CN111138444A - Epothilone B glucoside compounds and enzymatic preparation and application thereof - Google Patents
Epothilone B glucoside compounds and enzymatic preparation and application thereof Download PDFInfo
- Publication number
- CN111138444A CN111138444A CN202010018493.7A CN202010018493A CN111138444A CN 111138444 A CN111138444 A CN 111138444A CN 202010018493 A CN202010018493 A CN 202010018493A CN 111138444 A CN111138444 A CN 111138444A
- Authority
- CN
- China
- Prior art keywords
- epothilone
- glucoside
- compound
- bsgt
- glucosyl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D493/00—Heterocyclic compounds containing oxygen atoms as the only ring hetero atoms in the condensed system
- C07D493/02—Heterocyclic compounds containing oxygen atoms as the only ring hetero atoms in the condensed system in which the condensed system contains two hetero rings
- C07D493/04—Ortho-condensed systems
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/18—Preparation of compounds containing saccharide radicals produced by the action of a glycosyl transferase, e.g. alpha-, beta- or gamma-cyclodextrins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/44—Preparation of O-glycosides, e.g. glucosides
- C12P19/60—Preparation of O-glycosides, e.g. glucosides having an oxygen of the saccharide radical directly bound to a non-saccharide heterocyclic ring or a condensed ring system containing a non-saccharide heterocyclic ring, e.g. coumermycin, novobiocin
- C12P19/62—Preparation of O-glycosides, e.g. glucosides having an oxygen of the saccharide radical directly bound to a non-saccharide heterocyclic ring or a condensed ring system containing a non-saccharide heterocyclic ring, e.g. coumermycin, novobiocin the hetero ring having eight or more ring members and only oxygen as ring hetero atoms, e.g. erythromycin, spiramycin, nystatin
Abstract
The invention discloses a group of epothilone B glucoside compounds, which are epothilone B7-O- β -D glucoside, epothilone B7-O- β -D-glucosyl- (1 → 3) - β -D glucoside, epothilone B7-O- β -D-glucosyl- (1 → 2) - β -D glucoside or epothilone B7-O- β -D-glucosyl- (1 → 2) - β -D-glucosyl- (1 → 4) - β -D glucoside, wherein the compound is obtained by the glycosylation reaction of epothilone B and UDP-O- β -D-glucoside with I62A mutein of glycosyltransferase BsGT-1, the application of the epothilone B glucoside compound in preparing medicaments for preventing and treating liver cancer is proved, the economic value of the epothilone B7-O- β -D glucoside compound in preparing medicaments is proved by experimental experiments, the toxic effect of the epothilone B7-O- β -D glucoside compound on liver cancer cells is improved, and the toxicity of the epothilone B7-O-5639-D glucoside in preparing medicaments is improved by the application of the antitumor effect of the epothilone B7-5631.
Description
Technical Field
The invention relates to a group of epothilone glycoside compounds and preparation and application thereof, in particular to epothilone B glucose monosaccharide, disaccharide and trisaccharide compounds, an enzymatic preparation method thereof and application of the epothilone B glucose compounds in preparation of medicaments for treating and preventing liver cancer. Belongs to the field of microbial technology, product and application technology.
Background
Sorangium cellulosum belongs to the order Myxococcus, sub-order Sorangium, family Sorangium and genus Sorangium, and is a type of gram-negative bacteria widely distributed in soil. Can produce abundant secondary metabolites.
Epothilones (epothilones) are a class of 16-membered macrolides, currently derived only from Sorangium cellulosum. In terms of action mechanism, although the epothilone and the paclitaxel inhibit the growth of tumors by polymerizing tubulin, the epothilone shows better inhibition activity on multi-drug resistant tumor cells than the paclitaxel, has the potential of large-scale fermentation production, and is considered to be a good substitute of the paclitaxel. The compound has two main products, namely epothilone A and epothilone B, and the structural formula of the compound is as follows:
structural formula of epothilones (R ═ H, epothilones A; R ═ CH3，epothilone B)
The chemical structure of epothilones is simpler than paclitaxel, comprising a 16-membered macrolactone ring, a ternary oxygen ring, and a thiazole ring side chain. The structural skeletons of the analogues of the epothilone are basically the same, and the epothilone B has one more methyl group than A on the 12-position carbon of the macrolide, but the inhibitory activity on tumor cells is 4-10 times that of the epothilone A. In 2007, the epothilone B analog Ixabepilone (Ixabepilone) was approved by the FDA for the treatment of breast cancer, and at present, in addition to Ixabepilone, a variety of epothilone analogs have entered various stages of clinical evaluation, e.g., paclitaxel (Patupilone), epothilone D (KOS-862), ZK-EPO, and ABJ 879. Nevertheless, the epothilone analogs reported above have problems of strong neurotoxicity, blood toxicity or poor water solubility, which limits the clinical applications of epothilones. On the basis of the above, reasonable modification of the structure of epothilone is necessary, and therefore, the development of a simple and green (bio) chemical method for relevant modification is particularly urgent.
