LU88123A1 - IMPROVED METHOD FOR PRODUCING GLYCOSYL TRANSFERASES - Google Patents

Description

V

Improved process for the production of glycosyltransferases

The invention relates to the field of recombinant DNA technology and provides an improved method for producing glycosyltransferases by means of transformed yeast strains.

Glycosyltransferases transfer sugar residues from an activated donor substrate, usually a nucleotide sugar, to a specific acceptor sugar to form a glycosidic bond. Depending on the type of sugar transferred, these enzymes are divided into families, e.g. Galactosyltransferases, sialyltransferases and fucosyltransferases. As membrane-bound proteins, which are mainly found in the Golgi apparatus, the glycosyltransferases have a common domain structure, which consists of a short amino-terminal cytoplasmic tail, a signal anchor domain and an extended stem region, followed by a large carboxyl-terminal catalytic domain. The signal anchor domain functions both as a non-cleavable signal peptide and as an anchor extending across the membrane and aligns the catalytic domain of the glycosyltransferase within the lumen of the Golgi apparatus. The luminal stem region, also called the spacer region, is believed to function as a flexible chain that enables the catalytic domain to glycosylate carbohydrate groups of membrane-bound and soluble secretory pathway proteins that pass through the Golgi apparatus. In addition, it was discovered that the stem section functions as a retention signal to keep the enzymes bound to the Golgi membrane (PCT Application No. 91/06635). Soluble forms of glycosyltransferases are found in milk, serum and other body fluids. It is believed that these soluble glycosyltransferases result from proteolytic release of the corresponding membrane-bound forms of the enzymes by endogenous proteases, presumably from cleavage between the catalytic domain and the membrane-projecting domain.

The enzymatic synthesis of carbohydrate structures has the advantage that stereoselectivity and regioselectivity are high, which makes the glycosyltransferases a valuable tool for the modification or synthesis of glycoproteins, glycolipids and oligosaccharides. In contrast to chemical methods, the time-consuming introduction of protective groups is unnecessary.

Since glycosyltransferases occur in very small amounts in nature, their isolation from natural products and their subsequent purification are difficult. It was therefore worked on their production using the recombinant DNA method. For example, galactosyltransferases were expressed in rows of E. coli (PCT 90/07000) and Chinese hamster ovaries (CHO) (Smith, DF et al. (1990) J. Biol. Chem. 265, 6225-34), sialyltransferases in CHO cells (Lee, EU (1990) Diss. Abstr. Int.B.50,3453-4) and COS-1 cells (Paulsen, JC et al. (1988) J. Cell. Biol. 107,10A ) and fucosyl transferases were expressed in COS-1 cells (Goelz, SE et al. (1990) Cell 63, 1349-1356; Larsen RD et al. (1990) Proc. Natl. Acad. Sci. USA 87,6674- 6678) and CHO cells (Potvin, B. (1990) J. Biol. Chem. 265, 1615-1622). It is considered that heterologous expression in prokaryotes has the disadvantage that non-glycosylated products are obtained, but glycosyltransferases are glycoproteins, and that the production of glycosyltransferases by mammalian hosts is very expensive and due to the presence of many endogenous glycosyltransferases which would contaminate the desired product , is complicated, there is a need for improved processes that enable the economical production of glycosyltransferases on a large scale.

It is an object of the present invention to provide such methods.

The present invention provides a method for the production of biologically active glycosyltransferases using recombinant DNA technology, in which a yeast vector expression system is used.

More specifically, the present invention provides a method for the production of a membrane-bound glycosyltransferase from the group consisting of a galactosyltransferase, a sialyltransferase and a fucosyltransferase, or one of their variants, which method is characterized in that a yeast strain is cultivated which with a hybrid vector, the expression cassette consisting of a promoter and one for the said

Contains glycosyltransferase or its variant coding DNA sequence, which DNA is controlled by the promoter mentioned, has been transformed, and the enzymatic activity is obtained.

In a first embodiment, the invention provides a process for the production of a membrane-bound glycosyltransferase from the group consisting of a galactosyltransferase, a sialyltransferase and a fucosyltransferase, or one of their variants, the process being characterized in that a yeast strain is cultivated, which has been transformed with a hybrid vector which contains an expression cassette comprising a promoter, a DNA sequence coding for said glycosyltransferase or its variant, said DNA being controlled by said promoter and a DNA sequence with yeast transcription termination signals, and the enzymatic activity is obtained.

In a second embodiment, the invention relates to a process for the production of a membrane-bound glycosyltransferase from the group consisting of a galactosyltransferase, a sialyltransferase and a fucosyltransferase or one of their variants, the process being characterized in that a yeast strain is cultivated which is treated with a Hybrid vector comprising an expression cassette comprising a yeast promoter, which is functionally linked to a first DNA sequence coding for a signal peptide, which is linked in the correct reading frame to a second DNA sequence coding for the glycosyltransferase mentioned or its variant, and a DNA Sequence with yeast transcription termination signals, has been transformed, and the enzymatic activity is obtained.

The term "glycosyltransferase" whenever used in the preceding or following text is to be understood to include the family of galactosyltransferases, the family of sialyltransferases and the family of fucosyltransferases. The glycosyltransferases mentioned are naturally occurring enzymes which are found in mammals, e.g. Cattle, mice, rats and humans. Preferred glycosyltransferases are naturally occurring human glycosyltransferases in their full length, including those enzymes which are referred to in the following text with their EC numbers.

The membrane-bound galactosyltransferases and their variants, which are obtainable by the inventive method, catalyze the transfer of a galactose residue from an activated donor, usually a nucleotide activated donor, e.g. Uridine diphosphate galactose (UDP-Gal), on a carbohydrate group.

Examples of membrane-bound galactosyltransferases are UDP-galactose: β-galactoside-a (l-3) -galactosyltransferase (EC 2.4.1.151), for which galactose serves as an acceptor substrate with formation of an a (l-3) bond, and UDP-galactose: β-N-acetylglucosamine-β (1-4) galactosyltransferase (EC 2.4.1.22), which transfers galactose to N-acetylglucosarain (GlcNAc) to form a β (1-4) bond, including their respective variants. In the presence of a-lactalbumin, the β- (1-4) galactosyl transferase also serves as glucose as the acceptor substrate, thereby catalyzing the lactose synthesis.

The most preferred membrane bound galactosyltransferase is the enzyme with the amino acid sequence listed under SEQ ID NO. 1 is specified in the sequence listing.

The membrane-bound sialyltransferases and their variants, which are obtainable by the process according to the invention, catalyze the transfer of sialic acids (for example N-acetylneuraminic acid (NeuAc)) from an activated donor, usually a cytidine monophosphatsialic acid (CMP-SA), to a carbohydrate acceptor residue. An example of a membrane-bound sialyltransferase which can be obtained by the inventive method is CMP-NeuAc: β-galactoside-a (2-6) -sialyltransferase (EC 2.4.99.1) which the NeuAc-a (2-6) Gal- ß (l-4) GlcNAc sequence that is found in many N-linked carbohydrate groups.

The most preferred membrane-bound sialyltransferase is the enzyme with the amino acid sequence, which is listed in the sequence listing under SEQ ID no. 3 is listed.

The membrane-bound fucosyl transferases and their variants, which are obtainable by the inventive method, catalyze the transfer of a fucose residue from an activated donor, usually a nucleotide activated donor such as e.g. Guanosine diphosphate fucose (GDP-Fuc), on a carbohydrate group. Examples of such fucosyltransferases are GDP-fucose: β-galactoside-a (l-2) -fucosyltransferase (EC 2.4.1.69) and GDP-fucose: N-acetylamine-a (l-3/4) -fucosyltransferase (EC 2.4.1.65 ).

The most preferred membrane-bound fucosyltransferase is the enzyme with the amino acid sequence, which is shown in the sequence listing under SEQ ID no. 5 is listed.

In the present application, the term variants means both membrane-bound and soluble variants of the naturally occurring membrane-bound glycosyltransferases, with the proviso that these variants are enzymatically active. Variants occurring in humans are preferred.

For example, the term "variants" is to be understood to include naturally occurring membrane-bound variants of membrane-bound glycosyltransferases that are found within a particular species, such as e.g. a variant of a galactosyltransferase, which is derived from the enzyme with the SEQ ID no. 1 specified amino acid sequence in that it lacks the serine in position 11 and in positions 31 and 32 valine and tyrosine occur in place of alanine and leucine, respectively. Such a variant can be encoded by a related gene of the same gene family or by an allelic variant of a specific gene. The term “variants” also includes glycosyltransferases which are produced from an in vitro mutated DNA, as long as the protein encoded by said DNA has the enzymatic activity of the native glycosyltransferase. Such modifications can consist of an addition, an exchange and / or a deletion of amino acids, in which case shortened variants arise.

Preferred variants which are produced by the method according to the invention are shortened variants, in particular soluble variants, i.e. Variants that are not membrane-bound. Shortened variants are, for example, soluble forms of membrane-bound glycosyltransferases and their membrane-bound variants, e.g. those variants mentioned above which can be secreted by a transformed yeast strain used in the method according to the invention. According to the present invention, these soluble enzymes are the preferred shortened variants.

The invention also relates to a method for producing a soluble variant of a membrane-bound glycosyltransferase from the group consisting of a

Galactosyltransferase, a sialyltransferase and a fucosyltransferase, this method being characterized in that a yeast strain is cultivated, which with a hybrid vector comprising an expression cassette comprising a promoter, a DNA sequence functionally linked to this promoter and which codes for a signal peptide, and which is connected in the correct reading frame to a second DNA sequence coding for the variant mentioned, and a DNA sequence which contains yeast transcription termination signals has been transformed, and that said variant is isolated.

The soluble form of a glycosyltransferase is by definition a shortened variant, which differs from the corresponding form with the full length, i.e. the membrane-bound form, which is naturally found in the endoplasmic reticulum or in the Golgi complex, is distinguished by the absence of the cytoplasmic tail, the signal anchor and, if necessary, part of the stem region. The term “part of the stem region” is defined in connection with the present text in such a way that it denotes a smaller part of the N-terminal side of the stem region and consists of up to 12 amino acids. In other words, the soluble variants made in accordance with the present invention consist of essentially the entire stem region and the catalytic domain.

The soluble variants are enzymatically active enzymes which differ from the respective forms with the full length in that an NH2-terminal peptide consisting of 26 to 61 amino acids is missing, with the proviso that in those forms in which part of the stem region missing, only the smaller part of this region defined above is missing. Preferred soluble variants are those which are obtainable from the membrane-bound glycosyltransferases for which EC numbers are given, and additionally soluble variants which are from the membrane-bound fucosyltransferase with the SEQ. ID no. 5 are available.

Preferred soluble variants of the galactosyltransferases differ from the respective forms with the full length in that they lack an NH2-terminal peptide which consists of 37 to 55, in particular 41 to 44, amino acids. The most preferred soluble variant that is made according to the inventive method is the enzyme with the amino acid sequence that is identified under SEQ ID NO. 2 is listed in the sequence listing.

Preferred soluble variants of sialyltransferases lack an NH2-terminal peptide, which consists of 26 to 38 amino acids, compared to the full length forms. The most preferred soluble variant, which is produced according to the inventive method, is the enzyme with the amino acid sequence, which appears in the sequence listing in the SEQ ID no. 4 is listed. Also preferred is the soluble variant labeled ST (Lys27-Cys406), which consists of amino acids 27 to 406 of the sequence shown in SEQ ID no. 3 given amino acid sequence exists.

Preferred soluble variants of the fucosyltransferases differ from the respective full-length enzymes in that they lack an NH2-terminal peptide which consists of 56 to 67, in particular 56 to 61, amino acids. Particularly preferred is the soluble variant designated FT (Arg62-Arg405), which consists of amino acids 62 to 405 of the sequence shown in SEQ ID no. 5 amino acid sequence listed exists.

The yeast host strains and the components of the hybrid vectors are those given below.

The transformed yeast strains are grown using methods known to those skilled in the art.

Thus, the transformed yeast strains according to the invention are grown in a liquid medium which contains assimilable sources of carbon, nitrogen and mineral salts.

A number of carbon sources can be used. Examples of preferred carbon sources are assimilable carbohydrates such as e.g. Glucose, maltose, mannitol, fructose or lactose, or an acetate such as sodium acetate, which can be used either alone or in suitable mixtures. Suitable nitrogen sources include, for example, amino acids such as casamino acids, peptides and proteins and their breakdown products such as trypton, peptone or meat extracts, furthermore yeast extract, malt extract, corn steep liquor, as well as ammonium salts such as ammonium chloride, ammonium sulfate or ammonium nitrate, which can be used either alone or in suitable mixtures . The inorganic salts that can be used include, for example, sodium, potassium, magnesium and calcium sulfates, chlorides, phosphates and carbonates. The nutrient medium can also contain growth-promoting substances. The growth-promoting substances include, for example, trace elements such as iron, zinc, manganese and the like, or individual amino acids.

Because of the incompatibility between the endogenous two micron DNA and hybrid vectors with their replicon, yeast cells transformed with such hybrid vectors show a tendency to lose them. Such yeast cells must be grown under selective conditions, i.e. Conditions under which expression of a plasmid-encoded gene is required for growth. Most of the selective markers currently used and occurring in the hybrid vectors according to the invention (see below) are genes which code for enzymes for amino acid or purine biosynthesis. Therefore minimal synthetic media, in which the respective amino acid or purine base is missing, must be used. However, it is also possible to use genes that confer resistance to a suitable biocid [e.g. a gene that confers resistance to the aminoglycoside G418]. Yeast cells transformed with vectors containing genes for antibiotic resistance are grown in complex media containing the respective antibiotic, resulting in higher growth rates and higher cell density.

Hybrid vectors containing the complete two-micron DNA (including a functional replication start site) remain stable within Saccharomvces cerevisiae strains that are lacking endogenous two-micron plasmids (so-called cir ° strains), so that they are below non-selective growth conditions can be grown, ie in a complex medium.

Yeast cells which contain hybrid plasmids with a constitutive promoter express the DNA which codes for a glycosyltransferase controlled by the abovementioned promoter, or a variant thereof, without induction. However, if the above-mentioned DNA is controlled by a regulated promoter, the composition of the culture medium must be changed in order to obtain a maximum of mRNA transcripts, for example, when the PH05 promoter is used, the concentration of inorganic phosphate in the culture medium must be low to derepress this promoter.

Breeding is carried out using conventional techniques. The cultivation conditions such as temperature, pH of the medium and fermentation time are chosen so that a maximum of heterologous protein is produced. A selected yeast strain is preferably grown under aerobic conditions in a submerged culture under shaking or stirring at a temperature of about 25 ° to 35 ° C, preferably at about 28 ° C, and at a pH of 4 to 7, e.g. about pH 5, grown for at least 1 to 3 days, preferably as long as satisfactory protein yields are obtained.

After its expression in yeast, the membrane-bound glycosyltransferase or its variant is either enriched within the rows or secreted into the culture medium and isolated in a conventional manner.

For example, the first step is usually that the lines are separated from the culture liquid by centrifugation. If the membrane-bound glycosyltransferase or its variant has accumulated within the cells, the protein must be released from the cell interior by cell disruption. Yeast cells can be disrupted in various ways that are known to those skilled in the art: e.g. by exerting mechanical forces such as shaking with glass beads, by ultrasonic vibration, osmotic shock and / or by enzymatic digestion of the cell wall. If the desired membrane-bound glycosyltransferase or its variant is associated or bound to a membrane fraction, further enrichment e.g. can be achieved by subjecting the cell extract to a differential centrifugation and, if necessary, subsequently by using a detergent such as e.g. Triton is being treated. Methods suitable for the purification of the "crude" glycosyltransferase, or its variant, include the customary chromatographic methods such as affinity chromatography, for example with a suitable substrate, with antibodies or with Concanavalin A, ion exchange chromatography, gel filtration, distribution chromatography, HPLC, electrophoresis, precipitation steps such as ammonium sulfate precipitation, and other processes, in particular the processes known from the literature.

If the glycosyltransferase or its variant is secreted from the yeast cell into the periplasmic space, a simplified isolation protocol can be used: the protein is removed without cell lysis by enzymatic removal of the cell wall or by chemicals, e.g. Thiol reagents or EDTA, which induce cell wall damage and thus enable the release of the glycosyltransferase produced, were obtained. If the glycosyltransferase, or the Vaiante, is secreted into the culture liquid, it can be obtained directly from it and purified using the methods mentioned above.

Tests known from the literature can be used to detect glycosyltransferase activity. Galactosyltransferase activity can e.g. be determined by measuring the amount of radioactively labeled galactose that is incorporated into a suitable acceptor molecule such as a glycoprotein or a free sugar residue. Analogously, sialyltransferase activity can be tested by e.g. Sialic acid is incorporated into suitable substrates, and fucosyltransferase activity can be tested by transferring fucose to a suitable acceptor.

The transformed yeast host cells of the invention can be used. recombinant DNA techniques are produced according to the following steps: production of a hybrid vector which comprises a yeast promoter and a DNA sequence coding for a membrane-bound glycosyltransferase or its variant, this DNA sequence being controlled by said promoter, Transformation of a yeast host strain with the said hybrid vector, and selection of the transformed yeast cells from the untransformed yeast cells.

Expression vectors

The yeast hybrid vector according to the invention contains an expression cassette which comprises a yeast promoter and a DNA sequence coding for the membrane-bound glycosyltransferase or a variant thereof, this DNA sequence being controlled by said promoter.

In a first embodiment, the yeast hybrid vector according to the invention contains an expression cassette which contains a yeast promoter, a DNA sequence coding for a membrane-bound glycosyltransferase or one of its variants, this DNA sequence being controlled by the promoter mentioned, and a DNA sequence, containing yeast transcription termination signals.

In a second embodiment, the yeast hybrid vector according to the invention contains an expression cassette which contains a yeast promoter which is functionally linked to a first DNA sequence which codes for a signal peptide and which is linked in the correct reading frame to a second DNA sequence, encoding a membrane-bound glycosyltransferase or a variant thereof, and a DNA sequence containing yeast transcription termination signals

The yeast promoter is a regulated (inducible) or constitutive promoter, which is preferably derived from a highly expressed yeast gene, in particular a Saccharomyces cerevisiae gene. Thus, the promoters of the TRPl gene, the ADHI or ADHII gene, the acid phosphatase (PH05) gene, a promoter of the yeast mating pheromone genes which code for the a or a factor, or a promoter from one for a gene encoding a glycolytic enzyme, such as the promoter of enolase, glyceraldehyde-3-phosphate dehydrogenase (GAP), 3-phosphoglycerate kinase (PGK), hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3 Phosphoglycerate mutase, pyruvate kinase, triose phosphate isomerase, phosphoglucose isomerase or glucokinase genes can be used. It is also possible to use hybrid promoters containing "upstream activation sequences" (UAS) from a yeast gene and "downstream promoter elements" with a functional "TATA box" of another yeast gene, for example a hybrid promoter with the UAS of the yeast PH05- Gens and "downstream promoter elements" with a functional "TATA box" of the yeast GAP gene (PH05-GAP hybrid promoter). A preferred promoter is the promoter of the GAP gene, in particular its functional fragments, which begin at nucleotides between positions -550 and -180, in particular at nucleotide -540, -263 or -198, and at nucleotide -5 of the GAP gene end up. Another preferred promoter of the regulated type is the PH05 promoter. A preferred constitutive promoter is a truncated acid phosphatase PH05 promoter lacking the upstream regulatory elements (UAS), as is the PH05 (-173) promoter element that begins at nucleotide -173 of the PH05 gene and ends at nucleotide -9 of this gene.

The DNA sequence encoding a signal peptide ("signal sequence") preferably originates from a yeast gene which codes for a polypeptide which is normally secreted. Other signal sequences of heterologous proteins that are normally secreted can also be chosen. Yeast signal sequences are, for example, the signal and prepro sequences of the yeast invertase gene, α-factor gene, pheromone peptidase (KEXl) gene, "killer toxin" gene and the repressible acid phosphatase (PH05) gene , and the Aspergillus awamori glucoamylase signal sequence. Alternatively, combined signal sequences can be constructed by ligating part of the signal sequence (if any) of the gene naturally associated with the promoter used (e.g. PH05) to part of the signal sequence of another heterologous protein. Preferred combinations are those that allow precise cutting between the signal sequence and the glycosyltransferase amino acid sequence. Additional sequences such as pro- or spacer sequences with or without special processing signals can also be included in the constructions in order to enable precise processing of precursor molecules. However, it is also possible to produce fusion proteins with internal processing signals that enable maturation in vivo or in vitro. For example, the processing signals contain Lys-Arg, which is recognized by a yeast endopeptidase in the Golgi membranes. The preferred signal sequence according to the present invention is that of the yeast invertase gene.

When a full-length glycosyltransferase or one of its membrane-bound variants is expressed in yeast, the preferred yeast hybrid vector contains an expression cassette containing a yeast promoter, a DNA sequence coding for said glycosyltransferase or variant, which is controlled by said promoter, and a DNA Sequence comprising yeast transcription termination signals.

If a soluble variant of a glycosyltransferase is expressed in yeast, the preferred yeast hybrid vector contains an expression cassette which contains a yeast promoter which is functionally linked to a first DNA sequence which codes for a signal peptide and which is in the correct reading frame with a second DNA Sequence connected, which codes for the variant mentioned, and comprises a DNA sequence which contains yeast transcription termination signals. DNA coding for a membrane-bound glycosyltransferase or one of its variants can be produced by methods known to the person skilled in the art and contains genomic DNA, e.g. DNA derived from a mammalian genomic DNA library, e.g. Rat, mouse and bovine cells or human cells. If necessary, the introns that occur in the genomic DNA encoding the enzyme are removed. A DNA coding for a membrane-bound glycosyltransferase or one of its variants also comprises cDNA, which can be isolated from a mammalian cDNA library or prepared from the corresponding mRNA. The cDNA library can be made up of rows of different tissues, e.g. Placenta cells or liver cells. The cDNA is produced via the mRNA using conventional methods such as the polymerase chain reaction (PCR).

For example, isolation of poly (A) + RNA from mammalian cells, e.g. HeLa cells, and the subsequent synthesis of the first strand of the cDNA according to standard methods known in the art. Starting from this synthesized DNA template, the target sequence, i.e. the glycosyltransferase DNA, or one of its fragments, is amplified while minimizing the amplification of the excess undesired sequences. For this purpose the sequence of a small nucleotide section on both sides of the target sequence must be known. These flanking sequences are used to build up two synthetic single-stranded primer oligonucleotides, the sequence of which is chosen so that the bases are complementary to the flanking sequence in question. PCR begins with the denaturation of the mRNA-DNA hybrid strand, followed by the attachment of the primer to the sequences flanking the target sequence. By adding a DNA polymerase and deoxynucleoside triphosphates, two pieces of double-stranded DNA are formed, each beginning with the primer and extending over the target sequence, the latter being copied. Each of the newly synthesized products can be used as a template for priment attachment and extensions (in the next cycle), resulting in an exponential increase in double-stranded fragments of discrete length.

In addition, a DNA that codes for a membrane-bound glycosyltransferase or one of its variants can be synthesized enzymatically or chemically. A variant of a membrane-bound glycosyltransferase with enzymatic activity and an amino acid sequence in which one or more amino acids are deleted (DNA fragments) and / or exchanged for one or more other amino acids is encoded by a DNA mutant. A mutated DNA is also to be understood as a silent mutant in which one or more nucleotides are replaced by other nucleotides, the new codons coding for the same amino acid (s). Such a mutated sequence can also be a degenerate DNA sequence. The latter are degenerate with respect to the genetic code in that an unlimited number of nucleotides can be replaced with other nucleotides without changing the initially encoded amino acid sequence. Such degenerate DNA sequences can be useful because they have different restriction sites and / or frequencies of certain codons that are preferred by a specific host for optimal expression of a glycosyltransferase. Such DNA sequences preferably have codons as are preferably used by yeast.

A DNA mutant can also be obtained by mutating a naturally occurring genomic DNA or a cDNA in vitro according to methods known in the art. For example, a partial DNA encoding a soluble form of a glycosyltransferase can be excised from a DNA coding for the respective membrane-bound glycosyltransferase using the full length using restriction enzymes. For this purpose it is advantageous if a suitable restriction site is available.

A preferred DNA sequence that contains yeast transcription termination signals is the 3 'flanking sequence of a yeast gene that contains correct signals for transcription termination and polyadenylation. Suitable 3'-banking sequences are e.g. the sequences of the yeast gene which are naturally linked to the promoter used. The preferred flanking sequence is that of the yeast PH05 gene.

The yeast promoter, the optional DNA sequence encoding the signal peptide, the DNA sequence encoding a membrane-bound glycosyltransferase or one of its variants, and the DNA sequence containing the yeast transcription termination signals are functionally shown in connected in a tandem arrangement, ie they are placed side by side in such a way that their normal functions are retained. They are arranged in such a way that the promoter effects a correct expression of the DNA sequence encoding a membrane-bound glycosyltransferase or one of its variants (optionally with an upstream signal sequence), that the transcription termination signals cause a correct termination of the transcription and the polyadenylation, and that the possibly present signal sequence is connected in the correct reading frame to the above-mentioned DNA sequence in such a way that the last codon of the signal sequence is connected directly to the first codon of the said DNA sequence and the protein is secreted. If the promoter and the signal sequence are from different genes, the promoter is preferably added to the signal sequence at a location between the main mRNA start and the ATG of the gene naturally associated with the promoter. The signal sequence should have its own ATG for translation initiation. These sequences can be combined with the recognition sequence of an endonuclease by means of synthetic oligodeoxynucleotide linkers.

Vectors suitable for replication and expression in yeast contain a yeast replication start site. Hybrid vectors containing a yeast origin of replication, for example the chromosomal autonomously replicating segment (ARS), remain extrachromosomally in the yeast cell after the transformation and are replicated autonomously during mitosis. Hybrid vectors containing sequences homologous to yeast plasmid DNA can also be used. Such

Hybrid vectors are integrated by recombination into 2p plasmids that already exist in the cell, or they replicate autonomously.

The hybrid vectors according to the invention preferably contain one or more, in particular one or two, selective genetic markers for yeast and such a marker and a start of replication for a bacterial host, in particular Escherichia coli.

As far as the selective gene markers for yeast are concerned, all marker genes can be used which enable selection for transformants on the basis of the phenotypic expression of the marker gene. Examples of suitable markers for yeast are those which express resistance to antibiotics or, in the case of auxotrophic yeast mutants, genes which compensate for deficiencies in the host. The genes in question confer, for example, resistance to the antibiotics G418, hygromycin or bleomycin, or mediate prototrophy in an auxotrophic yeast mutant, for example the URA3, LEU2, LYS2 or TRP1 gene.

Since the amplification of the hybrid vectors can be carried out conveniently in E. coli, it is advantageous to incorporate a genetic marker for E. coli and an R coli replication start site. These can be derived from R coli plasmids such as e.g. pBR322, or a pUC plasmid, for example pUC18 or pUC19, are obtained which contain both an E. coli replication start site and a genetic marker for E. coli which confers resistance to antibiotics such as ampicillin.

The hybrid vectors according to the invention are produced by methods known to those skilled in the art, for example in that the expression cassette comprises a yeast promoter and a DNA sequence coding for a glycosyltransferase, or a variant, which is controlled by the promoter mentioned, or several components of the expression cassette , with the DNA fragments containing selective genetic markers for yeast and for a bacterial host and replication start sites for yeast and for a bacterial host, in the predetermined order.

Yeast strains and their transformation

Suitable yeast host organisms are strains of the genus Saccharomvces, in particular strains of Saccharomvces cerevisiae. The yeast strains mentioned include yeast strains which have optionally been freed from endogenous two-micron plasmids and / or which may have no yeast peptidase activity (s), e.g. Peptidase have ysca, yscA, yscB, yscY, and / or yscS activity.

The invention further relates to a yeast strain which has been transformed with a hybrid vector which contains an expression cassette comprising a yeast promoter and a DNA sequence coding for a membrane-bound glycosyltransferase or one of its variants, this DNA being controlled by the promoter mentioned.

In a first embodiment, the yeast strain according to the invention with a hybrid vector comprising an expression cassette comprising a yeast promoter, a DNA sequence which codes for a membrane-bound glycosyltransferase or one of its variants, this DNA sequence being controlled by the promoter mentioned, and one DNA sequence that contains yeast transformation termination signals.

In a second embodiment, the yeast strain according to the invention was transformed with a hybrid vector which comprises an expression cassette comprising a yeast promoter which is functionally linked to a first DNA sequence which codes for a signal peptide and which is linked in the correct reading frame to a second DNA sequence, which codes for a membrane-bound glycosyltransferase or one of its variants, and transforms a DNA sequence which contains yeast transcription termination signals.

The transformation of yeast with the hybrid vectors according to the invention is carried out according to methods known in the art, for example according to the method of Hinnen et al. (Proc. Natl. Acad. Sci. USA (1978) 75, 1929) and Ito et al. (J. Bact. (1983) 153, 163-168).

The membrane-bound glycosyltransferases produced by the process according to the invention and their variants can be used in a manner known per se, e.g. for the synthesis and / or modification of glycoproteins, oligosaccharides and glycolipids (US Patent 4,925,796; EP Application 414,171).

The invention relates in particular to the process for the preparation of membrane-bound glycosyltransferases and their variants, the hybrid vectors and the transformed yeast strains, as described in the examples.

The following abbreviations are used in the examples: GT = galactosyltransferase (EC 2.4.1.22); PCR έ polymerase chain reaction; ST s sialyltransferase (EC 2.4.99.1) variants; FT = fucosyltransferase

Example 1: Cloning of galactosyltransferase (GT) cDNA from HeLa lines GT cDNA is made from HeLa cells (Watzele, G. and Berger, EG (1990) Nucleic Acids Res. 18.7174) with the polymerase chain reaction (PCR) -Isolated procedure: 1.1 Preparation of poly (A) + RNA from HeLa cells.

For the RNA preparation, HeLa cells are grown on 5 plates (23 × 23 cm) in a single cell layer culture. RNA is quickly and effectively isolated from the cultured lines by extraction with guanidine-HCl as described by MacDonald, R.J. et al (Meth. Enzymol. (1987) 152, 226-227). In general, the yields are approximately 0.6 to 1 mg of total RNA per plate of confluent lines. The poly (A) + RNA is enriched by affinity chromatography on 01igo (dT) cellulose according to the method described in the Maniatis manual (Sambrook, J. Fritsch, EF and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual (2nd edition), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, USA), whereby 4 mg of total RNA are applied to a 400 pl column. 3% of the applied RNA are retained as enriched poly (A) + RNA, precipitated with three times the volume of ethanol and stored in aliquots at -70 ° C until use.

1.2 Synthesis of first strand cDNA for PCR

Poly (A) + RNA (mRNA) is reverse-transcribed with Moloney Murine Leukemia Virus RNase H'Reverse Transcriptase (M-MLV H'RT) (BRL) in DNA. In the preparation of the 20μ1 reaction mixture, there are slight deviations from that of BRL provided protocol: 1 pg HeLa cell poly (A) + RNA and 500 ng oligo (dT) 12_18 (Pharmacia) in 11.5 μΐ sterile H20 are heated to 70 ° C for 10 minutes and then quickly cooled on ice. Then 4 μΐ reaction buffer (BRL; 250 mM Tris-HCl pH 8.3, 375 mM KC1.15 mM MgCl2), 2 μΐ 0.1 M dithiothreitol, 1 μΐ mixed dNTP (each 10 mM dATP, dCTP, dGTP, TTP , Pharmacia), 0.5 μΐ (17.5 U) RNAguard (RNase inhibitor from Pharmacia) and 1 μΐ (200 U) M-MLVH'RT added. The reaction is carried out at 42 ° C and stopped after one hour by heating the tube to 95 ° C for 10 minutes.

To check the effectiveness of the reaction, an aliquot of the mixture (5 μ 5) is incubated in the presence of 2 pCi α-32Ρ dCTP. The amount of cDNA synthesized is calculated by measuring the built-in dCTP. The first strand synthesis yield is routinely between 5 and 15%. 1.3 Polymerase chain reaction

The oligodeoxynucleotide primers used for the PCR are applied in vitro using the phosphoramidite method (MH Caruthers, in Chemical and Enzymatic Synthesis of Gene Fragments, HG Gassen and A. Lang, ed. Verlag Chemie, Weinheim, FRG) in an Applied Biosystems Synthesizer , Model 380B, synthesized. They are listed in Table 1.

Table 1: PCR primers accordingly

Primer sequence (5 'to 3') 1} bp in GT cDNA2)

Plup (KpnI) cgcggtACCdTCTTAAAGCGGCGGCGGGAAGATG (-26) - 3 PI (EcoRI) gccgaattcATGAGGCTTCGGGAGCCGCTCCTGAGCG 1 - 28 P3 (Sad) CTGGAGCTCGTGGCAAAGCAGAACCC 448-473 P2d (EcoRI) gccgaaTTCAGTCTCTTATCCGTGTACCAAAACGC CTA 1222-1192 P4 (HindIII) cccaagctTGGAATGATGATGGCCACCTTGTGAGG 546- 520 L uppercase Steben for GT Sequences, lowercase letters are additional sequences, digits for

Restriction enzymes are underlined, "start" and "stop" codons for RNA translation are shown in bold 2) DT cDNA sequence from the human placenta as published in GenBank (entry number M22921).

The following are standard PCR conditions for a 30 μΐ incubation mixture: 1 μΐ of the reverse transcriptase reaction (see Example 1.2), which contains approx. 5 ng first-strand cDNA, 15 pmol each of the relevant primers, 200 pmol each of the four Deoxynucleoside triphosphates (dATP, dCTP, dGTP and TTP) in PCR buffer (10 mM Tris-HCl pH 8.3 (at 23 ° C), 50 mM KC1, 1.5 mM MgCl2.001% gelatin) and 0, 5 U

AmpliTaq polymerase (Perkin Elmer). The maceration is carried out in the Thermocycler 60 (Biomed) under the following conditions: 0.5 minutes denaturation at 95 ° C, 1 minute addition at 56 ° C and 1 minute 15 seconds extension at 72 ° C, over a total of 20-25 cycles. In the last cycle, primer extension takes 5 minutes at 72 ° C. For sequencing and subcloning, the HeLa-GT cDNA is amplified in two overlapping sections, using different primer combinations: (1) Fragment PI -P4: The primers PI and P4 are used for the amplification of a 0.55 kb DNA Used fragment that extends over the nucleotide positions 7-556 in HeLa-GT cDNA (SEQ ID NO. 1) (2) fragment P3 - P2d: the primers P3 and P2d are used for the amplification of a 0.77 kb fragment, which extends over nucleotide positions 457-1232 (SEQID No. 1).

In order to avoid errors during the amplification, 4 independent PCRs are carried out per fragment. Primer PI up (Kpnl) is used together with primer P4 to determine the DNA sequence, which is followed by the "start" codon.

After the PCR amplification, fragment P1-P4 is digested with the restriction enzymes EcoRI and Hindïïl, the digestion is analyzed on a 1.2% agarose gel, eluted from the gel using GENECLEAN (BIO 101) and into the vector pUC18 (Pharmacia), which was digested with the same enzymes, subcloned fragment P3-P2d is digested with SacI and EcoRI, the digest is analyzed on a 1.2% gel, eluted and subcloned into pUC18, which was digested with SacI and EcoRI. The subclones obtained are pUC18 / Pl - P4 and pUC18 / P3 - P2d. Standard protocols as described in Example 2 are followed for subcloning, ligation and transformation of E. coli strain DH5a. Mini preparations of the plasmids pUC18 / Pl - P4 or pUC18 / P3 - P2d are used for the dideoxy sequencing of denatured double-stranded DNA with the T7 polymerase sequencing kit (Pharmacia). For the sequencing of overlapping fragments that are from both DNA strands by digestion with different restriction enzymes, M13 / pUC sequencing primer and reverse sequencing primer (Pharmacia) are used.

Further subcloning of restriction fragments of the GT gene is required for extensive sequencing of overlapping fragments of both strands. The sequence of

Fragments amplified by independent PCR show that the amplification error is less than 1 in 3000 nucleotides. The complete nucleotide sequence of the HeLa cell GT cDNA, which is shown in SEQ ID no. 1 is 99.2% homologous to that of the human place (Genbank entry no. M22921). There are three differences: (a) Three additional base pairs in nucleotide positions 37-39 (SEQ ID No. 1), which give an additional amino acid (Ser) in the N-terminal region of the protein; (b) bp 98-101 are "CTCT" instead of "TCTG" in the sequence of the human placenta, resulting in two conservative amino acid substitutions (Ala Leu instead of ValTyr) in amino acid positions 31 and 32 in the GT membrane-wide domain; (c) the nucleotide at position 1047 changes from "A" to "G" without causing changes in the amino acid sequence.

The two overlapping DNA fragments PI - P4 and P3 - P2d, which encode the HeLa-GT cDNA, are assembled via the NotI restriction site in nucleotide position 498, which exists in both fragments.

The complete HeLa cell GT cDNA (SEQ ID No. 1) is cloned as a 1.2 kb EcoRI-EcoRI restriction fragment in plasmid pIC-7, pIC-7 being a derivative of pUC8 with additional restriction sites in the multiple cloning site (Marsh, JL, Erfle, M. and Wykes, EJ. (1984) Gene 32,481-485), which gives the vector p4ADl 13. To construct the GT expression cassette, the EcoRI restriction site (bp 1227) at the 3 'end of the cDNA sequence is eliminated as follows: Vector p4AD113 is first linearized by digestion with EcoRV and then treated with alkaline phosphatase. In addition, 1 pg of the linearized plasmid DNA is partially digested with 0.25 U EcoRI for 1 hour at 37 ° C. After electrophoresis on agarose gel, a fragment is isolated from the gel using GENECLEAN (Bio 101), which corresponds to the size of the linearized plasmid (3.95 kb). The protruding EcoRI end is filled in with Klenow polymerase as described in the Maniatis manual (see above). After phenolization and precipitation with ethanol, the plasmid is ligated again and used for the transformation of E. coli DH5a (Gibco / BRL). Plasmid mini-preparations are prepared from six transformants. The plasmids obtained are checked by restriction analysis for the absence of the EcoRI and EcoRV restriction sites at the 3 'end of the HeLa-GT cDNA. The plasmid designated p4AE113 is selected for the following experiments, since its DNA sequence is identical to that of plasmid p4AD113, with the exception that bp 1232-1238 with the

EcoRI-EcoRV restriction sites are eliminated.

Example 2: Construction of expression cassettes for complete GT For heterologous expression in Saccharomvces cerevisiae, the complete HeLa GT cDNA sequence (SEQ ID No. 1) is combined with transcriptional control signals from the yeast in order to achieve effective initiation and termination of the transcription. The promoter and terminator sequences come from the yeast acid phosphatase gene (PH05) (EP 100561). The full PH05 promoter is regulated by the supply of inorganic phosphate in the culture medium. High Pr concentrations lead to repression of the promoter, while a low Pj content has an inductive effect. However, a short 173 bp PH05 promoter fragment can be used, which lacks all regulatory elements and which therefore behaves like a constitutive promoter. 2.1 Construction of a phosphate-inducible expression cassette

The GT cDNA sequence is as follows with the yeast PH05 promoter and

Combined transcription termination sequences: (a) Complete HeLa-GT cDNA sequence:

Vector p4AE113 with the complete GT cDNA sequence is digested with the restriction enzymes EcoRI and BglII. The DNA fragments are separated electrophoretically on a 1% agarose gel. A 1.2 kb DNA fragment which contains the complete cDNA sequence for HeLa-GT is isolated from the gel by adsorption on "glass milk" using the GENECLEAN kit (B10 101). On this fragment, the "ATG" start codon for the protein synthesis of GT is arranged directly behind the interface for EcoRI, while the "TAG" stop codon 32 bp follows, on whose composition the 3'-untranslated region of the HeLa-GT and the multiple cloning site of the vector with the BglII restriction site are involved. (b) Vector for amplification in E. coli:

The amplification vector, plasmid p31R (cf. EP 100561), a pBR322 derivative, is digested with the restriction enzymes BamHI and Sali. The restriction fragments are separated on a 1% agarose gel and a 3.5 kb vector fragment is isolated from the gel as described above. This DNA fragment contains the large SalI-HindII vector fragment of the pBR322 derivative and a 337 bp PH05 transcription termination sequence instead of the HindIII-BamHI sequence of pBR322. (c) Sequence for the inducible PH05 promoter:

The PH05 promoter fragment containing the regulatory elements (UASp) for phosphate induction is isolated from plasmid p31R (cf. EP 100561) by digestion with the restriction enzymes Sali and EcoRI. The 0.8 kb Sali - EcoRI DNA fragment contains the 276 bp Sali - BamHI pBR322 sequence and the 534 bp BamHI-EcoRI PH05 promoter fragment with the EcoRI linker (5'-GAATTC-3 ') in position -8 of the PH05 promoter sequence was introduced. (d) Construction of plasmid pGTA 1132

The three DNA fragments (a) to (c) are ligated in a 12 μΐ ligation mixture: 100 ng DNA fragment (a) and 30 ng each of fragments (b) and (c) are kept at 15 ° C. for 18 hours 0.3 U T4 DNA ligase (Boehringer) in the ligase buffer supplied (66 mM Tris-HCl pH 7.5, 1 mM dithioerythritol, 5 mM MgCl2.1 mM ATP) ligated. Competent lines from E. coli strain DH5a (Gibco / BRL) are transformed with half of the ligation mixture. For the production of competent lines and for the transformation, the standard protocol as described in the Maniatis manual (see above) is used. The lines are spread on selective LB medium supplemented with 75 μg / ml ampicillin and incubated at 37 ° C. About 120 transformants are obtained. Plasmid mini-preparations according to the modified alkaline lysis protocol from Birnboim, H.C. and Doly, J. as indicated in the Maniatis Handbook (see above). The isolated plasmids are characterized by restriction analysis with 4 different enzymes (EcoRI, PstI, Hindïïl, Sali, and combinations). All six plasmids show the expected restriction fragments. One of the clones is selected and designated pGTA 1132. Plasmid pGTA 1132 contains the expression cassette with the complete HeLa-GT cDNA, which is under the control of the phosphate-regulated PH05 promoter, and the PH05 transcription termination sequence. This expression cassette can be cut out of pGTA 1132 as a 2.35 kb Sali Hindli fragment and is referred to as a DNA fragment (IA). 2.2 Construction of a constitutive expression cassette: For the construction of an expression cassette with a constitutive, unregulated promoter, a 5'-shortened PH05 promoter fragment without phosphate regulatory elements is used, which is isolated from plasmid p31 / PH05 (-173) RIT.

(a) Construction of plasmid p31 / PH05 (-173) RIT

Plasmid p31 RIT12 (EP 288435) contains the fully regulated PHQ5 promoter (with an EcoRI site introduced in the nucleotide position -8 on a 534bp BamHI - EcoRI fragment), following which the coding sequence for the yeast invertase signal sequence (72bp EcoRI -Xhol) and the PH05 transcription termination signal (135bp Xhol - Hindlll), cloned in tandem between BamHI and Hindin of the vector derived from pBR322, then.

The constitutive PH05 (-173) promoter element from plasmid pJDB207 / PH05 (-173) -YHIR (EP 340170) comprises the nucleotide sequence of the yeast PH05 promoter from nucleotide position -9 to -173 (BstEII restriction site), but has "upstream" "no regulatory sequences (UASp). The PH05 (-173) promoter therefore behaves like a constitutive promoter. This example describes the replacement of the regulated PH05 promoter in plasmid p31RIT12 with the short, constitutive PH05 (-173) promoter element to obtain plasmid p31 / PH05 (-173) RIT.

The plasmids p31RIT12 (EP 288,435) and pJDB207 / PH05 (-173) -YHIR (EP 340,170) are digested with the restriction endonucleases Sail and EcoRI. The respective 3.6 kb and 0.4 kb Sail - EcoRI fragments are isolated on a 0.8% agarose gel, eluted from the gel, precipitated with ethanol and resuspended in H20 in a concentration of 0.1 pmol / μΐ . The two DNA fragments are ligated and aliquots of the 1 μΐ ligation mixture are used for the transformation of competent E. coli HB101 (ATCC) cells. Ampicillin-resistant colonies are grown individually in LB medium supplemented with ampicillin (100 pg / ml). Plasmid DNA is prepared using the method of Holmes, D.S. et al. (Anal. Biochem. (1981) 144, 193) and analyzed by restriction digestion with Sail and EcoRI. The plasmid of a clone with the correct restriction fragments is called p31 / PH05 (-173) RIT. (b) Construction of plasmid pGTB1135

Plasmid p31 / PH05 (-173) RIT is digested with the restriction enzymes EcoRI and Sail. After separation on a 1% agarose gel, a 0.45 kb Sail - EcoRI fragment is isolated from the gel using GENECLEAN (BIO 101). This fragment contains the 276 bp Sal-BamHI sequence from pBR322 and the 173 bp BamHI (BstEII) EcoRI fragment of the constitutive PH05 promoter. The 0.45 kb SalI-EcoRI fragment is ligated with the 1.2 kb EcoRI-Bglïï GT cDNA (fragment (a)) and the 3.5 kb BamHI-Sall vector part is used for amplification in E. coli with the in Example 2.1. described PH05 terminator (fragment (b)) ligated. Ligation and transformation of E. coli strain DH5oc are carried out as above, whereby 58 transformants are obtained. Plasmids are isolated from six independent colonies using minipreparations and characterized by restriction analysis. All six plasmids show the expected fragmentation pattern. A correct clone is designated pGTB 1135 and used for further cloning experiments to provide the HeLa-GT expression cassette under the control of the constitutive PH05 (-173) promoter fragment. This expression cassette can be cut out of vector pGTB 1135 as a 2 kb Sali - HindII fragment and is referred to as a DNA fragment (1B).

Example 3: Construction of the expression vectors PDPGTA8 and pDPGTB5. The yeast vector used for heterologous expression is the episomal vector pDP34 (11.8 kb), which contains a yeast E. coli shuttle vector with the ampicillin resistance marker for E. çoli and the yeast-selective markers URA3 and dLEU2. Vector pDP34 (cf. EP 340,170) is digested with the restriction enzyme BamHI. The linearized vector is isolated using GENECLEAN and the protruding ends are filled in using Klenow polymerase treatment as described in the Maniatis manual (see above). The reaction is stopped after 30 minutes by heating at 65 ° C. for 20 minutes together with 10 mM EDTA. After ethanol precipitation, the plasmid is digested with saline and the digest is separated by gel electrophoresis on a 0.8% agarose gel. The (BamHI) blunt-ended vector pDP34 cut with saline is isolated from the gel as an 11.8 kb DNA fragment using the GENECLEAN kit.

Analogously to the vector preparation, the plasmids pGTA 1132 and pGTB 1135 are each digested with HindII. The protruding ends of the linearized plasmids are filled in by means of Klenow polymerase treatment and then subjected to a saline digestion, with (2A) a 2.35 kb (Hindïïl) blunt-ended Sal fragment with the phosphate-regulated expression cassette or (2B) a 2, 0 kb (Hindlïï) blunt-ended Sall fragment with the constitutive expression cassette is formed.

The ligation of the blunt-ended Sali pDP34 vector part with fragment 2A or fragment 2B and the transformation of competent lines of the E. coli strain DH5a are carried out as described above in Example 2, using 80 ng of the vector part and 40 ng fragment 2A or 2B . 58 and 24 transformants are obtained. Six plasmids from each transformation are prepared and characterized by restriction analysis. 2 plasmids show the restriction pattern (fragment 2A) expected for the construction with the regulated expression cassette. One of the clones is chosen and designated pDPGTA8.

A plasmid has the restriction pattern expected for construction with the constitutive expression cassette (fragment 2B) and is referred to as pDPGTB5.

Example 4: Transformation of the S. cerevisiae strain BT 150 DNA of the expression vectors pDPGTA8 and pDPGTB5 purified by means of CsCl is produced according to the protocol of R. Treisman in the Maniatis manual (see above). Each of the protease-deficient S. cerevisiae strains BT 150 (MATa, his4, leu2, ura3, pral, prbl, prcl, cpsl) and H 449 (MATa, prbl, cpsl, ura3A5, leu 2-3.2-112, cir ° ) is transformed with 5 pg each of the plasmids pDPGTA8, pDPTGB5 and pDP34 (control without expression cassette) according to the lithium acetate transformation method (Ito, H. et al., see above). Transformant Ura + transformants are isolated and used for screening for GT activity ( see above) used. Individual transformed yeast cells are selected and labeled as follows:

Saccharomvces cerevisiae BT 150 / pDPGTA8 Saccharomyces cerevisiae BT 150 / pDPGTB5 Saccharomvces cerevisiae BT 150 / pDP34

Saccharomvces cerevisiae H 449 / pDPGTA8 Saccharomvces cerevisiae H 449 / pDPGTB5 Saccharomvces cerevisiae H 449 / pDP34

Example 5: Enzyme activity of complete GT 5.1 production of cell extracts expressed in yeast

Rows of the transformed Saccharomvces cerevisiae strains BT 150 and H 449 are grown with uracil selection in yeast minimal media (Difco) enriched with histidine and leucine. The growth rate of the rows is in no way determined by the

Introduction of an expression vector influenced. Exponentially growing lines (with an OD578 of 0.5) or stationary lines are riveted by centrifugation, washed once with 5 mM Tris-HCl buffer, pH 7.4 (buffer 1), and in a concentration corresponding to 0.1-0. 2 OD578 suspended in buffer 1. The lines are broken mechanically by shaking vigorously for 4 minutes on a vortex mixer with glass balls (0.45 - 0.5 mm diameter), with cooling in between. The crude extracts are used directly for the determination of the enzyme activity

Fractionation of the cell components is achieved by differential centrifugation of the extract. The extract is first centrifuged at 450 g for 5 minutes; the supernatant obtained is then centrifuged at 20,000 g for 45 minutes.

The supernatant is drawn off and the pellets are suspended in buffer 1. For the phosphate induction of GT expression under the control of the inducible PH05 promoter, rows of the transformants BT 150 / pDPGTA8 and H 449 / pDPGTA8 are converted in bulk to a minimal medium with a low phosphate content (Meyhack, B. et a. Embo J. (1982) 1,675-680). The cell extracts are prepared as described above. 5.2 Protein test

Protein concentration is determined using a BCA protein assay kit (Pierce). 5.3 Test for GT activity GT activity can be measured using radiochemical methods, either using ovalbumin, a glycoprotein that has only GlcNAc as the acceptor, or free GlcNAc as the acceptor substrate. Cell extracts (with 1-2 cell-related ODs578) are incubated for 45 or 60 minutes at 37 ° C in 100 μΐ incubation mixture with 100 mM Tris-HCl pH 7.4.50 nCi UDP-14C-Gal (325 mCi / mmol), 80 nmol UDP-Gal, 1 pmol MnCl2.1% Triton X-100 and 1 mg ovalbumin or 2 μηιοί GlcNAc tested as acceptor. If a glycoprotein acceptor substrate is used, the reaction is stopped by acid precipitation of the protein, and the amount of 14C-galactose that has been incorporated into the ovalbumin is determined by liquid scintillation counting (Berger, EG et al. (1978) Eur. J. Biochem. 90, 213-222). If GlcNAc is the acceptor substrate, the reaction is quenched by adding 0.4 ml of ice-cold H20, and the unabsorbed UDP-14C-galactose is separated from the 14C products on an anion exchange column (AG Xl-8, BioRad) as described (Masibay, AS and Qasba, PK (1989) Proc. Natl. Acad. Sci. USA 86,5733-5737). Tests with and without acceptor molecules are performed to assess the extent of hydrolysis of UDP-Gal by nucleotide pyrophosphatases. The results are shown in Table 2.

Table 2: GT activity in the S. cerevisiae strain BT 150 transformed with various plasmids.

The GT activity of kuituren converted to inducible conditions (minimal medium with low Pj content) is approximately equal to the activity of kuituren in minimal media which constitutively express GT (Table 2). As expected, there is no enzyme activity in rows that are only transformed with the vector. During the fractionation, the most GT activity (70-90%, see Table 3) and the highest specific activity are always found in the pellet obtained at the high acceleration (20,000 g). Enzyme activity can be increased by adding 1-2% Triton X-100 to the enzyme test. Both results suggest that recombinant GT is membrane bound in yeast cells as well as in HeLa cells.

Table 3: Distribution of GT activity during the fractionation of BT 150 / pDPGT5 cells

Example 6: Purification of the recombinant GT

To release the membrane bound enzyme, the 20,000 g pellet fraction of the BT 150 / pDPGTB5 cells is treated with 1% (w / v) Triton X-100 at room temperature for 10 minutes and with 50 mM Tris HCl pH 7.4.25 mM MgCl2.0.5 mM UMP and 1% (w / v) Triton X-100 equilibrated. The supernatant obtained after centrifugation is filtered 0.2 pm and the filtrate is charged to a GlcNAc-p-aminophenyl-Sepharose column (Berger, EG et al. (1976) Experientia 32, 690-691), the bed volume being 5 ml and the flow rate Is 0.2 ml / min at 4 ° C. The enzyme is eluted with 50 mM Tris-HCl pH 7.4.5 mM GlcNAc, 25 mM EDTA and 1% Triton X-100. A single peak with enzyme activity is eluted within five fractions (size: 1 ml). These fractions are pooled and dialyzed against 2 × 1150 mM Tris-HCl pH 7.4.0.1% Triton X-100. The cleaned GT is enzymatically active.

Example 7: Construction of an expression cassette for soluble GT Galactosyltransferase expressed in yeast can be secreted into the culture medium if a yeast promoter is functionally linked to a first DNA sequence which codes for the signal sequence of the yeast invertase gene SUC2 and this in the correct reading frame with one cDNA is linked, which encodes a soluble GT. (a) HeLa GT cDNA partial sequence GT cDNA is released from plasmid p4AD113 (example 1) by means of EcoRI digestion. The 1.2 kb fragment with the complete GT cDNA is isolated and partially digested with Mvnl (Boehringer), the GT sequence being in positions 43, 55, 140 and 288 of the sequence shown in SEQ ID no. 1 shown nucleotide sequence is cut. When 0.2 pg of the EcoRI-EcoRI fragment is digested with 0.75 p Mvnl for one hour, the GT cDNA is cut only once at nucleotide position 134 to produce a 1.1 kb Mvnl EcoRI fragment (b) Vector for amplification in E. coli

Plasmid pUC18 (Pharmacia) is cut with BamHI and EcoRI at the multiple cloning site. The plasmid is then treated with alkaline phosphatase as described in the Maniatis manual (see above), subjected to agarose gel electrophoresis, and isolated from the gel as a 2.7 kb DNA fragment. (c) The constitutive PH05 (-173) promoter and the SUC2 signal sequence

The vector p31 / PH05 (-173) RIT (Example 2) is digested with the restriction enzymes BamHI and Xhol. A 0.25 kb BamHI-XhoI fragment with the constitutive PH05-Î-173) promoter and the adjacent sequence coding for the invertase signal sequence (inv ss) is isolated. The fragment is then cut again with Hgal (BioLabs). The Hgal recognition sequence is on the DNA antisense strand. The restriction enzyme cuts "upstream" of the recognition sequence in such a way that the 5-protruding end of the antisense strand matches the end of the coding sequence of the invertase signal sequence. The 0.24 kb DNA fragment cut with BamHI and Hgal contains the constitutive PH05 (-173) promoter sequence which is linked to the yeast invertase signal sequence. (d) adapter

Fragment (a) is connected to fragment (c) by means of an adapter sequence which is produced from equimolar amounts of the synthetic oligonucleotides (microsynth) 5'CT GCA CTG GCT GGC CG 3 'and 5'CG GCC AGC CAG 3' for the complementary strand. The oligonucleotides are attached to each other by first heating them to 95 ° C and then slowly cooling them to 20 ° C. The attached adapter is kept frozen.

(e) Construction of the plasmid psGT For the ligation, the linearized vector (b), the GT-cDNA fragment (a),

Fragment (c) with the promoter and the sequence coding for the signal peptide and adapter (d) in a molar ratio of 1: 2: 2: 30-100. The ligation is carried out in 12 μl ligase buffer (66 mM Tris-HCl pH 7.5.1 mM dithioerythritol, 5 mM MgCl2.1 mM ATP) for 18 hours at 16 ° C. The ligation mix is used for the

Transformation of competent E. coli strain DH5a cells (see above) was used. Plasmid mini-preparations are carried out from 24 independent transformants. The isolated plasmids are characterized by restriction analysis with four different enzymes (BamHI, PstI, EcoRI, Xhol, also in combination). A single clone with the expected restriction pattern is called psGT.

The correct sequence at the fusion site of the sequence encoding invertase signal peptide with the cDNA encoding soluble GT is confirmed for plasmid psGT by using the T7 sequencing kit (Pharmacia) and primer 5'AGTCGAGGTTAGTATGGC 3 ', starting at position -77 in the constitutive PH05 (-173) promoter can be used. DNA Mvnl

Sequence-1 ·): 5 'AAA ATA Tct gca ctg get ggc cgC GAC CTG AGC 3' 3 'TTT TAT AGA CGT gac ega ccg gcG CAG GAC TCG 5'

Protein: Lys Ile Ser Ala Leu Ala Gly Arg Asp Leu Ser 16 19 42 inv ss GT sequence

Interface for signal endopeptidase

Lower case letters denote the adapter sequence

The soluble GT expression cassette containing the constitutive PH05 (-173) promoter, the DNA sequence coding for invertase signal peptide and the partial GT cDNA from the plasmid psGT can be in the form of a 1.35 kb Sail (BamHI) -EcoRI fragments are cut out. The expression cassette still lacks the PH05 terminator sequences that are added in the subsequent cloning step.

Example 8: Construction of the expression vector pDPGTS

The following fragments are assembled to construct the soluble GT expression vector: (a) Vector part

Plasmid pDP34 is digested and pretreated as described in Example 3, producing a blunt-ended SalI vector fragment of 11.8 kb. (b) Expression cassette

Plasmid psGT is first linearized by digestion with Sali (at the multiple cloning site) and then partially digested with EcoRI. A 1.35 kb DNA fragment containing the constitutive PH05 (-173) promoter, a DNA sequence encoding the yeast invertase signal peptide and the partial GT cDNA is isolated. (c) PH05 terminator sequence

The PH05 terminator sequence is isolated from plasmid p31, which is constructed from plasmid p30 as described in EP 100561. After digestion with the restriction enzyme Hindli, the protruding ends are filled in using Klenow polymerase treatment as described above. The plasmid is then digested with EcoRI and a blunt-ended EcoRI fragment of 0.39 kb is isolated with the PH05 terminator sequences.

The ligation of fragments (a), (b) and (c) and the transformation of competent lines of the E. colI strain DH5a are carried out as described in Example 2. Plasmids are isolated from the transformants obtained and characterized by restriction analysis. The plasmid of a clone with the correct restriction fragments is called pDPGTS.

Example 9: Expression of soluble GT in yeast

Analogously to Example 4, DNA of the expression vector pDPGTS purified by means of CsCl is used for the transformation of the R, cerevisiae strains BT150 and H 449. Ura + transformants are isolated and screened for GT activity. One transformant each is selected and referred to as Saccharomyces cerevisiae BT 150 / pDPGTS and Saccharomyces cerevisiae H 449 / pDPGTS, respectively. When the test described in Example 5 is carried out, GT activity is found in the culture broths of both transformants.

Example 10: Cloning of the sialyltransferase (ST) cDNA from human HepG2 cells ST-cDNA is isolated from HepG2 cells by means of PCR analogously to the GT cDNA. The preparation of poly (A) + RNA and the synthesis of first-strand cDNA are carried out as described in Example 1. The primers (Microsynth) used for the PCR are listed in Table 5.

Table 5: PCR primer corresponds to bp

Primer sequence (5 'to 3') ^ in ST cDNA2)

PstFEcoRI SI Al cgctgcagaattcaaaATGATTCACACCAACCTGAAGAAAAAGT 1 - 28

BamHI SIA3 cgcggatCCTGTGCTTAGCAGTGAATGGTCCGGAAGCC 1228 - 1198 ^ Upper case letters stand for ST sequences, lower case letters are additional seqences with restriction sites (underlined). "Start" and "stop" codons for protein synthesis are printed in bold. 2) ST cDNA sequence from human placenta (27) as published in EMBL Data Bank (entry no. X17247).

HepG2-ST cDNA can be amplified using the primers SIA1 and SIA3 as a 1.2 kb DNA fragment. The PCR is carried out as described for GT-cDNA under slightly changed cycle conditions: 0.5 minutes denaturing at 95 ° C, 1 minute 15 seconds at 56 ° C, and 1 minute 30 seconds extension at 72 ° C, for a total of 25 to 35 cycles. In the last cycle the primer extension takes 5 minutes at 72 ° C.

After the PCR amplification, the 1.2 kb fragment is digested with the restriction enzymes BamHI and PstI, the digestion is analyzed on a 1.2% agarose gel, eluted from the gel and subcloned into the vector pUC18. The subclone obtained is called pSIA2.

Example 11: Construction of the constitutive ST expression cassette For constitutive heterologous expression, ST cDNA is ligated with the constitutive PH05 (-173) promoter fragment and the PH05 terminator sequences.

Plasmid pSIA2 is first linearized by digestion with the restriction enzyme BamHI and then partially digested with EcoRI. Since ST-cDNA also contains an internal restriction site for the enzyme EcoRI (at bp 144), a 1.2 kb fragment with the complex ST-cDNA (SEQ. ID No. 3) is produced by partial digestion with EcoRI, 1 μ »DNA and 0.25 U EcoRI are used (1 h, 37 ° C). After gel electrophoresis, the 1.2 kb EcoRI-BamHI fragment with the complete ST cDNA (SEQ ID No. 3) is isolated. The "ATG" start codon for the translation of ST is located on this DNA fragment in the vicinity of the EcoRI restriction site. Three adenosine phosphates (see PCR primer SIA 1) provide an "A" in bp position 12, which is found in the consensus sequence for "ATG" from highly expressed genes in yeast (Hamilton, R. et al. (1987 ) Nucleic Acids Res. 14.5125-5149). The BamHI site follows the stop codon "TAA" and 5 bp of the 3'-untranslated gene region.

The 1.2 kb EcoRI-BamHI-ST cDNA fragment is mixed with the 0.45 kb SalI EcoRI fragment with the constitutive PH05 - (- 173) promoter (Example 2.2 (b)) and with a 3.5 kb BamHI-Sall vector part for the amplification in E. coli, which contains the PH05 terminator sequence (cf. Example 2.1, fragment (b)) ligated. Ligation and transformation of E. coli strain DH5a are carried out as specified in Example 2.1. A clone that has the expected restriction pattern is called pST2.

Vector pST2 contains the expression cassette for HepG2-ST under the control of the constitutive PH05 - (- 173) promoter in the form of a 2.0 kb SalI-HindIII fragment which is referred to as a DNA fragment (1C).

Example 12: Expression of ST in yeast

Vector pDP34 (cf. EP 340 170) is digested with the restriction enzyme BamHI. The linearized vector is isolated with GENECLEAN and the protruding ends are filled in using Klenow polymerase treatment as described in the Maniatis manual (see above). The reaction is stopped after 30 minutes by heating for 20 minutes at 65 ° C. in the presence of 10 mM EDTA. After ethanol precipitation, the plasmid is digested with Sail and subjected to gel electrophoresis on a 0.8% agarose gel. The (BamHI) blunt-ended, sail-cut vector pDP34 is isolated with the GENECLEAN kit in the form of an 11.8 kb DNA fragment.

Plasmid pST2 is digested with the restriction enzyme Hind and filled in analogously to the preparation of the vector by means of Klenow polymerase treatment at the HindII site, namely analogously to the preparation of the vector. The product is digested with Sail, resulting in a 2.0 kb (Hind III) -stura-ended Sail fragment with the constitutive ST expression cassette (2C).

The ligation of 80 ng of the pDP34 vector with 40 ng fragment 2C, and the transformation of competent lines from E. coli strain DH5a is carried out as described in Example 2. A clone that has the expected restriction pattern is selected and designated pDPST5.

For the transformation of yeast, DNA of the expression vector pDPST5 purified with CsCl is produced according to the standard method specified in the Maniatis manual (see above). The S. cerevisiae strains BT 150 and H 449 are each transformed with 5 pg plasmid DNA according to the lithium acetate transformation method (Ito, H. et al, see above). Ura + transformants are selected and screened for ST activity. In each case a positive transformant is selected and designated Saccharomyces cerevisiae BT 150 / pDPST5 and Saccharomyces cerevisiae H 449 / pDPST5.

Example 13: Enzyme activity of complete ST 13.1 expressed in yeast production of cell extracts

Saccharomyces cerevisiae BT 150 / pDPST5 cells are grown with uracil selection on minimal yeast media enriched with histidine and leucine. Exponentially growing lines (with an OD578 of 0.5) or stationary lines are harvested by centrifugation, washed once with 50 mM imidazole buffer pH 7.0 (buffer 1), and in again at a concentration corresponding to 0.1-0.2 OD578 Buffer 1 suspended. The lines are broken up mechanically by shaking vigorously with glass beads (0.45-0.5 mm in diameter) on a vortex mixer for 4 minutes, with cooling in between.

The ST activity in the crude extracts can be measured using the test described below. 13.2 Test for ST activity

ST activity can be determined by measuring the amount of radiolabeled sialic acid that is transferred from CMP sialic acid to a glycoprotein acceptor. After the reaction had ended by acid precipitation, the precipitate was filtered through a glass fiber filter (Whatman GFA), washed thoroughly with ice-cold ethanol and tested for radioactivity by liquid scintillation counting (Hesford et al. (1984), Glycoconjugate J. 1, 141-153). The cell extracts are tested for 45 minutes in an incubation mixture containing 37 μl cell extract, which corresponds to approximately 0.5 mg protein, and 3 μl imidazole buffer 50 mmol / 1, pH 7.0.50 nmol CMP-N-acetyl-neuraminic acid (Sigma) with the addition of CMP-3H-N-acetylneuraminic acid (Amersham) to finally obtain a specific activity of 7.3 Ci / mol, and 75 μ »asialo-fetuin (produced by acid hydrolysis for 60 minutes with 0, 1 M H2S04 at 80 ° C followed by neutralization, dialysis and lyophilization). ST activity is found in the crude extracts made from S. cerevisiae BT 150 / pDPST5 and H449 / pDPST5 cells.

Example 14: Construction of an Expression Cassette for Soluble ST (Lysgo-Cys ^)

The soluble ST (Lys39-Cys406) is an N-terminal shortened variant and consists of 368 amino acids (SEQ. ID No. 4). (a) HepG2-ST cDNA partial sequence

Plasmid pSIA2 is digested with EcoRI and a 1.1 kb EcoRI-EcoRI fragment is isolated. (b) Vector for amplification in E. coli

Plasmid pUC18 (Pharmacia) is digested with BamHI and EcoRI at the multiple cloning site. The plasmid is then treated with alkaline phosphatase as described in the Maniatis manual (see above), subjected to agarose gel electrophoresis and isolated from the gel in the form of a 2.7 kb DNA fragment. (c) The constitutive PH05 - (- 173) promoter and the SUC2 signal sequence

The vector p31 / PH05 - (- 173) RIT (Example 2) is digested with the restriction enzymes BamHI and Xhol. A 0.25 kb BamHI-XhoI fragment with the constitutive PH05 - (- 173) promoter and the adjacent coding sequence for the invertase signal sequence (inv ss) is isolated. The fragment is then cut again with Hgal (BioLabs). The Hgal recognition sequence is on the DNA antisense strand. The restriction enzyme cuts above the recognition sequence in such a way that the 5-protruding end of the antisense strand coincides with the end of the coding sequence of the invertase signal sequence. The 0.24 kb DNA fragment cut with BamHI and Hgal contains the constitutive PH05 (- 173) promoter sequence bound to the yeast invertase signal sequence. (d) adapter

Fragment (a) is linked to fragment (c) via an adapter sequence which is produced from equimolar amounts of the synthetic oligonucleotides 5 'CTGCAAAATTGCAAACCAAGG 3' and 5'AA1TCCTTGGTTTGCAATTT 3 'in the case of the complementary strand. The oligonucleotides are attached to one another by first heating them to 95 ° C. and then slowly cooling them to 20 ° C. The attached adapter is kept frozen.

(e) Construction of a plasmid psST For the ligation, the linearized vector (b), the STcDNA fragment (a), fragment (c) with the promoter and the sequence coding for the signal peptide, and adapter (d) are in a molar ratio from 1: 2: 2: 30-100 use L The ligation is carried out over 18 hours in 12 μΐ ligase buffer (66 mM Tris-HCl pH 7.5.1 mM dithioerythritol, 5 mM MgCl2.1 mM ATP) at 16 ° C. Competent lines of the E. coli strain DH5a are transformed with the ligation mixture as described above. Plasmid minipreparations are made from 24 independent transformants. A single clone that shows the expected restriction pattern after characterization by restriction analysis with four different enzymes (BamHI, PstI, EcoRI, Xhol, also in combination) is called psST.

The correct sequence at the fusion site of the sequence coding for the invertase signal peptide with the cDNA coding for soluble ST (Lys39-Cys406) is determined for plasmid psST using the T7 sequencing kit (Pharmacia) and primer 5'ACGAGGTTAATGGC 3 ', which is at position -77 in the constitutive PH05 - (- 173) promoter begins, confirmed. DNA

Sequence1 ^: 5 'AAA ATA Tct gca aaa ttg caa acc aag gAA 3' 3 'TTT TAT AGA GTG ttt aac gtt tgg ttc ctt 5'

Protein Lys Ile Ser Ala Lys Leu Gin Thr Lys Glu 16 19 39 inv ss ST sequence

Interface for signal endopeptidase ^ Lower case letters denote the adapter sequence

The expression cassette for soluble ST with the constitutive PH05 - (- 173) promoter. the DNA sequence coding for invertase signal peptide and the partial ST cDNA

Plasmid psST can be excised in the form of a 1.35 kb Sail (BamHI) EcoRI fragment. The expression cassette still lacks the PH05 terminator sequences to be added in the subsequent cloning step.

Example 15: Construction of the expression vector pDPSTS

The following fragments are combined to construct the expression vector for soluble STCLj ^ p-Cys ^): (a) vector part

Plasmid pDP34 is digested and pretreated as described in Example 3, which results in a blunt-ended SalI vector fragment of 11.8 kb. (b) Expression cassette

Plasmid psST is first linearized by digestion with Sail (at the multiple cloning site) and then partially digested with EcoRI. A 1.35 kb DNA fragment with the constitutive PH05 - (- 173) promoter, a DNA sequence coding for the yeast invertase signal peptide and the partial ST cDNA is isolated. (c) PH05 terminator sequence

The PH05 terminator sequence is isolated from plasmid p31, which is constructed from plasmid p30 as described in EP 100561. After digestion with the restriction enzyme HindIII, the protruding ends are filled in by means of Klenow polymerase treatment as described above. The plasmid is then digested with EcoRI and a 0.39 kb blunt-ended EcoRI fragment with the PH05 terminator sequences is isolated.

The ligation of fragments (a), (b) and (c) and the transformation of competent lines of the E. coli strain DH5a are carried out as described in Example 2. Plasmids are isolated from the transformants obtained and characterized by means of restriction analysis. The plasmid of a clone with the correct restriction fragments is called pDPSTS.

Example 16: Expression of soluble ST in yeast

Analogously to Example 4, S. cerevisiae strains BT 150 and H 449 are transformed by means of DNA of the expression vector pDPSTS purified with CsCl. Ura + transformants are isolated and screened for ST activity. One each

Transformant is selected and designated Saccharomyces cerevisiae BT 150 / pDPSTS and Saccharomyces cerevisiae H 449 / pDPSTS. With the test described in Example 13, ST activity is found in the culture broths of both transformants.

Example 17: Construction of an expression cassette for soluble STfLySoy-Cys, ^)

The soluble ST (Lys27-Cys406) is an N-terminally truncated variant that encompasses the entire stem region and the catalytic domain. It consists of 380 amino acids, that is amino acids 27 to 406 of the SEQ ID no. 3 given amino acid sequence. (a) HepG2-ST cDNA partial sequence

Plasmid pSIA2 is digested with EcoRI and a 1.1 kb EcoRI-EcoRI fragment is isolated. (b) Vector for amplification in U. coli

Plasmid pUC18 (Pharmacia) is digested with BamHI and EcoRI at the multiple cloning site. The plasmid is then treated with alkaline phosphatase as described in the Maniatis manual (see above), subjected to agarose gel electrophoresis and isolated from the gel as a 2.7 kb DNA fragment. (c) The constitutive PH05 - (- 173) promoter and the SUC2 signal sequence

The vector p31 / PH05 (-173) RIT (Example 2) is digested with the restriction enzymes BamHI and Xhol. A 0.25 kb BamHI-XhoI fragment with the constitutive PH05 - (- 173) promoter and the adjacent coding sequence for the invertase signal sequence (inv ss) is isolated. The fragment is then cut again with Hgal (BioLabs). The Hgal recognition sequence can be found on the DNA antisense strand. The restriction enzyme cuts "upstream" of the recognition sequence in such a way that the 5-protruding end of the antisense strand coincides with the end of the coding sequence of the invertase signal sequence. The 0.24 kb DNA fragment cut with BamHI and Hgal contains the PH05-C-173) promoter sequence bound to the yeast invertase signal sequence. (d) adapter

Fragment (a) is linked to fragment (c) via an adapter sequence, which is produced from equimolar amounts of the synthetic oligonucleotides 5 'CTGCAAAGGAAAA GAAGAAAGGGAGTTACTATGATTCCTTTAAATTGCAAACCAAGG 3', and 5 'AATTCCTTGTTGC A ΑΊΤΤΑ A AGTTCCTCCTAGT' Compl . The oligonucleotides are attached to each other by first heating them to 95 ° C and then slowly cooling them to 20 ° C. The attached adapter is kept frozen. (e) Construction of the plasmid psSTl For the ligation, the linearized vector (b), the STcDNA fragment (a), fragment (c) with the promoter and the sequence coding for the signal peptide, and adapter (d) are in a molar ratio from 1: 2: 2: 30-100. The ligation is carried out over 18 hours in 12 μl ligase buffer (66 mM Tris-HCl pH 7.5.1 mM dithioerythritol, 5 mM MgCl2.1 mM ATP) at 16 ° C. With the ligation mixture, competent lines of the U. coli strain DH5a are transformed as described above. Plasmid minipreparations are made from 24 independent transformants. A single clone that shows the expected restriction pattern after characterization by means of restriction analysis with four different enzymes (BamHI, PstI, EcoRI, Xhol, also in combination) is called psSTl.

The correct sequence at the fusion site of the sequence coding for the invertase signal peptide with the cDNA coding for soluble ST (Lys27-Lys406) is determined for plasmid psSTl using the T7 sequencing kit (Pharmacia) and primer 5'AGTCGAGTAGTATGGC 3 ', which is at position -77 in the constitutive PH05 - (- 173) promoter begins, confirmed. DNA

Sequence1 ^: 5 'AAA ATA Tct gca aag gaa aag aag aaa ggg 3' 3 'TTT TAT AGA GTG ttc ctt ttc ttc ttt ccc 5'

Protein Lys Ile Ser Ala Lys Glu Lys Lys Lys Gly 16 19 27 inv ss ST sequence

Interface for signal endopeptidase ^ Lower case letters denote the adapter sequence

The expression cassette for soluble ST (Lys27-Cys406) with the constitutive PH05 - (- 173) promoter, the DNA sequence coding for invertase signal peptide and the partial ST cDNA from plasmid psSTl can be in the form of a 1.35 kb Sali ( BamHI) EcoRI fragments are cut out. The expression cassette still lacks the PH05 terminator sequences to be added in the subsequent cloning step.

Example 18: Construction of the expression vector pDPSTS1

The following fragments are assembled to construct the expression vector for soluble ST (Lys27-Cys406): (a) Vector part

Plasmid pDP34 is digested and pretreated as described in Example 3, which results in a blunt-ended SalI vector fragment of 11.8 kb. (b) Expression cassette

Plasmid psSTl is first linearized by digestion with Sali (at the multiple cloning site) and then partially digested with EcoRI. A 1.35 kb DNA fragment with the constitutive PH05 - (- 173) promoter, a DNA sequence coding for the yeast invertase signal peptide and the partial ST cDNA is isolated. (c) PH05 terminator sequence

The PH05 terminator sequence is isolated from plasmid p31, which is constructed starting from plasmid p30 as described in EP 100561. After digestion with the restriction enzyme Hindïïl, the protruding ends are filled in using Klenow polymerase treatment as described above. The plasmid is then digested with EcoRI and a 0.39 kb blunt-ended EcoRI fragment with the PH05 terminator sequences is isolated.

The ligation of fragments (a), (b) and (c) and the transformation of competent lines from U. coli strain DH5a are carried out as described in Example 2. Plasmids are isolated from the transformants obtained and characterized by means of restriction analysis. The plasmid of a clone with the correct restriction fragments is called pDPSTSl.

Example 19: Expression of soluble ST (Lvs27-Cvs / 106) in yeast Analogously to Example 4, S. cerevisiae strains BT 150 and H 449 are transformed by means of CsCl-purified DNA of the expression vector pDPSTS1. Ura + transformants are isolated and screened for ST activity. One each

Transformant is selected and designated Saccharomces cerevisiae BT 150 / pDPSTSl and Saccharomyces cerevisiae H 449 / pDPSTSl. With the test described in Example 13, ST activity is found in the culture broths of both transformants.

Example 20: Cloning the FTcDNA from the human HL 60 cell line based on the published cDNA sequence (Goelz, SE et al. (1990) Cell 63, 1349-1356) for ELFT (ELAM-1 ligand fucosyltransferase), the Encoded for a (l-3) fucosyltransferase, the following oligonucleotide primers are developed to amplify a DNA fragment containing the open reading frame of the ELFT cDNA using the PCR technique: 5'-CAGCGCTGCCTGTTCGCGCCAT-3 '( ELFT-1B) and 5'-GG AG ATGC AC AGTAG AGG ATCA-3 '(ELFT-2B). ELFT-1B acts as a primer at base pairs 38-59 of the published sequence, and ELFT-2B at bp 1347-1326 in the antisense strand. A 1.3 kb fragment is amplified with these primers using the Perkin-Elmer Cetus Taq polymerase kit. The fragment is amplified from fresh HL60 cDNA in the presence of 5% DMSO and 2 mM MgCl2, the cycle being as follows: 95 ° C 5 min 25x (1 min 95 ° C, 1 min 60 ° C, 1.5 min 72 ° C) lOx (1 min 95 ° C, 1 min 60 ° C, 1.5 min + 15 sec / cycle 72 ° C).

Agarose gel electrophoresis shows a clear 1.3 kb band which, when digested with Smal or Apal, shows the pattern predicted by the published sequence. The 1.3 kb band is purified using a gene clean kit (Bio 101) and subcloned into the vector pCRIOOO (Invitrogen). A single clone with the correct 1.3 kb insert is selected and designated as BRB.ELFT / pCR1000-13. The FTcDNA is inserted into the vector so that it is oriented in opposite directions with respect to the T7 promoter. The open reading frame of the FTcDNA is completely sequenced and is identical to the published sequence (SEQ ID No. 5)

Example 21: Construction of plasmids for inducible and constitutive expression of soluble FTfArg ^ -Arg ^) in yeast Soluble FT (Arg62-Arg405) is expressed from the FT cDNA starting at nucleotide position 241 (Nrul restriction site), the for the region encoding the cytoplasmic tail and the membrane-encompassing domain is missing. (see Sequence ID No. 5).

Plasmid BRB.ELFT / pCR1000-13 is digested with Hindli, which is in the multiple

Cloning region 3 'of the FT cDNA insert cuts. The cohesive ends are converted to blunt ends in a reaction with Klenow DNA polymerase. Xhol linkers (5 'CCTCGAGG 3', Biolabs) are treated with kinase, annealed, and ligated to the blunt ends of the plasmid using a 100-fold molar excess of linker. Excess linkers are removed by isopropanol precipitation of the DNA, and this is further digested with Xhol and Nrul (section at nucleotide position 240 of the FT cDNA according to Sequence ID No. 5). The 1.1 kb Nrul-Xhol fragment (a) contains the FT-cDNA sequence without the region coding for the cytoplasmic tail and the membrane-encompassing domain up to amino acid 61.

The plasmids p31 RIT12 and p31 / PH05 (-173) RIT (see Example 2) are digested with Sali and Xhol, respectively. The 0.9 kb and 0.5 kb fragments are isolated and cut with Hgal. The resulting cohesive ends are filled in with Klenow DNA polymerase. The blunt ends so produced match the 3 'end of the coding sequence for the yeast invertase signal sequence. Subsequent cutting with BamHI yields a BamHI "blunt end" fragment (b) with 596 bp, which contains the inducible PH05 promoter and the invertase signal sequence with its own ATG or a BamHI "blunt end" fragment (c) with 234 bp with the short constitutive PH05 (-173) promoter and the invertase signal sequence.

Plasmid p31RIT12 is linearized with the restriction endonuclease Sali. Partial digestion with Hindlïï in the presence of ethidium bromide yields a 1 kb SalI-HindlII fragment that contains the 276 bp SalI-BamHI-pBR322 sequence, the 534 bp promoter of PH05 yeast acid phosphatase, the yeast invertase signal sequence (which for 19 amino acids coded) and contains the PH05 transcription terminator. The 1 kb SalI HindII fragment of p31RIT12 is used in yeast E. coli shuttle vector pJDB207 (Beggs, J.D. in: Molecular Genetics in yeast, Alfred Benzon Symposium 16, Copenhagen, 1981, pages 383-389), which was previously cut with Sail and Hindlïï. The resulting plasmid with the 1 kb insert is referred to as pJDB207 / PH05-RIT12.

Plasmid pJDB207 / PH05-RIT12 is digested with BamHI and Xhol and the large 6.8 kb BamHI-XhoI fragment (d) is isolated. This fragment contains all sequences of the pJDB207 vector and the PH05 transcription terminator.

The BamHI "blunt end" fragment (b) with 596 bp, the 1.1 kb Nrul-Xhol fragment (a) and the 6.8 kb XhoI-BamHI vector fragment (d) are blunted ends under standard conditions for the ligation ligated. Competent E. coli HB 101 lines are transformed with aliquots of the ligation mixture. Plasmid DNA from ampicillin-resistant colonies is analyzed by restriction digestion. A single clone with the correct expression plasmid is called pJDB207 / PH05-I-FT.

Ligation of the DNA fragments (c), (a) and (d) gives the expression plasmid pJDB207 / PH05 (-173) -I-FT. The expression cassettes of these plasmids contain the coding sequence of the invertase signal sequence, which is fused in frame with that of the soluble a (l-3) fucosyltransferase, which is expressed under the control of the inducible PH05 or constitutive PH05 (-173) promoter. The expression cassettes are in the Hefe-U. coli shuttle vector pJDB207 cloned between the BamHI and HindII restriction sites.

The nucleotide sequence at the fusion site between the invertase signal sequence and the cDNA coding for soluble FT is confirmed by DNA sequencing on a double-strand plasmid DNA, using the primer 5 'AGTCGAGGTTAGTATGGC 3', which is from position -77 to -60 Nucleotide sequence of the PH05 and PH05 (-173) promoters. The correct connection looks like this: DNA

Sequence: 5 'AAA ATA TCT GCA CGA CCG GTG 3' 3 'TTT TAT AGA GTG GCT GGC CAC 5'

Protein Lys Ile Ser Ala Arg Pro Val 16 19 62 inv ss FT sequence

Interface for signal endopeptidase

Example 22: Construction of plasmids for the inducible and constitutive expression of membrane-bound FT in yeast

These constructs use the coding sequence of the FT cDNA with its own ATG. However, the nucleotide sequence immediately upstream of the ATG is relatively unfavorable for expression in yeast because of its high G-C content. This region was replaced by an A-T-rich sequence using PCR methods. At the same time, an EcoRI restriction site is introduced at the new nucleotide positions -4 to -9.

Table 6: PCR primers

Primer sequence (5 'to 3') ^ corresponds to FT cDNA nucleotide FT1 cqaqaattcataATGGGGGCACCGTGGGGC 58-75 FT2 ccqctcqaqGAGCGCGGCTTCACCGCTCG 1285-1266 1) Uppercase letters mean nucleotides from the FT, and lower case letters are additional "and new letters" "Codons are in bold.

Using standard PCR conditions, the FT cDNA with the primers FT1 and FT2 (see Table 6) in 30 cycles of DNA synthesis (Taq DNA polymerase, Perkin-Elmer, 5 U / μΙ, one minute at 72 ° C.) , Denaturation (10 seconds at 93 ° C) and attachments (40 seconds at 60 ° C) amplified. The resulting 1.25 kb DNA fragment is purified by phenol extraction and ethanol precipitation, and then digested with EcoRI, Xhol and Nrul. The 191 bp EcoRI-NruI fragment (s) is isolated on a preparative 4% Nusieve 3: 1 agarose gel (FMC BioProducts, Rockland, ME, USA) in Tris-Borate buffer pH 8.3, eluted from the gel and with Like ethanol. Fragment (e) contains the 5 'part of the FT gene coding for amino acids 1 to 61. The DNA has a 5 'extension with an EcoRI site as in the PCR primer FT1.

The plasmids p31RIT12 and p31 / PH05 (-173) RIT are digested with EcoRI and Xhol, respectively. The large vector fragments (f and g) are isolated, eluted and purified on a preparative 0.8% agarose gel. The 4.1 kb XhoI-EcoRI fragment (f) contains the vector based on pBR322, the 534 bp PH05 promoter (3 'EcoRI site) and the 131 bp PH05 transcription terminator (5' Xhol site). The 3.7 kb XhoI-EcoRI fragment (g) differs only in the short constitutive 172 bp PH05 (-173) promoter (3 'EcoRI site) instead of the full PH05 promoter.

The 191 bp EcoRI-NruI fragment (e), the 1.1 kb Nrul-Xhol fragment (a) and the 4.1 kb

XhoI-EcoRI fragment (f) are ligated. Competent E. coli HB 101 lines are transformed with 1 μΐ aliquot of the ligation mixture. The plasmid DNA ampicillin resistant colonies are analyzed. Single clone plasmid DNA is referred to as p31R / PH05-ssFT

Ligation of the DNA fragments (.e), (a) and (g) results in plasmid p31R / PH05 (-173) -ssFT. These plasmids contain the coding sequence of the membrane-bound FT under the control of the inducible PH05 or constitutive PH05 (- 173) promoter.

Example 23 Cloning the FT Expression Cassette in pDP34:

The plasmids p31R / PH05-ssFT and p31R / PH05 (-173) -ssFT are digested with Hindlïï, which cuts on the 3 'of the PH05 transcription terminator. After a reaction with Klenow DNA polymerase, the DNA is digested with Sali. The 2.3 kb and 1.9 kb Sall "blunted" fragments are each isolated.

The plasmids pJDB207 / PH05-I-FT and pJDB207 / PH05 (-173) -I-FT are mixed with Hind in the presence of 0.1 mg / ml ethidium bromide (to cut at an additional HindIII site in the invertase signal sequence to avoid) partially digested and then treated with Klenow DNA polymerase and saline as above. A 2.1 kb or 1.8 kb fragment is isolated.

Each of the 4 DNA fragments is ligated with the blunt-ended 11.8 kb Sall vector fragment of pDP34 (see Example 3). After transformation of competent E coli HB101 cells and analysis of the plasmid DNA of individual transformants, 4 correct expression plasmids are identified as pDP34 / PH05-I-FT; pDP34 / PH05 (-173) -I-FT; pDP34R / PH05-ssFT and pDP34R / PH05 (-173) -ssFT.

The S. cerevisiae strains BT150 and H449 are each transformed with 5 pg of the 4 expression plasmids (above) analogously to Example 4. Individual transformed yeast cell colonies are selected and labeled as follows:

Saccharomyces cerevisiae "" BT150 / pDP34 / PH05-I-FT; "" BT150 / pDP34 / PH05 (-173) -I-FT; "" BT150 / pDP34R / PH05-ssFT; "" BT150 / pDP34R / PH05 (-173) -ssFT; "" H449 / pDP34 / PH05-I-FT; "" H449 / pDP34 / PH05 (-173) -I-FT; "" H449 / pDP34R / PH05-ssFT;

"" H449 / pDP34R / PH05 (- 173) -ssFT

The fermentation and production of cell extracts is carried out according to Example 5. With a test analogous to that of Goetz et al. FT activity is described in the crude extracts from BT150 / pDP34R / PH05-ssFT, BT150 / pDP34R / PH05 (-173) -ssFT, H449 / pDP34R / PH05-ssFT and H449 / pDP34R / PH05 (-173) - (above) ssFT and in the culture broths of H449 / pDP34 / PH05-I-FT, H449 / pDP34 / PH05 (-173) -I-FT, BT150 / pDP34 / PH05-I-FT and BT150 / pDP34 / PH05 (-173) - I-FT found.

Deposit of the microorganisms

The following microorganism strains were deposited with the German Collection of Microorganisms (DSM), Mascheroder Weg 16, D-3300 Braunschweig (the filing dates and entry numbers are given):

Escherichia coli JM109 / pDP34: March 14, 1988; DSM 4473 Escherichia coli HB101 / p30: 23. October 1987; DSM 4297 Escherichia coli HB101 / p31R: December 19, 1988; DSM 5116 Saccharomyces cerevisiae H 449: 18. February 1988; DSM 4413 Saccharomvces cerevisiae BT 150: May 23, 1991; DSM 6530 SEOUENZPROTQKOLL SEP ID No., 1 SEQUENCE TYPE: nucleotide with the corresponding protein SEQUENCE LENGTH: 1265 bp. STRENGTH: double TOPOLOGY: linear MOLECULE TYPE: recombinant IMMEDIATE EXPERIMENTAL ORIGIN: plasmid p4AD113 from E. coli DH5oc / p4AD113 CHARACTERISTICS: from 6 to 1200 bp cDNAp sequence from 1 to 6 b7 from 7 to 6 coding for HeLa cell galactosyl transferase up to 504 bp emergency location from 1227 to 1232 bp EcoRI location from 1236 to 1241 bp EcoRV location from 1243 to 1248 bp Bglïï location FEATURES:

EcoRI HindIE fragment from plasmid p4ADl 13 with HeLa cell cDNA (EC2.4.1.22) coding for complete galactosyltransferase (EC2.4.1.22) GAATTC ATG AGG CTT CGG GAG CCG CTC CTG AGO GGC AGC 39

Met Arg Leu Arg Glu Pro Leu Leu Ser Gly Ser 5 10 GCC GCG ATG CCA GGC GCG TCC CTA CAG CGG GCC TGC CGC 78

Ala Ala Met Pro Gly Ala Ser Leu Gin Arg Ala Cys Arg 15 20 CTG CTC GTG GCC GTC TGC GCT CTG CAC CTT GGC GTC ACC 117

Leu Leu Val Ala Val Cys Ala Leu His Leu Gly Val Thr 25 30 35 CTC GTT TAC TAC CTG GCT GGC CGC GAC CTG AGC CGC CTG 156

Leu Val iyr Tyr Leu Ala Gly Arg Asp Leu Ser Arg Leu 40 45 50 CCC CAA CTG GTC GGA GTC TCC ACA CCG CTG CAG GGC GGC 195

Pro Gin Leu Val Gly Val -Ser Thr Pro Leu Gin Gly Gly 55 60 TCG AAC AGT GCC GCC GCC ATC GGG CAG TCC TCC GGG GAG 234

Ser Asn Ser Ala Ala Ala Ile Gly Gin Ser Ser Gly Glu 65 70 75 CTC CGG ACC GGA GGG GCC CGG CCG CCG CCT CCT CTA GGC 273

Leu Arg Thr Gly Gly Ala Arg Pro Pro Pro Pro Leu Gly 80 '85 GCC TCC TCC CAG CCG CGC CCG GGT GGC GAC TCC AGC CCA 312

Ala Ser Ser Gin Pro Arg Pro Gly Gly Asp Ser Ser Pro 90 95 100 GTC GTG GAT TCT GGC CCT GGC CCC GCT AGC AAC TTG ACC 351

Val Val Asp Ser Gly Pro Gly Pro Ala Ser Asn Leu Thr 105 110 115 TCG GTC CCA GTG CCC CAC ACC ACC GCA CTG TCG CTG CCC 390

Ser Val Pro Val Pro His Thr Thr Ala Leu Ser Leu Pro 120 125 GCC TGC CCT GAG GAG TCC CCG CTG CTT GTG GGC CCC ATG 429

Ala Cys Pro Glu Glu Ser Pro Leu Leu Val Gly Pro Met 120 135 140 CTG ATT GAG TTT AAC ATG CCT GTG GAC CTG GAG CTC GTG 468

Leu Ile Glu Phe Asn Met Pro Val Asp Leu Glu Leu Val 145 150 GCA AAG CAG AAC CCA AAT GTG AAG ATG GGC GGC CGC TAT 507

Ala Lys Gin Asn Pro Asn Val Lys Met Gly Gly Arg Tyr 155 160 165 GCC CCC AGG GAC TGC GTC TCT CCT CAC AAG GTG GCC ATC 546

Ala Pro Arg Asp Cys Val -Ser Pro His Lys Val Ala lie 170 175 180 ATC ATT CCA TTC CGC AAC CGG CAG GAG CAC CTC AAG TAC 585 lie lie Pro Phe Arg Asn Arg Gin Glu His Leu Lys Tyr 185 190 TGG CTA TAT TAT TTG CAC CCA GTC CTG CAG CGC CAG CAG 624

Trp Leu Tyr Tyr Leu His Pro Val Leu Gin Arg Gin Gin 195 200 205 CTG GAC TAT GGC ATC TAT GTT ATC AAC CAG GCG GGA GAC 663

Leu Asp iyr Gly lie Tyr Val lie Asn Gin Ala Gly Asp 210 215 ACT ATA TTC AAT CGT GCT AAG CTC CTC AAT GTT GGC TTT 702

Thr lie Phe Asn Arg Ala Lys Leu Leu Asn Val Gly Phe 220 225 230 CAA GAA GCC TTG AAG GAC TAT GAC TAC ACC TGC TTT GTG 741

Gin Glu Ala Leu Lys Asp Tyr Asp Tyr Thr Cys Phe Val 235 240 245 TTT AGT GAC GTG GAC CTC ATT CCA ATG AAT GAC CAT AAT 780

Phe Ser Asp Val Asp Leu lie Pro Met Asn Asp His Asn 250 255 GCG TAC AGG TGT TTT TCA CAG CCA CGG CAC ATT TCC GTT 819

Ala Tyr Arg Cys Phe Ser Gin Pro Arg His lie Ser Val 260 265 270 GCA ATG GAT AAG TTT GGA TTC AGC CTA CCT TAT GTT CAG 858

Ala Met Asp Lys Phe Gly Phe Ser Leu Pro Tyr Val Gin 275 280 TAT TTT GGA GGT GTC TCT GCT CTA AGT AAA CAA CAG TTT 897

Tyr Phe Gly Gly Val Ser -Ala Leu Ser Lys Gin Gin Phe 285 290 295 CTA ACC ATC AAT GGA TTT CCT AAT AAT TAT TGG GGC TGG 93 6

Leu Thr lie Asn Gly Phe Pro Asn Asn Tyr Trp Gly Trp 300 305 310 GGA GGA GAA GAT GAT GAC ATT TTT AAC AGA TTA GTT TTT 975

Gly Gly Glu Asp Asp Asp lie Phe Asn Arg Leu Val Phe 315 '320 AGA GGC ATG TCT ATA TCT CGC CCA AAT GCT GTG GTC GGG 1014

Arg Gly Met Ser lie Ser Arg Pro Asn Ala Val Val Gly 325 330 335 AGG TGT CGC ATG ATC CGC CAC TCA AGA GAC AAG AAA AAT 1053

Arg Cys Arg Met lie Arg His Ser Arg Asp Lys Lys Asn 340 345 GAA CCC AAT CCT CAG AGG TTT GAC CGA ATT GCA CAC ACA 1092

Glu Pro Asn Pro Gin Arg Phe Asp Arg lie Ala His Thr 350 355 360 AAG GAG ACA ATG CTC TCT GAT GGT TTG AAC TCA CTC ACC 1131

Lys Glu Thr Met Leu Ser Asp Gly Leu Asn Ser Leu Thr 365 370 375 TAC CAG GTG CTG GAT GTA CAG AGA TAC CCA TTG TAT ACC 1170

Tyr Gin Val Leu Asp Val Gin Arg Tyr Pro Leu Tyr Thr 380 385 CAA ATC ACA GTG GAC ATC GGG ACA CCG AGC TAGGACTTTT 1210

Gin Ile Thr Val Asp lie Gly Thr Pro Ser 390 395 GGTACAGGTA AAGACTGAAT TCATCGATAT CTAGATCTCG 1250 AGCTCGCGAA AGCTT. 1265 SEP ID no. 2 SEQUENCE TYPE: protein SEQUENCE LENGTH: 357 amino acids MOLECULE TYPE: C-terminal fragment of complete HeLa cell galactosyl transferase · PROPERTIES: Soluble galactosyl transferase (EC 2.4.1.22) from HeLa cells

Leu Ala Gly Arg Asp Leu Ser Arg Leu 5

Pro Gin Leu Val Gly Val Ser Thr Pro Leu Gin Gly Gly 10 15 '20

Ser Asn Ser Ala Ala Ala Ile Gly Gin Ser Ser Gly Glu 25 30 35

Leu Arg Thr Gly Gly Ala Arg Pro Pro Pro Pro Leu Gly 40 45

Ala Ser Ser Gin Pro Arg Pro Gly Gly Asp Ser Ser Pro 50 55 60

Val Val Asp Ser Gly Pro Gly Pro Ala Ser Asn Leu Thr 65 70

Ser Val Pro Val Pro His Thr Thr Ala Leu Ser Leu Pro 75 80 85

Ala Cys Pro Glu Glu Ser Pro Leu Leu Val Gly Pro Met 90 95 100

Leu lie Glu Phe Asn Met Pro Val Asp Leu Glu Leu Val 105 110

Ala Lys Gin Asn Pro Asn Val Lys Met Gly Gly Arg Tyr 115 120 125

Ala Pro Arg Asp Cys Val. Ser Pro His Lys Val Ala Ile 130 - 135

Ile Ile Pro Phe Arg Asn Arg Gin Glu His Leu Lys Tyr 140 145 150

Trp Leu Tyr Tyr Leu His Pro Val Leu Gin Arg Gin Gin 155 160 165

Leu Asp Tyr Gly Ile Tyr Val Ile Asn Gin Ala Gly Asp 170 '175

Thr Ile Phe Asn Arg Ala Lys Leu Leu Asn Val Gly Phe 180 185 190

Gin Glu Ala Leu Lys Asp Tyr Asp Tyr Thr Cys Phe Val 195 200

Phe Ser Asp Val Asp Leu Ile Pro Met Asn Asp His Asn 205 210 215

Ala Tyr Arg Cys Phe Ser Gin Pro Arg His Ile Ser Val 220 225 230

Ala Met Asp Lys Phe Gly Phe Ser Leu Pro Tyr Val Gin 235 240

Tyr Phe Gly Gly Val Ser Ala Leu Ser Lys Gin Gin Phe 245 250 255

Leu Thr Ile Asn Gly Phe Pro Asn Asn Tyr Trp Gly Trp 260 265

Gly Gly Glu Asp Asp Asp Ile Phe Asn Arg Leu Val Phe 270 275 280

Arg Gly Met Ser lie Ser Arg Pro Asn Ala Val Val Gly 285.290 295

Arg Cys Arg Met lie Arg His Ser Arg Asp Lys Lys Asn 300 305

Glu Pro Asn Pro Gin Arg Phe Asp Arg lie Ala His Thr 310 315 320

Lys Glu Thr Met Leu Ser Asp Gly Leu Asn Ser Leu Thr 325 '330 iyr Gin Val Leu Asp Val Gin Arg Tyr Pro Leu Tyr Thr 335 340 345

Gin lie Thr Val Asp lie Gly Thr Pro Ser 350 355 SEP ID no. 3 SEQUENCE TYPE: nucleotide with the corresponding protein SEQUENCE LENGTH: 1246 bp STRENGTH: double TOPOLOGY: linear MOLECOLE TYPE: recombinant IMMUTIBLE EXPERIMENTAL ORIGIN: plasmid pSIA2 from E. coli DH5oc / pSIA2 CHARACTERISTICS: from 15 to 1232-cDNA S-HepG cells-e Sequence from 1 to 6 bp Pstl site from 6 to 11 bp EcoRI site from 144 to 149 bp EcoRI site from 1241 to 1246 bp BamHI site PROPERTIES:

PstI-BamHI fragment from plasmid pSIA2 with HepG2 cDNA coding for complete sialyltransferase (EC 2.4.99.1) CTGCAGAATT CAAA ATG ATT CAC ACC AAC CTG AAG AAA 38

Met lie His Thr Asn Leu Lys Lys 5 AAG TTC AGC TGC TGC GTC CTG GTC TTT CTT CTG TTT GCA 77

Lys Phe Ser Cys Cys Val Leu Val Phe Leu Leu Phe Ala 10 15 20 GTC ATC TGT GTG TGG AAG GAA AAG AAG AAA GGG AGT TAC 116

Val Ile Cys Val Trp Lys Glu Lys Lys Lys Gly Ser Tyr 25 30 TAT GAT TCC TTT AAA TTG CAA ACC AAG GAA TTC CAG GTG 155

Tyr Asp Ser Phe Lys Leu Gin Thr Lys Glu Phe Gin Val 35 40 45 TTA AAG AGT CTG GGG AAA TTG GCC ATG GGG TCT GAT TCC 194

Leu Lys Ser Leu Gly Lys Leu Ala Met Gly Ser Asp Ser 50 55 60 CAG TCT GTA TCC TCA AGC -AGC ACC CAG GAC CCC CAC AGG 233

Gin Ser Val Ser Ser Ser Ser Thr Gin Asp Pro His Arg 65 70 GGC CGC CAG ACC CTC GGC AGT CTC AGA GGC CTA GCC AAG 272

Gly Arg Gin Thr Leu Gly Ser Leu Arg Gly Leu Ala Lys 75 80 85 GCC AAA CCA GAG GCC TCC TTC CAG GTG TGG AAC AAG GAC 311

Ala Lys Pro Glu Ala Ser Phe Gin Val Trp Asn Lys Asp 90 95 AGC TCT TCC AAA AAC CTT ATC CCT AGG CTG CAA AAG ATC 350

Ser Ser Ser Lys Asn Leu lie Pro Arg Leu Gin Lys Ile 100 105 110 TGG AAG AAT TAC CTA AGC ATG AAC AAG TAC AAA GTG TCC 389

Trp Lys Asn Tyr Leu Ser Met Asn Lys Tyr Lys Val Ser 115 120 125 TAC AAG GGG CC A GGA CC A GGC ATC AAG TTC AGT GCA GAG 428

Tyr Lys Gly Pro Gly Pro Gly Ile Lys Phe Ser Ala Glu 130 135 GCC CTG CGC TGC CAC CTC CGG GAC CAT GTG AAT GTA TCC 467

Ala Leu Arg Cys His Leu Arg Asp His Val Asn Val Ser 140 145 150 ATG GTA GAG GTC ACA GAT TTT CCC TTC AAT ACC TCT GAA 506

Met Val Glu Val Thr Asp Phe Pro Phe Asn Thr Ser Glu 155 160 TGG GAG GGT TAT CTG CCC AAG GAG AGC ATT AGG ACC AAG 545

Trp Glu Gly Tyr Leu Pro Lys Glu Ser Ile Arg Thr Lys 165 170 175 GCT GGG CCT TGG GGC AGG -TGT GCT GTT GTG TCG TCA GCG 584

Ala Gly Pro Trp Gly Arg Cys Ala Val Val Ser Ser Ala 180 185 190 GGA TCT CTG AAG TCC TCC CAA CTA GGC AGA GAA ATC GAT 623

Gly Ser Leu Lys Ser Ser Gin Leu Gly Arg Glu Ile Asp 195 200 GAT CAT GAC GCA GTC CTG AGG TTT AAT GGG GCA CCC ACA 662

Asp His Asp Ala Val Leu Arg Phe Asn Gly Ala Pro Thr 205 210 215 GCC AAC TTC CAA CAA GAT GTG GGC ACA AAA ACT ACC ATT 701

Ala Asn Phe Gin Gin Asp Val Gly Thr Lys Thr Thr Ile 220 225 CGC CTG ATG AAC TCT CAG TTG GTT ACC ACA GAG AAG CGC 740

Arg Leu Met Asn Ser Gin Leu Val Thr Thr Glu Lys Arg 230 235 240 TTC CTC AAA GAC AGT TTG TAC AAT GAA GGA ATC CTA ATT 779

Phe Leu Lys Asp Ser Leu Tyr Asn Glu Gly Ile Leu Ile 245 250 255 GTA TGG GAC CCA TCT GTA TAC CAC TCA GAT ATC CCA AAG 818

Val Trp Asp Pro Ser Val Tyr His Ser Asp lie Pro Lys 260 265 TGG TAC CAG AAT CCG GAT TAT AAT TTC TTT AAC AAC TAC 857

Trp Tyr Gin Asn Pro Asp Tyr Asn Phe Phe Asn Asn Tyr 270 275 280 AAG ACT TAT CGT AAG CTG CAC CCC AAT CAG CCC TTT TAC 896 Lys Thr Tyr Arg Lys Leu His Pro Asn Gin Pro Phe Tyr 285 290 ATC CTC AAG CCC CAG ATG -CCT TGG GAG CTA TGG GAC ATT 935 Ile Leu Lys Pro Gin Met Pro Trp Glu Leu Trp Asp lie 295 300 305 CTT CAA GAA ATC TCC CCA GAA GAG ATT CAG CCA AAC CCC 974 Leu Gin Glu lie Ser Pro Glu Glu lie Gin Pro Asn Pro 310 315 320 CCA TCC TCT GGG ATG CTT GGT ATC ATC ATC ATG ATG ACG 1013 Pro Ser Ser Gly Met Leu Gly lie lie met Met Thr 325 330 CTG TGT GAC CAG GTG GAT ATT TAT GAG TTC CTC CCA TCC 1052 Leu Cys Asp Gin Val Asp lie Tyr Glu Phe Leu Pro Ser 335 340 345 AAG CGC AAG ACT GAC GTG TGC TAC TAC TAC CAG AAG TTC 1091 Lys Arg Lys Thr Asp Val Cys Tyr Tyr Tyr Tyr Tyr Tyr Tyr Tyr Gyr Lys Phe 350 355 TTC GAT AGT GCC TGC ACG ATG GGT GCC TAC CAC CCG CTG 1130 Phe Asp Ser Ala Cys Thr Met Gly Ala Tyr His Pro Leu 360 365 370 CTC TAT GAG AAG AAT TTG GTG AAG CAT CTC AAC CAG GGC 1169 Leu Tyr Glu Lys Asn Leu Val Lys His Leu Asn Gi n Gly 375 380 385 ACA GAT GAG GAC ATC TAC CTG CTT GGA AAA GCC ACA CTG 1208 Thr Asp Glu Asp lie Tyr Leu Leu Gly Lys Ala Thr Leu 390 395 CCT GGC TTC CGG ACC ATT CAC TGC TAAGCACAGG ATCC 1246

Pro Gly Phe Arg Thr Ile His Cys 400 405 SEP ID NO. 4 SEQUENCE TYPE: protein SEQUENCE LENGTH: 368 amino acids MOLECULE TYPE: C-terminal fragment of complete sialyltransferase PROPERTIES: Soluble sialyltransferase (EC 2.4.99.1) from human HepG2 cells

Lys Leu Gin Thr Lys Glu Phe Gin Val 5

Leu Lys Ser Leu Gly Lys Leu Ala Met Gly Ser Asp Ser 10 15 20

Gin Ser Val Ser Ser Ser Ser Thr Gin Asp Pro His Arg 25 30 35

Gly Arg Gin Thr Leu Gly Ser Leu Arg Gly Leu Ala Lys 40 45

Ala Lys Pro Glu Ala Ser Phe Gin Val Trp Asn Lys Asp 50 55 60

Ser Ser Ser Lys Asn Leu lie Pro Arg Leu Gin Lys lie 65 70

Trp Lys Asn Tyr Leu Ser Met Asn Lys Tyr Lys Val Ser 75 80 85 lyr Lys Gly Pro Gly Pro Gly lie Lys Phe Ser Ala Glu 90 95 100

Ala Leu Arg Cys His Leu Arg Asp His Val Asn Val Ser 105 110

Met Val Glu Val Thr Asp Phe Pro Phe Asn Thr Ser Glu 115 120 125

Trp Glu Gly Tyr Leu Pro Lys Glu Ser Ile Arg Thr Lys 130 135

Ala Gly Pro Trp Gly Arg Cys Ala Val Val Ser Ser Ala 140 145 150

Gly Ser Leu Lys Ser Ser Gin Leu Gly Arg Glu Ile Asp 155 160 165

Asp His Asp Ala Val Leu Arg Phe Asn Gly Ala Pro Thr 170 175

Ala Asn Phe Gin Gin Asp Val Gly Thr Lys Thr Thr Ile 180 185 190

Arg Leu Met Asn Ser Gin Leu Val Thr Thr Glu Lys Arg 195 200

Phe Leu Lys Asp Ser Leu Tyr Asn Glu Gly Ile Leu Ile 205 210 215

Val Trp Asp Pro Ser Val Tyr His Ser Asp Ile Pro Lys 220 225 230

Trp Tyr Gin Asn Pro Asp Tyr Asn Phe Phe Asn Asn Tyr 235 240

Lys Thr Tyr Arg Lys Leu His Pro Asn Gin Pro Phe Tyr 245 250 255

Ile Leu Lys Pro Gin Met Pro Trp Glu Leu Trp Asp Ile 260 265

Leu Gin Glu Ile Ser Pro Glu Glu Ile Gin Pro Asn Pro 270 275 - 280

Pro Ser Ser Gly Met Leu Gly Ile Ile Ile Met Met Thr 285 290 295

Leu Cys Asp Gin Val Asp Ile Tyr Glu Phe Leu Pro Ser 300 305

Lys Arg Lys Thr Asp Val Cys Tyr Tyr Tyr Gin Lys Phe 310 315 320

Phe Asp Ser Ala Cys Thr Met Gly Ala Tyr Hi s Pro Leu 325 330

Leu Tyr Glu Lys Asn Leu Val Lys His Leu Asn Gin Gly 335 340 345

Thr Asp Glu Asp Ile Tyr Leu Leu Gly Lys Ala Thr Leu 350 355 360

Pro Gly Phe Arg Thr Ile His Cys 365 SEP ID NO. 5 SEQUENCE TYPE: nucleotide with the corresponding protein SEQUENCE LENGTH: 1400 bp STRENGTH: double TOPOLOGY: linear MOLECULE TYPE: recombinant DIRECT EXPERIMENTAL ORIGIN: BRB.ELFT / pCR1000-13 CHARACTERISTICS:

From 58 to 1272 bp for human a (l-3) fucosyltransferase coding cDNA sequence from 238 to 243 bp Nrul site

CHARACTERISTICS: Full α (1-3) fucosyltransferase encoding cDNA CGCTCCTCCA CGCCTGCGGA CGCGTGGCGA GCGGAGGCAG CGCTGCCTGT 50 TCGCGCC ATG GGG GCA CCG TGG GGC TCG CCG ACG GCG GCG 90

Met Gly Ala Pro Trp Gly Ser Pro Thr Ala Ala 5 10 GCG GGC GGG CGG CGC GGG TGG CGC CGA GGC CGG GGG CTG 129

Ala Gly Gly Arg Arg Gly Trp Arg Arg Gly Arg Gly Leu 15 20 CCA TGG ACC GTC TGT GTG CTG GCG GCC GCC GGC TTG ACG 168

Pro Trp Thr Val Cys Val Leu Ala Ala Ala Gly Leu Thr 25 30 35 TGT ACG GCG CTG ATC ACC TAC GCT TGC TGG GGG CAG CTG 207

Cys Thr Ala Leu lie Thr Tyr Ala Cys Trp Gly Gin Leu 40 45 50 CCG CCG CTG CCC TGG GCG TCG CCA ACC CCG TCG CGA CCG 246

Pro Pro Leu Pro Trp Ala Ser Pro Thr Pro Ser Arg Pro 55 60 GTG GGC GTG CTG CTG TGG TGG GAG CCC TTC GGG GGG CGC 285

Val Gly Val Leu Leu Trp Trp Glu Pro Phe Gly Gly Arg 65 70 75 GAT AGC GCC CCG AGG CCG CCC CCT GAC TGC CGG CTG CGC 324

Asp Ser Ala Pro Arg Pro Pro Pro Asp Cys Arg Leu Arg 80 85 TTC AAC ATC AGC GGC TGC CGC CTG CTC ACC GAC CGC GCG 363

Phe Asn lie Ser Gly Cys Arg Leu Leu Thr Asp Arg Ala 90 95 100 TCC TAC GGA GAG GCT CAG GCC GTG CTT TTC CAC CAC CGC 402

Ser Tyr Gly Glu Ala Gin Ala Val Leu Phe His His Arg 105 110 115 GAC CTC GTG AAG GGG CCC CCC GAC TGG CCC CCG CCC TGG 441

Asp Leu Val Lys Gly Pro Pro Asp Trp Pro Pro Pro Trp 120 125 GGC ATC CAG GCG CAC ACT GCC GAG GAG GTG GAT CTG CGC 480

Gly lie Gin Ala His Thr Ala Glu Glu Val Asp Leu Arg 130 135 140 GTG TTG GAC TAC GAG GAG GCA GCG GCG GCG GCA GAA GCC 519

Val Leu Asp Tyr Glu Glu Ala Ala Ala Ala Ala Glu Ala 145 150 CTG GCG ACC TCC AGC CCC AGG CCC CCG GGC CAG CGC TGG 558

Leu Ala Thr Ser Ser Pro Arg Pro Pro Gly Gin Arg Trp 155 160 165 GTT TGG ATG AAC TTC GAG TCG CCC TCG CAC TCC CCG GGG 597

Val Trp Met Asn Phe Glu Ser Pro Ser His Ser Pro Gly 170 175 180 CTG CGA AGC CTG GCA AGT AAC CTC TTC AAC TGG AC G CTC 636

Leu Arg Ser Leu Ala Ser Asn Leu Phe Asn Trp Thr Leu 185 190 TCC TAC CGG GCG GAC TCG GAC GTC TTT GTG CCT TAT GGC 675

Ser Tyr Arg Ala Asp Ser Asp Val Phe Val Pro Tyr Gly 195 200 205 TAC CTC TAC CCC AGA AGC CAC CCC GGC GAC CCG CCC TC A 714

Tyr Leu Tyr Pro Arg Ser His Pro Gly Asp Pro Pro Ser 210 215 GGC CTG GCC CCG CCA CTG TCC AGG AAA CAG GGG CTG GTG 753

Gly Leu Ala Pro Pro Leu Ser Arg Lys Gin Gly Leu Val 220 225 230 GCA TGG GTG GTG AGC CAC TGG GAC GAG CGC CAG GCC CGG 792

Ala Trp Val Val Ser His Trp Asp Glu Arg Gin Ala Arg 235 240 245 GTC CGC TAC TAC CAC CAA CTG AGC CAA CAT GTG ACC GTG 831

Val Arg Tyr Tyr His Gin Leu Ser Gin His Val Thr Val 250 255 GAC GTG TTC GGC CGG GGC GGG CCG GGG CAG CCG GTG CCC 870

Asp Val Phe Gly Arg Gly Gly Pro Gly Gin Pro Val Pro 260 265 270 G AA ATT GGG CTC CTG CAC ACA GTG GCC CGC TAC AAG TTC 909

Glu Ile Gly Leu Leu His Thr Val Ala Arg Tyr Lys Phe 275 280 TAC CTG GCT TTC GAG AAC TCG CAG CAC CTG GAT TAT ATC 948

Tyr Leu Ala Phe Glu Asn Ser Gin His Leu Asp Tyr Ile 285 290 295 ACC GAG AAG CTC TGG CGC AAC GCG TTG CTC GCT GGG GCG 987

Thr Glu Lys Leu Trp Arg Asn Ala Leu Leu Ala Gly Ala 300 305 310 GTG CCG GTG GTG CTG GGC CCA GAC CGT GCC AAC TAC GAG 1026

Val Pro Val Val Leu Gly Pro Asp Arg Ala Asn Tyr Glu 315 320 CGC TTT GTG CCC CGC GGC GCC TTC ATC CAC GTG GAC GAC 1065

Arg Phe Val Pro Arg Gly Ala Phe lie His Val Asp Asp 325 330 335 TTC CCA AGT GCC TCC TCC CTG GCC TCG TAC CTG CTT TTC 1104

Phe Pro Ser Ala Ser Ser Leu Ala Ser Tyr Leu Leu Phe 340 345 CTC GAC CGC AAC CCC GCG GTC TAT CGC CGC TAC TTC CAC 1143

Leu Asp Arg Asn Pro Ala Val Tyr Arg Arg Tyr Phe His 350 355 360 TGG CGC CGG AGC TAC GCT GTC CAC ATC ACC TCC TTC TGG 1182

Trp Arg Arg Ser iyr Ala Val His Ile Thr Ser Phe Trp 365 370 375 GAC GAG CCT TGG TGC CGG GTG TGC CAG GCT GTA CAG AGG 1221

Asp Glu Pro Trp Cys Arg Val Cys Gin Ala Val Gin Arg 380 385 GCT GGG GAC CGG CCC AAG AGC ATA CGG AAC TTG GCC AGC 1260

Ala Gly Asp Arg Pro Lys Ser Ile Arg Asn Leu Ala Ser 390 395 400 TGG TTC GAG CGG TGAAGCCGCG CTCCCCTGGA AGCGACCCAG 1302

Trp Phe Glu Arg 405 GGGAGGCCAA GTTGTCAGCT TTTTGATCCT CTACTGTGCA TCTCCTTGAC 1352

Claims (19)

Claims: 1. A process for the preparation of a membrane-bound mammalian glycosyltransferase from the group consisting of a galactosyltransferase, a sialyltransferase and a fucosyltransferase, or one of their variants, characterized in that a yeast strain is cultured with a hybrid vector comprising an expression cassette comprising a promoter and a contains DNA sequence coding for said glycosyltransferase or its variant, this DNA being controlled by said promoter, transformed, and the enzymatic activity being obtained. 2. The method according to claim 1, characterized in that the glycosyltransferase is of human origin. 3. The method for producing a variant according to claim 1, characterized in that the variant differs from the corresponding form with the full length by the absence of the cytoplasmic tail, the signal anchor and, if appropriate, a smaller part of the stem region. 4. The method for the production of a variant according to claim 3, characterized in that a yeast strain is cultivated, the expression cassette comprising a promoter, which is functionally linked to a first, a signal peptide coding DNA sequence, in the correct reading frame with a second DNA sequence coding for the variant mentioned, which is controlled by the promoter mentioned, contains, and the enzymatic activity is obtained. 5. The method according to claim 1, characterized in that the glycosyltransferase is a galactosyltransferase. 6. The method according to claim 5, characterized in that the galactosyltransferase UDP-galactose: ß-galactoside-oc (l-3) galactosyltransferase (EC 2.4.1.151) or UDP-galactose: ß-N-acetylglucosamine-ß (l-4th ) galactosyltransferase (EC 2.4.1.22). 7. The method according to claim 5, characterized in that the galactosyltransferase in SEQ ID no. 1 amino acid sequence shown. 8. The method according to claim 3, characterized in that the galactosyltransferase in SEQ ID no. 2 amino acid sequence shown. 9. The method according to claim 1, characterized in that the glycosyltransferase is a sialyltransferase. 10. The method according to claim 9, characterized in that the sialyltransferase CMP-NeuAc-ß-galactoside-a (2-6) sialyltransferase (EC 2.4.99.1). 11. The method according to claim 9, characterized in that the sialyltransferase the in SEQ ID no. 3 amino acid sequence shown. 12. The method according to claim 9, characterized in that the sialyl transferase is designated as ST (Lys27-Cys406) and from amino acids 27 to 406 of the SEQ ID no. 3 listed amino acid sequence. 13. The method according to claim 9, characterized in that the sialyltransferase the in SEQ ID no. 4 amino acid sequence shown. 14. The method according to claim 1, characterized in that the glycosyltransferase is a fucosyltransferase. 15. The method according to claim 14, characterized in that the fucosyltransferase GDP-fucose: β-galactoside-a (l-2) fucosyltransferase (EC 2.4.1.69) and GDP-fucose: N-actylglucosamine-a (1-3 / 4 ) is fucosyltransferase (EC 2.4.1.65). 16. The method according to claim 14, characterized in that the fucosyltransferase the SEQ ID no. 5 amino acid sequence shown. 17. The method according to claim 14, characterized in that the fucosyl transferase is referred to as FT (Arg62-Arg405) and from amino acids 62 to 405 of the SEQ ID no. 5 amino acid sequence shown consists. 18. A yeast hybrid vector, characterized in that it contains an expression cassette comprising a yeast promoter and one for a merabrond-linked mammalian glycosyltransferase from the grapple, consisting of a galactosyltransferase, a sialyltransferase and a fucosyliransferase, or a DNA sequence encoding their variants, wherein these DNA sequence is controlled by the promoter mentioned. A yeast strain transformed with a hybrid vector according to claim 18.