-tryptophan oxidase VioA (GenBank number: AAD 51808.1), CPA synthetase VioB (GenBank number: AAD 51809.1), cytochrome P450 enzyme StaP or RebP (GenBank number: BAC55212.1, CAC 93717.1) and monooxygenase SpcC (GenBank number: AGL 96582.1) are used for biocatalysis to obtain K252c and/or K252c derivatives with more types and high yield.

Similarly, the enzyme can be expressed by using escherichia coli to obtain enzyme liquid, and then the enzyme liquid is subjected to catalytic synthesis in vitro, and by matching with the catalytic synthesis system, the invention can obtain various compounds with staurosporine skeletons from L-tryptophan and/or L-tryptophan derivatives.

The numerical ranges recited herein include not only the recited point values, but also any point values between the recited numerical ranges that are not recited, and are limited to, and for the sake of brevity, the invention is not intended to be exhaustive of the specific point values that the recited range includes.

Compared with the prior art, the invention has the beneficial effects that:

the biological glycosyl synthesis system and the synthesis method thereof are mainly used for L-rhamnosylation of K252c and derivatives thereof, so that different staurosporine analogues are synthesized, a compound library is further formed, and the biological glycosyl synthesis system is used for discovering new kinase inhibitor medicines; the glycosyltransferase StaG used in the synthesis system can efficiently catalyze K252c and derivatives thereof to synthesize a compound containing a staurosporine skeleton by taking dTDP-L-rhamnose as a substrate.

Meanwhile, the biological glycosylation reaction is simple to operate and can be synthesized in vivo or in vitro, namely, the glycosylation reaction can carry out glycosylation on a substrate by taking additionally added and/or endogenous activated monosaccharide as a glycosyl donor in enzyme liquid containing glycosyl transferase StaG, so that the substrate is converted into different staurosporine analogues; the substrate can also be directly mixed with a recombinant bacterium culture for expressing glycosyltransferase StaG, the substrate penetrates through a cell membrane to enter cells, and the StaG takes endogenous activated monosaccharide as a donor to complete glycosylation; therefore, the biological glycosylation reaction disclosed by the invention is simple to operate, has higher efficiency, and is suitable for synthesizing and screening new kinase inhibitor medicines.

Drawings

FIG. 1 is a graph of the results obtained after LCMS detection of K252c and its L-rhamnosylated product K252c-L-Rha1, wherein the graph I is the ultraviolet absorbance spectrum of the sample at 290nm, the graph II is the ion spectrum of the sample with a mass-to-charge ratio (m/z) of 312, and the graph III is the ion spectrum of the sample with a mass-to-charge ratio (m/z) of 458.

Detailed Description

The following embodiments are merely simple examples of the present invention, and do not represent or limit the scope of the claims of the present invention.

In the following examples, reagents and consumables were purchased from the manufacturers of reagents as conventional in the art unless otherwise specified; unless otherwise indicated, all methods and techniques used are those conventional in the art.

Example 1

This example was used to construct plasmids and recombinant cells expressing the glycosyltransferase StaG.

The method specifically comprises the following steps:

(1) The amino acid sequence of glycosyltransferase StaG is selected from the group consisting of UniProt ID: q83WG5, optimizing the gene into codons favored by escherichia coli, and synthesizing a DNA sequence for encoding the StaG through total genes, wherein the DNA sequence is shown as SEQ ID NO. 2;

(2) The corresponding expression plasmid pET30a-staG is obtained by double digestion of NdeI and HindIII and loading of an expression vector pET-30a (+);

(3) The expression plasmid pET30a-staG is introduced into a host bacterium BL21 (DE 3) to obtain a corresponding expression strain BL21 (DE 3)/pET 30a-staG.

Example 2

This example was used to prepare an enzyme solution containing the glycosyltransferase StaG. The method comprises the following specific steps:

(1) The strain BL21 (DE 3)/pET 30a-staG prepared in example 1 was inoculated into a 5L fermenter (Shanghai Bairen) containing TB medium for cultivation at 37 ℃;

(2) Concentration OD of bacterial liquid ₆₀₀ When the temperature is 0.4-0.6, adding inducer 0.1mM IPTG, and inducing expression for 16h at 20 ℃;

(3) After the completion of the centrifugation, the cells were collected by centrifugation, washed 2 times with a buffer (100 mM Tris-HCl,150mM NaCl,pH: 7), and resuspended in a buffer (100 mM Tris-HCl,150mM NaCl,20% glycerol, pH 7) to obtain an OD ₆₀₀ About 500;

(4) After the bacterial suspension is fully crushed by a high-pressure cell crusher (Shanghai permanent connection), the supernatant obtained by centrifuging the cell lysate is enzyme solution containing glycosyltransferase StaG;

(5) The protein concentration of the enzyme solution was measured by using a Bradford kit (Shanghai Biotechnology), and the total protein concentration in the obtained enzyme solution was 64mg/mL.