The report of glycosylation modification of Epothilone is limited to Epothilone A found in 2010 and Epothilone A7-O- β -D glucoside (Epothilone A7-O- β -D glucoside) reported in 2014, however, the glycosylation of Epothilone B with better antitumor activity is limited to the glycosylation of garactosylated Epothilone B synthesized by organic chemistry only, or Epothilone B3-O- α -D arabinopyranoside, other types of glycosylation products are not reported yet, in addition, the step of synthesizing the Epothilone B glycosylation product by the organic chemistry method is complicated, the number of byproducts is large, the separation and purification are difficult, the synthesis cost is high, the organic chemistry synthesis method is large, the synthesis condition is required to be high, the environment-friendly modification condition is high, the defect of the Epothilone B is overcome, and the like.
Disclosure of Invention
Aiming at the defects of the prior art, the invention aims to provide a group of epothilone B glucoside compounds, an enzymatic preparation method thereof and application of the epothilone B glucoside compounds in preparation of medicines for treating and preventing liver cancer.
The group of epothilone B glucoside compounds of the invention are epothilone B glucose monosaccharide, disaccharide and trisaccharide compounds, and are characterized in that the epothilone B glucoside compounds are compound 1, epothilone B7-O- β -D glucoside, or compound 2, epothilone B7-O- β -D-glucopyranosyl- (1 → 3) - β -D glucoside, or compound 3, epothilone B7-O- β -D-glucopyranosyl- (1 → 2) - β -D glucoside, or compound 4, epothilone B7-O- β -D-glucopyranosyl- (1 → 2) - β -D-glucopyranosyl- (1 → 4) - β -D glucoside, and the structural formula and the connection mode of the compounds and the corresponding names are as follows:
wherein the epothilone B glucoside compound is preferably compound 1, epothilone B7-O- β -D glucoside.
The enzymatic preparation method of the epothilone B glucoside compound comprises the following steps:
in the following proportions, 50mM Tris-HCl,10mM MgCl2In the buffer solution environment, an in vitro enzyme activity reaction experiment is carried out on epothilone B with the final concentration of 10mM, UDP-O- β -D-glucose with the final concentration of 50mM and I62A mutant protein of glycosyltransferase Bsgt-1 with the final concentration of 500 mu g/ml, a reaction mixed solution is incubated at 37 +/-1 ℃ for 12 +/-2 hours, then 3 times of volume of methanol is added to terminate the reaction, 14000r/min is carried out, protein precipitate is removed in 30min, a sample is subjected to rotary evaporation drying treatment, a methanol heavy suspension product is added, the product is separated and purified through a semi-preparative liquid phase after being centrifuged again for 30min at 14000r/min, and the size of a chromatographic column is specifiedGrid selection of YMC-Pack Pro C18,250mm × 10.0mm,5 μm; mobile phase system: elution with a 35:65 acetonitrile water system, peak time of epothilone B glucoside: compound 1: 13.2 min; compound 2: 10.6 min; compound 3: 7.1 min; compound 4: 5.2 min; the four separated compounds were evaporated to dryness separately and then applied to CD3OD dissolution, and respectively identifying by using UHPLC-ESI-Q-TOF high-resolution mass spectrum and nuclear magnetic resonance;
wherein, the I62A mutant protein of the glycosyltransferase BsGT-1 takes pET28a-BsGT-1 recombinant plasmid as a template, and a mutant primer F-I62A is designed: CTTGAATgccGATCCTAAGCAAATCAGGGAGATG, respectively; R-I62A: TAGGATCggcATTCAAGGATGTATGATAGATCAATGC, generating linear recombinant mutant plasmid fragments by one-time PCR, and carrying out cyclization by recombination reaction to form I62A mutant pET28a-Bsgt-1 recombinant plasmid, and obtaining the recombinant plasmid through transformation of the recombinant plasmid and induced expression of protein.
The protein sequence of the glycosyltransferase BsGT-1(CUB50191) is published, and the glycosyltransferase BsJRS11 is obtained by extracting a B.subtiliss JRS11 genome, designing a primer (F-BamHI: CGCGGATCCATGAAAAAGTACCATATTTCGAT; R-SalI: ACGCGTCGACTTACTGCGGGACAGCGGATTTTT), forming pET28a-BsGT-1 recombinant plasmid through double enzyme digestion and connection, and transforming Escherichia coli BL21(DE3) by a recombinant vector to induce and express.
In the method for preparing the epothilone B glucoside compound by the enzyme method, the mixing molar ratio of the epothilone B and the UDP-O- β -D-glucose is preferably 1:5, and the reaction mixture of the epothilone B and the UDP-O- β -D-glucose in the glycosylation reaction mediated by the I62A mutein of the glycosyltransferase Bsgt-1 is preferably incubated at 37 ℃ for 12 hours.
The invention relates to application of an epothilone B glucoside compound in preparation of a medicine for preventing and treating liver cancer.
Experiments prove that the Epothilone B glucoside compound 1 has a half-inhibitory effect on human liver cancer cell HepG2 when the concentration is 9.84 mu M, and the toxicity on normal liver cells HL7702 is reduced by 9430 times compared with that of an Epothilone B technical product, further comparison experiments show that the Epothilone B7-O- β -D glucoside, the compound 1, namely Epothilone B7-O- β -D glucoside, has a stronger inhibitory effect on human liver cancer cell HepG2 of previously reported Epothilone A7-O- β -D glucoside (Epothilone A7-O- β -D glucoside), and the compound 1, namely the Epothilone B7-O- β -D glucoside, is preferably used as a low-toxicity high-efficiency inhibitor for preparing related medicinal preparations or as a liver cancer effective prevention and treatment medicinal preparation.
