AU655470B2 - Improved process for the production of glycosyltransferases - Google Patents

Description

I

?1 f 0 4, i ~rr r rtrr c r ri -1- 4-18658/A/BEG Improved process for the production of glycosyltransferases The invention relates to the field of recombinant DNA technology and provides an improved method for the production of glycosyltransferases by use of transformed yeast strains.

Glycosyltransferases transfer sugar residues from an activated donor substrate, usually a nucleotide sugar, to a specific acceptor sugar thus forming a glycosidic linkage. Based on the type of sugar transferred, these enzymes are grouped into families, e.g. galactosyltransferases, sialyltransferases and fucosyltransferases. Being resident membrane proteins primarily located in the Golgi apparatus, the glycosyltransferases share a common domain structure consisting of a short amino-terminal cytoplasmic tail, a signal-anchor domain, and an extended stem region which is followed by a large carboxy-terminal catalytic domain. The signal-anchor domain acts as both uncleavable signal peptide and as membrane spanning region and orients the catalytic domain of the glycosyltransferase within the lumen of the Golgi apparatus. The luminal stem or spacer region is supposed to serve as a flexible tether, allowing the catalytic domain to glycosylate carbohydrate groups of membrane-bound and soluble proteins of the secretory pathway enroute through the Golgi apparatus. Furthermore, the stem portion was discovered to function as retention signal to keep the enzyme bound to the Golgi membrane (PCT Application No. 91/06635).

Soluble forms of glycosyltransferases are found in milk, serum and other body fluids.

These soluble glycosyltransferases are supposed to result from proteolytic release from the corresponding membrane-bound forms of the enzymes by endogenous proteases, presumably by cleavage between the catalytic domain and the transmembrane domain.

Enzymatic synthesis of carbohydrate structures has the advantage of a high stereoselectivity and regioselectivity, rendering the glycosyltransferases a valuable tool for the modification or synthesis of glycoproteins, glycolipids and oligosaccharides. In contrast to chemical methods the time-consuming introduction of protective groups is superfluous.

As glycosyltransferases are naturally occurring in very low amounts, isolation from natural sources and subsequent purification are difficult. Therefore, production using L. I r ILt '4~ j:

E!

II:

~.a Fl;: -2recombinant DNA technology has been worked on. For example, galactosyltransferases have been expressed in E. coli (PCT 90/07000) and Chinese hamster ovary (CHO) cells (Smith, D.F.et al.. (1990) J. Biol.Chem.265,6225-34), sialyltransferases have been expressed in CHO cells (Lee, E.U. (1990)Diss.Abstr.Int.B.50,3453-4) and COS-1 cells (Paulsen,J.C.et al.(1988)J.Cell.Biol.107,10A), and fucosyltransferases have been produced in COS-1 cells(Goelz,S.E.et al.(1990)Cell 63,1349-1356;Larsen R.D.et al.(1990)Proc.Natl.Acad.Sci.USA 87,6674-6678) and CHO cells (Potvin,B.(1990)J.Biol.Chem.265,1615-1622). Considering the facts that heterologous expression in prokaryotes has the disadvantage of providing unglycosylated products, glycosyl-transferases, however, being glycoproteins, and that glycosyltransferase production by use of mammalian hosts is very expensive as well as complicated due to the presence of many endogenous glycosyltransferases which would contaminate the desired product, there is a need for improved methods which render possible the economic production of glycosyltransferases on a large scale.

It is an object of the present invention to provide such methods.

The present invention provides a process for the production of biologically active 20 glycosyltransferases by a recombinant DNA technology using a yeast vector expression system.

More specifically, the present invention provides a process for the production of a membrane-bound glycosyltransferase selected from the group consisting of a galactosyltransferase, a sialyltransferase and a fucosyltransferase, or a variant thereof, respectively, wherein the variant differs from the corresponding full-length glycolyltransferase by lack of the cytoplasmic tail,, the signal anchor and, optionally, a minor part of the stem region, said process comprising culturing a yeast strain which has been transformed with a hybrid vector comprising an expression cassette comprising a promoter and a DNA sequence coding for said glycosyltransferase or variant which DNA is controlled by said promoter, and recovering the enzymatic activity.

i 1 fe ll i~u In a first embodiment, the invention relates to a process for the production of a F L. -C i 4. _I I i.,

~I

i., 2a membrane-bound glycosyltransferase selected from the group consisting of a galactosyltransferase, a sialyltransferase and a fucosyltransferase, or a variant thereof, respectively, said process comprising culturing a yeast strain which has been transformed with a hybrid vector comprising an expression cassette comprising a promoter, a DNA sequence coding for said glycosyltransferase or variant which DNA sequence is controlled by said promoter, and a DNA sequence containing yeast transcription termination signals, and r r 1t t t I f t il t t 4 t t t t t tt i ~ir rr f- t t t i rrcr r t 1.

r t ii :1 4 -I 71'"1,-m I I' 6_ 1

I

j: i recovering the enzymatic activity.

Irr -a In a second embodiment, the invention relates to a process for the production of a membrane-bound glycosyltransferase selected from the group consisting of a galactosyltransferase, a sialyltransferase and a fucosyltransferase, or a variant thereof, respectively, said process comprising culturing a yeast strain which has been transformed with a hybrid vector comprising an expression cassette comprising a promoter operably linked to a first DNA sequence encoding a signal peptide linked in the proper reading frame to a second DNA sequence coding for said glycosyltransferase or variant, and a DNA sequence containing yeast transcription termination signals, and recovering the enzymatic activity.

The term "glycosyltransferase" whenever used hereinbefore or hereinafter is intended to embrace the family of galactosyltransferases, the family of sialyltransferases and the family of fucosyltransferases. Said glycosyltransferases are naturally occurring enzymes of mammalian, e.g. bovine, murine, rat and human origin. Preferred are naturally occurring human full-length glycosyltransferases including those enzymes identified hereinafter by their EC-numbers.

The membrane-bound galactosyltransferases and their variants obtainable according to the inventive process catalyse the transfer of a galactose residue from an activated donor, usually a nucleotide activated donor such as uridine diphosphate galactose (UDP-Gal), to a carbohydrate group.

Examples of membrane-bound galactosyltransferases are UDP-Galactose: P-galactoside c(1-3)-galactosyltransferase (EC 2.4.1.151) which uses galactose as acceptor substrate forming an ao(1-3)-linkage and UDP-Galactose: P-N-acetylglucosamine P(1-4)-galactosyltransferase (EC 2.4.1.22) which transfers galactose to N-acetylglucosamine (GlcNAc) forming a P(1-4)-linkage, including variants thereof, respectively. In the presence of a-lactalbumin, said P(1-4)-galactosyltransferase also accepts glucose as an acceptor substrate, thus catalysing the synthesis of lactose.

The most preferred membrane-bound galactosyltransferase is the enzyme having the amino acid sequence depicted in the sequence listing with the SEQ ID NO. 1.

The membrane-bound sialyltransferases and their variants obtainable according to the process of the invention catalyse the transfer of sialic acids (for example N-acetyl 'L i -4neuraminic acid (NeuAc)) from an activated donor, usually a cytidine monophosphate sialic acid (CMP-SA) to a carbohydrate acceptor residue. An example of a membrane-bound sialyltransferase obtainable according to the inventive method is the CMP-NeuAc: p-galactoside oa(2-6)-sialyltransferase (EC 2.4.99.1) which forms the NeuAc-a(2-6)Gal-P(1-4)GlcNAc-sequence common to many N-linked carbohydrate groups.

The most preferred membrane-bound sialyltransferase is the enzyme having the amino acid sequence depicted in the sequence listing with the SEQ ID NO. 3.

The membrane-bound fucosyltransferases and their variants obtainable according to the process of the invention catalyse the transfer of a fucose residue from an activated donor, usually a nucleotide-activated donor, such as guanosine diphosphate fucose (GDP-Fuc), to i a carbohydrate group. Examples of such fucosyltransferases are GDP-Fucose:p-galactoside a(1-2)-fucosyltransferase (EC 2.4.1.69) and GDP-Fucose:N-acetylglucosamine ac(1-3/4)-fucosyltransferase (EC 2.4.1.65).

The most preferred membrane-bound fucosyltransferase is the enzyme having the amino acid sequence depicted in the sequence listing with SEQ ID NO. The term variants as used herein is intended to embrace both membrane-bound and soluble variants of the naturally occurring membrane-bound glycosyltransferases of mammalian origin with the provision that these variants are enzymatically active.

SPreferred are variants of human origin.

For example, the term "variants" is intended to include naturally occurring membrane-bound variants of membrane-bound glycosyltransferases found within a S* particular species, e.g. a variant of a galactosyltransferase which differs from the enzyme Shaving the amino acid sequence With the SEQ ID NO. 1 in that it lacks serine in position 11 and has the amino acids valine and tyrosine instead of alanine and leucine in positions 31 and 32, respectively. Such a variant may be encoded by a related gene of the same gene family or by an allelic variant of a particular gene. The term "variants" also embraces glycosyltransferases produced from a DNA which has been subjected to in vitro mutagenesis, with the provision that the protein encoded by said DNA has the enzymatic activity of the native glycosyltransferase. Such modifications may consist in an addition, exchange and/or deletion of amino acids, the latter resulting in shortened variants.

IS

Si Preferred variants prepared according to the process of the invention are shortened variants, particularly soluble variants, i.e. variants which are not membrane-bound.

Shortened variants include for example soluble forms of membrane-bound glycosyltransferases and their membrane-bound variants, e.g. those variants mentioned above, which are secretable by a transformed yeast strain used in the process according to the invention. According to the present invention, these soluble enzymes are the preferred truncated variants.

The invention also relates to a process for the production of a soluble variant of a membrane-bound glycosyltransferase selected from the group consisting of a galactosyltransferase, a sialyltransferase and a fucosyltransferase, said process comprising culturing a yeast strain which has been transformed with a hybrid vector comprising an expression cassette comprising a promoter operably linked to a first DNA sequence encoding a signal peptide linked in the proper reading frame to a second DNA sequence coding for said variant, and a DNA sequence containing yeast transcription termination signals, and isolating said variant.

By definition the soluble form of a glycosyltransferase is a shortened variant differing from the corresponding full-length, i.e. the membrane-bound form naturally located in the S* endoplasmic reticulum or the Golgi complex, by lack of the cytoplasmic tail, the signal-anchor and, optionally, part of the stem region. The term "part of the stem" region as used herein is defined to be a minor part of the N-terminal side of the stem region consisting of up to 12 amino acids. In other words, the soluble variants prepared according to the process of the present invention consist of essentially the whole stem region and the catalytic domain.

I The soluble variants are enzymatically active enzymes differing from the corresponding full-length forms by the absence'of an NH 2 -terminal peptide consisting of 26 to 67, particularly 26 to 61, amino acid residues, with the provision that those forms lacking part of the stem region only lack the above-defined minor part therof. Preferred are soluble variants obtainable from the membrane-bound glycosyltransferases identified hereinbefore by their EC-numbers and additionally soluble variants obtainable from the membrane-bound fucosyltransferase with SEQ. ID NO. 5. Preferred soluble variants of galactosyltransferases are distinct from the corresponding

ZI

i ao 0 0ft p -6full-length forms in that they lack an NH 2 -terminal peptide consisting of 37 to particularly 41 to 44, amino acids. The most preferred soluble variant prepared according to the inventive process is the enzyme having the amino acid sequence depicted in the sequence listing with the SEQ ID NO. 2.

Preferred soluble variants of sialyltransferases miss an NH 2 -terminal peptide consisting of 26 to 38 amino acids compared to the full length form. The most preferred soluble variant prepared according to the inventive process is the enzyme having the amino acid sequence depicted in the sequence listing with the SEQ ID NO. 4. Likewise preferred is the soluble variant designated ST(Lys 27 -Cys 40 6 consisting of the amino acids 27 to 406 of the amino acid sequence listed in SEQ ID NO. 3.

Preferred soluble variants of fucosyltransferases differ from the corresponding full-length enzymes in that they lack an NH 2 -terminal peptide consisting of 56 to 67, particularly 56 to 61, amino acids. Especially preferred is the soluble variant designated FT(Arg 62 -Arg 405 consisting of the amino acids 62 to 405 of the amino acid sequence listed in SEQ ID NO. The yeast host strains and the constituents of the hybrid vectors are those specified below.

The transformed yeast strains are cultured using methods known in the art.

Thus, the transformed yeast strains according to the invention are cultured in a liquid medium containing assimilable sources of carbon, nitrogen and inorganic salts.

Various carbon sources are usable. Examples of preferred carbon sources are assimilable carbohydrates, such as glucose, maltose, mannitol, fructose or lactose, or an acetate such as sodium acetate, which can be used either alone or in suitable mixtures. Suitable nitrogen sources include, for example, amino acids, such as casamino acids, peptides and proteins and their degradation products, such as tryptone, peptone or meat extracts, furthermore yeast extract, malt extract, corn steep liquor, as well as ammonium salts, such as ammonium chloride, sulphate or nitrate which can be used either alone or in suitable mixtures. Inorganic salts which may be used include, for example, sulphates, chlorides, phosphates and carbonates of sodium, potassium, magnesium and calcium. Additionally, the nutrient medium may also contain growth promoting substances. Substances which promote growth include, for example, trace elements, such as iron, zinc, manganese and C p 144.

t 8* ft 8 L. i- i- i" i r:; ~~4 -7the like, or individual amino acids.

a..

o t Due to the incompatibility between the endogenous two-micron DNA and hybrid vectors carrying its replicon, yeast cells transformed with such hybrid vectors tend to lose the latter. Such yeast cells have to be grown under selective conditions, i.e. conditions which require the expression of a plasmid-encoded gene for growth. Most selective markers currently in use and present in the hybrid vectors according to the invention (infra) are genes coding for enzymes of amino acid or purine biosynthesis. This makes it necessary to use synthetic minimal media deficient in the corresponding amino acid or purine base. However, genes conferring resistance to an appropriate biocide may be used as well a gene conferring resistance to the amino-glycoside G418]. Yeast cells transformed with vectors containing antibiotic resistance genes are grown in complex media containing the corresponding antibiotic whereby faster growth rates and higher cell densities are reached.

Hybrid vectors comprising the complete two-micron DNA (including a functional origin of replication) are stably maintained within strains of Saccharomyces cerevisiae which are devoid of endogenous two-micron plasmids (so-called ciro strains) so that the cultivation can be carried out under non-selective growth conditions, i.e. in a complex medium.

Yeast cells containing hybrid plasmids with a constitutive promoter express the DNA encoding a glycosyltransferase, or a variant thereof, controlled by said promoter without induction. However, if said DNA is under the control of a regulated promoter the :-mposition of the growth medium has to be adapted in order to obtain maximum levels of mRNA transcripts, e.g. when using the PH05 promoter the growth medium must contain a low concentration of inorganic phosphate for derepression of this promoter.

The cultivation is carried out by employing conventional techniques. The culturing conditions, such as temperature, pH of the medium and fermentation time are selected in such a way that maximal levels of the heterologous protein are produced. A chosen yeast strain is preferably grown under aerobic conditions in submerged culture with shaking or stirring at a temperature of about 250 to 35 0 C, preferably at about 28 0 C, at a pH value of from 4 to 7, for example at approximately pH 5, and for at least 1 to 3 days, preferably as long as satisfactory yields of protein are obtained.

After expression in yeast the glycosyltransferase, or its variant, is either accumulated inside the cells or secreted into the culture medium and is isolated by conventional means.

i' i- I 1 -8- For example, the first step usually consists in separating the cells from the culture fluid by centrifugation. In case the glycosyltransferase, or its variant, has accumulated within the cells, the protein has to be liberated from the cell interior by cell disruption. Yeast cells can be disrupted in various ways well-known in the art: e.g. by exerting mechanical forces such as shaking with glass beads, by ultrasonic vibration, osmotic shock and/or by enzymatic digestion of the cell wall. In case the glycosyltransferase, or its variant, to be isolated is associated with or bound to a membranous fraction, further enrichment may be achieved for example by differential centrifugation of the cell extract and, optionally, subsequent treatment of the particular fraction with a detergent, such as Triton. Methods suitable for the purification of the crude glycosyltransferase, or the variant thereof include standard chromatographic procedures such as affinity chromatography, for example with a suitable substrate, antibodies or Concanavalin A, ion exchange chromatography, gel filtration, partition chromatography, HPLC, electrophoresis, precipitation steps such as ammonium sulfate precipitation and other processes, especially those known from the 4.44 literature.

In case the glycosyltransferase, or its variant, is secreted by the yeast cell into the periplasmic space, a simplified isolation protocol can be used: the protein is recovered without cell lysis by enzymatic removal of the cell wall or by chemical agents, e.g. thiol reagents or EDTA, which gives rise to cell wall damages permitting the produced glycosyltransferase to be released. In case the glycosyltransferase, or its variant, is secrected into the culture broth, it can be recovered directly therefrom and be purified using the methods specified above.

In order to detect glycosyltransferase activity assays known from the literature can be S. used. For example, galactosyltransferase activity can be measured by determing the amount of radioactively labelled galactose incorporated into a suitable acceptor molecule such as a glycoprotein or a free sugar residue. Analogously, sialyltransferase activity may -be assayed e.g. by the incorporation of sialic acid into suitable substrates, and fucosyltransferase activity can be assayed by the transfer of fucose to a suitable acceptor.

The transformed yeast host cells according to the invention can be prepared by recombinant DNA techniques comprising the steps of: preparing a hybrid vector comprising a yeast promoter and a DNA sequence coding for a membrane-bound glycosyltransferase, or a variant thereof, which DNA sequence is L. ii i- 1 .la~ ,I j

I(

II I I us..

44 1 4 4C -9controlled by said promoter, transforming a yeast host strain with said hybrid vector, and selecting transformed yeast cells from untransformed yeast cells.

Expression vectors The yeast hybrid vector according to the invention comprises an expression cassette comprising a yeast promoter and a DNA sequence coding for a membrane-bound glycosyltransferase, or a variant thereof, which DNA sequence is controlled by said promoter.

In a first embodiment, the yeast hybrid vector according to the invention comprises an expression cassette comprising a yeast promoter, a DNA sequence coding for a membrane-bound glycosyltransferase, or a variant thereof, which DNA sequence is controlled by said promoter, and a DNA sequence containing yeast transcription termination signals.

In a second embodiment, the yeast hybrid vector according to the invention comprises an expression cassette comprising a yeast promoter operably linked to a first DNA sequence encoding a signal peptide linked in the proper reading frame to a second DNA sequence encoding a membrane-bound glycosyltransferase, or a variant therof, and a DNA sequence containing yeast transcription termination signals.

The yeast promoter is a regulated or a constitutive promoter preferably derived from a highly expressed yeast gene, especially a Saccharomyces cerevisiae gene. Thus, the promoter of the TRP1 gene, the ADHI or ADHII gene, the acid phosphatase PH05) gene, a promoter of the yeast mating pheromone genes coding for the a- or a-factor or a promoter derived from a gene encoding a glycolytic enzyme such as the promoter of the enolase, glyceraldehyde-3-phosphate dehydrogenase (GAP), 3-phosphoglycerate kinase (PGK), hexokinase, pyruvate decarboxylase, phosihofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase or glucokinase genes can be used. Furthermore, it is possible to use hybrid promoters comprising upstream activation sequences (UAS) of one -sast gene and downstream promoter elements including a functional TATA box of anothcr yeast gene, for example a hybrid promoter including the UAS(s) of the yeast PH05 gene and downstream promoter elements including a functional TATA box of the yeast GAP gene GAP hybrid promcter). A preferred promoter is the promoter of the GAP gene, k: ii I I 1 i x

I-'

I'

9.

iii iii i it

II

Ci t CC11 especially functional fragments thereof starting at nucleotides between positions -550 and -180, in particular at nucleotide -540, -263 or -198, and ending at nucleotide -5 of the GAP gene. Another preferred promoter of the regulated type is the PH05 promoter. As a constitutive promoter a shortened acid phosphatase PH05 promoter devoid of the upstream regulatory elements (UAS) is preferred as is the PH05 (-173) promoter element arting at nucleotide -173 and ending at nucleotide -9 of the PH05 gene.

The DNA sequence encoding a signal peptide ("signal sequence") is preferably derived from a yeast gene coding for a polypeptide which is ordinarily secreted. Other signal sequences of heterologous proteins, which are ordinarily secreted can also be chosen.

Yeast signal sequences are, for example, the signal and prepro sequences of the yeast invertase, a-factor, pheromone peptidase (KEX1), "killer toxin" and repressible acid phosphatase (PH05) genes and the glucoamylase signal sequence from Aspergillus awamori. Alternatively, fused signal sequences may be constructed by ligating part of the signal sequence (if present) of the gene naturally linked to the promoter used (for example with part of the signal sequence of another heterologous protein. Those combinations are favoured which allow a precise cleavage between the signal sequence and the glycosyltransferase amino acid sequence. Additional sequences, such as pro- or spacersequences which may or may not carry specific processing signals can also be included in the constructions to facilitate accurate processing of precursor molecules. Alternatively, fused proteins can be generated containing internal processing signals which allow proper maturation in vivo or in vitro. For example, the processing signals contain Lys-Arg, which is recognized by a yeast endopeptidase located in the Golgi membranes. The preferred signal sequence according to the present invention is that of the yeast invertase gene.

If a full-length glycosyltransferase, or a membrane-bound variant thereof, is expressed in yeast, the preferred yeast hybrid vector comprises an expression cassette comprising a yeast promoter, a DNA sequence encoding said glycosyltransferase or variant, which DNA sequence is controlled by said promoter, and a DNA sequence containing yeast transcription termination signals. If the DNA encodes a membrane-bound enzyme there is no need for an additional signal sequence.

In case a soluble variant of a membrane-bound glycosyltransferase is expressed in yeast, the preferred yeast hybrid vector comprises an expression cassette comprising a yeast promoter operably linked to a first DNA sequence encoding a signal peptide linked in the proper reading frame to a second DNA sequence encoding said variant and a DNA 3 L U1UI VY l~vuC, 1 i- -11 sequence containing yeast transcription termination signals.

DNA encoding a membrane-bound glycosyltransferase, or a variant thereof, can be prepared by methods known in the art and comprises genomic DNA, e.g. isolated from a mammalian genomic DNA library, e.g. from rat, murine, bovine or human cells. If necessary, the introns occurring in genomic DNA encoding the enzyme are deleted.

Furthermore, DNA encoding a membrane-bound glycosyltransferase, or a variant thereof, comprises cDNA which can be isolated from a mammalian cDNA library or produced from the corresponding mRNA. The cDNA library may be derived from cells from different tissues, e.g. placenta cells or liver cells. The preparation of cDNA via the mRNA route is achie"ePd using conventional methods such as the polymerase chain reaction

(PCR).

.For example, isolation of poly(A)+RNA from mammalian cells, e.g. HeLa cells, and subsequent first strand cDNA synthesis are performed following standard procedures known 'in the art. Starting from this synthesized DNA template, PCR can be used to amplify the w4 Itargeted sequence, i.e. the glycosyltransferase DNA or a fragment thereof, while the amplification of the numerically overwhelming nontarget sequences is minimized. For this purpose, the sequence of a small stretch of nucleotides on each side of the target sequence Smust be known. These flanking sequences are used to design two synthetic single-stranded primer oligonucleotides the sequence of which is chosen so that each has basepair complementarity with its respective flanking sequence. PCR starts by denaturing of the mRNA- DNA hybrid strand, followed by annealing the primers to the sequences flanking the i target. Addition of a DNA polymerase and desoxynucleoside triphosphates causes two pieces of double-stranded DNA to form, each beginning at the primer and extending S across the target sequence, thereby copying the latter. Each of the newly synthesized products can serve as templates for primer annealing and extensions (next cycle) thus leading to an exponential increase in double-stranded fragments of discrete length.

Furthermore, DNA encoding a membrane-bound glycosyltransferase, or a variant thereof, can be enzymatically or chemically synthesized. A variant of a membrane-bound glycosyltransferase having enzymatic activity and an amino acid sequence in which one or more amino acids are deleted (DNA fragments) and/or exchanged with one or more other amino acids, is encoded by a mutant DNA. Furthermore, a mutant DNA is intended to include a silent mutant wherein one or more nucleotides are replaced with other nucleotides with the new codons coding for the same amino acid(s). Such a mutant -12sequence is also a degenerated DNA sequence. Degenerated DNA sequences are degenerated within the meaning of the genetic code in that an unlimited number of nucleotides are replaced by other nucleotides without resulting in a change of the amino acid sequence originally encoded. Such degenerated DNA sequences may be useful due to their different restriction sites and/or frequency of particular codons which are preferred by the specific host to obtain optimal expression of a glycosyltransferase or a variant thereof. Preferably, such DNA sequences have the yeast preferred codon usage.

A mutant DNA can also be obtained by in vitro mutation of a naturally occurring genomic DNA or a cDNA according to methods known in the art. For example, the partial DNA coding for a soluble form of a glycosyltransferase may be excised from the full-lefgth DNA coding for the corresponding membrane-bound glycosyltransferase by using restriction enzymes. The availability of an appropriate restriction site is advantageous S therefor.

*4 ~-12- A DNA sequence containing yeast transcription termination signals is preferably the 3' flanking sequence of a yeast gene which contains proper signals for transcription termination and polyadenylation. Suitable 3' flanking sequences are for example those of the yeast gene naturally linked to the promoter used. The preferred flanking sequence is that of the yeast PH05 gene.

The yeast promoter, the optional DNA sequence coding for the signal peptide, the DNA sequence coding for a membrane-bound glycosyltransferase, or a variant thereof, and the DNA sequence containing yeast transcription termination signals are operably linked in a tandem array, i.e. they are juxtaposed in such a manner that their normal functions are maintained. The array is sich that the promoter effects proper expression of the DNA sequence encoding a membrane-bound glycosyltransferase, or a variant thereof, (optionally preceded by a signal sequence), the transcription termination signals effect proper termination of transcription and polyadenylation and the optional signal sequence is linked in the proper reading frame to the above-mentioned DNA sequence in such a manner that the last codon of the signal sequence is directly linked to the first codon of said DNA sequence and secretion of the protein occurs. If the promoter and the signal sequence are derived from different genes, the promoter is preferably joined to the signal sequence at a site between the major mRNA start and the ATG of the gene ilaturally linked to the promoter. The signal sequence should have its own ATG for translation initiation. The junction of these sequences may be effected by means of synthetic saidDNAseqenc an sereton f te potei ocurs Iftheproote an th sinal!! se ue c are .from" n genes, L2. th pr mo e is rbl e t- th -ina 5020 c r r I LI- u: I

S.

I *5*5 *54* *1 f .5 5 A ~i 11 13oligodeoxynucleotide linkers carrying the recognition sequence of an endonuclease.

Vectors suitable for replication and expression in yeast contain a yeast replication origin.

Hybrid vectors that contain a yeast replication origin, for example the chromosomal autonomously replicating segment (ars), are retained extrachromosomally within the yeast cell after transformation and are replicated autonomously during mitosis. Also, hybrid vectors that contain sequences homologous to the yeast 2j plasmid DNA can be used.

Such hybrid vectors are integrated by recombination in 24 plasmids already present within the cell, or replicate autonomously.

Preferably, the hybrid vectors according to the invention include one or more, especially one or two, selective genetic markers for yeast and such a marker and an origin of replication for a bacterial host, especially Escherichia coli.

As to the selective gene markers for yeast, any marker gene can be used which facilitates the selection for transformants due to the phenotypic expression of the marker gene.

Suitable markers for yeast are, for example, those expressing antibiotic resistance or, in the case of auxotropnic yeast mutants, genes which complement host lesions.

Corresponding genes confer, for example, resistance to the antibiotics G418, hygromycin or bleomycin or provide for prototrophy in an auxotrophic yeast mutant, for example the URA3, LEU2, LYS2 or TRP1 gene.

As the amplification of the hybrid vectors is conveniently done in E. coli, an E. coli genetic marker and an E. coli replication origin are included advantageously. These can be obtained from E. coli plasmids, such as pBR322 or a pUC plasmid, for example pUC18 or pUC19, which contain both E. coli replication origin and E. coli genetic marker conferring resistance to antibiotics, such as ampicillin.

The hybrid vectors according to the invention are prepared by methods known in the art, for example by linking the expression cassette comprising a yeast promoter and a DNA sequence coding for a glycosyltransferase, or a variant thereof, which DNA sequence is controlled by said promoter, or the several constituents of the expression cassette, and the DNA fragments containing selective genetic markers for yeast and for a bacterial host and origins of replication for yeast and for a bacterial host in the predetermined order.

The hybrid vectors of the invention are used for the transformation of the yeast strains -14described below.

Yeast strains and transformation thereof Suitable yeast host organisms are strains of the genus Saccharomyces, especially strains of Saccharomyces cerevisiae. Said yeast strains include strains which, optionally, have been cured of endogenous two-micron plasmids and/or which optionally lack yeast peptidase activity(ies), e.g. peptidase yscoc, yscA, yscB, yscY and/or yscS activity.

The invention concerns furthermore a yeast strain which has been transformed with a hybrid vector comprising an expression cassette comprising a yeast promoter and a DNA 4 sequence coding for a membrane-bound glycosyltransferase, or a variant therof, which DNA is controlled by said promoter.

In a first embodiment, the yeast strain according to the invention has been transformed with a hybrid vector comprising an expression cassette comprising a yeast promoter, a DNA sequence coding for a membrane-bound glycosyltransferase, or a variant thereof, which DNA sequence is controlled by said promoter, and a DNA sequence containing yeast transcription termination signals.

In a second embodiment, the yeast strain according to the invention has been transformed o with a hybrid vector comprising an expression cassette consisting of a yeast promoter operably linked to a first DNA sequence encoding a signal peptide linked in the oroper S. reading frame to a second DNA sequence encoding a membrane-bound glycosyltransferase, or a variant thereof, and a DNA sequence containing yeast transcription termination signals.

son The yeast strains of the invention are used for the preparation of a membrane-bound f glyeosyitransferase or a variant thereof.

The transformation of yeast with the hybrid vectors according to the invention is accomplished by methods known in the art, for example according to the methods described by Hinnen et al. (Proc. Natl. Acad. Sci. USA (1978) 75, 1929) and Ito et al.

Bact. (1983) 153, 163-168).

The membrane-bound glycosyltransferases, and the variants thereof, prepared by the process according to the invention can be used in a manner known per se, e.g. for the i- r" C1:- l. c~ sii;!:I o o o r D c r rr o r o r o ir o i~ synthesis and/or modification of glycoproteins, oligosaccharides and glycolipids (US Patent 4,925,796; EP Application 414 171).

The invention concerns especially the method for the production of membrane-bound glycosyltransferases, and variants therof, the hybrid vectors, the transformed yeast strains, and the glycosyltransferases obtainable according to the inventive process, as described in the Examples.

In the Examples, the following abbreviations are used: GT galactosyltransferase (EC 2.4.1.22), PCR L polymerase chain reaction; ST sialyltransferase (EC 2.4.99.1); FT= fucosyltransferase.

Example 1: Cloning of the galactosyltransferase (GT) cDNA from HeLa cells GT cDNA is isolated from HeLa cells (Watzele, G. and Berger, E.G. (1990) Nucleic Acids Res. 18, 7174) by the polymerase chain reaction (PCR) method: 1.1 Preparation of poly(A)+RNA from HeLa cells For RNA preparation HeLa cells are grown in monolayer culture on 5 plates (23x23 cm).

The rapid and efficient isolation of RNA from cultured cells is performed by extraction with guanidine-HC1 as described by Mac Donald, R.J. et al (Meth. Enzymol. (1987) 152, 226-227). Generally, yields are about 0.6 1 mg total RNA per plate of confluent cells.

Enrichment of poly(A)'RNA is achieved by affinity chromatography on oligo(dT)-cellulose according to the method described in the Maniatis manual (Sambrook, Fritsch, E.F.

and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual (2nd edition), Cold Spring Harbor Laboratory Press, Cold Spring Habor, USA), applying 4 mg of total RNA on a 400 4l column. 3 of the loaded RNA are recovered as enriched poly(A)+RNA which is stored in aliquots precipitated with 3 volumes of ethanol at -70 0 C until it is used.

1.2 First strand cDNA synthesis for PCR Poly(A)+RNA (mRNA) is reverse-transcribed into DNA by Moloney Murine Leukemia Virus RNase H- Reverse Transcriptase (M-MLV H- RT) (BRL). In setting up the 20 tl reaction mix, the protocol provided by BRL is followed with minor variations: 1 gg of HeLa cell poly(A)+RNA and 500 ng Oligo(dT) 1 2 -18 (Pharmacia) in 11.5 il sterile H 2 0 are heated to 70 0 C for 10 min and then quickly chilled on ice. Then 4 pl reaction buffer o eel e oa.

.1

{LS

tl tX _Il jaI.

j i-' 'i: i

)-A

i:*p~tr: ii i :r I I 16provided by BRL (250 mM Tris-HCl pH 8.3, 375 mM KC1, 15 mM MgCl 2 2 gl 0.1 M dithiothreitol, 1 1l mixed dNTP (10 mM each dATP, dCTP, dGTP, TTP, Pharmacia), pl (17.5 U) RNAguard (RNase Inhibitor of Pharmacia) and 1 gl (200 U)M-MLVH- RT are added. The reaction is carried out at 42 0 C and stopped after 1 h by heating the tube to 0 C for 10 min.

In order to check the efficiency of the reaction an aliquot of the mixture (5 gl) is incubated in the presence of 2 utCi oa- 32 P dCTP. By measuring the incorporated dCTP, the amount of cDNA synthesizeJ is calculated. The yield of first strand synthesis is routinely between and 15 1.3 Polymerase chain reaction The oligodeoxynucleotide primers used for PCR are synthesized in vitro by the phosphoramidite method Caruthers, in Chemical and Enzymatic Synthesis of Gene Fragments, H.G. Gassen and A. Lang, eds., Verlag Chemie, Weinheim, FRG) on an Applied Biosystems Model 380B synthesizer. They are listed in Table 1.

Table 1: PCR-primers o a c n o a

A

r r

I

R"

r

I

r primer sequence to 3')1) corresponding to bp in GT cDNA 2 Plup (KpnI) cgcggtACCCTTCTTAAAGCGGCGGCGGGAAGATG P1 (EcoRI) gccgaattcATGAGGCTTCGGGAGCCGCTCCTGAGCG P3 (SacI) CTGGAGCTCGTGGCAAAGCAGAACCC 3 1- 28 448- 473 P2d (EcoRI) gccgaaTTCAGTCTCTTATCCGTGTACCAAAACGC CTA 1222 1192 P4 (HindIII) cccaagctTGGAATGATGATGGCCACCTTGTGAGG 546- 520 1) Capital letters represent sequences from GT, small letters are additional sequences, sites for restriction enzymes are underlined. Codons for 'start' and 'stop' of RNA translation are highlighted in boldface.

2) GT cDNA sequence from human placenta as published in GenBank (Accession Nr. M22921).

Standard PCR-conditions for a 30 pl incubation mixture are: 1 p1 of the Reverse Transcriptase reaction (see Example containing about 5 ng first strand cDNA, 15 pmol each of the relevant primers, 200 tmol each of the four deoxynucleoside triphosphates (dATP, dCTP, dGTP and TIP) in PCR-buffer (10 mM Tris-HCl pH 8.3 (at 23 0 50 mM I I -I I ri at 1t- 17o 00,e

S

S C~o KC1, 1.5 mM MgC12, 0.001 gelatine) and 0.5 U AmpliTaq Polymerase (Perkin Elmer).

The amplification is performed in the Thermocycler 60 (Biomed) using the following conditions: 0.5 min denaturing at 95 0 C, 1 min annealing at 56 0 C, and 1 min 15 sec extension at 72 0 C, for a total of 20 25 cycles. In the last cycle, primer extension at 72 0 C is carried out for 5 min.

For sequencing and subcloning, the HeLa GT cDNA is amplified in two overlapping pieces, using different primer combinations: Fragment P1 -P4: Primers Pl and P4 are used to amplify a 0.55 kb DNA fragment covering nucleotide positions 7-556 in HeLa GT cDNA (SEQ ID NO. 1) Fragment P3 P2d: Primers P3 and P2d are used to amplify a 0.77 kb fragment covering nucleotide positions 457 1232 (SEQ ID NO. 1).

In order to avoid errors during amplification four independent PCRs are carried out for each fragment. Also primer Plup (KpnI) in combination with primer P4 is used to determine the DNA sequence followed by the 'start' codon.

After PCR amplification, fragment P1 P4 is digested with the restriction enzymes EcoRI and HindIII, analysed on a 1.2 agarose gel, eluted from the gel by GENECLEAN (BIO 101) and subcloned into the vector pUC18 (Pharmacia), digested with the same enzymes. Fragment P3 P2d is digested with SacI and EcoRI, analysed on a 1.2 gel, eluted and subcloned into pUC18, digested with SacI and EcoRI. The resulting subclones are pUC18/P1 P4 and pUC18/P3 P2d, respectively. For subcloning, ligation and transformation of E. coli strain DH5c, standard protocols are followed as described in Example 2. Minipreparations of Plasmids pUC18/P1 P4 and pUC18/P3 P2d are used for dideoxy-sequencing of denatured double-stranded DNA with the T7 polymerase Sequencing kit (Pharmacia). M13/pUC sequencing primers and reverse sequencing primers (Pharmacia) are applied to sequence overlapping fragments produced from both DNA strands by digestion with various restriction enzymes. Further subcloning of restriction fragments of the GT gene is necessary for extensive sequencing of overlapping fragments of both strands. The sequence of fragments amplified by independent PCRs shows that the error of amplification is less than 1 in 3000 nucleotides. The complete nucleotide sequence of the HeLa cell GT cDNA which is presented in SEQ ID NO. 1 is 99.2 homologous to that of human placenta (Genbank Accession No. M22921). Three differences are found: ;,uiange anc/or deletion of amino acids, the latter resulting in shortened variants.

I U- t, ~"lc" t 1

I

I

r r ri rcr r: :rf rrr it rr c -18- Three extra base pairs at nucleotide positions 37-39 (SEQ ID NO. 1) resulting in one extra amino acid (Ser) in the N-terminal region of the protein; bp 98 to 101 are 'CTCT' instead of 'TCTG' in the sequence of human placenta, leading to two conservative amino acid substitutions (Ala Leu instead of ValTyr) at amino acid positions 31 and 32 in the membrane spanning domain of GT; the nucleotide at position 1047 is changed from to without ensuing a change in amino acid sequence.

The two overlapping DNA-fragments P1 P4 and P3 P2d encoding the HeLa GT cDNA are joined via the NotI restriction site at nucleotide position 498 which is present in both fragments.

The complete HeLa cell GT cDNA (SEQ ID No. 1) is cloned as a 1.2 kb EcoRI-EcoRI restriction fragment in plasmid pIC-7, a derivative of pUC8 with additional restriction sites in the multicloning site (Marsh, Erfle, M. and Wykes, E.J. (1984) Gene 32, 481-485), resulting in vector p4AD113. For the purpose of creating the GT expression cassette the EcoRI restriction site (bp 1227) at the 3' end of the cDNA sequence is deleted as follows: vector p4AD113 is first linearized by digestion with EcoRV and then treated with alkaline phosphatase. Furthermore, 1 gg of the linearised plasmid DNA is partially digested with 0.25 U EcoRI for 1 h at 37 0 C. After agarose gel electrophoresis a fragment corresponding to the size of the linearized plasmid (3.95 kb) is isolated from the gel by GENECLEAN (Bio 101). The protruding EcoRI end is filled in with Klenow polymerase as described in.the Maniatis manual (supra). After phenolisation and ethanol precipitation the plasmid is religated and used to transform E. coli DH5a (Gibco/BRL). Minipreparation of plasmids are prepared from six transformants. The plasmids obtained are checked by restriction analysis for the absence of the EcoRI and EcoRV restriction sites at the 3' end of HeLa GT cDNA. The plasmid designated p4AE113 is chosen for the following experiments, its DNA sequence being identical to that of plasmid p4AD113, with the exception that bp 1232-1238 with the EcoRI-EcoRV restriction sites are deleted.

Example 2: Construction of expression cassettes for full length GT For heterologous expression in Saccharomyces cerevisiae the full length HeLa GT cDNA sequence (SEQ ID NO. 1) is fused to transcriptional control signals of yeast for efficient initiation and termination of transcription. The promoter and terminator sequences originate from the yeast acid phosphatase gene (PH05) (EP 100561). The full-length promoter is regulated by the supply of inorganic phosphate in the culture medium. High Pi c E I t t S I t t. j -19concentrations lead to promoter repression whereas low P; acts by induction.

Alternatively, a short, 173 bp PH05 promoter fragment is used, which is devoid of all regulatory elements and therefore behaves as a constitutive promoter.

2.1 Construction of a phosphate inducible expression cassette The GT cDNA sequence is combined with the yeast PH05 promoter and transcription terminator sequences as follows: Full length HeLa GT cDNA sequence: Vector p4AE113 with the full length GT cDNA sequence is digested with the restriction enzymes EcoRI and BglII. The DNA fragments are electrophoretically separated on a 1 agarose gel. A 1.2 kb DNA fragment containing the complete cDNA sequence for HeLa GT is isolated from the gel by adsorption to glasmilk, using the GENECLEAN kit (BIO 101). On this fragment the 'ATG' start codon for protein synthesis of GT is located directly behind the restriction site for EcoRI, whereas the stop codon 'TAG' is followed by 32 bp contributed by the 3'untranslated region of HeLa GT and the multiple cloning site of the vector with the BglII restriction site.

Vector for amplification in E. coli: The vector for amplification, plasmid p31R (cf. EP 100561), a derivative of pBR322, is digested with the restriction enzymes BamHI and Sail. The restriction fragments are separated on a 1 agarose gel and a 3.5 kb vector fragment is isolated from the gel as "described before. This DNA fragment contains the large Sall HindIII vector fragment of the pBR322 derivative as well as a 337 bp PH05 transcription terminator sequence in place of the HindIII BamHI sequence of pBR322.

Sequence for the inducible PH05 promoter: The PH05 promoter fragment containing the regulatory elements (UASp) for phosphate induction is isolated from plasmid p31R (cf. EP 100561) by digestion with the restriction enzymes SalI and EcoRI. The 0.8 kb Sall EcoRI DNA fragment comprises the 276bp Sail BamHI pBR322 sequence and the 534 bp BamHI-EcoRI PH05 promoter fragment with the EcoRI linker (5'-GAATTC-3') introduced at position -8 of the PH05 promoter sequence.

Construction of plasmid pGTA 1132 The three DNA fragments to are ligated in a 12 tl ligation mixture: 100 ng of DNA I- I I -1

I

~I

C.

r r j I"

I

I a rro oe r r r e cr o r ror ri

D

r o o r~ i rol rt ii ii fragment and 30 ng each of fragments and are ligated using 0.3 U T4 DNA ligase (Boehringer) in the supplied ligase buffer (66 mM Tris-HCl pH 7.5, 1 mM dithioerythritol, 5 mM MgC12, 1 mM ATP) at 15 0 C for 18 hours.

Half of the ligation mix is used to transform competent cells of E. coli strain (Gibco/BRL). For preparing competent cells and tor transformation, the standard protocol as given in the Maniatis manual (supra) is followed. The cells are plated on selective LB-medium, supplemented with 75 ugg/ml ampicillin and incubated at 37 0 C. About 120 transformants are obtained. Minipreparations of plasmid are performed from six independent transformants by using the modified alkaline lysis protocol of Birnboim, H.C. and Doly, J. as described in the Maniatis manual (supra). The isolated plasmids are characterized by restriction analysis with four different enzymes (EcoRI, PstI, HindIII, SalI, also in combination). All six plasmids show the expected restriction fragments. One of the clones is chosen and referred to as pGTA 1132. Plasmid pGTA 1132 contains the expression cassette with the full-length HeLaGT cDNA under the control of the phosphate regulated PH05 promoter, and the PH05 transcriptional terminator sequence. This expression cassette can be excised from pGTA 1132 as a 2.35 kb Sall HindII fragment, referred to as DNA fragment (1A).

2.2. Construction of a constitutive expression cassette: For the construction of an expression cassette with a constitutive, nonregulated promoter, a 5' truncated PH05 promoter fragment without phosphate regulatory elements is used, which is isolated from plasmid p31/PH05(-173)RIT.

Construction of plasmid p31/PH05(-173)RIT Plasmid p31 RIT12 (EP 288435) comprises the full length, regulated PH05 promoter (with an EcoRI site introduced at nucleotide position -8 on a 534bp BamHI EcoRI fragment, followed by the coding sequence for the yeast invertase signal sequence (72bp EcoRI XhoI) and the PH05 transcription termination signal (135bp XhoI HindIII) cloned in a tandem array between BamHI and HindIII of the pBR322 derived vector.

The constitutive PH05(-173) promoter element from plasmid pJDB207/PH05(-173)-YHIR (EP 340170) comprises the nucleotide sequence of the yeast PH05 promoter from nucleotide position -9 to -173 (BstEII restriction site), but has no upstream regulatory sequences (UASp). The PH05(-173) promoter, therefore, behaves like a constitutive promoter. This example describes the replacement of the regulated PH05 promoter in plasmid p31RIT12 by the short, constitutive PH05 (-173) promoter element in order to 1 I _e I I -21 obtain plasmid p31/PH05 (-173) RIT.

Plasmids p31RIT12 (EP 288435) and pJDB207/PH05(-173)-YHIR (EP 340170) are digested with restriction endonucleases Sail and EcoRI. The respective 3.6 kb and 0.4 kb Sail EcoRI fragments are isolated on a 0.8 agarose gel, eluted from the gel, ethanol precipitated and resuspended in H 2 0 at a concentration of 0.1 pmoles/gl. Both DNA fragments are ligated and 1 ~il aliquots of the ligation mix are used to transform E. coli HB101 (ATCC) competent cells. Ampicillin resistant colonies are grown individually in LB medium supplemented with ampicillin (100 gig/ml). Plasmid DNA is isolated according to the method of Holmes, D.S. et al. (Anal. Biochem. (1981) 144, 193) and analysed by restriction digests with SalI and EcoRI. The plasmid of one clone with the correct restriction fragments is referred to as p31/PH05(-173)RIT.

o a Construction of plasmid pGTB 1135 Plasmid p31/PH05(-173)RIT is digested with the restriction enzymes EcoRI and Sail.

After separation on a 1 agarose gel, a 0.45 kb Sal EcoRI fragment is isolated from the gel by GENECLEAN (BIO 101). This fragment contains the 276 bp SalI-BamHI sequence of pBR322 and the 173bp BamHI(BstEII)-EcoRI constitutive PH05 promoter fragment.

The 0.45 kb SalI-EcoRI fragment is ligated to the 1.2 kb EcoRI BglII GT cDNA a qt (fragment and the 3.5 kb BamHI-SalI vector part for amplification in E. coli with the terminator (fragment described in Example 2.1. Ligation and transformation of "a E. coli strain DH50a are carried out as described above yielding 58 transformants. Plasmids are isolated from six independent colonies by minipreparations and characterized by restriction analysis. All six plasmids show the expected fragments. One correct clone is S referred to as pGTB 1135 and used for further cloning experiments to provide the expression cassette for HeLa GT under the control of the constitutive PH05 (-173) promoter fragment. This expression cassette can be excised from the vector pGTB 1135 as a 2 kb SalI HindIII fragment, referred to as DNA fragment (1B).

Example 3: Construction of the expression vectors pDPGTA8 and The yeast vector used for heterologous expression is the episomal vector pDP34 (11.8 kb) which is a yeast E. coli shuttle vector with the ampicillin resistance marker for E. coli and the URA3 and dLEU2 yeast selective markers. Vector pDP34 (cf. EP 340170) is digested with the restriction enzyme BamHI. The linearized vector is isolated with GENECLEAN and the protruding ends are filled in by Klenow polymerase treatment as described in the Maniatis manual (supra). The reaction is stopped after 30 min by heating L. I i; r ii I i;r Ic: i-

Y

l~n 1 ~1 w 1 -22-

I

II

C

to 65 0 C for 20 min in the presence of 10 mM EDTA. After ethanol precipitation the plasmid is digested with Sall and subjected to gel electrophoresis on a 0.8 agarose gel.

The (BamHI) blunt end-SalI cut vector pDP34 is isolated as an 11.8 kb DNA fragment from the gel with the GENECLEAN kit.

In analogy to the vector preparation plasmids pGTA 1132 and pGTB 1135 are each digested with HindIII. The protruding ends of the linearized plasmids are filled in by Klenow polymerase treatment and subsequently subjected to Sail digestion, resulting in (2A) a 2.35 kb (HindIII)blunt end Sail fragment with the phosphate regulated expression cassette, or (2B) a 2.0 kb (HindIII)blunt end Sail fragment with the constitutive expression cassette.

Ligation of the blunt end-Sail pDP34 vector part with fragment 2A or fragment 2B and transformation of competent cells of E. coli strain DH5c is carried out as described in Example 2 using 80 ng of the vector part and 40 ng of fragment 2A or 2B, respectively. 58 and 24 transformants are obtained, respectively. From each transformation six plasmids are prepared and characterized by restriction analysis. For the construction with the regulated expression cassette (fragment 2A), two plasmids show the expected restriction pattern. One of the clones is chosen and designated pDPGTA8.

For the construction with the constitutive expression cassette (fragment 2B) one plasmid shows the expected restriction pattern, and is designated Example 4: Transformation of S. cerevisiae strain BT 150 CsCl-purified DNA of the expression vectors pDPGTA8 and pDPGTB 5 is prepared following the protocol of R. Treisman in the Maniatis manual (supra). The protease deficient S. cerevisiae strains BT 150 (MAToc, his4, leu2, ura3, pral, prbl, prcl, cpsl) and H 449 (MATa, prbl, cpsl, ura3A5, leu 2-3, 2-112, ciro) are each transformed with 5 gg each of plasmids pDPGTA8, pDPGTB5 and pDP34 (control without expression cassette) according to the lithium-acetate transformation method (Ito, H. et al., supra).

Ura+-transformants are isolated and screened for GT activity (infra). Single transformed yeast cells are selected and referred to as i Saccharomyces cerevisiae BT 150/pDPGTA8 Saccharomyces cerevisiae BT 150/pDPGTB5 Saccharomyces cerevisiae BT 150/pDP34 ,01 1 o' -23- Saccharomyces cerevisiae H 449,'DPGTA8 Saccharimyces cerevisiae H 449/pDPGTB5 Saccharomyces cerevisiae H 449/pDP34 Example 5: Enzyme activity of full-length GT expressed in yeast

B

o e o o c or, r o o.r

D

o ~r ~o r~ r r D D or r r o o rori r r Irrr 1 ri t ri i I 5.1 Preparation of cell extracts Cells of transformed Saccharomvces cerevisiae strains BT 150 and H 449 are each grown under uracil selection in yeast minimal media (Difco) supplemented with histidine and leucine. The growth rate of the cells is not affected by the introduction of any of the expression vectors. Exponentip-v growing cells (at OD 57 8 of 0.5) or stationary cells are collected by centrifugation, washed once with 50 mM Tris-HCl buffer pH 7.4 (buffer 1) and resuspended in buffer 1 at a concentration corresponding to 0.1 0.2 OD 57 8.

Mechanical breakage of the cells is effected by vigorous shaking on a vortex mixer with glass beads (0.45 0.5 mm diameter) for 4 min with intermittent cooling. The crude extracts are used directly for determination of enzyme activity.

Fractionation of cellular components is achieved by differential centrifugation of the extract. First, the extract is centrifuged at 450 g for 5 min; secondly, the supernatant obtained is centrifuged at 20000 g for 45 min.

The supernatant is collected and the pellets are resuspended in buffer 1.

For phosphate induction of GT expression under the control of the inducible promoter, cells of transformants BT 150/pDPGTA8 and H 449/pDPGTA8 are massshifted to low phosphate minimal medium, respectively, (Meyhack, B. et al. Embo J.

(1982) 1, 675-680). The cell extracts are prepared as described above.

5.2 Protein assay The protein concentration is determined by use of the BCA-Protein Assay Kit (Pierce).

5.3 Assay for GT activity GT activity can be measured with radiochemical methods using either ovalbumin, a glycoprotein which solely exposes GlcNAc as acceptor site, or free GlcNAc as acceptor substrates. Cell extracts (of 1 2 ODs 57 of cells) are assayed for 45 or 60 min at 37°C in I- I I Ed -24a 100 Rl incubation mixture containing 100 mM Tris-HC1 pH 7.4, 50 nCi UDP- 1 4 C-Gal (325 mCi/mmol), 80 nmol UDP-Gal, 1 tmol MnC1 2 1 Triton X-100 and 1 mg ovalbumin or 2 gmol GlcNAc as acceptor. In case a glycoprotein acceptor substrate is used, the reaction is terminated by acid precipition of the protein and the amount of 1 4 C galactose incorporated into ovalbumin determined by liquid scintillation counting (Berger, E.G. et al. (1978) Eur. J. Biochem. 90, 213-222). For GlcNAc as acceptor substrate, the reaction is terminated by the addition of 0.4 ml ice cold H 2 0 and the unused UDP- 14 C-galactose is separated from 14 C products on an anion exchanged column (AG X1-8, BioRad) as described (Masibay, A.S. and Qasaba, P.K. (1989) Proc. Natl. Acad. Sci. USA 86, 5733-5737). Assays are performed with and without acceptor molecules to assess the extent of hydrolysis of UDP-Gal by nucleotide pyrophosphatases. The results are shown in Table 2.

a C a o 0 Table 2: GT activity in S. cerevisiae strain BT 150 transformed with different plasmids.

GT specific activity (mU/mg protein) plasmid PH05 promoter high Pi low Pi pDP34 <0.01 n.d. pDPGTA8 phosphate regulated 0.1 0.6-1 constitutive 0.6 n.d. 1) a B e. i- 11 .1 1 i ,ii i 11.- 1 1) not determined GT activity of cultures shifted to inducible conditions (lowP i minimal medium) is about the same as the activity of cultures in minimal media expressing GT constitutively (Table As expected, no enzyme activity is found in cells transformed with the vector only.

During fractionation, most of the GT activity (70 90 see Table 3) and highest specific activity is always found in the high speed pellet (20000 Enzyme activity can be increased by the addition of I 2 Triton X-100 to the enzyme assay. Both findings suggest that recombinant GT is membrane bound in yeast cells, as it is in HeLa cells.

Ai Table 3: Distribution of GT activity during fractionation of BT 150/pDPGT5 cells GT activity cpm UDP-14C-Gal incorporated Fraction in GlcNAc crude extract 19400 400 g pellet 1000 4.6 20000 g pellet 15800 72.5 20000 g supernatant 5000 22.9 total: 21800 100% S. Example 6: Purification of the recombinant GT In order to liberate the membrane-bound enzyme the 20000 g pellet fraction of BT 150/pDPGTB5 cells is treated with 1 Triton X-100 for 10 min at room temperature and equilibrated with 50 mM Tris HC1 pH 7.4, 25 mM MgC1 2 0.5 mM UMP and 1 Triton X-100. The supernatant obtained after centrifugation is 0.2 gm filtered and passed over a GlcNAc-p-aminophenyl-Sepharose-column (Berger, E.G. et al. (1976) Experientia 32, 690-691) with a bed volume of 5 ml at a flow rate of 0.2 ml/min at 4 0

C.

The enzyme is eluted with 50 mM Tris-HCl pH 7.4, 5 mM GlcNAc, 25 mM EDTA and 1 Triton X-100. A single peak of enzyme activity is eluted within five fractions (size: 1 ml). These fractions are pooled and dialyzed against 2x 11 of 50 mM Tris-HCl pH 7.4, S0.1 Triton X-100. The purified GT is enzymatically active.

Example 7: Construction of an expression cassette for soluble GT S Galactosyltransferase expressed in yeast can be secreted into the culture medium if a yeast promoter is operably linked to a first DNA sequence encoding the signal sequence of the yeast invertase gen SUC2 linked in the proper reading frame to a cDNA encoding soluble

GT.

Partial HeLa GT cDNA sequence GT cDNA is excised from plasmid p4AD113 (Example 1) by digestion with EcoRI. The 1.2 kb fragment containing the complete GT cDNA is isolated and partially digested with MvnI (Boehringer) cutting the GT sequence at positions 43, 55, 140 and 288 of the nucleotide sequence depicted in SEQ ID NO. 1. When digesting 0.2 Ag of the EcoRI- EcoRI fragment with 0.75 MvnI for 1 h the GT cDNA is cut only once at nucleotide I position 134 yielding a 1.1 kb MvnI-EcoRI fragment.

i I

*I

-26- Vector for amplification in E. coli Plasmid pUC18 (Pharmacia) is digested with BamHI and EcoRI in the multiple cloning site. Then the plasmid is treated with alkaline phosphatase as described in the Maniatis manual (supra), subjected to agarose gel electrophoresis and isolated from the gel as a 2.7 kb DNA fragment.

Constitutive PH05 (-173) promoter and SUC2 signal sequence The vector p31/PH05 (-173) RIT (Example 2) is digested with the restriction enzymes BamHI and XhoI. A 0.25 kb BamHI-XhoI fragment with the constitutive PH05 (-173) promoter and the adjacent coding sequence for the invertase signal sequence (inv ss) is isolated. Then the fragment is recut with HgaI (BioLabs). The HgaI recognition sequence is on the antisense DNA strand. The restriction enzyme cuts upstream of the recognition sequence in such a way that the 5 staggered end of the antisense strand coincides with the end of the coding sequence of the invertase signal sequence. The 0.24 kb BamHI and HgaI Scut DNA fragment contains the constitutive PH05 (-173) promoter sequence linked to the yeast invertase signal sequence Adaptor Fragment is linked to fragment by means of an adaptor sequence which is prepared from equimolar amounts of the synthetic oligonucle6tides (Microsynth) 5'CT GCA CTG GCT GGC CG 3' and 5'CG GCC AGC CAG 3' for the complementary strand. The oligonucleotides are annealed to each other by first heating to 95 0 C and then slowly cooling to 0 C. The annealed adaptor is stored frozen.

0 Construction of plasmid psGT For ligation, linearized vector the GTcDNA fragment fragment containing the promoter and the sequence encoding the signal peptide and the adaptor are used in a '.molar ratio of 1: 2: 2: 30-100. Ligation is carried out in 12 p1 of ligase buffer (66 mM Tris-HCl pH 7.5, 1 mM dithioerythritol, 5 mM MgCl 2 1 mM ATP) at 16 0 C for 18 hours.

The ligation mix is used to transform competent cells of E. coli strain DH5a as described above. Minipreparations of plasmid are performed from 24 independent transformants.

The isolated plasmids are characterized by restriction analysis using four different enzymes (BamHI, PstI, EcoRI, XhoI, also in combination). A single clone with the expected restriction pat.ern is referred to as psGT.

4 t t o 4 4 0* 27 -27- The correct sequence at the fusion site of the sequence encoding invertase signal peptide with the cDNA coding for soluble GT is confirmed for plasmid psGT by using the T7-Sequencing kit (Pharmacia) and primer 5'AGTCGAGGTTAGTATGGC 3' starting at position -77 in the constitutive PH05 (-173) promoter.

Sequence for MvnI

DNA

1 5' AAA ATA Tct gca ctg gct ggc cgC GAC CTG AGC 3' 3' TTT TAT AGA CGT gac cga ccg gcG CAG GAC TCG Protein: Lys Ile Ser Ala Leu Ala Gly Arg Asp Leu Ser 16 19 42 inv ss GT sequence cleavage site for signal endopeptidase Small letters represent the adaptor sequence.

The expression cassette for secreted GT containing the constitutive PH05 (-173) promoter, the DNA sequence encoding invertase signal peptide and the partial GT cDNA from plasmid psGT can be excised as a 1.35 kb Sall (BamHI) EcoRI fragment. The expression cassette is still lacking the PH05 terminator sequences to be added in the following cloning step.

Example 8: Construction of the expression vector pDPGTS For construction of the expression vector for soluble GT the following fragments are combined: Vector part Plasmid pDP34 is digested and pretreated as described in Example 3 resulting in a 11.8 kb blunt end Sal vector fragment.

Expression cassette Plasmid psGT is first linearized by digestion with Sall (in the multiple cloning site) and then partially digested with EcoRI. A 1.35 kb DNA fragment is isolated containing the constitutive PH05 (-173) promotor, a DNA sequence encoding the yeast invertase signal peptide and the partial GT cDNA.

-28 PH05 terminator sequence The PH05 terminator sequence is isolated from plasmid p31 which is constructed starting from plasmid p30 as described in EP 100561. After digestion with the restriction enzyme HindIII the protruding ends are filled up by Klenow polymerase treatment as described above. Then the plasmid is digested with EcoRI and a 0.39 kb blunt end EcoRI fragment with the PH05 terminator sequences is isolated.

Ligation of fragments and and transformation of competent cells of E. coli strain DH5tx is carried out as described in Example 2. From the obtained transformants plasmids are isolated and characterized by restriction analysis. The plasmid of one clone with the correct restriction fragments is referred to as pDPGTS.

Example 9: Expression of soluble GT in yeast In analogy to Example 4, CsCl-purified DNA of the expression vector pDPGTS is used to transform S. cerevisiae strains BT 150 and H 449. Ura+-transformants are isolated and screened for GT activity. In each case one transformant is selected and referred to as Saccharomyces cerevisiae BT 150/pDPGTS and Saccharomyces cerevisiae H 449/pDPGTS, respectively. Employing the assay described in Example 5 GT-activity is found in the culture broths of both transformants.

Example 10: Cloning of the sialvltransferase (ST) cDNA from human HepG2 cells ST cDNA is isolated from HepG2 cells by PCR in analogy to GT cDNA. Preparation of poly (A)+RNA and first strand synthesis are performed as described in Example The primers (icrosynth) listed in Table 5 are used for PCR.

Eape9Exrsiono slbl T nyes I. a' 29- Table 5: PCR-primers corresponding to bp primer sequence to in ST cDNA 2 PstI/EcoRI SIA1 cgctgcagaattcaaaATGATTCACACCAACCTGAAGAAAAAGT 1 28 BamHI SIA3 c.cggatCCTGTGCTTAGCAGTGAATGGTCCGGAAGCC 1228 1198 1) Capital letteis represent sequences from ST, small letters are additional sequences with sites for restriction enzymes (underlined). Codons for 'start' and 'stop' for protein synthesis are indicated in boldface.

2) ST cDNA sequence from human placenta (27) as published in EMBL Data Bank (Accession Nr.X17247).

o t HepG2 ST cDNA can be amplified as one DNA fragment of 1.2 kb using the primers SIA1 and SIA3. PCR is performed as described for GT cDNA under slightly modified cycling conditions: 0.5 min denaturing at 95 0 C, 1 min. 15 sec annealing at 56 0 C, and S* 1 min 30 sec extension at 72 0 C, for a total of 25-35 cycles. In the last cycle, primer extension at 72'C is carried out for 5 min.

After PCR amplification, the 1.2 kb fragment is digested with the restriction enzymes S' BamHI and PstI, analysed on a 1.2 agarose gel, eluted from the gel and subcloned into the vector pUC 18. The resulting subclone is designated pSIA2.

Example 11: Construction of the constitutive ST expression cassette For constitutive heterologous expression, ST cDNA is ligated to the constitutive (-173) promoter fragment and PH05 terminator sequences.

Plasmid pSIA2 is first linearized by digestion with the restriction enzyme BamHI and subsequently partially digested with EcoRI. Since ST cDNA also contains an internal restriction site for the enzyme EcoRI (at bp 144), a 1.2 kb fragment with the complete ST ScDNA (SEQ. ID NO. 3) is created by partial digestion with EcoRI using 1 jg of DNA and 0.25 U EcoRI (1 h, 37 0 After gel electrophoresis the 1.2 kb EcoRI-BamHI fragment comprising the complete ST cDNA (SEQ ID NO. 3) is isolated. On this DNA fragment the 'ATG' start codon for translation of ST is located close to the EcoRI restriction site.

Three adenosine phosphates (see PCR primer SIA 1) provide an at bp position 12, which is found in the consensus sequence around the 'ATG' from highly expressed genes in yeast (Hamilton, R. et al. (1987) Nucleic Acids Res. 14, 5125-5149). The stop codon I j i 'TAA' and 5 bp of the 3' untranslated region of the gene are followed by the BamHI site.

The 1.2 kb EcoRI-BamHI ST cDNA fragment is ligated to the 0.45 kb SalI-EcoRI fragment containing the constitutive PH05 (-173) promoter (Example and a 3.5 kb BamHI-SalI vector part for amplification in E. coli containing the PH05 terminator sequence (cf. Example 2.1, fragment Ligation and transformation of E. coli strain is performed as detailed in Example 2.1. One clone showing the expected restriction pattern is designated pST2.

Vector pST2 comprises the expression cassette for HepG2 ST under the control of the constitutive PH05 (-173) promotor as a 2.0 kb SalI-HindIII fragment, referred to as DNA fragment (1C).

Example 12: Expression of ST in yeast Vector pDP34 (cf. EP 340 170) is digested with the restriction enzyme BamHI. The linearized vector is isolated with GENECLEAN and the protruding ends are filled in by Klenow polymerase treatment as described in the Maniatis manual (supra). The reaction is stopped after 30 min by heating to 65°C for 20 min in the presence of 10 mM EDTA.

After ethanol precipitation the plasmid is digested with SalI and subjected to gel electrophoresis on a 0.8 agarose gel. The (BamHI) blunt end-SalI cut vector pDP34 is isolated as an 11.8 kb DNA fragment with the GENECLEAN kit.

Plasmid pST2 is digested with the restriction enzyme HindIII and in analogy to the f S. preparation of the vector part filled in at the HindIII site by Klenow polymerase treatment.

The product is subjected to Sall digestion, resulting in a 2.0 kb (HindIII) blunt end SalI fragment comprising the constitutive ST expression cassette (2C).

Ligation of 80 ng of the pDP34 vector with 40 ng of fragment 2C and transformation of competent cells of E. coli strain DH5ca is performed as described in Example 2. One clone Sshowing the expected restriction pattern is chosen and referred to as For transformation of yeast, CsC1 purified DNA of the expression vector pDPST5 is prepared following the standard procedure given in the Maniatis manual (supra). S.

cerevisiae strains BT 150 and H 449 are each is transformed with 5 tg of plasmid DNA according to the lithium-acetate transformation method (Ito, H. et al, supra).

Ura+-transformants are selected and screened for ST activity. In each case, one positive L I i. LI -31 transformant is selected and referred to as Saccharomyces cerevisiae BT 150/pDPST5 and Saccharomyces cerevisiae H 449/pDPST5.

Example 13: Enzyme activity of full-length ST expressed in yeast 13.1 Preparation of cell extracts Cells of Saccharomyces cerevisiae BT 150/pDPST5 are grown under uracil selection in yeast minimal media supplemented with histidine and leucine. Exponentionally growing cells (at OD 57 8 of 0.5) or stationary cells are collected by centrifugation, washed once with mM imidazole buffer, pH 7.0 (buffer 1) and resuspended in buffer 1 at a concentration corresponding to 0.1-0.2 OD 5 7 8 Mechanical breakage of the cells is effected by vigorous shaking on a vortex mixer with glass beads (0.45-0.5 mm diameter) for 4 min with S intermittent cooling.

S ST-activity can be measured in the crude extracts employing the assay described below.

13.2 Assay for ST activity ST activity can be determined by measuring the amount of radiolabeled sialic acid which Sis transferred from CMP-sialic acid to a glycoprotein acceptor. After termination of the reaction by acid precipitation the precipitate is filtered using glass fiber filters (Whatman GFA), washed extensively with ice-cold ethanol and assessed for radioactivity by liquid scintillation counting (Hesford et al' (1984), Glycoconjugate J. 1, 141-153). Cell extracts V are assayed for 45 min in an incubation mixture containing 37 .tl cell extract corresponding to approximately 0.5 mg protein, 3 tgl imidazol buffer 50 mMol/1, pH 50 nMol CMP-N-acetylneuraminic acid (Sigma) to which CMP- 3 H-N-acetylneuraminic acid (Amersham) is added to give a final specific activity of 7.3 Ci/mol, and 75 itg asialo-fetuin (prepared by acid hydrolysis using 0.1 M H 2

SO

4 at 80 0 C for 60 min, followed by neutralization, dialysis and lyophilization).

ST-activity is found in the crude extracts prepared from S. cerevisiae BT 150/pDPST5 and H 449/pDPST5 cells.

Example 14: Construction of an expression cassette for soluble ST (Lysg 3 -Cys4 06 The soluble ST designated ST(Lys 39 -Cys 4 06 is an N-terminally truncated variant and consists of 368 amino acids (SEQ ID NO. 4).

_r_ ii ji .i r ioi ir I r~ir I trr r o I r, r ~t ii

I

r

I

r

I

.'t

I

r rr -32- Partial HepG2 ST cDNA sequence Plasmid pSIA2 is digested with EcoRI and a 1.1 kb EcoRI-EcoRI fragment is isolated.

Vector for amplification in E. coli Plasmid pUC18 (Pharmacia) is digested with BamHI and EcoRI in the multiple cloning site. Then the plasmid is treated with alkaline phosphatase as described in the Maniatis manual (supra), subjected to agarose gel electrophoresis and isolated from the gel as a 2.7 kb DNA fragment.

Constitutive PH05 (-173) promoter and SUC2 signal sequence The vector p31/PH05 (-173) RIT (Example 2) is digested with the restriction enzymes BamHI and XhoI. A 0.25 kb BamHI-XhoI fragment with the constitutive PH05 (-173) promoter and the adjacent coding sequence for the invertase signal sequence (inv ss) is isolated. Then the fragment is recut with HgaI (BioLabs). The HgaI recognition sequence is on the antisense DNA strand. The restriction enzyme cuts upstream of the recognition sequence in such a way that the 5 staggered end of the antisense strand coincides with the end of the coding sequence of the invertase signal sequence. The 0.24 kb BamHI and HgaI cut DNA fragment contains the constitutive PH05 (-173) promoter sequence linked to the yeast invertase signal sequence Adaptor Fragment is linked to fragment by means of an adaptor sequence which is prepared from equimolar amounts of the synthetic oligonucleotides 5'CTGCAAAATTGCAAACCAAGG 3' and 5'AATTCCTTGGTTTGCAATTT 3' for the complementary strand. The oligonucleotides are annealed to each other by first heating to 0 C and then slowly cooling to 20 0 C. The annealed adaptor is stored frozen.

Construction of plasmid psST For ligation, lineaized vector the STcDNA fragment fragment containing the promoter and the sequence encoding the signal peptide and the adaptor are used in a molar ratio of 1: 2: 2: 30-100. Ligation is carried out in 12 gl of ligase buffer (66 mM Tris-HCl pH 7.5, 1 mM dithioerythritol, 5 mM MgC1 2 1 mM ATP) at 16 0 C for 18 hours.

The ligation mix is used to transform competent cells of E. coli strain DHSc as described above. Minipreparations of plasmid are performed from 24 independent transformants. A single clone showing the expected restriction pattern after characterisation by restriction analysis using four different enzymes (BamHI, PstI, EcoRI, XhoI, also in combination) is 1 L, i' -7 33 referred to as psST.

The correct sequence at the fusion site of the sequence encoding invertase signal peptide with the cDNA coding for soluble ST(Lys 39 -Cys 4 06 is confirmed for plasmid psST by using the T7-Sequencing kit (Pharmacia) and primer 5'ACGAGGTTAATGGC 3' starting at position -77 in the constitutive PH05 (-173) promoter.

Sequence for DNA): 5' AAA ATA Tct gca aaa ttg caa acc aag gAA 3' 3' TTT TAT AGA GTG ttt aac gtt tgg ttc ctt Protein: Lys Ile Ser Ala Lys Leu Gin Thr Lys Glu 16 19 39 It t inv ss ST sequence cleavage site for signal endopeptidase 1) Small letters represent ihe adaptor sequence The expression cassette for secreted ST containing the constitutive PH05 (-173) promoter, the DNA sequence encoding invertase signal peptide and the partial ST cDNA from plasmid psST can be excised as a 1.35 kb Sail (BamHI) EcoRI fragment. The expression cassette is still lacking the PH05 terminator sequences to be added in the following cloning step.

Example 15: Construction of the expression vector pDPSTS For construction of the expression vector for soluble ST(Lys 39 -Cys 406 the following fragments are combined: b- Vector part Plasmid pDP34 is digested and pretreated as described in Example 3 resulting in a 11.8 kb blunt end SalI vector fragment.

Expression cassette Plasmid psST is first linearized by digestion with Sail (in the multiple cloning site) and then partially digested with EcoRI. A 1.35 kb DNA fragment is isolated containing the ii,..

F

-i.

34 constitutive H05 (-173) promotor, a DNA sequence encoding the yeast invertase signal peptide and ,he partial ST cDNA.

PH05 terminator sequence The PH05 terminator sequence is isolated from plasmid p31 which is constructed starting from plasmid p30 as described in EP 100561. After digestion with the restriction enzyme HindIII the protruding ends are filled up by Klenow polymerase treatment as described above. Then the plasmid is digested with EcoRI and a 0.39 kb blunt end EcoRI fragment with the PH05 terminator sequences is isolated.

Ligation of fragments and and transformation of competent cells of E. coli strain DH50 is carried out as described in Example 2. From the obtained transformants plasmids are isolated and characterized by restriction analysis. The plasmid of one clone with the correct restriction fragments is referred to as pDPSTS.

Example 16: Expression of soluble ST in yeast In analogy to Example 4, CsCl-purified DNA of the expression vector pDPSTS is used to transform S. cerevisiae strains BT 150 and H 449. Ura+-transformants are isolated and screened for ST activity. In each case one transformant is selected and referred to as Saccharomyces cerevisiae BT 150/pDPSTS and Saccharomyces cerevisiae H 449/pDPSTS. Using the assay described in Example 13 ST-activity is found in the culture broths of both transformants.

,Example 17: Construction of an expression cassette for soluble ST(Lys 27 -Cys,4 6 The soluble ST designated ST(Lys 27 -Cys 406 is an N-terminally truncated variant containingthe catalytic domain and the entire stem region and consisting of 380 amino acids, i.e. amino acids 27 to 406 of the amino acid sequence listed in SEQ ID NO. 3.

Partial HepG2 ST cDNA sequence Plasmid pSIA2 is digested with EcoRI and a 1.1 kb EcoRI-EcoRI fragment is isolated.

Vector for amplification in E. coli Plasmid pUC18 (Pharmacia) is digested with BamHI and EcoRI in the multiple cloning site. Then the plasmid is treated with alkaline phosphatase as described in the Maniatis manual (supra), subjected to agarose gel electrophoresis and isolated from the gel as a i i 2.7 kb DNA fragment.

Constitutive PH05 (-173) promoter and SUC2 signal sequence The vector p 3 1/PH05 (-173) RIT (Example 2) is digested with the restriction enzymes BamHI and XhoI. A 0.25 kb BamHI-XhoI fragment with the constitutive PH05 (-173) promoter and the adjacent coding sequence for the invertase signal sequence (inv ss) is isolated. Then the fragment is recut with Hgal (BioLabs). The HgaI recognition sequence is on the antisense DNA strand. The restriction enzyme cuts upstream of the recognition sequence in such a way that the 5 staggered end of the antisense strand coincides with the end of the coding sequence of the invertase signal sequence. The 0.24 kb BamHI and HgaI cut DNA fragment contains the constitutive PH05 (-173) promoter sequence linked to the S. yeast invertase signal sequence Adaptor Fragment is linked to fragment by means of an adaptor sequence which is prepared from equimolar amounts of the synthetic oligonucleotides CCAAGG and

AATTCCTTGTTGCAATITAAAGGAATCATAGTAACTCCCTTTCTTCTITT

CCTT 3' for the complementary strand. The oligonucleotides are annealed to each other by first heating to 95 0 C and then slowly cooling to 20 0 C. The annealed adaptor is stored frozen.

Construction of plasmid psSTl For ligation, linearized vector the STcDNA fragment fragment containing the promoter and the sequence encoding the signal peptide and the adaptor are used in a molar ratio of 1: 2: 2: 30-100. Ligation is carried out in 12 pl of ligase buffer (66 mM Tris-HCl pH 7.5, 1 mM dithioerythritol, 5 mM MgC1 2 1 mM ATP) at 16 0 C for 18 hours.

SThe ligation mix is used to transform competent cells of E. coli strain DH5aX as described above. Minipreparations of plasmid are performed from 24 independent transformants. A single clone showing the expected restriction pattern after characterisation by restriction analysis using four different enzymes (BamHI, PstI, EcoRI, XhoI, also in combination) is referred to as psST1.

The correct sequence at the fusion site of the sequence encoding invertase signal peptide -t i:r i- 36 with the cDNA coding for soluble ST(Lys 2 7 -Cys 40 6 is confirmed for plasmid psST1 by using the T7-Sequencing kit (Pharmacia) and primer 5'AGTCGAGTAGTATGGC 3' starting at position -77 in the constitutive PH05 (-173) promoter.

Sequence for DNA) Protein: 5' AAA ATA Tct gca aag gaa aag aag aaa ggg 3' 3' TTT TAT AGA GTG ttc ctt ttc ttc ttt ccc Lys Ile Ser Alal Lys Glu Lys Lys Lys Gly 16 19 27 inv ss ST sequence .o u r r D r

D

ai r r r o otl

I~

r ~lr~ i cleavage site for signal endopeptidase Small letters represent the adaptor sequence *644 4 44I 44 4 4.4, *0't 69 4 4.

4 The expression cassette for secreted ST(Lys 27 -Cys 4 06 containing the constitutive (-173) promoter, the DNA sequence encoding invertase signal peptide and the partial ST cDNA from plasmid psST1 can be excised as a 1.35 kb Sall (BamHI) EcoRI fragment. The expression cassette is still lacking the PH05 terminator sequences to be added in the following cloning step.

Example 18: Construction of the expression vector pDPSTS1 For construction of the expression vector for soluble ST(Lys 2 Cys 406 the following fragments are combined: Vector part Plasmid pDP34 is digested and pretreated as described in Example 3 resulting in a 11.8 kb blunt end SalI vector fragment.

Expression cassette Plasmid psST1 is first linearized by digestion with Sall (in the multiple cloning site) and then partially digested with EcoRI. A 1.35 kb DNA fragment is isolated containing the constitutive PH05 (-173) promotor, a DNA sequence encoding the yeast invertase signal peptide and the partial ST cDNA.

).A

c b oit cii o ~r o o 11 rt o r ir

I

I

I I rr r r t o~ I 1 rrrr r I -37- PH05 terminator sequence The PH05 terminator sequence is isolated from plasmid p31 which is constructed starting from plasmid p30 as described in EP 100561. After digestion with the restriction enzyme HindIl the protruding ends are filled up by Klenow polymerase treatment as described above. Then the plasmid is digested with EcoRI and a 0.39 kb blunt end EcoRI fragment with the PH05 terminator sequences is isolated.

Ligation of fragments and and transformation of competent cells of E. coli strain DH5ac is carried out s described in Example 2. From the obtained transformants plasmids are isolated and characterized by restriction analysis. The plasmid of one clone with the correct restriction fragments is referred to as pDPSTS1.

Example 19: Expression of soluble ST(Lys 27 Y-Cvsj) in yeast In analogy to Example 4, CsCl-purified DNA of the expression vector pDPSTS1 is used to transform S. cerevisiae strains BT 150 and H 449. Ura+-transformants are iso 1 ad and screened for ST activity. In each case one transformant is selected and referred to as Saccharomyces cerevisiae BT 150/pDPSTS1 and Saccharomvces cerevisiae H 449/pDPSTS1. Using the assay described in Example 13, ST-activity is found in the culture broths of both transformants.

Example 20: Cloning of the FTcDNA from the human HL60 cell line On the basis of the published cDNA sequence (Goelz, S.E. et al. (1990) Cell 63, 1349-1356) for ELFT (ELAM-1 ligand fucosyltransferase) coding for fucosyltransferase the following oligonucleotide primers are designed to amplify a DNA fragment encompassing the open reading frame of the ELFT cDNA by PCR technology: 5'-CAGCGCTGCCTGTTCGCGCCAT-3' (ELFT-1B) and 5'-GGAGATGCACAGTAGAGGATCA-3'(ELFT-2B). ELFT-1B primes at base pairs 38-59 of the published sequence, and ELFT-2B primes at bp 1347-1326 in the antisense.

The primers are used to amplify a 1.3 kb fragment using the Perkin-Elmer Cetus Taq polymerase kit. The fragment is amplified from fresh HL60 cDNA in the presence of DMSO and 2 mM MgC12 with the following cycle: 0 C 5 min, (1 min 95 0 C, 1 min 60 0 C, 1.5 min 72 0

C),

(1 min 95 0 C, 1 min 60 0 C, 1.5 min 15 sec/cycle 72 0

C).

Agarose gel electrophoresis reveals a prominent 1.3 kb band which when digested with Smal or Apal gives the pattern predicted by the published sequence. The 1.3 kb band is 1 i~W R:Qi I

S

*I

I r r rrf I r;rt rre -38purified using a Gene-Clean kit (Bio 101) and is subcloned into the pCR1000 vector (Invitrogen). A single clone with the correct 1.3 kb insert is selected and referred to as BRB.ELFT/pCR1000-13. The FTcDNA is inserted in the vector in a reverse orientation with respect to the T7 promoter. The open reading frame of the FTcDNA has been fully sequenced and is identical to the published sequence (SEQ.ID Example 21: Construction of plasmids for inducible and constitutive expression of soluble FT(Arg62Arg4 05 in yeast Soluble FT(Arg 62 -Arg 405 is expressed from the FT cDNA starting at nucleotide position 241 (NruI restriction site) omitting the N-terminal region coding for the cytoplasmic tail and the membrane spanning domain (see sequence ID NO. Plasmid BRB.ELFT/pCR'000-13 is digested with HindIII, which cuts in the multicloning region 3' of the FT cDNA insert. The sticky ends are converted to blunt ends in a reaction with Klenow DNA polymerase. XhoI linker CCTCGAGG Biolabs) are kinased, annealed and ligated to the blunt ends of the plasmid, using a 100-fold molar excess of linkers. Unreacted linkers are removed by isopropanol precipitation of the DNA, which is further digested with XhoI and NruI (cleavage at nucleotide position 240 of the FT cDNA according to Sequence ID NO. The 1.1 kb NruI-XhoI fragment contains the FT cDNA sequence lacking the region which codes for the cytoplas nic tail and the membrane-spanning domain up to amino acid 61.

Plasmids p31 RIT12 and p31/PHO5(-173)RIT (see Example 2) are each digested with SalI and XhoI. The 0.9 kb and 0.5 kb fragments, respectively, are isolated and cut with Hgal.

The resulting sticky ends are filled by Klenow DNA polymerase. The created blunt ends coincide with the 3' end of the coding sequence for the yeast invertase signal sequence.

Subsequent BamHI cleavage releases a 596 bp BamHI-blunt end fragment which comprises the inducible PHO5 promoter and the invertase signal sequence with its own ATG or a 234 bp BamHI-blunt end fragment comprising the short, constitutive PHO5(-173) promoter and the invertase signal sequence.

Plasmid p31RIT12 is linearized with restriction endonuclease Sall. Partial HindIII digestion in the presence of ethidiumbromide results in a 1 kb SalI-HindIII fragment comprising the 276 bp SalI-BamHI pBR322 sequence, the 534 bp promoter of the yeast acid phosphatase PH05, the yeast invertase signal sequence (coding for 19 amino acids) aI~ 39and the PHO5 transcriptional terminator. The 1 kb Sall-HindIII fragment of p31RIT12 is cloned into the yeast-E.coli shuttle vector pJDB207 (Beggs, J.D. in: Molecular Genetics in yeast, Alfred Benzon Symposium 16, Copenhagen, 1981, pp. 383-389), which has been cut with SalI and HindIII. The resulting plasmid containing the 1 kb insert is referred to as pJDB207/PHO5-RIT12.

Plasmid pJDB207/PHO5-RIT12 is digested with BamHI and XhoI and the large, 6.8 kb BamHI-XhoI fragment is isolated. This fragment contains all the pJDB207 vector sequences and the PH05 transcriptional terminator.

The 596 bp BamHI-blunt end fragment the 1.1 kb NruI-XhoI fagment and the 6.8 kb XhoI-BamHI vector fragment are ligated using standard conditions for blunt end ligation. Aliquots of the ligation mix are used to transform competent E. coli HB101 cells.

Plasmid DNA from ampicillin-resistant colonies is analysed by restriction digests. A single clone with the correct expression plasmid is referred to as pJDB207/PHO5-I-FT.

Ligation of DNA fragments and leads to expression plasmid pJDB207/PHO5- (-173)-I-FT. The expression cassettes of these plasmids comprise the coding sequence of the invertase signal sequence fused in frame to that of the soluble a(1-3)fucosyltransferase which is expressed under the control of the inducible PH05 or the constitutive PHO5(-173) promoter, respectively. The expression cassettes are cloned into the yeast-E.

Scoli shuttle vector pJDB207 between the BamHI and HindIII restriction sites.

S The nucleotide sequence at the site of the fusion between the invertase signal sequence and cDNA coding for soluble FT is confirmed by DNA sequencing on double stranded o plasmid DNA using the primer 5' AGTCGAGGTTAGTATGGC 3' representing the nucleotide sequence at position -77 to -60 of the PHO5, as well as the PHO5(-173) promoter. The correct junction is: AAA ATA TCT GCA CGA CCG GTG 3' 3' TTT TAT AGA CGT GCT GGC CAC Lys Ile Ser Ala Arg Pro Val 19 62 Inv.ss FT cleavage site for signal peptidase L 1$ A I.

S

40 Example 22: Construction of plasmids for inducible and constitutive expression of membrane-bound FT in yeast These constructs use th sequence of the FT cDNA with its own ATG. The nucleotide sequence immediately upstream of the ATG, however, is rather unfavourable for expression in yeast due to its high G-C content. This region has been replaced by an A-T rich sequence using PCR methods. At the same time an EcoRI restriction site is introduced at the new nucleotide positions -4 to -9.

Table 6: PCR primers 2 corresponding to primer sequence to bp in FT cDNA o-0n00 a n 0 0 0 0 o* 0 a o (0 0o O 00B o 0 60 O 0 09 000 0 ft 1 0 0 0 0o FT1 cgaqaattcataATGGGGGCACCGTGGGGC 58to FT2 ccgctccaqGAGCGCGGCTTCACCGCTCG 1285 to 1266 1) Capital letters represent nucleotides from FT, small letters are additional new sequences, restriction sites are underlined, "start" and "stop" codons are highlighted.

Standard PCR conditions are used to amplify the FT cDNA with primers FT1 and FT2 (see Table 6) in 30 cycles of DNA synthesis (Taq DNA polymerase, Perkin-Elmer, 5 U/pl, 1 min at 72 0 denaturation (10 sec at 93 0 C) and annealing (40 sec at 60 0 The resulting 1.25 kb DNA fragment is purified by phenol extraction and ethanol precipitation, then digested with EcoRI, XhoI and NruI. The 191 bp EcoRI-NruI fragment is isolated on a preparative 4% Nusieve 3:1 agarose (FMC BioProducts, Rockland, ME, USA) gel in tris-borate buffer pH 8.3, gel-eluted and ethanol precipitated. Fragment comprises the part of the FT gene coding for amino acids 1 to 61. The DNA has a 5' extension with the EcoRI site as in PCR primer FT1.

Plasmids p31RIT12 and p31/PHO5(-173)RIT are each digested with EcoRI and XhoI. The i large vector fragments (f and g, respectively) are isolated on a preparative 0.8% agarose gel, eluted and purified. The 4.1 kb XhoI-EcoRI fragment comprises the i u 1.i: 'I 'i i lxl '1 I cc

II

or o o o ~n roo ii

I

oo .4 r r o s o rer rrr oa o oi -41 pBR322-derived vector, the 534 bp PH05 promoter EeoRI site) and the 131 bp transcriptional terminator XhoI site). The 3.7 kb XhoI-EcoRI fragment only differs by the short, constitutive, 172 bp PHO5(-173) promoter EcoRI site) instead of the full length PHO5 promoter.

The 191 bp EcoRI-NruI fragment the 1.1 kb NruI-XhoI fragment and the 4.1 kb XhoI-EcoRI fragment are ligated. A 1 pl aliquot of the ligation mix is used to transform competent E. coli HB101 cells. Plasmid DNA from ampicillin resistant colonies is analysed. Plasmid DNA from a single clone is referred to as p31R/PHO5-ssFT.

Ligation of DNA fragments and leads to plasmid p31R/PHO5(-173)-ssFT.

These plasmids comprise the coding sequence of the membrane-bound FT under the control of the inducible PH05 or the constitutive PHO5(-173) promoter, respectively.

Example 23: Cloning of the FT expression cassettes into pDP34: Plasmids p31R/PHO5-ssFT and p31R/PHO5(-173)-ssFT are digested with HindIII, which cuts 3' of the PH05 transcriptional terminator. After a reaction with Klenow DNA polymerase, the DNA is digested with SalI. The 2.3 kb and 1.9 kb SaIl-blunt end fragments, respectively, are isolated.

Plasmids pJDB207/PHO5-I-FT and pJDB207/PHO5(-173)-I-FT are partially digested with HindIII in the presence of 0.1 mg/ml of ethidium bromide (to avoid cleavage at an additional HindIII site in the invertase signal sequence) and then treated with Klenow DNA polymerase and Sall as above. The 2.1 kb and 1.8 kb fragments, respectively, are isolated.

The four DNA fragments are each ligated to the 11.8 kb SalI-blunt end vector fragment of pDP34 (see Example Upon transformation of competent E. coli HB101 cells and analysis of plasmid DNA of individual transformants, four correct expression plasmids are referred to as pDP34/PHO5-I-FT; pDP34/PHO5(-173)-I-FT; pDP34R/PHO5-ssFT and pDP34R/PHO5(-173)-ssFT.

S. cerevisiae strains BT150 and H449 are transformed with 5 gg each of the four expression plasmids (above) according to Example 4. Single transformed yeast colonies are selected and referred to as 'N_41

F

42 Saccharomyces cerevisiae BT1 50/pDP34/PHO5-I-FT; BTI 50/pDP34/PHO5(- 173)-I-FTF; BT1 50/pDP34R/PHO5-ssFTF; BT15O/pDP34R/PHO5(- 173)-ssFT; H449/pDP34/PHO5-I-FT; H449/pDP34/PHO5(- 173)-I-FT; H449/pDP34RIPHO5-ssFT; H449/pDP34R]PHO5(- 173)-ssFT t I II t C 4 Fermentation and preparation of the cell extracts is performed according to Example Using an assay analo'gous to that described by Goelz et al. (supra) FT-activity is found in the crude extracts prepared from strains BT15O/pDP34R/PHO5-ssFT, BT15O/pDP34RIPHO5(-173)-ssFT, H449/pDP34RIPHO5-ssFT and H449/pDP34RIPHO5(-173)-ssFT, and in the culture broth of strains H449/pDP34/PHO5-I-FT, H449/pDP34/PHO5(- 17 3)-I-FT, BT1 50/pDP34/PHO5-J-FT and BT15O/pDP34/PHO5(- 173)-I-FT.

Deposition of microorganisms The following microorganism strains were deposited with the Deutsche Sammiung von Mikroorgyanismen (DSM), Mascheroder Weg 16, D-3300 Braunschweig (deposition dates and accession numbers given): Escherichia coli JM1O9/pDP34: March 14, 1988; DSM 4473 Escherichia coli HB101/p30: October 23, 1987; DSM 4297 Escherichia coli HB1O1/p3lR: December 19, 1988; DSM 5116 Saccharomyces cerevisiae, H 449: February 18, 1988; DSM 4413 Saccharomyces cerevisiae BT 150: May 23, 1991; DSM 6530 24' -43- Sequence listing SEQ ID NO. 1 SEQUENCE TYPE: Nucleotide with corresponding protein SEQUENCE LENGTH: 1265 bp STRANDEDNESS: double TOPOLOGY: linear MOLECULE TYPE: recombinant IMMEDIATE EXPERIMENTAL SOURCE: Plasmid p4AD113 from E. coli DH5cdp4AD113 FEATURES: from 6 to 1200 bp cDNA sequence coding for He La cell ri t o r o ~ir o i o i~r r from 1 to 6 bp from 497 to 504 bp from 1227 to 1232 bp from 1236 to 1241 bp from 1243 to 1248 bp galactosyltransferase EcoRI site NotI site EcoRI site EcoRV site BglII site PROPERTIES: EcoRI-HindIII fragment from plasmid p4AD113 comprising HeLa cell cDNA coding for full-length galactosyltransferase (EC 2.4.1.22) GAATTC ATG AGG CTT CGG GAG CCG CTC CTG AGC GGC AGC 39 Met Arg Leu Arg Glu Pro Leu Leu Ser Gly Ser -a i d s r o o s i o GCC GCG ATG CCA GGC GCG TCC CTA Ala Ala Met Pro Gly Ala Ser Leu 15 CTG CTC GTG GCC GTC TGC GCT CTG Leu Leu Val Ala Val Cys Ala Leu 30 CTC GTT TAC TAC CTG GCT GGC CGC Leu Val Tyr Tyr Leu Ala Gly Arg 45 CAG CGG Gln Arg CAC CTT His Leu

GCC

Ala

GGC

Gly

AGC

Ser

TGC

Cys

GTC

Val

CGC

Arg

ACC

Thr 78 117 GAC CTG Asp Leu

CGC

Arg

CTG

Leu 156 i i: i II LI -i e 44

CCC

Pro

TCG

Ser

CTC

Leu ~c ro r o itr r

I

ir

.Q

I r i I ~r

I

I r

I~

c rr

GCC

Ala

GTC

Val CAA CTG GTO GGA GTC TCC ACA COG CTG CAG Gin Leu Val Gly Val Ser Thr Pro Leu Gin AAO AGT GOC GOC GCC ATC GGG CAG TOC TCC Asn Ser Ala Ala Ala Ile Gly Gin Ser Ser 70 OGG ACC GGA GGG GOC OGG COG CCG CCT OCT Arg Thr Gly Gly Ala Arg Pro Pro Pro Pro TCC TOC CAG OCG OGC OCG GGT GGC GAO TCC Ser Ser Gin Pro Arg Pro Gly Gly Asp Ser 95 100 GTG GAT TOT GGC CCT GGO CCC GOT AGO AAO Val Asp Ser Gly Pro Gly Pro Ala Ser Asn 105 110 GTC CCA GTG CCC CAC ACC ACC GCA CTG TCG Val Pro Val Pro His Thr Thr Ala Leu Ser 120 125 TGO COT GAG GAG TCC COG CTG OTT GTG GGO Oys Pro Glu Giu Ser Pro Leu Leu Val Gly 120 135 ATT GAG TTT AAC ATG OCT GTG GAC CTG GAG Ile Glu Phe Asn Met Pro Val Asp Leu Glu 145 150

GGG

Gly

GAG

Glu 234

GGO

Gly OTA GGO Leu Gly 273

GGO

Gly AGO CCA Ser Pro 312 195 TTG ACC Leu Thr 115

TCG

Ser

OTG

Leu

CCC

Pro 390

GCC

Ala

CTG

Leu

CCC

Pro 140

CTC

Leu

CGC

Arg

ATG

Met 429

GTG

Val

TAT

Tyr 468 GCA AAG CAG AAC CCA AAT GTG AAG ATG GGO GGO Ala Lys Gin Asn Pro Asn Val Lys Met Gly Gly 155 160 165 507

H.

i ;u ~I V1 GCC CCC AGG GAC TGC GTC TCT CCT CAC AAG GTG GCC ATC 546 Ala Pro Arg Asp 170

ATC

Ile

TGG

Trp ATT CCA TTC Ile Pro Phe CTA TAT TAT Leu Tyr Tyr 195 Cys Val Ser Pro His Lys 175 CGC AAC CGG CAG GAG CAC Arg Asn Arg Gin Glu His 185 190 TTG CAC CCA GTC CTG CAG Leu His Pro Val Leu Gin 200 Val Ala Ile 180 CTC AAG Leu Lys a tr cc s eo a

O

0

CTG

Leu

ACT

Thr 220

CAA

Gin

TTT

Phe 4 44I 4I *44 CC 4 rc' GAC TAT GGC ATC TAT GTT ATC AAC CAG Asp Tyr Gly Ile Tyr Val Ile Asn Gin 210 215 ATA TTC AAT CGT GCT AAG CTC CTC AAT Ile Phe Asn Arg Ala Lys Leu Leu Asn 225 GAA GCC TTG AAG GAC TAT GAC TAC ACC Glu Ala Leu Lys Asp Tyr Asp Tyr Thr 235 240 AGT GAC GTG GAC CTC ATT CCA ATG AAT Ser Asp Val Asp Leu Ile Pro Met Asn 250 255 TAC AGG TGT TTT TCA CAG CCA CGG CAC Tyr Arg Cys Phe Ser Gin Pro Arg His 260 265 ATG GAT AAG TTT GGA TTC AGC CTA CCT Met Asp Lys Phe Gly Phe Ser Leu Pro 275 280 CGC CAG Arg Gin 205 GCG GGA Ala Gly GTT GGC Val Gly 230 TGC TTT Cys Phe GAC CAT Asp His ATT TCC Ile Ser 270 TAT GTT Tyr Val

TAC

Tyr

CAG

Gin

GAC

Asp

TTT

Phe

GTG

Val 245

AAT

Asn

GTT

Val

CAG

Gin 585 624 663 702 741 780 819

GCG

Ala

GCA

Ala 858 bl TAT TTT GGA GGT GTO TOT ryr Phe Gly Gly Val Ser 285 290 CTA ACC ATO AAT GGA TTT Leu Thr Ilie Asn Gly Phe 300 GGA GGA GAA GAT GAT GAO Gly Gly Glu Asp Asp Asp 315 AGA GGO ATG TOT ATA TOT Arg Gly Met Ser Ile Ser S C325 AGO TGT OGO ATG ATO OGO Arg Oys Arg Met Ile Arg 340 *GAA 000 AAT OOT OAG AGG Olu Pro Asn Pro Gin Arg 350 355 AAG GAG ACA ATG OTO TOT Lys Glu Thr Met Leu Ser 365 46 GOT OTA AGT AAA CAA OAG TTT 897 Ala Leu Ser Lys Gin Gin Phe 295 OOT AAT AAT TAT TGG GGO TGG 936 Pro Asn Asn Tyr Trp Gly Trp 305 310 ATT TTT AAO AGA TTA GTT TTT 975 Ile Phe Asn Arg Leu Vai Phe 320 OGO OOA AAT GOT OTG GTO GGG 10i4 Arg Pro Asn Ala Val Val Gly 330 335 CAC TOA AGA GAO AAG AAA AAT 1053 His Ser Arg.Asp Lys Lys Asn 345 TTT GAO OGA ATT GOA CAC ACA 1092 Phe Asp Arg Ile Ala His Thr 360 GAT GGT TTG AAO TOA OTO ACC 1131 Asp Oly Leu Asn Ser Leu Thr 370 375 OAG AGA TAO OOA TTO TAT ACC 1170

TAO

Tyr OAG GTG Gin Val O TG Leu

GAT

Asp 380

GAO

Asp

OTA

Val Gin Arg Tyr Pro Leu 385 Tyr Thr CAA ATO ACA Gin Ile Thr 390

OTG

Val ATO GGG ACA Ile Giy Thr 395 OOG AGO TAGOAOTTTT Pro Ser 1210

I

S 5555 47 GGTACAGGTA AAGACTGAAT TCATCGATAT CTAGATCTCO AGCTCGCGAA AGCTT 1250 1265 4 1; i

P.

48 SEQ ID NO. 2 SEQUENCE TYPE: Protein SEQUENCE LENH: 357 amino acids MOLECULE TYPE: C-terminal fragment of full-length HeLa cell gyalactosyl-transferase

PROPERTIES:

Leui Ala Gly soluble galactosyltransferase (EC 2.4.1.22) from HeLa cells Arg Asp Leu Ser Arg Leu Pro Gin Leu Val Gly Val 15 Ala Ala Ala Ser Thr Pro Leu Gin Gly Gly Gin Ser Ser Gly Glii 0 0* 0400 0 0*00 00 00 0 00 Ser Asn Ser 25 Leu Arg Thr 30 Ile Giy Pro Leu Giy Gly Gly Ala Arg Pro Pro Pro Ala Ser Val Val Ser Val Ala Cys Leu Ile Ser Asp Gin Pro Arg Pro 55 Gly Pro Gly Gly Gly Asp Ser Ser Pro Ser Asn Leu Thr Ser 65 Pro Ala Pro Val Pro His Thr 80 Pro Glu Glu Ser Pro Giu Phe Asn Met Pro 105 Gin Asn Pro Asri Val 120 Thr Ala Leu Ser Leu Pro Leu 95 Leu Val Val Asp Leu 110 Lys Met Gly Gly Pro Met 100 Glii Leu Val Gly Arg Tyr 125 Ala Lys 115 49 Ala Pro Arg Asp Cys Val Ser Pro His Lys Val Ala Ile 130 135 Ile Ile Pro Phe Arg Asn Arg Gin Glu His Leu Lys Tyr 140 145 150 Trp Leu Tyr Tyr Leu His Pro Vai Leu Gin Arg Gin Gin 155 160 165 Leu Asp Tyr Giy Ile Tyr Val Ile Asn Gin Aia Gly Asp 170 175 Thr Ile Phe Asn Arg Ala Lys Leu Leu Asn Vai Gly Phe o *I *9 9 9999 9*9.9, 9990 o 9.

99 9 9*9 1 9191

I

1119

CIII

180 185 190 Gin Glu Ala Leu Lys Asp Tyr Asp Tyr Thr Cys Phe Val 195 200 Phe Ser Asp Val Asp Leu Ile Pro Met Asn Asp His Asn 205 210 215 Ala Tyr Arg Cys Phe Ser Gin Pro Arg His Ile Ser Val 220 225 230 Ala Met Asp Lys Phe Gly Phe Ser Leu Pro Tyr Val Gin 235 240 Tyr Phe Giy Gly Val Ser Ala Leu Ser Lys Gin Gin Phe 245 250 255 Leu Thr Ile Asn Gly Phe Pro Asn Asn Tyr Trp Gly Trp 260 265 Gly Gly Giu Asp Asp Asp Ile Phe Asn Arg Leu Val Phe 270 20275 280 C, 4' 50 Arg Gly Met Ser .285 Arg Cys Arg Met Glu i ro Asn Pro 310 Lys Giu Thr Met 325 Tyr Gin Val Leu 335 Ile Ser Arg Pro Asn Ala Val Val 290 O ly 295 Ile Arg 300 His Ser Arg Asp Lys 305 Lys Asn Gin Arg Phe Asp Arg TIe Ala 315 His 320 Thr Leu Ser Asp Giy Leu Asn Ser Leu Thr 330 444 4 44.4 044444 4 44 C 4 444 C 4 *44* 44 0 *4 Asp Val 340 Gin Arg Tyr Pro Leu Tyr Thr 345 Gly Thr Pro Ser 355 Gin Ile Thr Val Asp Ile 350 1 51 SEQ ID NO. 3 SEQUENCE TYPE: Nucleotide with corresponding protein SEQUENCE LENH: 1246 bp STRANDEDNESS: double TOPOLOGY: linear MOLECULE TYPE: recombinant IMMEDIATE EXPERIMENTAL SOURCE: Plasmid pSIA2 from E. coli DH5WxpSJA2 FEATURES: from 15 to 1232 bp cDNA sequence codingy for HepG2 cell from 1 to 6 bp from 6 tolIl bp from 144 to 149 bp from 1241 to 1246 bp sialyltransferase PstI site EcoRI site EcoRI site BarnHJ site o 14 *4 C 444 1 4444 144411 4 4: 44.4 4 44 4 4(4 4 It'.

4 4 4 14 I 1 44

PROPERTIES:

CTOCAGAATT C PstI-BamHI fragment from plasmid pSIA2 comprising HepG2 cDNA coding for full-length sialyltransferase (EC 2.4.99.1)

:AAA

AAO

L~y s

OTC

Val1

TTC

Phe 10

ATC

Ile

GAT

Asp AOC TGC Ser Cys TOT GTG Cys Val TCC TTT Ser Phe

ATG

Met

TOC

Cy 5

TOO

Trp

AAA

Ly s

ATT

Ile

OTC

Val

AAO

Ly s

TTO

Leu 40

CAC

His C TO Leu 15

OAA

Olu

CAA

Gln

ACC

Thr

OTC

Val1

AAO

Lys5

ACC

Thr

AAC

Asn

TTT

Phe

AAO

Lys5

AAO

L~ys

CTO

Leu

CTT

Leu

AAA

Lys

OAA

Glu C TO Leu 000 Oly

TTC

Phe

TTT

Phe

AOT

Ser

CAO

Gln

OCA

Ala

TAC

Tyr

OTO

Val AAO AAA Lys Lys 38 77 116 155 TAT

V.

V

L ii

I~J

52 TTA AAG ACT CTO GGG AAA TTG GCC. ATO GGG TOT GAT TCO 194 Leu Lys Ser Teu Gly Lys Leu Ala Met Gly Ser Asp Ser

CAG

Gin

GGC

Gly TOT OTA Ser Val TOO TOA AGC Ser Ser Ser CGC CAG, ACC Arg Gin Thr Crc GGC Leu Gly

GC

Al a 10 0P V 000 1 40#I o a 0009 9 0440 0444ic 9~ 4 44 a 0~

OOVO

O 44 a, t 0 A 04 040 0 O 4 9004 9 0 44 9 0 00 4 00

AGO

Ser 100

TGG

Trp

TAO

Tr

GC

Ala AAA OOA Lys Pro TOT TOO Ser Ser AAG AAT Lys Asn 115 AAG GGG Lys Gly OTG OGO Leu Arg 140 CTA GAG Val Glu

GAG

Glu 90

AAA

Ly s

TAO

Tyr

OCA

Pro

TGO

Oy s

GTO

Val1 155 GOO TOO Ala Ser AAO CTT Asn Leu 105 OTA AGO Leu Ser GGA OOA Gly Pro 130 CAC OTO His Leu ACA CAT Thr Asp AGO ACC Ser Thr ACT OTO Ser Leu 80 TTO CAG Phe Gin ATO OOT Ile Pro ATG AAO Met Asn 120 GGC ATO Gly Ile CC GAO Arg Asp 145 TTT 000 Phe Pro OAG GAO 000 CAC Gin Asp Pro His AGA GC OTA CO Arg Cly Leu Ala CTG TGG AAO AAG Val Trp Asn Lys AGG OTG CAA AAG Arg Leu Gin Lys 110 AAG TAO AAA GTG Lys Tyr Lys Val AAC TTO ACT GOA Lys Phe Ser Ala 135 OA T GTG AAT CTA His Val Asn Val 150 TTO AAT ACC TOT Phe Asn Thr Ser 160

AGG

Arg

AAG

Ly s

GAO

Asp

ATO

Ile

TOO

Ser 125

GAG

Clu

TOO

Ser

CAA

Glu 233 272 311 350 389 428 o'

ATG

Met 506

TGG

Trp 165

GCT

Ala

GAG

Glu

GGG

Gly

GGA

Gly

TCT

Ser t at t t tt *t t I Il f

I

I

GAT

Asp

CAT

His 205

AAC

Asn -53- GGT TAT CTG CCC AAG GAG AGC ATT AGG ACC AAG 545 Gly Tyr Leu Pro Lys Glu Ser Ile Arg Thr Lys 170 175 CCT TGG GGC AGG TGT GCT GTT GTG TCG TCA GCG 584 Pro Trp Gly Arg Cys Ala Val Val Ser Ser Ala 180 185 190 CTG AAG TCC TCC CAA CTA GGC AGA GAA ATC GAT 623 Leu Lys Ser Ser Gin Leu Gly Arg Glu Ile Asp 195 200 GAC GCA GTC CTG AGG TTT AAT GGG GCA CCC ACA 662 Asp Ala Val Leu Arg Phe Asn Gly Ala Pro Thr 210 215 TTC CAA CAA GAT GTG GGC ACA AAA ACT ACC ATT 701 Phe Gin Gin Asp Val Gly Thr Lys Thr Thr Ile 220 225 ATG AAC TCT CAG TTG GTT ACC ACA GAG AAG CGC 740 Met Asn Ser Gin Leu Val Thr Thr Glu Lys Arg 235 240 AAA GAC AGT TTG TAC AAT GAA GGA ATC CTA ATT 779 Lys Asp Ser Leu Tyr Asn Glu Gly Ile Leu Ile 245 250 255 GAC CCA TCT GTA TAC CAC TCA GAT ATC CCA AAG 818 Asp Pro Ser Val Tyr His Ser Asp Ile Pro Lys 260 265

GCC

Ala ri 1 ti rrrr

II

ri ,,a ri~r r~ri r Iirr

II

r r

CGC

Arg 230

CTG

Leu TTC CTC Phe Leu

GTA

Val

TGG

Trp

TGG

Trp

TAC

Tyr 270 CAG AAT CCG GAT TAT AAT TTC TTT AAC AAC TAC Gin Asn Pro Asp Tyr Asn Phe Phe Asn Asn Tyr 275 280 857 i- i It t -54- AAG ACT TAT CGT AAG CTG CAC CCC.AAT CAG CCC TTT TAC 896 Lys Thr Tyr Arg 285 Lys Leu His Pro Asn 290 Gin Pro Phe Tyr

ATC

Ile 295

CTT

Leu CTC AAG CCC Leu Lys Pro

CAG

Gin ATG CCT TGG GAG Met Pro Trp Glu 300

CTA

Leu

TGG

Trp 305

CCA

Pro

GAC

Asp

ATT

Ile 935 CAA GAA ATC Gin Glu Ile 310 TCC TCT GGG Ser Ser Gly TCC CCA GAA GAG ATT Ser Pro Glu Glu Ile 315

CAG

Gin

AAC

Asn

CCC

Pro 320

ACG

Thr 974

.I

P I

(I(

I

I~

I

I

I

CCA

Pro

ATG

Met 325

GTG

Val CTT GGT ATC ATC Leu Gly Ile Ile

ATC

Ile 330

ATG

Met

ATG

Met 1013

CTG

Leu t s 'ta i lt rr~

AAG

Lys TGT GAC CAG Cys Asp Gin 335 CGC AAG ACT Arg Lys Thr 350 GAT AGT GCC Asp Ser Ala

GAC

Asp

TTC

Phe 360

CTC

Leu

TGC

Cys GAT ATT TAT GAG Asp Ile Tyr Glu 340 GTG TGC TAC TAC Val Cys Tyr Tyr 355 ACG ATG GGT GCC Thr Met Gly Ala 365 TTG GTG AAG CAT Leu Val Lys His 380 TAC CTG CTT GGA Tyr Leu Leu Gly TAC CAG Tyr Gin TTC CTC CCA Phe Leu Pro 345

TCC

Ser AAG TTC Lys Phe

TAC

Tyr 1052 1091 TAT GAG AAG Tyr Glu Lys 375

AAT

Asn

ATC

Ile 390

CTC

Leu

AAA

Lys 395

CAC

His 370

AAC

Asn

GCC

Ala CCG CTG Pro Leu 1130 CAG GGC Gin Gly 385 ACA CTG Thr Leu 1169 ACA GAT GAG GAC Thr Asp Glu Asp 1208 55 CCT GGC TTC CGG ACC ATT CAC TOO.. TAAGCCAGG ATCC Pro Gly Phe Arg Thr Ile His Cys 400 405 1246 o CC.~1 >1 -56- SEQ ID NO. 4 SEQUENCE TYPE: Protein SEQUENCE LENH: 368 amino acids MOLECULE TYPE: C-terminal fragment of full-length sialyltransferase PROPERTIES: soluble sialyltransferase (EC 2.4.99.1) from human HepG2 cells Lys Leu Gin Thr Lys Glu Phe Gin Val Leu Lys Ser Leu Gly Lys Leu Ala Met Gly Ser Asp Ser 15 Gin Ser Val Ser Ser Ser Ser Thr Gin Asp Pro His Arg 30 Gly Arg Gin Thr Leu Gly Ser Leu Arg Gly Leu Ala Lys Ala Lys Pro Glu Ala Ser Phe Gin Val Trp Asn Lys Asp 55 Ser Ser Ser Lys Asn Leu Ile Pro Arg Leu Gin Lys Ile Trp Lys Asn Tyr Leu Ser Met Asn Lys Tyr Lys Val Ser 80 Tyr Lys Gly Pro Gly Pro Gly Ile Lys Phe Ser Ala Glu 95 100 Ala Leu Arg Cys His Leu Arg Asp His Val Asn Val Ser 105 110 Met Val Glu Val Thr Asp Phe Pro Phe Asn Thr Ser Glu 115 120 125 h 57 Trp Giu Gly Tyr Leu Pro Lys Glu 130 Ser Ile 135 Arg Thr Lys Ala 140 Gly Pro Trp Gly Arg Cys Ala 145 Val Val Ser 150 Ser Ala Gly Ser Leu Lys Ser Ser Gin Leu 155 160 Asp His Asp Ala Val Leu Arg Phe 170 Gly Arg Giu Ile Asp 165 Asn Gly 175 Aia Pro Thr Ala Asn 180 Phe Gin Gin Asp Vai Giy 185 Thr Lys Thr Thr Ile 190 Arg Leu Met Asn 195 t4 4 Phe 205 Leu Lys Asp Ser Gin Leu Vai Ser Leu Tyr Asn 210 Ser Vai Tyr His 225 Pro Asp Tyr Asn 235 Glu Gly Ile Leu Ile 215 Thr 200 Thr Glu Lys Arg Val Trp Asp Pro 220 Trp Tyr Gin Asn Ser Asp Ile Pro Ly s 230 Phe Phe 240 Asn Asn Tyr Lys Thr 245 Tyr Arg Lys Leu His Pro 250 Asn Gin Pro Phe Tyr 255 Ile Leu Lys Pro Gin Met Pro Trp 260 Giu 265 Leu Trp Asp Ile Leu 270 Gin Giu Ile Ser Pro Giu Giu 275 Ile Gin Pro Asn Pro 280 .1 58 Pro Ser Ser Gly Met Leu Gly Ile Ile Ile Met Met Thr 285 290 295 Leu. Cys Asp Gin Val Asp Ile Tyr Giu Phe Leu Pro Ser 300 305 Lys Arg Lys Thr Asp Vai Cys Tyr Tyr Tyr Gin Lys Phe 310 315 320 Phe Asp Ser Aia Cys Thr Met Giy Aia Tyr His Pro Leu 4 4 4 *44 4 4444 441444 4 325 330 Leu Tyr Giu Lys Asn Leu Val Lys His Leu Asn Gin Giy 335 340 345 Thr Asp Giu Asp Ile Tyr Leu Leu Giy Lys Aia Thr Leu 350 355 360 I I Pro Giy Phe Arg Thr Ile His Cys 365 4 4 4 14 -59- SEQ ID SEQUENCE TYPE: Nucleotide sequence with corresponding protein SEQUENCE LENGTH: 1400 bp STRANDEDNESS: double TOPOLOGY: linear IMMEDIATE EXPERIMENTAL SOURCE: BRB.ELFT/pCR1000-13 k a r a alit a~ it

FEATURES:

from 58 to 1272 bp from 238 to 243 bp PROPERTIES: HL60 cDNA transferase cDNA sequence coding forhumana(1-3) fucosyltransferase NruI site coding for full-length a(1-3) fucosyl- CGCTCCTCCA CGCCTGCGGA CGCGTGGCGA GCGGAGGCAG CGCTGCCTGT TCGCGCC ATG Met k

GCG

Ala

CCA

Pro

TGT

Cys

CCG

Pro

GGC

Gly

TGG

Trp

ACG

Thr

CCG

Pro

GGG

Gly

ACC

Thr

GCG

Ala

CTG

Leu GGG GCA Gly Ala CGG CGC Arg Arg GTC TGT Val Cys CTG ATC Leu Ile CCC TGG Pro Trp

CCG

Pro

GGG

Gly

GTG

Val 30

ACC

Thr

GCG

Ala

TGG

Trp

TGG

Trp

CTG

Leu

TAC

Tyr

TCG

Ser

GGC

Gly

CGC

Arg

GCG

Ala

GCT

Ala 45

CCA

Pro

TCG

Ser

CGA

Arg

GCC

Ala

TGC

Cys

ACC

Thr

CCG

Pro

GGC

Gly

GCC

Ala

TGG

Trp

CCG

Pro

ACG

Thr

CGG

Arg

GGC

Gly

GGG

Gly

TCG

Ser

GCG

Ala

GGG

Gly

TTG

Leu

CAG

Gln

CGA

Arg

CTG

Leu 129

GCG

Ala

ACG

Thr

CTG

Leu

CCG

Pro 168 207 246 i i;,

I

-I

~asg r i-

I'

GTG GGC GTG CTG CTG TGG TGG GAG Glu Val Gly Val GAT AGC GCC Asp Ser Ala TTC AAC ATC Phe Asn Ile TCC TAC GGA Ser Tyr Gly 105 GAC CTC GTG Asp Leu Val GGC ATC CAG Gly Ile Gin 130 GTG TTG GAC Val Leu Asp Leu Leu Trp Trp 70 i: Iq~ CCG AGG Pro Arg AGC GGC Ser Gly GAG GCT Glu Ala AAG GGG Lys Gly 120 GCG CAC Ala His TAC GAG Tyr Glu 145 TCC AGC Ser Ser CCG CCC Pro Pro TGC CGC CTG Cys Arg Leu 95 CAG GCC Gin Ala CCC CCC Pro Pro ACT GCC Thr Ala 135 GAG GCA Glu Ala

GTG

Val 110

GAC

Asp

GAG

Glu

GCG

Ala

CCT

Pro CCC TTC GGG GGG Pro Phe Gly Gly GAC TGC CGG CTG Asp Cys Arg Leu CTC ACC GAC CGC Leu Thr Asp Arg 100 CTT TTC CAC CAC Leu Phe His His TGG CCC CCG CCC Trp Pro Pro Pro 125 GAG GTG GAT CTG Glu Val Asp Leu 140 GCG GCG GCA GAA Ala Ala Ala Glu 150 CCG GGC CAG CGC Pro Gly Gin Arg 165 TCG CAC TCC CCG Ser His Ser Pro

GCG

Ala 363

CGC

Arg 324

CGC

Arg 115

TGG

Trp

CGC

Arg

GCC

Ala

TGG

Trp 402 CGC 285 Arg 480 519

CTG

Leu 155

GTT

Val GCG ACC Ala Thr CCC AGG CCC Pro Arg Pro 160 GAG TCG CCC Glu Ser Pro 175 558 TGG ATG Trp Met 170 AAC TTC Asn Phe

GGG

Gly 180 597 ji L_

K

61 OTG OGA AGC CTG GOA AGT AAC OTO TTC Leu Arg Ser Leu Ala Ser Asn Leu Phe 185 TCO TAC OGG GCG GAO TCG GAO GTO TTT Ser Tyr Arg Ala Asp Ser Asp Val Phe 195 200

AAC

Asn 190

GTG

Val1

TG

Trp

AOG

Thr O TO Leu 636

CCT

Pro

TAT

Tyr 205

GC

G ly 675 TAO OTO TAC 000 AG A AGO CAC 000 GGO GAO Tyr Leu Tyr Pro Arg Ser His Pro Gly Asp 210 215 OOG 000 Pro Pro

TOA

Ser 714 I I C C C 55CC C CCCC GGO OTG GOO OOG OOA OTG TOO AGG AAA Gly Leu Ala Pro Pro Leu Ser Arg Lys 220 225 GOA TGG GTG GTG AGO CAC TGG GAO GAG Ala Trp Val Vai Ser His Trp Asp Giu 235 240 GTO OGO TAO TAO CAC CAA OTG AGO CAA Val Arg Tyr Tyr His Gin Leu Ser Gin 250 GAO GTG TTO GGO OGG GGO GGG OOG GGG Asp Val Phe Giy Arg Gly Gly Pro Gly 260 265 GAA ATT GGG OTO OTG CAC ACA GTG GOO Giu Ile Gly Leu Leu His Thr Val Ala 275 280

OAG

Gin

OGO

Arg

OAT

His 255

OAG

Gin

OGO

Arg

GGG

Gly 230

OAG

Gin

GTG

Val1

OOG

Pro

TAO

Tyr O TG Leu

GOO

Ala

ACC

Thr

GTG

Vai 270

AAG

Ly s

GTG

Val1 753

OGG

Arg 245

GTG

Val

I

-4 ~JJ t t 000 Pro 870

TTO

Phe 909 TAO OTG GOT TTO GAG AAO TOG OAG CAC OTG GAT' TAT ATO Tyr Leu Ala Phe Glu Asn Ser Gin His Leu Asp Tyr Ile 285 290 295 948 i

Y~~

;f* i i? P: srl: i ii 4.

-62- ACO GAG AAG CTC TGG CGC AAC GCG TTG CTC Thr Glu Lys Leu Trp Arg Asn Ala Leu Leu 300 305 GTG CCG GTG GTG CTG GGO CCA GAC OGT GCO Val Pro Val Val Leu Gly Pro Asp Arg Ala 315 320 CGC TTT GTG CCC CGC GGO GOC TTC ATC CAC Arg Phe Val Pro Arg Gly Ala Phe Ile His 325 330 TTC OCA AGT GOC TCO TCC CTG GOC TCG TAC Phe Pro Ser Ala Ser Ser Leu Ala Ser Tyr 340 345 GCT GGG GCG Ala Gly Ala 310 AAC TAC GAG Asn Tyr Glu GTG GAO GAO Val Asp Asp 335 OTG OTT TTO Leu Leu Phe 987 1026 1065 1104 44 I 41 .4~r 4 4144 4i41

CTC

Leu 350 GAC CGC AAC CCC GOG GTO TAT CGC CGC Asp Arg Asn Pro Ala Val Tyr Arg Arg 355 I t Ic C 44 44 4 4 44 4i 4 TGG CGC CGG AGO TAO GOT GTC CAC ATO ACC Trp Arg Arg Ser Tyr Ala Val His Ile Thr 365 370 GAO GAG CCT TGG TGC CGG GTG TGC CAG GCT Asp Glu Pro Trp Cys Arg Val Oys Gin Ala 380 385 TAO TTC CAC Tyr Phe His 360 TCC TTO TGG Ser Phe Trp 375 GTA OAG AGG Val Gin Arg TTG GOC AGO Leu Ala Ser 400 1182 1143 1221 :d Fr j~

GCT

Ala GGG GAC CGG CCC AAG AGO ATA OGG AAO Gly Asp Arg Pro Lys Ser Ile Arg Asn 390 395 1260

TGG

Trp TTO GAG OGG TGAAGCCGCG CTCCCCTGGA AGOGACCCAG Phe Glu Arg 405 1302 63 GGGAGCCCAA GTTGTCAGCT TTTTCATCCT CTACTGTGCA TCTCCTTGAC 1352 TGCCCCATCA TGGGACTAAG TTCTTCAAAC ACCCATTTTT GCTCTATG 1400 t f Ut

Claims (19)

1. Process for the production of a membrane-bound mammalian glycosyltransferase selected from the group consisting of a galactosyltransferase, a sialyltransferase and a fucosyltransferase, or a soluble variant thereof, respectively, wherein the variant differs from the corresponding full-length glycosyltransferase by lack of the cytoplasmic tail, the signal anchor and, optionally, a minor part of the stem region, said process comprising culturing a yeast strain which has been transformed with a hybrid vector comprising an expression cassette comprising a promoter and a DNA sequence coding for said glycosyl- transferase or variant which DNA is controlled by said promoter, and recovering the enzymatic activity.

2. Process according to claim 1, wherein the glycosyltransferase is of human origin.

3. Process for the production of a variant according to claim 1, wherein the variant differs from the corresponding full-length glycosyltransferase by lack of the cytoplasmic tail, the signal anchor and, optionally, a minor part of the stem region.

4. Process for the production of a variant according to claim 3 comprising culturing a yeast strain comprising an expression cassette comprising a promoter operably linked to a first DNA sequence encoding a signal peptide linked in the proper reading frame to a second DNA sequence coding for said variant which DNA sequence is controlled by said promoter, and recovering the enzymatic activity.

Process according to claim 1, wherein the glycosyltransferase is a galactosyltransferase.

6. Process according to claim 5, wherein the galactosyltransferase is selected from the Sgroup consisting of UDP-Galactose: P-galactoside a(l-3)-galactosyltransferase S(EC 2.4.1.151) and UDP-Galactose: p-N-acetylglucosamine p(1-4)-galactosyltransferase (EC 2.4.1.22).

7. Process according to claim 5, wherein the galactosyltransferase has the amino acid sequence depicted in SEQ ID NO. 1.

8. Process according to claim 5, wherein the galactosyltransferase has the amino acid ,f"Ft sequence depicted in SEQ ID NO. 2. I-

9. Process according to claim 1, wherein the glycosyltransferase is a sialyltransferase.

Process according to claim 9, wherein the sialyltransferase is CMP-NeuAc P-galactoside a(2-6)-sialyltransferase (EC 2.4.99.1).

11. Process according to claim 9, wherein the sialyltransferase has the amino acid sequence depicted in SEQ ID NO. 3.

12. Process according to claim 9, wherein the sialyltransferase is designated ST(Lys 27 -Cys 406 and consists of amino acids 27 to 406 of the amino acid sequence listed in SEQ. ID NO. 3.

13. Process according to claim 9, wherein the sialyltransferase has the amino acid sequence depicted in SEQ ID NO. 4. 1 4 ~f'r3~ T

14. Process according to claim 1, wherein the glycosyltransferase is a fucosyltransferase.

Process according to claim 14, wherein the fucosyltransferase is selected from the group consisting of GDP-Fucose.' ga.actoside a(1-2)-fucosyltransferase (EC 2.4.1.69) and GDP-Fucose:N-acetylglucosamine ao(1-3/4)-fucosyltransferase (EC 2.4.1.65).

16. Process according to claim 14, wherein the fucosyltransferase has the amino acid sequence depicted in SEQ ID NO.

17. Process according to claim 14, wherein the fucosyltransferase is designated FT(Arg 62 -Arg 4 05 and consists of amino acids 62 to 405 of the amino acid sequence depicted in SEQ ID. NO.

18. A yeast hybrid vector comprising an expression cassette comprising a yeast promoter and a DNA sequence coding for a membrane-bound mammalian glycosyltransferase selected from the group consisting of a galactosyltransferase, a sialyltransferase and a fucosyltransferase, or a soluble variant thereof, respectively, wherein the variant differs from the corresponding full-length glycosyltransferase by lack of the cytoplasmic tail, the signal anchor and, optionally, a minor part of the stem region, which DNA sequence is controlled by said promoter. c I: i_ i i~ l i- IriFt Mt !9 Llk l 66

19. A yeast strain which has been transformed with a hybrid vector according to claim 18. DATED this 28th day of September, 1994 CIBA-GEIGY AG By Its Patent Attorneys DAVIES COLLISON CAVE 1311~ a "UXL 44 44 *44 *r 4