Example 3

In this example, K252c was L-rhamnosylated in vitro using K252c as substrate. The method comprises the following specific steps:

based on the StaG enzyme solution prepared in example 2, the synthesis system was prepared as shown in table 1 and reacted at 25 ℃ for 16 hours. Among them, DMSO is advantageous in promoting the dissolution of the substrate.

TABLE 1

Component of synthesis system	Volume (mu L)
		DMSO	9.5
20mMK252c	0.5
		StaG enzyme solution	90
Total volume of	100

After the reaction is finished, the reactant is treated for 15min at 80 ℃ to denature the protein;

after cooling to room temperature, adding ethyl acetate with 2 times of volume for extraction, treating for 30min at 37 ℃ and 200rpm in a shaking table, and centrifugally collecting the supernatant;

evaporating the supernatant at 40 ℃, adding DMSO to dissolve, and then performing LCMS detection;

as shown in FIG. 1, the ultraviolet absorbance peak of K252c and L-rhamnosylated product K252c-L-Rha1 as shown in formula III (FIG. I), as well as [ M+1] ion peak M/z 312 in K252c cation mode (FIG. II), and [ M+1] ion peak M/z 458 in K252c-L-Rha1 cation mode (FIG. III) can be detected at a wavelength of 290 nm.

In addition, the synthetic system shown in the following Table 2 was prepared for reaction in this example,

TABLE 2

SynthesisSystem component	Volume (mu L)
		DMSO	9.5
20mMK252c	0.5
		20mMdTDP-L-rhamnose	1
StaG enzyme solution	89
		Total volume of	100

The experimental result proves that the glycosylation proportion of K252c can be improved when dTDP-L-rhamnose is exogenously added.

Example 4

In this example, K252c was subjected to in vivo L-rhamnosylation using a staurosporine mother nucleus K252c as a substrate. The method comprises the following specific steps:

(1) Culturing the E.coli obtained in example 1 in a test tube containing LB medium, shaking culture at 37 ℃;

(2) At the cell concentration OD ₆₀₀ When the concentration is 0.4-0.6, adding an inducer IPTG with the final concentration of 0.4mM, after the induction expression is carried out for 2 hours at 20 ℃, adding K252c with the final concentration of 25 mu M, and reacting for 16 hours;

(3) After the reaction is finished, the reactant is treated for 15min at 80 ℃ to denature protein, ethyl acetate with the volume being 2 times of that of the reactant is added for extraction after the temperature is reduced to room temperature, the mixture is treated for 30min at 200rpm in a shaking table at 37 ℃, and the supernatant is collected centrifugally;

(4) The supernatant was evaporated to dryness at 40℃and dissolved in DMSO, followed by LCMS detection.

The ultraviolet absorbance peak of the L-rhamnosylated product K252c-L-Rha1 of K252c and the M/z 458 ion peak (M+1) in cationic mode can be detected at a wavelength of 290 nm.

Example 5

In this example, K252c derivatives (shown in formula II, the derivatives are compounds obtained by substituting certain sites on the basis of K252 c) are used as substrates for in vitro L-rhamnosylation of K252c derivatives.

In this example, 5K 252c derivatives were selected, including Arcyriafilavin A (shown in formula IV) and 5,5' dime-Arcyriafilavin A (shown in formula V), and also including 5 MeO-Arcyriafilavin A, 6F-Arcyriafilavin A and 4OH-K252c, which were subjected to in vitro L-rhamnosylation under the catalysis of StaG, and the synthesis system was shown in Table 1 in example 3;

through detection, all of the 5K 252c derivatives can be catalyzed by StaG, so that an L-rhamnosylated product is generated, the L-rhamnosylated product Arcyriafilavin A-L-Rhal generated by Arcyriafilavin A is shown as a formula VI, and the L-rhamnosylated product 5,5 'dime-Arcyriafilavin A-L-Rhal generated by 5,5' dime-Arcyriafil A is shown as a formula VII:

LC-MS results for 5K 252c derivatives are shown in table 3:

TABLE 3 Table 3

K252c derivatives	L-rhamnosylated products	m/z(M+1)
			Arcyriaflavin A	Arcyriaflavin A-L-Rha1	472
5,5'diMe-Arcyriaflavin A	5,5'diMe-Arcyriaflavin A-L-Rha1	500
			5MeO-Arcyriaflavin A	5MeO-Arcyriaflavin A-L-Rha1	502
6F-Arcyriaflavin A	6F-Arcyriaflavin A-L-Rha1	490
			4OH-K252c	4OH-K252c-L-Rha1	474

In addition, in the practical experimental process, recombinant escherichia coli expression strains of other glycosyltransferases such as RebG (Uniprot: Q8KHE 4) are simultaneously constructed, wherein a glycosyl donor can be dTDP-D-glucose but not dTDP-L-rhamnose, and a glycosyl acceptor can be K252c and derivatives thereof such as Arcyriafilavin A. Coli is also capable of naturally synthesizing dTDP-D-glucose, so dTDP-D-glucose is also present in its cells. The experimental procedure is the same as that of StaG, and the experimental result proves that: in vitro glycosylation experiments, rebG was not catalytically active and was unable to D-glycosylate K252c and its derivative arceriaflavana; however, in vivo glycosylation experiments, rebG is catalytically active and is capable of D-glycosylation of K252c and its derivative arceriaflavin a.

In addition to the above-mentioned derivatives, the biose-based synthesis system described in the present invention is also catalytically active for the remaining K252c derivatives (e.g. compounds of formula II), which are not shown here.

In summary, in the synthesis system and the synthesis method thereof disclosed by the invention, glycosyltransferase StaG is preferred, and the biological glycosyl synthesis system and the synthesis method thereof which are constructed can catalyze and form a large number of staurosporine analogues with different structures, and the staurosporine analogues may have kinase inhibition activity and/or selectivity which are the same as or better than those of staurosporine, so that the synthesis system and the synthesis method thereof have important research value for screening kinase inhibition drugs.

The applicant declares that the above is only a specific embodiment of the present invention, but the scope of the present invention is not limited thereto, and it should be apparent to those skilled in the art that any changes or substitutions that are easily conceivable within the technical scope of the present invention disclosed by the present invention fall within the scope of the present invention and the disclosure.

SEQUENCE LISTING

<110> the Baizhu pharmaceutical Co., ltd

<120> biological glycosyl synthesis system of staurosporine skeleton compound and its synthesis method