The invention discloses a group of epothilone B glucoside compounds and an enzymatic preparation method thereof, wherein the epothilone B glucoside compounds are synthesized by a mild enzymatic method in the preparation process, complex chemical reactions in organic synthesis are not needed, and the conversion of the epothilone glucoside is realized in one step; all glycosylation reaction processes are carried out in vitro, so that a negative regulation system possibly existing in an in vivo synthesis way is avoided; in vitro glycosylation modification has few compounds participating in the reaction, and is beneficial to the reutilization of raw materials and the separation and purification of new products; the conversion efficiency of the glycosylation reaction is high; the enzyme is used as a mild catalyst and has strong plasticity, mutation is introduced into the enzyme, the original activity of the protein is changed to a certain extent, the enzyme has new characteristics and new functions, and the diversity of products is facilitated. With the increasing abuse of cancer and drug-resistant bacteria, the clinical demand for novel anticancer drugs with novel action targets and high bacteriostatic activity is urgent. The novel epothilone B glucoside obtained by the invention is expected to gain the application value of the epothilone B glucoside in the antitumor activity, thereby generating good social benefit and economic value.
Drawings
FIG. 1: HPLC analysis chromatogram of glycosyltransferase Bsgt-1 on epothilone B glycosylation modification reaction liquid
Wherein, the peak time of four epothilone B glucosides is as follows: compound 1: 13.2 min; compound 2: 10.6 min; compound 3: 7.1 min; compound 4: 5.2 min; the peak time of the Epothilone B standard (Epothilone B) was 28.4 min.
FIG. 2 shows the high resolution mass spectrum of compound 1, epothilone B7-O- β -D glucoside, the excimer peak [ M + H ]]+Is m/z 670.3131.
FIG. 3 shows the high resolution mass spectrum of compound 2 epothilone B7-O- β -D-glucosyl- (1 → 3) - β -D glucoside, excimer peak [ M + H ]]+Is m/z 832.5618.
FIG. 4 shows the high resolution mass spectrum of compound 3 epothilone B7-O- β -D-glucosyl- (1 → 2) - β -D glucoside, excimer peak [ M + H ]]+Is m/z 832.5627.
FIG. 5 shows a high-resolution mass spectrum of compound 4, epothilone B7-O- β -D-glucosyl- (1 → 2) - β -D-glucosyl- (1 → 4) - β -D-glucoside, with an excimer ion peak [ M + H ]]+Is m/z 994.4121.
Detailed Description
The present invention will be described in detail with reference to specific examples. The following examples are merely illustrative of the preferred embodiments of the present invention and are not intended to limit the present invention in any way, and any simple modifications, equivalent changes and modifications made to the embodiments according to the technical spirit of the present invention fall within the scope of the technical solution of the present invention.
The reagents, plasmids, strains, cells or experimental devices used in the present invention are all commercially available products.
Example 1 preparation of epothilone glycosyltransferase Bsgt-1 recombinant plasmid, construction of I62A mutant recombinant plasmid, expression of I62A mutant protein, and preparation of epothilone B glucoside
The inventor experimentally screens and determines a glycosyltransferase BsGT-1(CUB50191) capable of efficiently glycosylating epothilone B, and the protein sequence of the glycosyltransferase is published. The method for obtaining the recombinant plasmid of the epothilone glycosyltransferase BsGT-1 and expressing the recombinant plasmid to obtain the glycosyltransferase BsGT-1 comprises the following steps:
obtaining a gene fragment for coding glycosyltransferase BsGT-1 by extracting B.subtilis JRS11 genome DNA, and designing a double-enzyme digestion guideSubstance (F-BamHI: CGCGGATCCATGAAAAAGTACCATATTTCGAT; R-SalI: ACGCGTCGACTTACTGCGGGACAGCGGATTTTT) used
Max Super-Fidelity DNApolymerase Polymerase Chain Reaction (PCR) was carried out in a reaction system of 0.5. mu.l of B.subtilis JRS11 genomic DNA, 25. mu.l of 2 XPantha MaxBuffer, 1. mu.l of dNTP Mix (10mM each), 2. mu.l of F-BamHI (10. mu.M), 2. mu.l of R-SalI (10. mu.M), 1. mu.l of PhantaMax Super-Fidelity DNApolymerase, sterile water was added to 50. mu.l of PCR product gel and recovered, together with pET28a plasmid, by double digestion with restriction enzymes BamHI and SalI, 37 ℃, 4h, after digestion, PCR fragment and linear fragment of pET28a were re-gel recovered, and then ligated with T4 DNA ligase in a molar ratio of PCR product: plasmid fragment of 1:5, 16 ℃, after transforming E.coli ligation product into BsGT 5 α, sequencing plasmid DNA fragment DNA, cloning and sequencing the plasmid of Escherichia coli strain GT 1. coli, cloning and inducing expression of recombinant DNA fragment GT 1. RTM 3875 and expressing the recombinant DNA overnight.
