JPH05501359A - Fucosyltransferase involved in adhesion molecule expression - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] ・ Fucosyltransferase a-kun 3υ [i The present invention relates to the biology of cell adhesion, and in particular to molecules involved in the expression of surface ligands. related. This surface ligand specifically promotes leukocyte binding to the adhesion molecule ELAMI. It is a CDX for the expression of glycoproteins involved in.

Inflammation is characterized by an increase in the number of white blood cells (leukocytes), particularly those that attack the inner walls of blood vessels. adhesion of white blood cells) and infiltration of leukocytes into surrounding tissues (Harlan, 1985). In normal inflammation, the infiltrate white blood cells that phagocytose invading organisms or dead cells and play a role in tissue repair. Tasu. However, in pathological inflammation, infiltrating white blood cells are severely damaged and often can often cause fatal damage (Hough and 5okolofV, 1 9115; Ross, 1986;) Iarlan, 1987 and Malec h and Ga1lin, +987) o Leukocyte adhesion is involved in many inflammations. Recognizing that this is a key step in pathology, researchers have recently We are focusing on the mechanism by which leukocytes bind to the surface of endothelial cells.

Cell adhesion involves endothelial cells and leukocytes that act as receptors and ligands. (Feartan et al., 1987 HDana et al., 1986, and Bevilacqua et al. 191]7a). Molecules on the endothelial cell surface that mediate lymphocyte binding are - Sometimes called leukocyte adhesion molecules (ELAMS) (Bevilacqu a et al., 1987b). A certain ELAM, 4 temples (this ELAMI, It is thought that this is an important mediator for PMN adhesion to the vascular wall. ELAM I is a 116 kD cell surface species protein. HUV grown in vitro In ECs (human venous endothelial cells), ELAMI is an inflammatory cytokine I It is rapidly synthesized in response to L-1 and TNF (Bevilacqua et al. 1987b; Cotran et al.

1986, and C0tran and Pober, 1988).

Adhesion of leukocytes to ELAMI-expressing cells induces ELAM1 ligand It is suggested that this is present on leukocytes. We are PCT/US 901023 57 (incorporated herein by reference), the attachment of leukocytes to endothelial cells (MICA), which is probably the only ELAMI reported on the isolation of a ELAMI ligand (or an ELAMI ligand). H The molecule isolated from L-60111 cells and named CDX is a 150k D glycoprotein. We decided to immunize mice with whole cells of HL-60. Therefore, using 5GB3B4, a monoclonal antibody raised against CDI, CDI was isolated. 5G83B4 induces PMN and HL into ELAMI-expressing cells. Inhibits binding of -60 cells. Furthermore, CDX is known to attach to ELAML. Leukocyte cells that are present in the type of white blood cells that are present and that do not adhere to ELAMI Absent from cystic and other cell types. In this way, CDI mediated leukocytes - certain leukocytes that play an important role in endothelial cell adhesion It is a molecule expressed in

In addition to their role in inflammation, ELAMs play a role in tumor invasion, metastasis and across a wide range of pathological conditions involving cell-to-cell recognition, including viral infections. Many experiments have proven that it can play an important role (H arlan, 1985; *allfs and Harlan, 1986; B evi Iacqua et al., 1987a; and Cotran and Pober, 1988).

Thus, CDx and ELAMI may be involved in inflammation and possibly other disease states. and play an important role. the amount that directly or indirectly contributes to their expression. Isolation of offspring may interfere with cell adhesion during inflammation or in other pathological conditions. in the development of treatments aimed at limiting the involvement of ELAML and CDX. This is an important process.

Oizudate! 1 The present invention provides several cell lines including C05SCHO and R1,1 with anti- Expressing a surface glycoprotein recognized by CDX (α-CDX) antibody; A DNA sequence encoding a molecule that binds to ELAMI is provided. The present invention , especially clone 7.2 and clone 1, and protein 7.2 and protein Provide each person with 1. These proteins are 1,3-fucosyltransfected. It is thought that it is lase.

The present invention also provides glycoproteins Pseudo-X and Pseudo-X2. provide. These proteins induce ELA in cos and CHO cells, respectively. It binds to MI and is then recognized by α-CDX antibody.

Ward road ρJJ 1 km Figure 1 shows the cDNA sequence encoding protein 7.2 and pSQ219 and and protein 7.2 derived from CDX pCDM8CD-on 7.2. The amino acid sequence shown is shown below. These nucleotides are numbered from 1 to 2175. ing. In this application, we have cloned the coding DNA sequence of this figure into clone 7. ．． It is called the DNA sequence for 2. We also have the amino acid configuration depicted in this figure. The polypeptide containing the sequence is called protein 7.2.

Figure 2 shows the cDNA sequence encoding protein A derived from Clone. It is depicted. In this application, we clone the coding DNA sequence of this figure. This is called the DNA sequence for zone 1.

We also prepared a poly liang bean sauce containing the amino acid sequence depicted in this figure. In accordance with this detailed description, the following definitions apply: two expression control sequences--other A DNA sequence that controls and regulates the transcription and translation of a DNA sequence.