<130> 20210416

<160> 2

<170> PatentIn version 3.3

<210> 1

<211> 436

<212> PRT

<213> Streptomyces longisporoflavus

<400> 1

Met Thr Arg Val Leu Ile Ala Thr Thr Pro Ala Pro Gly His Val Val

1 5 10 15

Ser Met Leu Glu Val Ala Gly Glu Leu Ala Arg Arg Gly His Glu Val

20 25 30

Arg Trp Tyr Thr Gly Arg Ala Phe Gln Arg Gln Val Glu Arg Val Gly

35 40 45

Ala His Phe Glu Pro Met Ser Pro Glu Leu Asp Phe Ser Gly Arg Ser

50 55 60

Arg Glu Glu Ala Phe Pro Glu His Ala Gly Leu Ser Gly Leu Thr Asn

65 70 75 80

Phe Lys Ile Gly Val Arg Asp Ile Phe Tyr Arg Thr Ala Pro Arg Gln

85 90 95

Met Asp Asp Leu Ser Lys Ile Leu Glu Arg Phe Pro Ala Asp Cys Leu

100 105 110

Leu Ala Asp Asp Met Cys Tyr Gly Ala Cys Phe Val Gly Glu Arg Thr

115 120 125

Gly Ile Pro Val Ala Trp Leu Ala Asn Ser Val Tyr Ile Leu Gly Ser

130 135 140

Arg Asp Thr Ala Pro Leu Gly Arg Gly Leu Gly Pro Ala Ser Ser Pro

145 150 155 160

Leu Gly Arg Val Arg Asn Ala Leu Leu Arg Phe Val Cys Asp His Val

165 170 175

Val Met Arg Asp Met Arg Gln Glu Ala Asp Arg Val Arg Ala Leu Val

180 185 190

Gly Leu Asp Arg Leu Arg Ser Ser Ala Met Glu Asn Ile Ala Arg Pro

195 200 205

Pro Ala Leu Tyr Leu Leu Gly Thr Val Pro Ser Phe Glu Phe Pro Arg

210 215 220

Ser Asp Leu Leu Pro Gly Thr His Phe Val Gly Pro Leu Leu Gly Val

225 230 235 240

Pro Pro Glu His Phe Asp Pro Pro Ala Trp Trp Glu Asp Leu Asp Gly

245 250 255

Gly Arg Pro Val Val Leu Ile Thr Gln Gly Thr Thr Ala Asn Asp Val

260 265 270

Asp Gly Leu Leu Arg Pro Ala Leu Arg Ala Leu Ala Asp Gln Glu Val

275 280 285

Leu Val Val Val Thr Thr Gly Ser Asp Leu Asp Val Glu Arg Leu Arg

290 295 300

Pro Leu Pro Ala Asn Val Arg Leu Glu Arg Phe Val Pro Tyr His His

305 310 315 320

Leu Leu Pro Arg Val Asp Ala Met Val Thr Asn Gly Gly Tyr Asn Gly

325 330 335

Val Asn Ala Ala Leu Ala Gln Gly Val Pro Leu Val Val Val Pro Gly

340 345 350

Ser Glu Glu Lys Pro Asp Val Ala Ala Arg Val Glu Trp Ala Gly Ala

355 360 365

Gly Val Val Leu Glu Arg Arg Pro Val Ser Glu Ala Asp Leu Arg Glu

370 375 380

Ala Val Thr Thr Val Leu Arg Asp Gly Ser His Arg Arg Arg Ala Arg

385 390 395 400

Ala Leu Ala Glu Glu His Gly Ser Val Asp Ala Pro Arg Arg Ala Ala

405 410 415

Asp Leu Ile Glu Ser Met Ala Asp Ser Gln Gly Gln Ile Pro Thr Gly

420 425 430

Gly Ile Thr Arg

435

<210> 2

<211> 1311

<212> DNA

<213> Streptomyces longisporoflavus

<400> 2

atgacccgtg tgctgattgc gaccaccccg gcgccgggtc atgtggttag catgctggaa 60

gtggcgggtg aactggcgcg tcgtggtcac gaggttcgtt ggtacaccgg tcgtgcgttt 120

cagcgtcaag tggaacgtgt tggcgcgcac ttcgagccga tgagcccgga actggacttt 180

agcggtcgta gccgtgagga agcgttcccg gagcatgcgg gtctgagcgg tctgaccaac 240

ttcaagatcg gcgtgcgtga catcttctac cgtaccgcgc cgcgtcagat ggacgatctg 300

agcaaaattc tggagcgttt tccggcggat tgcctgctgg cggacgatat gtgctacggt 360

gcgtgcttcg ttggcgaacg taccggtatc ccggtggcgt ggctggcgaa cagcgtttat 420

attctgggta gccgtgacac cgcgccgctg ggtcgtggcc tgggtccggc gagcagcccg 480

ctgggccgtg tgcgtaacgc gctgctgcgt ttcgtttgcg accacgtggt tatgcgtgat 540

atgcgtcaag aggcggaccg tgtgcgtgcg ctggttggcc tggatcgtct gcgtagcagc 600

gcgatggaga acattgcgcg tccgccggcg ctgtacctgc tgggcaccgt gccgagcttc 660

gaatttccgc gtagcgacct gctgccgggc acccactttg ttggtccgct gctgggtgtt 720

ccgccggagc actttgatcc gccggcgtgg tgggaagacc tggatggtgg ccgtccggtg 780

gttctgatta cccagggcac caccgcgaac gacgttgatg gtctgctgcg tccggcgctg 840

cgtgcgctgg cggaccagga agttctggtg gtggtgacca ccggtagcga cctggatgtt 900

gaacgtctgc gtccgctgcc ggcgaacgtg cgtctggaac gttttgttcc gtaccaccac 960

ctgctgccgc gtgtggacgc gatggttacc aacggtggct ataacggtgt gaacgcggcg 1020

ctggcgcagg gtgttccgct ggttgtggtt ccgggcagcg aggaaaagcc ggatgttgcg 1080

gcgcgtgttg aatgggcggg tgcgggtgtg gttctggagc gtcgtccggt tagcgaggcg 1140

gacctgcgtg aagcggtgac caccgttctg cgtgatggta gccatcgtcg tcgtgcgcgt 1200

gcgctggcgg aggaacatgg cagcgttgat gcgccgcgtc gtgcggcgga cctgatcgaa 1260

agcatggcgg atagccaggg tcaaatcccg accggtggca ttacccgtta a 1311

Claims

1. A biological glycosyl synthesis system of a staurosporine framework compound, which is characterized in that the biological glycosyl synthesis system comprises: k252c derivative, dTDP-L-rhamnose and glycosyltransferase StaG, wherein the K252c derivative is any one of Arcyriafilavin A, 5' dime-Arcyriafilavin A, 5 MeO-Arcyriafilavin A or 4OH-K252c, and has the structural formula as follows;

the glycosyltransferase StaG exists in recombinant escherichia coli;

the recombinant escherichia coli contains an expression vector for expressing glycosyltransferase StaG, the amino acid sequence of the glycosyltransferase StaG is shown as SEQ ID NO.1, and the nucleotide sequence for encoding the glycosyltransferase StaG is shown as SEQ ID NO. 2;

in the biological glycosyl synthesis system, the molar concentration of the K252c derivative is 100-300 mu M.

2. A biological glycosylation synthesis method of a staurosporine framework compound, which is characterized by comprising the following steps:

connecting a nucleotide sequence for encoding glycosyltransferase StaG on an expression vector, introducing the expression vector into escherichia coli to obtain recombinant escherichia coli, culturing the recombinant cells, expressing the glycosyltransferase StaG through an induction step to obtain a recombinant escherichia coli culture for expressing the glycosyltransferase StaG, mixing a K252c derivative with the recombinant escherichia coli culture for expressing the glycosyltransferase StaG to obtain the biological glycosyl synthesis system of claim 1, and reacting;

the amino acid sequence of the glycosyltransferase StaG is shown as SEQ ID NO.1, the nucleotide sequence of the encoding glycosyltransferase StaG is shown as SEQ ID NO.2, the K252c derivative is any one of Arcyriafilavin A, 5' dime-Arcyriafilavin A, 5 MeO-Arcyriafilavin A, 6F-Arcyriafilavin A or 4OH-K252c, and the structural formula is as follows;

3. the method according to claim 2, wherein the reaction temperature is 20-25 ℃.

4. The method of biological glycosylation synthesis according to claim 2, wherein the reaction time is 10-20 hours.

5. The method of biological glycosylation synthesis according to claim 2, wherein said post-reaction further comprises a step of heating.

6. The method according to claim 5, wherein the heating temperature is 80-85 ℃.

7. The method of biological glycosylation synthesis according to claim 5, wherein the heating time is 10-15 min.

8. The method of biological glycosylation synthesis according to claim 2, wherein said post-reaction further comprises an extraction step.

9. The method of biological glycosylation synthesis according to claim 8, wherein the extractant used in the extraction comprises ethyl acetate.

10. The method according to claim 8, wherein the extraction temperature is 30-37 ℃.

11. The method of biological glycosylation synthesis according to claim 8, wherein the extraction time is 20-40 min.

12. The method according to claim 2, wherein the inducer used for induction in the preparation of recombinant E.coli cultures expressing glycosyltransferase StaG comprises 0.05-0.5 mM IPTG, the induction temperature is 16-25℃and the time is 2-3 hours.

13. The method of biological glycosylation synthesis according to claim 2, wherein the method of biological glycosylation synthesis comprises the steps of:

(1) Connecting a nucleotide sequence for encoding glycosyltransferase (StaG) to an expression vector, and introducing the expression vector into escherichia coli to obtain recombinant escherichia coli;

(2) Culturing the recombinant escherichia coli, and inducing the recombinant escherichia coli for 2-3 hours at 16-25 ℃ by using 0.05-0.5 mM IPTG to obtain a recombinant escherichia coli culture expressing the glycosyltransferase StaG;

(3) And directly adding a K252c derivative into the recombinant escherichia coli culture, reacting for 10-20 hours at 20-25 ℃, heating for 10-15 minutes at 80-85 ℃, and extracting by adopting ethyl acetate.