The inventors mutated isoleucine at position 62 of glycosyltransferase BsGT-1 to alanine (I62A) and expressed the I62A mutein of glycosyltransferase BsGT-1 by constructing a recombinant plasmid with I62A mutation. The method for introducing mutation into glycosyltransferase Bsgt-1 comprises the following steps:
MutExpressIIFastMutageneskitV 2 is selected and used for designing mutation primers
F-I62A：CTTGAATgccGATCCTAAGCAAATCAGGGAGATG；
R-I62A：TAGGATCggcATTCAAGGATGTATGATAGATCAATGC，
By using
Carrying out PCR by using the MaxSuper-FidelityDNApolymerase high-fidelity enzyme and the recombinant plasmid pET28a-BsgT-1 as a template to form a linear fragment, wherein the reaction system comprises the following components: recombinant plasmid pET28a-BsgT-1DNA0.5 ul; 2X Phanta MaxBuffer 25. mu.l; dNTP Mix (10mM each) 1. mu.l; F-I62A (10. mu.M) 2. mu.l; 2. mu.l of R-I62A (10. mu.M); phanta Max Super-Fidelity DNApolymerase 1. mu.l; sterile water was added to 50. mu.l.Then, the system was demethylated (37 ℃ C., 1h) with DpnI to remove the template recombinant plasmid (reduce the generation of false positive), and then the recombinant cyclization was completed by recombinase ExnaseII, and further sequencing verification was performed. pET28a-BsgT-1 recombinant plasmid with correct sequencing determination I62A mutation is transformed into Escherichia coli BL21(DE3), the transformant is transferred to 20ml LB culture medium added with kanamycin (40 mu g/ml final concentration), cultured at 37 ℃ for 12 hours, then 20ml seed liquid is respectively transferred to 1000ml LB culture medium (added with 100 mu l kanamycin at 40 mg/ml), expanded and cultured at 37 ℃, IPTG (0.1 mM final concentration) is added when OD value reaches 0.6-0.8, then the thallus is transferred to a shaking table at 16 ℃ and cultured at 200r/min for 24 hours, and centrifuged at 4 ℃ and 8000r/min for 5 minutes for collection. The collected cells were resuspended in 100ml of Tris-HCl buffer (50mM Tris-HCl, pH 7.5), the resuspended cells were sonicated for 5min (5S sonication, 10S pause) in an ice-water mixture, the sonicated cells were centrifuged (12000r/min, 30min at 4 ℃), the supernatant and the pellet were separated, and then the expression of the mutant protein was examined by SDS-PAGE.
The invention uses nickel filler to purify I62A mutant protein, the supernatant after ultrasonication is added into the nickel filler which is balanced by buffer solution (50mM Tris-HCl, pH 7.5) in advance, then the mixture is incubated for 12 hours at 4 ℃, then the incubated mixture is added into a purification column, after the filler is naturally settled, and after the buffer solution is washed and balanced, the Tris-HCl buffer solution (20mM,50mM,100mM,150mM,200mM and 250mM imidazole, 50mM Tris-HCl, pH 7.5) with different concentrations of imidazole is respectively used for elution into a 1.5ml centrifuge tube, and then the protein is collected and detected by SDS-PAGE. The collected purified protein was subjected to imidazole removal using a 30kDa ultrafiltration tube and concentrated, and a sample of the concentrated protein (I62A mutein) was subjected to the next glycosylation reaction.
The I62A mutant protein of glycosyltransferase BsGT-1 which is separated and purified is used for catalyzing and producing the epothilone B glucoside compound, and the preparation method and the reaction conditions are as follows:
4ml of in vitro enzyme activity reaction systems respectively comprise I62A mutant protein (500 mu g/ml) of glycosyltransferase Bsgt-1,Tris-HCl buffer (50mM Tris-HCl,10mM MgCl)2) And performing in-vitro enzyme activity experiments on epothilone B (with the final concentration of 10mM, dissolved in DMSO and about 20mg) and UDP-O- β -D-glucose (with the final concentration of 50mM, dissolved in water and about 122mg), incubating the reaction mixed solution at 37 ℃ for 12 hours, adding 3 times of methanol for terminating the reaction, removing protein precipitates at 14000r/min for 30min, performing rotary evaporation to dry the sample, adding a methanol heavy suspension product, centrifuging at 14000r/min for 30min again, and separating and purifying the product through a semi-preparative liquid phase.
The above epothilone B glucoside preparation was carried out using a YMC column (YMC-Pack Pro C18, 250mm. times.10.0 mm,5 μm), mobile phase system: acetonitrile water system elution (35:65), time to peak of four epothilone B glucosides: compound 1: 13.2 min; compound 2: 10.6 min; compound 3: 7.1 min; compound 4: 5.2 min. The four separated compounds were evaporated to dryness separately and then applied to CD3OD dissolution is carried out, and then UHPLC-ESI-Q-TOF high-resolution mass spectrum and nuclear magnetic resonance are respectively used for identification.