An operably linked m-expression control sequence controls transcription and translation of the DNA sequence. When regulated, this DNA sequence is operably linked to expression control sequences. child The term "operably linked" includes any preceding DNA sequence that is expressed. have a suitable initiation signal (e.g. ATG) and be under the control of expression control sequences. Expression of this DNA sequence and the desired product encoded by this DNA sequence maintaining the correct reading frame to allow for the manufacture of. recombinant DNA If the gene to be inserted into the molecule does not contain a suitable initiation signal, such A start signal may be inserted before the gene.

Standard hybridization conditions - 1 Hybridization and washing Salt and temperature conditions substantially equal to 5xssc and 65°C for both . Under standard hybridization conditions, the DNA sequences of the invention: Other DNA sequences with sufficient homology, including homologous sequences from hundreds of different species hybridize to. The stringency of hybridization conditions This has been shown to be a factor in the degree of homology required for ization.

DNA Sequence - A DNA sequence of the present invention is a DNA sequence prepared using recombinant DNA technology. or an isolated DNA sequence. These DNA sequences include cDNA, natural DNA sequences isolated from genomes, as well as synthetic DNA sequences are included. of the claim The term as used in the scope refers to natural DNA as it occurs in nature. Not intended to contain arrays.

Expression of a recombinant DNA molecule of the invention involves the expression of a polypeptide produced by a host cell. Post-translational modifications may be included. For example, in mammalian cells, expression includes: May include: in particular, glycosylation of polypeptides, lipid molecules (l1pi) dation) or phosphorylation, or by cleaving the signal sequence to produce a “mature” tag. To cause an impact. Therefore, as used herein, the term "protein" The term includes full-length polypeptides and modifications or derivatives thereof, e.g. For example, glycosylated forms of such polypeptides, mature proteins, and signal peptides can be preserved. a truncated polypeptide with comparable biological activity. and so on.

The molecules of the present invention are involved in the expression of CDI, a glycoprotein, on certain leukocytes. ing. CDX appears as a single, extended band of approximately 150 kD in the 5DS-P Appears on AGE. The 90 kD protein band is sometimes derived from HL-60 cells. found in bound proteins and commonly found in neutrophil-derived proteins. seen in

We believe that this 90 kD band represents a CDI degradation product. High molecular A large band (ie, approximately 170 kD) was also occasionally seen. These are non-specific It can be a different band. +50 kD CDX was converted to N-glycanase (N-glyc When treated with anase), this molecular weight was reduced to approximately 70 kD. 150kD When the band was treated with N-glycanase and O-glycanase, the molecular weight was It did not decrease further. Furthermore, HL-60 cells were treated with sialidase. , they lose the ability to bind to ELAMI. These results indicate that CDX It is a heavily glycosylated protein, and this glycosylation results in CDX - Indicates that it plays an important role in the interaction of ELAMI.

We glycosylated the CDx polypeptide and converted the CDX polypeptide to Coating 1,3-fucosyltransferase, which confers the ability to bind LAMI. Two DNA sequences, clone 7.2 and clone l, are believed to be was isolated. 1,3-fucosyltransferase is located in the Golgi apparatus and endoplasmic reticulum. The fucosyl acts on the appropriate receptor carbohydrate through a 1.3 glycosidic linkage. It is a very specific enzyme that joins the moieties together. The genetic structure of these sequences is similar to that of other This is consistent with the well-known gene structure of glyconortransferase. moreover, CHO cells transfected with clone 7.2 were transfected with fucosyl transfectants. expresses lase activity.

Several 1,3-fucosyltransferases are known to those skilled in the art (Paul son and Colley, 1989 and Kukowska-Latall .

et al., 1990). These proteins with similar activities can interact with each other or with each other. glycosyltransferases or other glycosyltransferases. (Paulson and Colley, 1989 and Kuk ovska-Latallo et al., 1990). Therefore, we have these DNs It is not believed that the A sequences are kilohomogeneous with the DNA sequences of the invention. But other species that share sufficient sequence homology with the DNA sequences disclosed herein. It is thought that this gene contains the following genes. Under standard /% hybridization conditions, Using the DNA sequences of the invention as lobes, these homologous genes can be isolated. Ru. The present invention specifically contemplates and encompasses such arrangements.

When COS 7 cells are transfected with either of these two clones , they behaved like cells expressing CDI. In other words, if ELAMI and is recognized by α-CDX monoclonal 5G83BJ. , have become “visible” to ELAMI in that they can give rise to surface glycoproteins. . By using α-CDX monoclonal, we named it Pseudo-X. An image of a 130 kD glycoprotein from transfected CO8 cells. Munobrenvitation was performed. Similarly, transfected with clone 7.2 CHO cells also became visible for ELAMI and α-CDX . They express a 140 kD glycoprotein that we named Pseudo-X2. do.

Both Pseudo-X and Pseudo-X2 are not CDX o Ps eud.

-X has a molecular weight of approximately 130 kD and Pseudo-X2 has a molecular weight of 140 kD. It has a molecular weight of D. CDX has a molecular weight of 150 kD. N-glycanase or when treated with hydrofluoric acid (which removes all hydrocarbons), Pseu do-X changes to 110kD. Pseudo-X2 changes to about 120kD. Ru. CDI changes to approximately 70kD. Because it does not move to 4SkD or 59kD , the predicted molecular weights of protein 7.2 and protein 1 are. Pseudo-X and CDX also have different v8 and chymotrypsin digestion patterns.

We isolated clone 7.2 and clone 1 as follows: CDX Create a cDNA library from the expressed human cell line HL-60 mRNA did. As described below, human cell lines that do not express CDX (in this case HeL This library was prepared by using a subtraction technique in a-cells). - turned into a bullet. This resulted in a subtraction containing approximately 2100 clones. generated an installed library. subtractic, assayed in many ways. We transfected COS7, a monkey kidney cell line, with the engineered library. I tried it.

We used transfected cells with α-CDX monoclonal antibody (Moab s) and coated with anti-mouse IgG or IgM. Banned them on the market (Wysocki and 5ato, 1978 ). Cells that bind to the plate are recognized by α-CDX Moabs. It is the one that expresses the child.

In this way, we: 2. Transfected with Lkb DNA insert Adherent cells were identified. We subtract part of this sequence into the sea fence vector. I loaned it and named it psQ219. in pCDM8CD-on The DNA insert was named clone 7°2. Furthermore, hybridization A 2.9 kb insert was therefore isolated and designated clone 1. this These two clones encode protein 7.2 and protein 1, respectively.

Another feature of the invention is the expression of the DNA sequences disclosed herein. For those skilled in the art ( As is known, the DNA sequence can be linked to expression control sequences in an appropriate expression vector. operably linked and the expression vector used to transform a suitable unicellular host. It can be expressed by converting.

Operable linking of such a DNA sequence of the invention to an expression control sequence includes this D Providing the start codon ATG in the correct reading frame of the NA sequence is included. This means that the start codon is not yet present in this DNA sequence or in this expression. This is done if it is not part of the vector.

A wide range of host/expression vector combinations can be used to express the DNA sequences of the invention. can be used. Useful expression vectors include, for example, chromosomal, non-chromosomal and synthetic vectors. It can consist of segments of NA sequences. Suitable vectors include SV40 induction and well-known bacterial plasmids, such as Escherichia coli plasmids calEl, Proteins such as pcRl, pBR322, pMB9 and their derivatives, RP4 Lasmids; phage DNA, e.g., numerous derivatives of the λ phage, e.g. NM 989, and other phage DNA, such as M13 and filamentous (Ftlam) er+tous) single-stranded phage DNA: 2u plasmid or its derivatives vectors useful in eukaryotic cells, such as insect or yeast plasmids; vectors useful in mammalian cells; plasmid and phage DNA assembly Using vectors derived from combinations, e.g. phage DNA or expression control sequences of Examples include plasmids that have been modified to

A wide range of expression control sequences - one that controls the expression of DNA sequences operably linked thereto; Both sequence-1 can be used in these vectors to express the DNA sequence of the present invention. It can be used in the turret. Such useful expression control sequences include, for example, 5v40 or adenovirus early and late promoters, Iac system, Main operator and promoter regions of Ω, 1, and λ phages region, fd cocotan, control region of f, 3-phosphoglycerate kinase or is the promoter of other glycolytic enzymes, the promoter of acid phosphatase (e.g. , Phon), yeast α-mating factor promoter, and prokaryotic or eukaryotic Other promoters known to control expression of cells or their viruses, and and various combinations thereof.

A wide variety of unicellular host cells are also useful for expressing the DNA sequences of the invention. . These hosts include well-known eukaryotic and prokaryotic hosts, such as E. coli, Fungi such as Pseudomonas, Bacillus, Streptomysis, yeast, and physical cells, such as C00% R1,1, B4 and LM cells, African Green Monkey kidney cells (e.g. COS 1, COS 7, B5Cl, B5C40 , and BMTIO), insect cells (e.g. S'9), and in tissue culture. Human cells and plant cells may be included.

All vectors, expression control sequences, and hosts are suitable for expressing the DNA of the invention. It is understood that not all methods work equally well. Similarly all Not all hosts function equally well with the same expression system. However, this One skilled in the art will be able to use excessive techniques to achieve the desired effect without departing from the scope of the invention. Appropriate vectors, expression control sequences, and hosts can be selected without extensive experimentation. example For example, the host must be considered when choosing a vector. Na This is because this vector must function within it. This vector the number of copies of a protein, the ability to control that copy number, and the ability to control that copy number, such as antibiotic markers. Expression of any other proteins fed by the vector is also considered. It will be done.

A number of factors are typically considered when selecting appropriate expression control sequences. to these for example, the relative strength of this system, its control capabilities, and the particular D expressed. Compatibility with the NA sequence or gene (particularly with respect to potential secondary structure) is included. It will be done. Suitable unicellular hosts are determined, for example, by their compatibility with the selected vector, their secretory properties, their ability to fold proteins correctly, and their culture conditions, and the host of the product encoded by the expressed DNA sequence. and the ease of purification of the expressed product. Ru.

It is understood that expression of the DNA sequences of the invention may have different effects in different hosts. It is also recognized that For example, clone 7.2, expressed in CO3 cells, While leading to the emergence of ELAMI-binding surface molecules, e.g. Expression of 7.2 does not have a similar effect. This is because prokaryotes contain protein 7 It lacks an internal cellular structure (Golgi apparatus) that may be necessary for the biological functionality of ゜2. This is because they are doing so. On the other hand, clone 7.2 expression product was isolated and intact. Protein 7.2 has a function in cellular biochemistry, e.g. Host cells that do not have the catalytic role of cosyltransferases are preferred. It can be done. Those skilled in the art will know the appropriate host cell and expression mechanism for a particular purpose. Select and get le.

Taking into account these and other factors, one skilled in the art will Large-scale animal cell culture (A) using various vectors expressing the DNA sequences of the present invention. A vector/expression control sequence y11/host combination can be constructed.

Isolation and isolation of Tan/XHri 72 and Tan, 4i 1 after expression in one host system Several types of strategic forces are effective for refinement and refinement. A method ζ This can be done by expressing cells, lysing the cells, and by conventional means. It includes purifying the tan t4 of the. Or, some people (well, cellular power) DNA sequences can be manipulated to cause secretion. For example, if Coley et al. (198 9) +, on the DNA sequence for sialyltransferase (this human group) 1 cleavable signal peptide of interferon! 111 notes of writing Ru. Larsen et al. (1990) reported that the fucosyltransferase gene Tan7<riA (DNA distribution 1 to this) is fused to the amino terminus and secreted. This was expressed as a fusion Tannokuri. In these constructs, some ( IV. can be removed at will. After secretion, this protein is purified from the medium. similar strategy is effective against bacteria.

Scientists are increasingly recognizing the value of enzymes as catalysts in organic synthesis (Wang, 1989). The 1,3-fucosyltransferase of this month is 1.3 of the present invention is useful for the enzymatic synthesis of carbonaceous compounds in vitro. - Fucosyltransferases are specifically It is useful for catalyzing the conjugation of fucose to receptors. We in Example I describes a set of suitable conditions for this catalyst, which Concerning an assay for ferase activity. Those skilled in the art will appreciate the information provided herein. Other suitable conditions under which the 1,3 fufusyl transferase may be advantageously used are recognized. Understand.

Currently, the carbohydrate moiety of CDI is important for ELAMI-mediated cell attachment. is obvious. CDX5Pseudo-X, or Pseudo-X2 A molecule containing a carbohydrate moiety, or a fucose-containing portion of that moiety, is εL It may be important to function as an AMI ligand. Such molecules are ELAM Inhibition of I-mediated cell adhesion may be useful in methods involving therapy.

The invention also relates to synthetic organic chemicals, natural culture products, 1,3-fucosyltransferers described herein, including peptides and the like directed against small molecules that inhibit enzyme activity. These small molecules It may be useful in treatments aimed at inhibiting cell adhesion. Such a minute In order to identify potential inhibitors, one may use fucose receptors and 1.3-fucose receptors. Prepare a test mixture by contacting cosyltransferase with do. The fucose receptor is preferably LacNAc or 2'-fucose receptor. It is lulactose.

This 1.3-fucosyltransferase is preferably clone 7.2. or derived from extracts from cells transformed with clone 1. Next, the fruit For the activity of 1,3-fucon letransferase, as described in Example ■, Then test the mixture for 7 times.

In order that the invention may be better understood, we present the following examples. Examples of these are for illustrative purposes and do not limit the scope of the invention in any way. Then, it should be interpreted as 艷l doudan. We identified two types of CDX-expressing cells: HL-60 cells and U937 cells. Two cDNA libraries derived from cells were constructed in the pcDMB vector. this mRNA from these cells is isolated and processed using methods well known to those skilled in the art. was used to reverse transcribe into cDNA (Gubler and Hoffman, 1983 ). Using standard methods, create a Notl-BstXI linker with the following sequence: / double-stranded cDNA was ligated to the adapter. : 5’ GCG GCCGCT TTA GAG CACA 3’3° CGCCG G　CGA　AAT　CTC5' Then 4.2n+1 of 5-20% potassium acetate um gradient, 2mM EDTA, lμg/m1 ethidium bromide. , BECKMAN 5W600 according to the protocol of Br1an 5eed. - Size selection of cDNA at 50°00 rpm for 3 hours at 22°C (See also Maniat is, 1982. p. 278) . cDNA fragments larger than 500 base pairs were pooled and then added to the vector, pCD M8 was prepared (gift from Brian 5eed).

This plasmid was digested with BstXI. 400 base pair stuffer fragment (s This mixture was diluted with potassium acetate to remove the tuffer fragment. centrifuged as above on a gradient and isolated large fragments. moreover , this fragment was purified by agarose gel electrophoresis, and then this vector The cDNA was ligated to the

Next, 32p-labeled CD was first extracted from 1 μg of HL-60 polyA+ mRNA. Create a NA probe and then use a polypeptide derived from HeLa cells that do not express CDX. This probe was hybridized with 30 μg of A+ mRNA. cDNA live enriched by subtracting non-CDX-related cDNA sequences. A slurry was prepared (see Davis, 1986). subtraction Screening of pCDM8 cDNA library using the designed probe In this way, HL-60 cell-derived enriched cells were added to E. coli MC1061P3. A sub-library was created. In 22 96-well plates, approximately 2100 clones were expanded. U937 enhanced sub-library It was prepared in a similar manner and 1400 clones were obtained.

COS by spheroplast fusion? For cell transfection/ion, Colonies from the HL-60 enriched library were divided into 22 pools. (Sandri-Goldin et al., 1981) α-CDX from hybridoma 5GC2ES according to the method of Banning with monoclonal antibody (antibody with similar function to 5G83B4) COS transfected for ELAMI binding activity by 7 cells were assayed (Aruffo and 5eed, 1987 and Wys see also Ocki and 5ato, 1978). Assay pool #7 The results were positive and two clones were obtained with a 2.1 kb cDNA insert. Ta. These two clones were named clone 7.1 and 7.2.

CDX is from clone 7.2 of pCDM8 and is a Sea Fence vector From part of the 7,2 insert subcloned into pNNl1, Max. Cloning by the Bart method (Maxim and G11bert, 1980) The DNA sequence of 7.2 was obtained. This latter plasmid was named psQ219.

The obtained DNA sequence is shown in FIG.

We are InVitro International, Inc., 611 P, HammondsFerry Rd, Linthieum, Md, 21 090 (USA) on April 26, 1990 based on the Butahest Treaty. A culture containing midoCDX pCDM8CD-on7.2 was deposited. this deposit is shown as below. ： CDX pCDM8 / E, coli MC1061P3 Deposit number IVI-1 0242 We also analyzed mRNA derived from 1 (L-60 cells with 7-Zambrosoto) and found that This was probed with clone 7.2. Clone 7.2 has three 1RNA types , that is, 5. Two prominent bands at Okb and 2.4kb, and and other bands at 3.0 kb)\bridized. Clone 7.2 The 2', 1 kb cDNA is 3. Total length c from Okb and 6.0 kb species It is not large enough to become DNA. Therefore, for these messages Oligonucleotides derived from clone 7.2 were used to identify the DNA sequence. in the enriched cDNA source derived from both U937 and I (L-60 cells). library was probed. Several long inserts from the HL-60 library isolated and transfected the insert into COS 7 cells, and EL Clones binding to AMI and α-CDX were selected. In this way, 3. We identified a 2.9 kb insert that could arise from a 0 kb message. we are that was called CDX clone l.

The DNA sequence of CDx clone 1 was determined by the Maxam-Gilbert method.

The obtained DNA sequence is shown in FIG.

We are InVitro International, Inc., 611 P, HammondsFerry Rd, Linthicum, Md, 21 090 (USA) on October 11, 1990 based on the Butahest Treaty. A culture containing Sumid CDX clone 1 was deposited. This deposit is as follows: shown. :CDX alone 1 pCDM8 / E, coli MC1 061P3 Deposit number IVY-10255 Are we COS? and clone 7.2 and clone 1 into CHO cells. transfected. After 48 hours of transfusilane, these cells A. Expresses glycoproteins on the cell surface, as assayed by CS, and this A fluorescently labeled α-CDI antibody was bound to this. These cell surface proteins are 1 25I and immunoprecipitated with α-CDX Moabs. C The protein isolated from O37 cells was named Pseudo-X and CIIO The protein isolated from the cells was named Pseudo-X2. SDS polyacrylic In the Ruamide gel, Pseudo-X and Pseudo-X2 are each , approximately 130 kD and 140 kD.

The transfected CO3 cells also received recombinant soluble ELAMI (r forming a rosette around Sepharose beads coated with sELAMl); And this rosé, Tinob, is cation-dependent and has BBII (anti-ELAMI). antibody) and α-CDX. pCDM8 only (insert clone) CO3 and CHO cells transfected with rsEL It did not rosette onto AMl beads. Additionally, transfected with clone 72 CO3 cells and CHO cells were treated with beads coated with bovine serum albumin. It didn't rosette in the first place.

Additionally, DNA sequence analysis and enzymatic assays revealed clone 7.2 and clone 7.2. 1 was characterized. Clone 1 consists of the nucleotides from positions 174 to 1763 in Figure 2. encodes a polypeptide of 530 amino acids (hooded by Otide) . Clone 7.2 was cloned by nucleotides from position 66 to position 1280 in Figure 1. encodes a polypeptide of 405 amino acids (encoded). UWGCG array Analysis sequence analysis software Weber (UWGCG 5 sequence Analysis s Software Package) (Version 6, 1. 1989 8 The program FASTA for homology searches with other proteins using We want to search the database of NBRF proteins using Release 23 , December 1989). Also, GenBank (Release 63. March 1990) ) and EMBL (Release 19. May 1989) using TFA STA. I searched for it. In these searches, herpes simplex virus type 1, dengue fever virus Certain viral pathogens, including viruses, yellow fever and other flaviviruses, There is homology within a short region (for example, about 23 amino acids) to the target protein. I discovered something. In general, homology to known proteins is low and We conclude that this polypeptide is novel.

Nucleo from nucleotide position 9 to nucleotide position 2162 of clone 7.2 Part of the sequence (Fig. 1) starts from nucleotide position 492 of clone I. It is equivalent to a part of the sequence at position 2645 (Fig. 2). The first methionine of protein 7.2 methionine corresponds to the amino acid methionine at position 126 of protein 1. this homo One explanation for the logic is that the two inserts are different from the same DNA segment. In other words, it represents the transcripts.

As mentioned above, these clones contain CDX% Pseudo-X or Pse Does not code udo-X2. the polypeptides they encode are the correct size isn't it. Rather, the evidence is strong (supporting the following conclusions, i.e., clone 7.2 and Clone 1 hoods 1,3-fucosyltransferase, and this enzyme proteins, such as CDX, Pseudo-X or Pseudo-X2 (recognized by ELAMI or α-CDX? -CDX), 'visible ELAMI or α-CDX Glycosylate as follows. First, the DNA of clone 1 and clone 7.2 The sequence is based on several structures possessed by the DNA sequences of well-known glycosyltransferases. share architectural characteristics. For example, the well-known glycosyltransferase genes usually have consecutive methionine start sites, and more than one mRNA A transcript can be produced. As already mentioned, hive to clone 72 Three mRNA transcripts that redize were identified, and clone 1 was identified as a transcription initiation signal. It was confirmed that it contains two codons that act as In addition, the well-known glyco Like the Dyltransferase, these clones contain many SPI enhancers. It has one part. The base sequence of these parts is GGGCGG or CCGCCC It is. Clone 1 has five such sites. In addition, the well-known glycodyl Similar to transferase, clone 7.2 and clone 1 contain guanine (G) and and cytosine (C) rich. For example, clone l has 7 in the 5° region of the gene. It is 5% GC-rich and 60% GC-rich in the 3° region of the gene. Also, Glycosyltransferase is a typical lys I+ membrane protein that binds to membranes ( The membrane-spanning) domain is located near the amino terminus, The extracellular portion is near the carboxy terminus. Clone 1 and clone 7.2 are amino It encodes a polypeptide that has a hydrophobic region near its end.

Glycosyltransferases tend to have molecular weights between 40 kD and 60 kD. clone 1 encodes a polypeptide of approximately 59 kD, clone 7.2 encodes a polypeptide of approximately 46 kD. Finally, the well-known glycodyltora Sferases usually have 1 to 3 N-glycosylation sites, and clone 1 and and clone 7.2 both have two such sites.

Second, for extracts from CHO cells transfected with clone 7.2, Enzyme assays performed showed no expression in untransfected cells. It was shown that there are many fucosyltransferases. In this assay, Testing the ability of an enzyme to bind radiolabeled fucose to an acceptor molecule I did it. The assay was performed as follows.

Contains 10 μm enzyme, 8 μl cocktail and 2 μl 10x acceptor Assay samples were prepared in batches. Klonoa, transfected with 2 ca. 1.5 million CHO cells were isolated and 150 μM chilled 1% Triton The cells were lysed by sonication for 15 seconds in a -1oo aqueous solution to prepare the enzyme.

Cocktail: 75μM l’c-GDP Fufus, 100mM ATP, 500 mM L-fucose, LM MnCl2, and IM cacodylate (cacod ylate) pt(6,2). 200mM LacNAcSLac-N-biose or lactose, 25 0mM phenyl-β-D-galactoside or 50mM 2'-fucosyllac It contained toss. Incubate the assay sample for 1 hour at 37°C. The reaction was stopped by adding 20 μl of ethanol.

Dilute with 560 μl of water and centrifuge for 5 minutes at high speed in an Ebbendorf centrifuge. did.

DOWEX I! 2-400 column (Sigma Ch chemical (manufactured by Co., Ltd.), and unconverted 1AC fucolate from the converted one. Su-〇DP was separated. This matrix was applied to a large column to obtain 10 times the volume. of IN NaOH, 5 volumes of water, then 10 volumes of 5% formic acid. Washed. This wash cycle was repeated. Using this material, make a 0.4ml small I made a small column. This small column was washed with 10 volumes of water before use.

Place 200 μl of sample onto a small column, collect the eluate and wash with 2 ml of water. and concentrated in the eluate. The radioactivity of this eluate was determined by I decided after searching.

The results of this assay indicate that the induced enzyme (See Table 1).

Enzymes convert fucose to LacNAc, 2-fucosyllactose, lactose, etc. these acceptors are GlcNA with free 3' hydroxyl. c or has a glucose moiety.

Fucose has no free 3° hydroxyl in its GlcNAc moiety; It did not bind to LacN biose. with negative control acceptor It also did not bind to certain phenyl-β-D-galactosides. transfected These activators of fructose were The bond to the scepter only showed a meaningless degree.

Table 1 - Fucosylation efficiency Therefore, both genetic and enzymatic evidence suggests that clone 7°2 and clone 1 are ．． It is shown to encode 3-fucon letransferase.

Although numerous embodiments of the invention are described herein, those skilled in the art will Modifications, if any, to the methods of the invention and other embodiments utilizing the processes and compositions of the invention are contemplated. It is clear that 9% can be achieved. Accordingly, the scope of the invention is limited to is defined by the claims appended hereto, rather than by any particular embodiment described herein. It is obvious that it must be done.

(Margin below) Hiro ■1” BiL (dedicated) Aruffo, A., and B. 5eed, r. Highly efficient CO3 cells. Molecular cloning of CD28 cDNA using expression system J, Proc, Na tl, Acad, Sci, U-Ki, 84. pp. 8573-77 (1987) Bevilacqua, M. P., et al., “Endothelium-dependent mechanisms of leukocyte adhesion: "Regulation by interleukin-1 and tumor necrosis factor", ration and Its Se uelae (S, Karger A- G., 5wltzerland, 1987a), pp. 79-93) Be Vilacqua, M. P., et al., “Identification of inducible endothelial-leukocyte adhesion molecules”, Proc, Natl, Acad, Set, USA, 84. pp, 9238-42 (1987b) Bevi 1acqua, M, P,, et al., [Endothelial leukocyte adhesion molecule 1: neutrophils related to complement regulatory proteins and lectins] Inducible Receptor J, 5science, 243. I) Ri, 11 60-5 (1989) Cotran, R.S., et al. "Induction and Detection of Endothelial Activation Antigen", Mu L Juhong, 164. pp, 661-6 6 (1986) Colley, K., J., et al. Golgi sialyltransferer by replacement of Nl2-terminal signal anchor J, J, Biol, Set, 264. pp, 17619-22 (198Cotran, R,S, and J, S, Pober, r Endothelial activation: its role in inflammation and in the immune response That role J, Endothelial C rainbow shadow and Masae, S 　o　n　e　sc　u and 51m1onescu! i, Plenum P ress.

New York (1988), pp, 335-47 Dana, N,, et al., “rMo1 surface saccharide: structure, function and clinical significance”, b. 5. pp, 371-83 (1986) Da vis, M, M,, r subtractive cDNA hybridization and T-cell receptor gene, 1 mmunolo In Four Volumes, 4th edition, Blackbell 5cien tificPubl 1cations, 0xford, Engl and (1986), pp. 76, 1-76, 13 Gubler, U., and H. offman, B., J., r. A simple and easy way to generate cDNA libraries. A very effective method”, Kan, 25. pp, 263-69 (1983)H Arlan, J.M., [Leukocyte-Endothelial Interactions J, Blood, 65. p p, 513-25 Harlan, J, Ml, “Neutrophil-Mediated Vascular Injury J, Ac. ta Med, 5cand, Su1 engineering, 715. I) I), 123-29 (1987) Harlan, J. M., et al., “Neutrophil membrane tissue in neutrophil emigration” The role of Npaku J, Leukocte Emiration and It Edited by H. Movat, (S. Karger AG, B. a5el, 5wltzerland, 1987), pp, 9494-1 O4Hou, A and Ri, 5okoloff, rPathology, 4th car, Rhe umatoid Arthritis, P, D, Ustinger, N , J., Zugifler, and Ehrlich, G., E.

(Lippencott, Phladelphia, 1985), pp, 49-69Kukowsk49-69Kuko, J, F, et al. , “Cloned human cDNA to develop mouse developmental stage-specific embryonic antigen (Mous e Stage-specific Embry.

nic Antigen) and Lewis blood group a (1,3/1.4) fucosyl Determining transferase expression J, Genes and Develo me■, raw, pp, 1288-1303 (1990) Larsen, R, D., et al. [Molecular cloning, sequencing, and human GPD-L-7 course] and expression: β-D-galactoside 2-α-L-fufusyl, which can form H blood group antigens. Transferase cDNAJ Proc, Natl, Acad, Sci, USA, 87. pp, 6674-6678 (1990) Malech , H.L., and Gallin, J., 1. , ``Neutrophils in human diseases'', L-K LL ■ Rainbow, 317. pp, 687-94 (1987) Maniati s, T,, et al. Molecular Cloning: A Labor ator Manual (Cold Spring Harbor Labor atery, Colorado Spring Harbor, New York, 19 82) Maxam, A., and W. G11bert, r base-specific chemical cleavage. Sequencing of end-labeled DNA J, Methods in Enzmo l,,65. pp, 49 Paulson, J. C., and J. Co1 1ey, r glycosyltransferase: structure of cell type-specific glycosylation. Structure, localization, and regulation J, J, Biol, Chem, 264.　 pp, 17615-17618 (1989) Ross, R., “Atheroma "Etiology of sclerosis - latest edition", L. Yu, Med, 314. pp, 488- 500 (1986) Sandri-Goldin, R.M., et al. Cloned herpes simplex virus type I to mammalian cells by last fusion High frequency transitions of sequence sequences J, Molec and Cell Biol, 1. p p, 743-52 (1981) Seed, B., rLFA-3 cDNA J, Natur, which encodes a phospholipid-linked membrane protein similar to CD2 e, 329. pp, 840-42 (1987>5eed, B, and A , Aruffo, r Rapid immunoselection method for CD2 antigen, T cell erythrocyte lysis Pig Molecular Cloning J,’Proc, NatlAcad, Sci, USA, 84. pp, 3365-69 (1987) Wallis, W. , J., and J.M. Harlan, “Inflammation and immune response Skin effector function J Pathol, 1mmuno athol, Re s,, 5゜pp, 773-1O3 (1986 ) Wan, C, -H,, r Enzymatic Catalyst in Yoiki Synthesis J, 5cien ce, 24 East, pp. 1-145-1152 (1989) Wysocki, L. , J, and V, L, 5ato, r panning for leukocytes.

Cell selection method J Proc, Natl, Acad, Sci, USA, 75.　 pp, 2844-48FIG, IA F IG, old FIG, IC FIG, 2A FIG, 2B FIG, 2G 1751 CTGGTTCGAGCGGTGAAGCCGCGCTCCCCTG GAAGCGACCCAGGGGAGGGSA 18001801 CAAGTTG TCAGCTTTTTGATCCTCTACTGTGCATCTCT÷cAc τcccacM 1as.

1a51 TCATGGGAGTAAGTTCTTTCλAACACCCAT÷T TTGCTCTkTGGGkkAAkkk 19001901 CGkTTTk CCAATTAATTATTACTCAGCAcAGAOATOGGOGCCCG GTTTCCλ 19501951 TATTTTTTGCACAGCTkGC MTTGGGCr product CT? TGCTG(÷GATGCGCATC2000200 1xTT(,rT?ACGGGTC entered AGcAGcGGGTTCTT(CTCA CCT? G÷AACCACiTGC＾　205゜FIG, 2D Copy and translation of amendment) Submission (Article 184-7, Paragraph 1 of the Patent Act) December 1991 2681

Claims (1)

[Claims] 1. From the group consisting of (a), (b), (c), (d), (e) and (f) below: Selected DNA sequence: (a) DNA sequence from nucleotides 66 to 1280 in FIG. (b) DNA sequence from nucleotides 69 to 1280 in Figure 1; (c) Nucleotide in Figure 2; DNA sequence of leotide 172-1761; (d) Nucleotides 175-1 in Figure 2 (e) Under standard hybridization conditions, the DNA sequence of 761; DNA sequence that hybridizes to any of the DNA sequences, and protein 7.2 or a DNA sequence having the biological activity of protein 1; and (f) expressing an amino acid sequence encoded by any of the above DNA sequences; A DNA sequence that codes for 2. From the group consisting of (a), (b), (c), (d), (e) and (f) below: A recombinant DNA molecule comprising a selected DNA sequence: (a) DNA sequence of nucleotides 66-1280 of Figure 1; (b) Nucleotide of Figure 1 DNA sequence of nucleotides 69 to 1280; (c) nucleotides 172 to 1761 in Figure 2 (d) DNA sequence of nucleotides 175 to 1761 in Figure 2; (e ) under standard hybridization conditions to any of the above DNA sequences. Implidizing DNA Sequences and Biology of Protein 7.2 or Protein 1 a DNA sequence that has clinical activity; and (f) expressing an amino acid sequence encoded by any of the above DNA sequences; A DNA sequence that codes for 3. 3. The DNA sequence of claim 2, wherein the DNA sequence is operably linked to an expression control sequence. recombinant DNA molecules. 4. Recombinant DNA containing a DNA sequence encoding the amino acid sequence of Figure 1 or Figure 2 A unicellular host transformed with a molecule. 5. Escherichia coli, Pseudomonas, Bacillus, Streptomysis, Yeast, CHO, R1.1, B-W, LM, COS1, COS7, BSC1, BSC40, BM T10, insect cells, and plant and human cells in tissue culture. 5. The unicellular host according to claim 4, selected from: 6. By the method of expressing a recombinant DNA molecule according to claim 2 in a unicellular host. A protein produced by 7. A process for producing molecules that bind to ELAM1 in eukaryotic host cells. The step of expressing a DNA sequence encoding the amino acid sequence shown in Figure 1 or Figure 2. Including, process. 8. A process for producing molecules that attach to ELAM1 in eukaryotic host cells. The step of expressing a DNA sequence encoding the amino acid sequence shown in Figure 1 or Figure 2. Including, process. 9. Pseudo-X or a fragment thereof capable of binding to α-CDX. 10. Pseudo-X2 or a fragment thereof capable of binding to α-CDX. 11. In ELAM1 containing carbohydrate moieties of proteins or their fucose-containing portions A molecule capable of binding, wherein the protein is CDX, Pseudo-X or Pseudo-X. A molecule selected from the group consisting of udo-X2. 12. 12. The molecule of claim 11, wherein the protein is CDX. 13. Method for inhibiting adhesion between leukocytes and endothelial cells in a system containing them and introducing an effective amount of molecules capable of binding to ELAM1 into the system. and the molecule is a carbohydrate of the protein or the fucose-containing portion thereof. and the protein contains CDX, Pseudo-X and Pseud A method selected from the group consisting of o-X2. 14. 14. The method of claim 13, wherein the protein is CDX. 15. The activity of the 1,3-fucosyltransferases described herein Small molecules that inhibit. 16. inhibits the activity of the 1,3-fucosyltransferases described herein A method for identifying small molecules comprising: (1) preparing a test mixture for an inhibitor; Both the candidate fucose receptor and 1,3-fucosyltransferase contacting; and (2) Assaying the 1,3-fucosyltransferase activity of the test mixture Process; A method that encompasses. 17. 17. The method of claim 16, wherein the fucose receptor is LacNAc. 18. 17. The fucose receptor according to claim 16, wherein the fucose receptor is 2'-fucosyllactose. How to put it on. 19. The 1,3-fucosyltransferase is clone 7.2 or clone 7.2. 17. The method of claim 16, wherein the method is derived from an extract of cells transformed with loan 1. 20. 1,3-fucosyltransferase in a method for synthesizing organic compounds Use of. 21. 1,3-fucosyltransferase, as described herein 1,3-glycosylation between fucose and fucose acceptor, including a step catalyzed by A method of manufacturing a bond. 22. 22. The method of claim 21, wherein the fucose receptor is a carbohydrate. 23. Protein 7.2, Protein 1, Protein 7.2 or non-human analogs of 1 and biologically active fragments of any of these proteins.