EXAMPLE 2 structural characterization of Compound 1
According to FIG. 2, UHPLC-ESI-Q-TOF high resolution mass spectrum shows the excimer peak [ M + H ] of compound 1]+M/z670.3131, confirming that 1 is the monoglucoside of epothilone B. Meanwhile, the monosaccharide can also be obtained from the NMR spectrum of the compound 1: (1H NMR) and carbon Spectroscopy (13C NMR) was confirmed. In the HMBC spectrum, H-7 is related to C-1 'and H-1' is related to C-7, so that the hydroxyl at the 7-position of the skeleton of epothilone B macrolide is determined by the connection of glucosyl. Larger coupling constant (J) between terminal protons H-1 'and H-2' on the sugar1',2'7.8Hz) and a terminal proton plateau of 4.46ppm, revealed that the glycosyl donor and epothilone B acceptor were linked by an β -D glucoside bond, compound 1 was EpothiloneB 7-O- β -Dglucoside, the specific nuclear magnetic data of which is summarized in table 1.
TABLE 1 nuclear magnetic data assignment for Compound 1
EXAMPLE 3 structural characterization of Compound 2
According to FIG. 3, the high resolution mass spectrum shows the excimer peak [ M + H ] of Compound 2]+At m/z832.5618, it is predicted to be the diglucoside of epothilone B. Secondary mass spectrometry of Compound 2 gave fragment ion peaks m/z 670.3120 and 508.2615, and NMR spectra: (1H NMR) and carbon Spectroscopy (13C NMR) gave a clear signal for both sugars, further verifying that 2 is the diglucoside of epothilone B. Also, HMBC and sugar end group proton coupling constant analysis (J)1',2'7.8Hz), the disaccharide group is determined to be connected with the epothilone B through a7-O- β -D glycosidic bond, as for the β -1, 3-glycosidic bond connection mode inside the disaccharide, the method is mainly determined through two-dimensional nuclear magnetic resonance experiments, and specifically, the analysis of the terminal proton coupling constant (J) is carried out (HSQC, HMBC, COSY and NOESY)1”,2”7.2Hz) and a relatively high field proton chemical shift (δ)H4.60) the terminal glycosyl is β -D glucose, the direct hydrogen on each glycosyl carbon is assigned using HSQC and COSY spectra, in HMBC spectra the 3 'position is associated with the key carbon-hydrogen at position 1 ", the order of attachment of the two glucose residues is 1, 3-glycosidic bond, at the same time the chemical shift of 86.8ppm of the carbon at position 3' on the glucose residue directly attached to Epothilone B is clearly shifted to low field, also the position is substituted by the second glucose residue, thus compound 2 is Epothilone B7-O- β -D-glucopyranosyl- (1 → 3) - β -D glucopyranoside, nuclear magnetic data are assigned in Table 2.
Table 2. nuclear magnetic data attribution of compound 2.
EXAMPLE 4 structural characterization of Compound 3
According to FIG. 4, UHPLC-ESI-Q-TOF high resolution mass spectrum gave the excimer peak [ M + H ] of Compound 3]+Is m/z832.5627, and by secondary mass fragmentation analysis, 3 is predicted to be the diglucoside of epothilone B, i.e. the isomer of 2. NMR spectra of Compounds 3 and 21H NMR) and carbon Spectroscopy (13C NMR), it was confirmed that 3 differs from 2 only in the disaccharide groups, further analysis of the disaccharide groups of these two compounds by comparison of HMBC spectra revealed that the disaccharide in 3 was linked by a 1, 2-glucosidic linkage, and that this order of linkage was also verified by a chemical shift of 82.0ppm from the 2' position shifted to low field, thus compound 3 was Epothilone B7-O- β -D-glucoside- (1 → 2) - β -D glucoside, and the nuclear magnetic data are summarized in table 3.
TABLE 3. nuclear magnetic data attribution of Compound 3.
EXAMPLE 5 structural characterization of Compound 4
According to FIG. 5, UHPLC-ESI-Q-TOF high resolution mass spectrum gave the excimer peak [ M + H ] of Compound 4]+At m/z994.4121, it is predicted to be the triglucoside of epothilone B. Secondary mass spectrometry of Compound 4 gave fragment ion peaks m/z832.3765, 670.3271 and 508.2744, and NMR Hydrogen spectra (M/z: (M/z))1H NMR) and carbon Spectroscopy (13C NMR) to giveThe terminal carbon and hydrogen signals for the three sugars are evident, further demonstrating 4 as the triglucoside of epothilone B, the coupling constants for the three sugar terminal hydrogen signals are all 7.8Hz, and the chemical shift values are all around 4.60ppm of the relatively high field, demonstrating that the three sugars are all linked by β -D glycosidic linkagesC82.5) was clearly shifted towards low field, demonstrating that the first glucose directly linked to epothilone B was linked to the second intermediate glucose by a 1, 2-glucosidic linkage. As for the determination of the order of 1, 4-glucosidic linkages of the second glucose to the last third glucose, it is based mainly on the H-6 'in the HMBC spectra and the C-4' (delta) shifted low towards the chemical shiftC79.6), H-1 '"is associated with C-4", and H-4 "is associated with C-1'". thus, Compound 4 is Epothilone B7-O- β -D-glucosyl- (1 → 2) - β -D-glucosyl- (1 → 4) - β -D glucoside, with nuclear magnetic data being summarized in Table 4.
Table 4. nuclear magnetic data attribution of compound 4.
Example 6 antitumor Activity test of epothilone B glucoside
The screening method comprises the following steps: method for reducing tetrazolium salt (MTT)
Cell lines: HepG2 human liver cancer and Normal liver cell HL7702
Acting time: 48 hours
The experimental method comprises the following steps:
cells in the logarithmic growth phase were trypsinized, the reaction was stopped by adding a predetermined amount of culture medium, the cells were collected by centrifugation, and the cells were resuspended in 1ml of culture medium. Another sterile gun slot was taken, and the cell suspension was mixed well with fresh culture medium and added to a 96-well plate (marginal wells filled with sterile PBS). And (3) placing the inoculated cell culture plate into an incubator for culture and adherent growth until a cell monolayer is paved on a 96-hole bottom plate, respectively adding four epothilone B glucoside compounds with concentration gradient, wherein each hole is 100 mu l, and 4 parallel experiment multiple holes are arranged. 5% CO2Incubating at 37 ℃ for 48 hours, sucking out the supernatant, washing with PBS for 2-3 times, adding 100 mu l of MTT solution (5mg/ml, namely 0.5% MTT culture medium), continuing to culture for 4 hours, removing the supernatant, washing with PBS for 2-3 times, adding 100 mu l of dimethyl sulfoxide (DMSO) into each hole, and placing on a shaking bed to shake at low speed for 10min to fully dissolve crystals. The absorbance of each well was measured at OD 492nm of the microplate reader.
The inhibition rates of four epothilone B glucoside compounds on human liver cancer HepG2 are respectively measured under different drug concentrations:
the compound 1, namely the inhibition rates of epothilone B7-O- β -D glucoside on human liver cancer HepG2 are respectively 3.40% (0.01 mu M), 4.02% (0.1 mu M), 13.19% (1 mu M), 29.23% (5 mu M), 62.26% (20 mu M), 83.08% (100 mu M) and 83.38% (200 mu M);
the compound 2, namely epothilone B7-O- β -D-glucosyl- (1 → 3) - β -D glucoside has the inhibition rate of 42.69 percent (100 mu M) to human liver cancer HepG2 at 100 mu M and the IC of the compound is 42.69 percent (100 mu M)50Values are considered to be greater than 100 μ M;
the inhibition rates of epothilone B7-O- β -D-glucosyl- (1 → 2) - β -D glucoside on human liver cancer HepG2 are 2.14% (0.01. mu.M), 11.50% (0.1. mu.M), 20.95% (1. mu.M), 40.17% (5. mu.M), 55.83% (20. mu.M), 83.87% (100. mu.M), 89.07% (200. mu.M) and 84.87% (500. mu.M), respectively;
the inhibition rates of epothilone B7-O- β -D-glucosyl- (1 → 2) - β -D-glucosyl- (1 → 4) - β -D glucoside to human liver cancer HepG2, compound 4, were 3.40% (0.01. mu.M), 4.02% (0.1. mu.M), 13.19% (1. mu.M), 29.23% (5. mu.M), 62.26% (20. mu.M), 83.08% (100. mu.M), and 83.38% (200. mu.M), respectively.
In response, the inventors obtained the IC of four epothilone B glucoside compounds in human hepatoma cell HepG2 by fitting a curve non-linearly50Value and IC on inhibition of Normal hepatocytes50The values are as in tables 5 and 6:
TABLE 5 IC of epothilone B glucoside against human hepatoma cell HepG250Value of
TABLE 6 IC of epothilone B glucoside on human Normal hepatocytes HL770250Value of
And (4) conclusion: as can be seen from Table 5, epothilone B glucoside Compound 1 was present at a concentration of 9.84. mu.M (10)-6M) has half inhibition effect on liver cancer cells HepG2, the activity of the inhibitor is higher than that of Epothilone A7-O- β -D glucoside (Epothilone A7-O- β -D glucoside), and as can be seen from Table 6, the toxicity of the compound 1 on normal liver cells HL7702 is reduced by 9430 times compared with that of Epothilone B raw drug, so the compound is expected to be a candidate drug of a low-toxicity high-efficiency inhibitor for tumor cells such as liver cells.
Claims (5)
1. A group of epothilone B glucoside compounds are characterized in that the epothilone B glucoside compounds are compound 1, epothilone B7-O- β -D glucoside, compound 2, epothilone B7-O- β -D-glucosyl- (1 → 3) - β -D glucoside, compound 3, epothilone B7-O- β -D-glucosyl- (1 → 2) - β -D glucoside, or compound 4, epothilone B7-O- β -D-glucosyl- (1 → 2) - β -D-glucosyl- (1 → 4) - β -D glucoside.
2. The epothilone B glucoside of claim 1, wherein epothilone B glucoside is compound 1 epothilone B7-O- β -D glucoside.
3. The process for the enzymatic preparation of epothilone B glucosides according to claim 1 or 2, comprising the steps of:
in the following proportions, 50mM Tris-HCl,10mM MgCl2In the buffer solution environment, an in vitro enzyme activity reaction experiment is carried out on epothilone B with the final concentration of 10mM, UDP-O- β -D-glucose with the final concentration of 50mM and I62A mutein of glycosyltransferase BsGT-1 with the final concentration of 500 mu g/ml, a reaction mixed solution is incubated at 37 +/-1 ℃ for 12 +/-2 hours, then 3 times of methanol is added for stopping the reaction, 14000r/min is carried out, protein precipitate is removed for 30min, the sample is subjected to rotary evaporation drying treatment, then methanol heavy suspension product is added, 14000r/min is centrifuged again for 30min, then the product is separated and purified through a semi-preparative liquid phase, the size specification of a chromatographic column is selected from YMC-Pack Pro 18,250mm multiplied by 10.0mM and 5 mu m, a mobile phase system is eluted by a 35:65 acetonitrile water system, the peak emergence time of epothilone B glucoside is compound 1: 13.2min, compound 2: 10.6min, compound 3: 7.1min, compound 4: 5.2min, four compounds are evaporated to dryness after separation, and four compounds are respectively used3OD dissolution, and respectively identifying by using UHPLC-ESI-Q-TOF high-resolution mass spectrum and nuclear magnetic resonance;
wherein, the I62A mutant protein of the glycosyltransferase BsGT-1 takes pET28a-BsGT-1 recombinant plasmid as a template, and a mutant primer F-I62A is designed: CTTGAATgccGATCCTAAGCAAATCAGGGAGATG, respectively; R-I62A: TAGGATCggcATTCAAGGATGTATGATAGATCAATGC, generating linear recombinant mutant plasmid fragments by one-time PCR, and carrying out cyclization by recombination reaction to form I62A mutant pET28a-Bsgt-1 recombinant plasmid, and obtaining the recombinant plasmid through transformation of the recombinant plasmid and induced expression of protein.
4. The method for preparing epothilone B glucosides by the enzymatic method according to claim 3, wherein epothilone B and UDP-O- β -D-glucose are mixed in a molar ratio of 1:5, and the mixture is incubated with the reaction mixture of the glycosylation reaction mediated by the I62A mutein of glycosyltransferase Bsgt-1 at 37 ℃ for 12 hours.
5. Use of the epothilone B glucosides according to claim 1 or 2 for the preparation of a medicament for the prevention and treatment of liver cancer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010018493.7A CN111138444B (en) | 2020-01-08 | 2020-01-08 | Epothilone B glucoside compounds and enzymatic preparation and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010018493.7A CN111138444B (en) | 2020-01-08 | 2020-01-08 | Epothilone B glucoside compounds and enzymatic preparation and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111138444A true CN111138444A (en) | 2020-05-12 |
| CN111138444B CN111138444B (en) | 2022-05-03 |
Family
ID=70524000
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010018493.7A Active CN111138444B (en) | 2020-01-08 | 2020-01-08 | Epothilone B glucoside compounds and enzymatic preparation and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111138444B (en) |
Citations (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999066028A2 (en) * | 1998-06-18 | 1999-12-23 | Novartis Ag | Genes for the biosynthesis of epothilones |
| WO2001027306A2 (en) * | 1999-10-13 | 2001-04-19 | The Board Of Trustees Of The Leland Stanford Junior University | Biosynthesis of polyketide synthase substrates |
| WO2004050089A1 (en) * | 2002-12-05 | 2004-06-17 | Schering Ag | Epothilone analogs for site specific delivery in the treatment of proliferative diseases |
| WO2006003456A2 (en) * | 2004-07-07 | 2006-01-12 | Isis Innovation Limited | Glycosylation of antibiotics |
| CN101362784A (en) * | 2008-10-06 | 2009-02-11 | 山东大学 | Ebomycin glycosides compounds, composition using the same as activity component and use thereof |
| CN101643490A (en) * | 2008-08-07 | 2010-02-10 | 浙江海正药业股份有限公司 | Epothilonoside compound, preparation method and application as cytostatics thereof |
| WO2014185717A1 (en) * | 2013-05-15 | 2014-11-20 | 한국생명공학연구원 | Novel epothilone derivative and use thereof |
| KR20150086990A (en) * | 2014-01-21 | 2015-07-29 | 선문대학교 산학협력단 | Novel Epothilone Glycosides and Method for Preparing the Same |
| KR20170005591A (en) * | 2015-07-06 | 2017-01-16 | 선문대학교 산학협력단 | Novel Epothilone A derivatives and Uses Thereof |
| KR20170059549A (en) * | 2015-11-20 | 2017-05-31 | 경희대학교 산학협력단 | A protein having glycosyltransferase activity to ginsenoside and use thereof |
| KR20170077422A (en) * | 2015-12-28 | 2017-07-06 | 선문대학교 산학협력단 | New Sialic Acid Derivatives of Epothilone A and Method for Producing the Same |
| CN109232684A (en) * | 2018-11-02 | 2019-01-18 | 蚌埠医学院 | 17-AAG glucoside and preparation method thereof and application in preparation of anti-tumor drugs |
-
2020
- 2020-01-08 CN CN202010018493.7A patent/CN111138444B/en active Active
Patent Citations (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999066028A2 (en) * | 1998-06-18 | 1999-12-23 | Novartis Ag | Genes for the biosynthesis of epothilones |
| WO2001027306A2 (en) * | 1999-10-13 | 2001-04-19 | The Board Of Trustees Of The Leland Stanford Junior University | Biosynthesis of polyketide synthase substrates |
| WO2004050089A1 (en) * | 2002-12-05 | 2004-06-17 | Schering Ag | Epothilone analogs for site specific delivery in the treatment of proliferative diseases |
| WO2006003456A2 (en) * | 2004-07-07 | 2006-01-12 | Isis Innovation Limited | Glycosylation of antibiotics |
| CN101643490A (en) * | 2008-08-07 | 2010-02-10 | 浙江海正药业股份有限公司 | Epothilonoside compound, preparation method and application as cytostatics thereof |
| CN101362784A (en) * | 2008-10-06 | 2009-02-11 | 山东大学 | Ebomycin glycosides compounds, composition using the same as activity component and use thereof |
| WO2014185717A1 (en) * | 2013-05-15 | 2014-11-20 | 한국생명공학연구원 | Novel epothilone derivative and use thereof |
| KR20150086990A (en) * | 2014-01-21 | 2015-07-29 | 선문대학교 산학협력단 | Novel Epothilone Glycosides and Method for Preparing the Same |
| KR20170005591A (en) * | 2015-07-06 | 2017-01-16 | 선문대학교 산학협력단 | Novel Epothilone A derivatives and Uses Thereof |
| KR20170059549A (en) * | 2015-11-20 | 2017-05-31 | 경희대학교 산학협력단 | A protein having glycosyltransferase activity to ginsenoside and use thereof |
| KR20170077422A (en) * | 2015-12-28 | 2017-07-06 | 선문대학교 산학협력단 | New Sialic Acid Derivatives of Epothilone A and Method for Producing the Same |
| CN109232684A (en) * | 2018-11-02 | 2019-01-18 | 蚌埠医学院 | 17-AAG glucoside and preparation method thereof and application in preparation of anti-tumor drugs |
Non-Patent Citations (3)
| Title |
|---|
| PENG ZHANG等: "Phylogeny-guided characterization of glycosyltransferases for epothilone glycosylation", 《MICROBIAL BIOTECHNOLOGY》 * |
| QIANQIAN WANG等: "Molecular cloning and expression of a glycosyltransferase from Bacillus subtilis for modification of morin and related polyphenols", 《BIOTECHNOL LETT》 * |
| 张鹏: "埃博霉素糖基转移酶的初步探究", 《中国优秀硕士学位论文全文数据库基础科学辑》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111138444B (en) | 2022-05-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220168428A1 (en) | Cannabinoid glycoside prodrugs and methods of synthesis | |
| WO2013182206A1 (en) | Method for producing oligosaccharides and oligosaccharide glycosides by fermentation | |
| Xu et al. | Nocardiopsistins AC: New angucyclines with anti-MRSA activity isolated from a marine sponge-derived Nocardiopsis sp. HB-J378 | |
| Jayasuriya et al. | Isolation and structure elucidation of thiazomycin | |
| Fan et al. | Switching glycosyltransferase UGT BL 1 regioselectivity toward polydatin synthesis using a semi-rational design | |
| Fu et al. | Total Synthesis of Nucleoside Antibiotics Amicetin, Plicacetin, and Cytosaminomycin A—D | |
| CN112010924B (en) | Novel Nosiheptide glycosylated derivative and preparation method and application thereof | |
| Li et al. | Promoter‐Controlled Synthesis and Conformational Analysis of Cyclic Mannosides up to a 32‐mer | |
| Liu et al. | Recent advances in methods of puerarin biotransformation | |
| CN111138444B (en) | Epothilone B glucoside compounds and enzymatic preparation and application thereof | |
| Wu et al. | Design, synthesis, and anti-tobacco mosaic virus (TMV) activity of glycoconjugates of phenanthroindolizidines alkaloids | |
| NZ229964A (en) | N-alkyl derivatives of antibiotic bu-3608 and pharmaceutical compositions | |
| CN111205343B (en) | Nitrogen acetyl glucoside or galactoside compound of epothilone B, and enzymatic preparation and application thereof | |
| WO2019227969A1 (en) | Ansamycin all-carbon cycle polyketide-type antibiotic and uses thereof in preparing antimicrobial medications or anti-tumor medications | |
| KR101638045B1 (en) | Novel epothilone derivatives and uses thereof | |
| Zhang et al. | Sugar-pirating as an enabling platform for the synthesis of 4, 6-dideoxyhexoses | |
| Yang et al. | Synthesis of (1→ 6)-β-d-glucosamine hexasaccharide, a potential antitumor and immunostimulating agent | |
| Mandal et al. | Convergent synthesis of a tetrasaccharide repeating unit of the O-specific polysaccharide from the cell wall lipopolysaccharide of Azospirillum brasilense strain Sp7 | |
| CN111170975B (en) | Antibiotic lobophorin, preparation method and application thereof | |
| Antonov et al. | New triterpene oligoglycosides from the Caribbean sponge Erylus formosus | |
| Kumar et al. | Reagent-controlled chemo/stereoselective glycosylation of ʟ-fucal to access rare deoxysugars | |
| Ghosh et al. | Facile synthesis of the pentasaccharide repeating unit of the cell wall O-antigen of Escherichia coli 19ab | |
| KR101347335B1 (en) | Novel narbomycin derivatives compounds, antibacterial composition comprising the same and manufacturing method of the same | |
| CN113025549B (en) | Biological glycosyl synthesis system of staurosporine framework compound and synthesis method thereof | |
| JP3074084B2 (en) | Novel 16-membered macrolide derivatives and production method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |