JPH05199871A - Improved production of glycosyltransferase - Google Patents

Abstract

PURPOSE: To provide a new method regarding the field of recombinant DNA technology and for producing glycosyltransferase by the use of a transformed yeast strain.

CONSTITUTION: This method comprises the production of membrane-bound mammalian glycosyltransferase selected from the group consisting of galatosytransferase, sialyltransferase and fucosyltransferase, or variants thereof, being characterized by that a yeast strain transformed by a hybrid vector containing an expression cassette containing a DNA sequence (to be controlled by a promoter) coding for the promoter and glycosyltransferase or variants thereof is cultured and the resultant enzymatic activity is recovered.

COPYRIGHT: (C)1993,JPO

Description

Detailed Description of the Invention

[0001]

FIELD OF THE INVENTION The present invention relates to the field of recombinant DNA technology and provides improved methods of producing glycosyltransferases by the use of transformed yeast strains.

[0002]

Glycosyltransferases convert sugar residues from an activated donor substrate, usually a nucleotide sugar, into specific acceptors, thus forming glycosidic bonds. Based on the type of sugar converted, these enzymes are divided into families such as galactosyltransferase, sialyltransferase and fucosyltransferase. Glycosyltransferases, which are membrane proteins naturally located in the Golgi apparatus, share a common domain structure, which consists of a short amino-terminal cytoplasmic tail, a signal-anchor domain, and an extended stem region. Then the large C-terminal catalytic domain is present.

The signal-anchor domain acts both as a non-cleavable signal protein and a spanning region of the membrane, and directs the catalytic domain of glycosyltransferases within the Golgi lumen.
The lumen stem or spacer region acts as a flexible “tether” allowing the catalytic domain to glycosylate carbohydrate groups on membrane-bound and soluble proteins of the secretory pathway as it passes through the Golgi apparatus. Furthermore, it was found that the stem portion functions as a retention signal and retains the enzyme in association with the Golgi membrane (PCT application No. 91/06635). Soluble forms of glycosyltransferases are found in milk, serum and other body fluids. It is speculated that these soluble glycosyltransferases result from their corresponding membrane-bound forms of the enzyme, possibly by cleavage between the catalytic and transmembrane domains by endogenous proteases.

Enzymatic synthesis of carbohydrate structures has the advantage of high stereoselectivity and regioselectivity, making glycosyltransferases a valuable tool for the modification or synthesis of glycoproteins, glycolipids and oligosaccharides. In contrast to chemical methods, the time-consuming introduction of protecting groups is unnecessary. Glycosyltransferases are naturally present in very low abundance, making isolation and subsequent purification from natural sources difficult. Therefore, manufacturing using recombinant DNA technology has been investigated. For example, galactosyltransferase E. coli (E. Coli)
(PCT90 / 07000) and Chinese hamster ovary (CHO) cells (Smith, DF et al.
(1990) J. Biol. Chem. 265, 6225-34), sialyltransferase is a CHO cell (Lee, EU (1990) Diss. Abs.
tr.Int.B.50, 3453-4) and COS-1 cells (Paulse
n, JC et al. (1988) J. Cell. Biol. 107, 10A) and fucosyltransferase was expressed in COS-1 cells (Goelz, SE et al. (1990) Cell 63, 1349-1356; Larsen).
RD et al. (1990) Proc.Natl.Acad.Sci.USA 87, 6674
-6678) and CHO cells (Potvin, B. (1990) J. Biol. C.
hem. 265, 1615-1622). Heterologous expression in prokaryotes has the disadvantage of providing the glycoprotein glycosyltransferase as a non-glycosylated product, and the production of glycosyltransferases by the use of mammalian hosts is very costly and In view of the fact that it is complicated by the presence of multiple endogenous glycosyltransferases that contaminate the product, there is a need for improved methods that allow large-scale economic production of glycosyltransferases.

The object of the present invention is to provide such a method. The present invention provides methods for producing biologically active glycosyltransferases using recombinant vector technology in yeast vector expression systems.
More particularly, the present invention provides a method for producing a mammalian membrane-bound glycosyltransferase selected from the group consisting of galactosyltransferase, sialyltransferase and fucosyltransferase, or a variant thereof, which method comprises the promoter and the glycosyl glycoside. Culturing a yeast strain transformed with a hybrid vector comprising an expression cassette comprising a DNA sequence encoding a transferase or a variant, wherein the DNA is controlled by the promoter and the enzymatic activity is recovered. Is characterized by.

In a first embodiment, the present invention relates to a method for producing a mammalian membrane-bound glycosyltransferase selected from the group consisting of galactosyltransferase, sialyltransferase and fucosyltransferase, or a variant thereof, which method comprises a promoter, Transformed with a hybrid vector comprising an expression cassette comprising a DNA sequence encoding said glycosyltransferase or a variant (which DNA sequence is controlled by said promoter) and a DNA sequence containing a yeast transcription termination signal. And culturing the yeast strain and recovering the enzyme activity.

In a second embodiment, the present invention relates to a method for producing a mammalian membrane-bound glycosyltransferase selected from the group consisting of galactosyltransferase, sialyltransferase and fucosyltransferase, or a variant thereof, which method comprises A promoter operably linked to a first DNA sequence encoding a signal peptide linked in proper reading frame to a second DNA sequence encoding a transferase or variant, and a DNA sequence containing a yeast transcription termination signal Culturing a yeast strain transformed with the hybrid vector comprising the expression cassette and recovering the enzymatic activity.

The term “glycosyltransferase”
As used herein is intended to encompass the family of galactosyltransferases, the family of sialyltransferases and the family of fucosyltransferases. The glycosyltransferases are naturally occurring enzymes of mammalian, eg, bovine, murine, rat and human origin. After that EC
It includes enzymes identified by numbers. Naturally occurring human full length glycosyltransferases are preferred.

The membrane-bound glycosyltransferases and variants thereof obtainable by the method of the invention catalyze the conversion of an activated donor, usually nucleotide-activated uridine diphosphate galactose, into a carbohydrate group of a galactose residue. . Examples of membrane-bound glycosyltransferases are: UDP-galactose: β-galactoside α (1-3) -galactosyltransferase (EC 2.4.1.151), which is α (1-3) -linked. Galactose is used as an acceptor substrate to form) and UDP-galactose: β-N-acetylglucosamine β (1-4) -galactosyltransferase (EC 2.4.1.2).
2), which converts galactose to N-acetylglucosamine (GlcNAc) to form β (1-4) -bonds, each of which includes variants thereof.
In the presence of α-lactalbumin, the β (1-4)-
Galactosyltransferases also accept glucose as an acceptor substrate and thus catalyze the synthesis of lactose.

The most preferred membrane-bound galactosyltransferase is an enzyme having the amino acid sequence shown in SEQ ID NO: 1. Membrane-bound sialyltransferases and variants thereof obtainable in accordance with the present invention include activated donors, usually cytidine monophosphate sialic acid (CMP-SA) to sialic acid (eg N.
Catalyses the conversion of acetylneuraminic acid (NeuAc) to carbohydrate acceptor residues. One example of a membrane-bound sialyltransferase obtainable by the method of the invention is CMP-NeuAc: β-galactoside α (2-6) -sialyltransferase (EC
2.4.9.1), which is a common NeuAc-α (2-6) Gal for multiple N-linked carbohydrate groups.
-Β (1-4) GlcNAc-sequence is formed.

The most preferred sialyltransferase is an enzyme having the amino acid sequence shown in SEQ ID NO: 3. Membrane-bound fucosyltransferases and variants thereof obtainable by the method of the invention include activated donors, usually nucleotide-activated donors,
For example, guanosine diphosphate fucose (GDP-
Catalyzes the conversion of fucose residues from Fuc) into carbohydrate groups. An example of such a fucosyltransferase is GDP-fucose: β-galactoside α (1-2).
-Fucosyl transferase (EC 2.4.1.6
9) and GDP-fucose: N-acetylglucosamine α (1−3 / 4) -fucosyltransferase (E
C2.4.1.65).

The most preferred membrane-bound fucosyltransferase is an enzyme having the amino acid sequence shown in SEQ ID NO: 5. The term "variant" as used herein is intended to include both membrane-bound and soluble variants of naturally-occurring membrane-bound glycosyltransferases of mammalian origin, provided that these variants are Provided that it is enzymatically active. Preferred variants are of human origin.

For example, the term "variant" is a naturally occurring membrane-bound variant of a membrane-bound glycosyltransferase found within a particular species, such as a variant of galactosyltransferase, which variant is at position 11.
Differs from the enzyme having the amino acid sequence of SEQ ID NO: 1 in that it lacks the serine in and has the amino acids valine and tyrosine instead of alanine and leucine in positions 31 and 32, respectively. Such variants are encoded by related genes of the same gene family or by allelic variants of a particular gene.

The term "variant" also embraces glycosyltransferases produced from DNA subjected to in vitro mutagen, provided that the protein encoded by said DNA has the enzymatic activity of the native glycosyltransferase. Such modifications may further consist of amino acid exchanges and / or deletions, the latter resulting in truncated variants.

Preferred variants according to the method of the invention are shortened variants, especially soluble variants, ie variants which are not membrane bound. Truncated variants are, for example, soluble forms of membrane-bound glycosyltransferases and their membrane-bound variants, such as the aforementioned variants,
These can be secreted by the transformed yeast strains used according to the invention. According to the invention, these soluble enzymes are the preferred truncated variants.

The invention also relates to a method for producing a soluble variant of a membrane-bound glycosyltransferase selected from the group consisting of galactosyltransferase, sialyltransferase and fucosyltransferase, which method comprises a second D encoding said variant.
An expression cassette comprising a promoter operably linked to a first DNA sequence encoding a signal peptide linked in proper reading frame to an NA sequence, and a DNA sequence containing a yeast transcription termination signal It is characterized by culturing a yeast strain transformed with the hybrid vector and recovering the enzyme activity.

By definition, the soluble forms of glycosyltransferases range from corresponding full-length, ie, naturally-occurring, membrane-bound forms in the endoplasmic reticulum or Golgi complex, to cytoplasmic tails, signal anchors, and optionally stem regions. It is a shortened variant that differs due to the lack of a part of. The term "portion of the stem region", as used herein, is defined as the small portion of the N-terminal side of the stem region consisting of up to 12 amino acids. In other words, the soluble variants prepared by the method of the invention consist essentially of the entire stem region and catalytic domain.

Soluble variants are 26-67, especially 26
By the absence of NH ₂ -terminal peptides consisting of -61 amino acid residues, unlike the form of the corresponding full-length, but those forms lacking a portion of the stem region lacking only the small portion as defined above. Soluble variants obtainable from the membrane-bound glycosyltransferases identified by the EC number above and additional soluble variants obtainable from the membrane-bound fucosyltransferase having the sequence SEQ ID NO: 5 are preferred.

The preferred soluble variant of galactosyltransferase differs from the corresponding full-length form in lacking the NH ₂ -terminal peptide consisting of 37-55, in particular 41-44 amino acids. The most preferred soluble variant prepared according to the method of the invention is SEQ ID NO: 2.
It is an enzyme having the amino acid sequence shown by the sequence.

Preferred soluble variants of sialyltransferases, lacking NH ₂ -terminal peptides consisting of 26-38 amino acids as compared to the total length of the form. The most preferred soluble variant prepared according to the method of the present invention is an enzyme having the amino acid sequence shown in SEQ ID NO: 4. Similarly, ST (Lys ₂₇ -Cys ₄₀₆ ) consisting of amino acids 27-406 of the amino acid sequence shown in SEQ ID NO: 3.
Soluble variants denoted by are preferred.

A preferred soluble variant of fucosyltransferase differs from the corresponding full-length enzyme in the lack of an NH ₂ -terminal peptide consisting of 56-67, especially 56-61 amino acids. FT consisting of amino acids 62-405 of the amino acid sequence listed in SEQ ID NO: 5
(Arg ₆₂ -Arg ₄₀₅₎ soluble form to be displayed and is particularly preferred.

The components of the yeast host strain and hybrid vectors are specified below. The transformed yeast strain is cultured by methods known in the art. Thus, the transformed yeast strain according to the invention is cultivated in a liquid medium containing assimilable sources of carbon, nitrogen and inorganic salts.

Various carbon sources can be used. Examples of preferred carbon sources are assimilable carbohydrates such as glucose,
Maltose, mannitol, fructose or lactose, or acetates such as sodium acetate, which can be used alone or in suitable mixtures. Suitable nitrogen sources include, for example: amino acids such as casamino acids, peptides and proteins and their degradation products such as tryptone, peptone or meat extracts, as well as yeast extract, malt extract, corn steep. Liquids, as well as ammonium salts, such as ammonium chloride, sulfate or nitrate,
These can be used alone or in suitable mixtures. Inorganic salts that can be used include, for example, sodium, potassium, magnesium and calcium sulfates, chlorides, phosphates and carbonates. In addition, the nutrient medium can also contain growth promoting substances. Growth promoting substances include, for example, trace elements such as iron, zinc, manganese, etc., or individual amino acids.

Due to the incompatibility between the endogenous 2 micron DNA and the hybrid vector containing the replicon, yeast cells transformed with such hybrid vectors tend to lose the hybrid vector. Such yeast cells must be grown under selective conditions, that is, conditions that require expression of the plasmid-encoded gene for growth. Most selectable markers currently used and present in hybrid vectors according to the invention (see below)
Is a gene encoding an amino acid or purine biosynthetic enzyme.

This requires the use of synthetic minimal medium lacking the corresponding amino acids or purine bases. However, genes conferring resistance to suitable biocides can be used as well [eg, genes conferring resistance to the amino-glycoside G418]. Yeast cells transformed with a vector containing an antibiotic resistance gene grow in complex medium containing the corresponding antibiotic, thereby reaching faster growth rates and higher cell densities.

A hybrid vector comprising complete 2 micron DNA (including a functional origin of replication) is a strain of Saccharomyces cerevisiae (so-called c which lacks the endogenous 2 micron plasmid).
Since it is stably maintained in (ir ⁰ strain), the culture can be performed under non-selective growth conditions, that is, in complex medium.

Yeast cells which contain the hybrid plasmid with a constitutive promoter express the DNA encoding the glycosyltransferase or variants thereof, which is controlled by said promoter without induction. However, if the DNA is under the control of a regulated promoter, the composition of the growth medium must be adapted to obtain maximal levels of mRNA transcripts, for example when using the PH05 promoter, the growth medium is Must contain low concentrations of inorganic phosphate for repression of this promoter.

Culturing is carried out by using conventional techniques. Culture conditions, such as temperature, medium pH and fermentation time, are selected to produce maximal levels of heterologous protein. The selected yeast strain is preferably about 25 to about 25 to 50% with shaking or stirring in submerged culture under aerobic conditions.
Grow at a temperature of 35 ° C., preferably about 28 ° C., at pH 4-7, eg about pH 5, for at least 1 to 3 days, preferably until a satisfactory yield of protein is obtained.

After expression in yeast, the glycosyltransferase or a variant thereof accumulates in the cells or is secreted into the medium and is isolated by conventional means. For example, the first step generally consists in separating the cells from the medium by centrifugation. If the glycosyltransferase or a variant thereof accumulates intracellularly, the protein must be released from the inside of the cell by cytolysis. Yeast cells may be subjected to a variety of methods well known in the art, such as exerting mechanical forces, eg shaking with glass beads, ultrasonic vibrations, osmotic shock and / or cell wall enzymes. It can be disintegrated by digestion.

If the glycosyltransferase to be isolated or a variant thereof is associated with or bound to the membrane fraction, further concentration can be carried out, for example, by fractional centrifugation of the cell extract and optionally Correspondingly, it can be achieved by subsequent treatment with a specific fraction of detergent, for example Triton. Suitable methods for purification of crude glycosyltransferase or variants thereof include
Standard chromatography, eg affinity chromatography, eg appropriate substrate, antibody or concanavalin A, ion exchange chromatography, gel filtration, partition chromatography, HPLC, electrophoresis, precipitation steps,
For example, ammonium sulfate precipitation and other methods, especially those known from the literature.

If the glycosyltransferase or a variant thereof is secreted by the yeast cell into the periplasmic space, a simplified isolation protocol can be used. Chemical factors that cause the protein to be enzymatically removed from the cell wall without lysing the cell, or damage the cell wall and release the glycosyltransferase produced,
For example, it is recovered with a thiol reagent or EDTA.
If the glycosyltransferase or a variant thereof is secreted into the culture medium, it can be directly recovered from it and purified using the methods described above.

To detect glycosyltransferase activity, assays known from the literature can be used. For example, glycosyltransferase activity can be measured by determining the amount of radiolabeled galactose incorporated into a suitable acceptor molecule, eg, a glycoprotein or free sugar residue.
Similarly, sialyltransferase activity is, for example,
It can be measured by including sialic acid in a suitable substrate, and fucosyltransferase activity can be measured by conversion of fucose to a suitable acceptor.

Yeast host cells transformed according to the invention can be prepared by recombinant DNA technology comprising the steps of: -a DNA sequence encoding the yeast promoter and membrane-bound glycosyltransferase or variants thereof. A hybrid vector comprising (wherein this DNA sequence is controlled by said promoter) is prepared, -a yeast host cell is transformed with said hybrid vector, and-a transformed yeast cell is selected from untransformed yeast cells. To do.

Expression Vector The yeast hybrid vector according to the present invention comprises an expression cassette comprising a yeast promoter and a DNA sequence coding for a membrane-bound glycosyltransferase or a variant thereof, which DNA sequence is controlled by said promoter. It consists of

In a first embodiment, the yeast hybrid vector according to the invention comprises a yeast promoter, a DNA sequence encoding a membrane-bound glycosyltransferase or a variant thereof (this DNA sequence is controlled by said promoter) and a yeast transcription. It comprises an expression cassette comprising a DNA sequence containing a stop signal.

In a second embodiment, the yeast hybrid vector according to the invention comprises a second DNA encoding a membrane-bound glycosyltransferase or a variant thereof.
An expression cassette comprising a promoter operably linked to a first DNA sequence encoding a signal peptide linked in proper reading frame to the sequence, and a DNA sequence containing a yeast transcription termination signal.

The yeast promoter is preferably a regulated or constitutive promoter derived from the highly expressed yeast gene, especially the Saccharomyces cerevisiae gene. Thus, TRP1 gene, ADH
I or ADHII gene, acid phosphatase (PH0
5) Promoter of gene, promoter of yeast exchange pheromone gene encoding a- or α-factor or promoter derived from gene encoding glycolase, for example, enolase, glyceraldehyde-3-phosphate dehydrogenase (GAP) ,
3-phosphoglycerate kinase (PGK), hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase or gluco. The promoter of the gene for the kinase can be used.

Furthermore, a hybrid promoter comprising an upstream activating sequence (UAS) of one yeast gene and a downstream promoter element comprising a functional TATA box of another yeast gene, eg one or more of the yeast PH05 gene. Hybrid promoter (PH05-
GAP hybrid promoters) can be used.

The preferred promoter is the promoter of the GAP gene, especially the positions -550 and -for the GAP gene.
Nucleotides between 180, especially -540, -26
It is a functional fragment thereof starting at 3 or -198 and ending at nucleotide -5. Another preferred promoter of the regulated type is the PH05 promoter. As a constitutive promoter, a truncated acid phosphatase PH05 promoter lacking upstream regulatory elements (UAS), as well as PH05 (-1 starting at nucleotide -173 and ending at nucleotide -9 of the PH05 gene.
73) Promoter elements are preferred.

The DNA sequence encoding the signal peptide ("signal sequence") is preferably derived from the yeast gene which encodes the normally secreted polypeptide. Other signal sequences for normally secreted heterologous proteins can also be selected. Yeast signal sequences include, for example, the yeast invertase, α-factor, pheromone peptidase (KEX1), “chelatoxin” and regulatable acid phosphatase (PH05) gene signal and prepro sequences, and Aspergillus awamori ( It is the signal sequence of glucoamylase from Aspergillus awamori ).

Alternatively, the fusion signal sequence may be such that a portion of the signal sequence (if present) of the gene naturally associated with the promoter used (eg PH05) is linked to a portion of the signal sequence of another heterologous protein. Can be configured by Combinations that allow the correct cleavage between the signal sequence and the amino acid sequence of the glycosyltransferase are preferred. Additional sequences, eg
Prosequences or spacer sequences, with or without specific processing signals, can also be included in the construct to facilitate correct processing of the precursor molecule.

Alternatively, a fusion protein containing an internal processing signal may be generated which allows for proper maturing in vivo or in vitro. For example, the processing signal is L recognized by a yeast endopeptidase located in the Golgi membrane.
ys-Arg is included. A preferred signal sequence according to the invention is that of the yeast invertase gene.

When the full length glycosyltransferase, or a membrane bound variant thereof, is expressed in yeast,
A preferred yeast hybrid vector comprises an expression cassette comprising a yeast promoter, a DNA sequence encoding said glycosyltransferase or variants thereof (which DNA sequence is controlled by said promoter) and a yeast transcription termination signal.
If the DNA encodes a membrane-bound enzyme, no additional signal sequence is needed.

When a soluble variant of a membrane-bound glycosyltransferase is expressed in yeast, a preferred yeast hybrid vector will have a first DNA sequence encoding a signal peptide linked in proper reading frame to a second DNA sequence encoding said variant. It comprises an operably linked yeast promoter and a DNA sequence containing a yeast transcription termination signal.

The DNA encoding the membrane-bound glycosyltransferase or variants thereof can be prepared by methods known in the art, and genomic DNA, eg, a library of mammalian genomic DNA, eg, , Genomic DNA isolated from rat, murine, bovine or human cells. If necessary, the intron present in the genomic DNA encoding the enzyme is removed. In addition, the DNA encoding the membrane-bound glycosyltransferase or variants thereof comprises cDNA that can be isolated from a mammalian cDNA library or generated from the corresponding mRNA. cDNA can be derived from a variety of tissues, such as placental cells or liver cells. Preparation of cDNA via mRNA is accomplished using conventional methods, eg, polymerase chain reaction (PCR).

For example, mammalian cells such as HeLa
Isolation of poly (A) ⁺ RNA from cells and subsequent initial cDNA synthesis is performed according to standard procedures known in the art. Starting from this synthesized DNA template, the sequence targeted using PCR, namely the glycosyltransferase DN
Although A or fragments thereof can be amplified, amplification of many non-target sequences is minimal. For this purpose, the sequence of a small stretch of nucleotides on each side of the target sequence must be known.

Using these flanking sequences, 2
One synthetic single-stranded primer oligonucleotide is designed and the sequences are selected such that each has a base pair that is complementary to its respective flanking sequence. P
CR begins with the denaturation of the mRNA-DNA hybrid strand and then anneals the primer to sequences that flank the target. Addition of DNA polymerase and desoxynucleoside triphosphates forms two pieces of double-stranded DNA, each starting with a primer and extending across the target sequence, thereby copying the target sequence. Each of the newly synthesized products can serve as a primer for primer annealing and extension (next cycle), thus leading to an exponential increase in well-defined double-stranded fragments.

In addition, the DNA encoding the membrane-bound glycosyltransferase or variants thereof can be enzymatically or chemically synthesized. A variant of a membrane-bound glycosyltransferase having an amino acid sequence in which one or more amino acids are deleted and / or exchanged with one or more other amino acids and which has enzymatic activity is a mutant DNA. Coded by Furthermore, variant DNA is intended to include silent mutations in which one or more nucleotides have been replaced with one or more other nucleotides such that the same amino acid is encoded by a new codon.

The sequence of such a mutation is also degenerate D
NA sequence. A degenerate DNA sequence is degenerate within the meaning of the genetic code in that a limited number of nucleotides are replaced by other nucleotides without altering the originally encoded amino acid sequence. Such degenerate DNA sequences are useful because of their different restriction enzyme recognition sites and / or because of the frequency of particular codons preferred by particular hosts to obtain optimal expression of glycosyltransferases or variants thereof. Is.
Preferably, such DNA sequences use yeast preferred codons.

Mutant DNA may also be a naturally occurring genomic DNA, according to methods known in the art.
Alternatively, it can be obtained by in vitro mutation of cDNA. For example, a partial DNA encoding a soluble form of a glycosyl transferase is encoded by the full length DN encoding the corresponding membrane-bound glycosyl transferase.
From A, it can be excised using restriction enzymes. The availability of suitable recognition sites is therefore advantageous.

DNA containing yeast transcription termination signal
The sequence is the 3'flanking sequence of a yeast gene that contains appropriate signals for transcriptional termination and polyadenylation. Suitable 3'flanking sequences are, for example, those of yeast genes naturally linked to the promoter used. Preferred flanking sequences are yeast PH
It is that of the 05 gene.

A yeast promoter, any DNA sequence encoding a signal peptide, a DNA sequence encoding a membrane-bound glycosyltransferase or a variant thereof,
And a DNA sequence containing a yeast transcription termination signal is operably linked in tandem. That is, they are juxtaposed in such a way that their normal function is maintained. This column is
The promoter provides proper expression of the DNA sequence encoding the membrane-bound glycosyltransferase or variant thereof (optionally preceded by a signal sequence), the transcription termination signal provides proper termination of transcription, and the last codon of the signal sequence. Is linked directly to the first codon of the DNA sequence, and any signal sequence is
It is such that it is linked to the NA sequence in the proper reading frame and secretion of the protein occurs.

When the promoter and signal sequence are derived from different genes, the promoter is preferably linked to the signal sequence at a site between the major mRNA start and the ATG of the gene naturally linked to the promoter. The signal sequence will have its own ATG for translation initiation. The linkage of these sequences can be carried out by means of a synthetic oligonucleotide linker having an endonuclease recognition sequence.

Vectors suitable for replication and expression in yeast contain a yeast origin of replication. Hybrid vectors containing yeast origins of replication, eg, autonomously replicating segments (ars) of the chromosome, are retained extrachromosomally in yeast cells after transformation and replicate autonomously during mitosis. Further, a hybrid vector containing a sequence homologous to yeast 2μ plasmid DNA can be used. Such a hybrid vector is integrated by recombination in the 2μ plasmid already present in the cell.

Preferably, the hybrid vector according to the invention comprises one or more, especially one or two,
It contains a selectable gene marker for yeast, and such a marker origin of replication for bacterial hosts, especially E. coli. Regarding the selectable gene marker for yeast, any marker gene that facilitates selection of transformants based on the phenotypic expression of the marker gene can be used. Suitable markers for yeast are, for example, those that express antibiotic resistance or, in the case of yeast auxotrophic mutants, genes that complement host deficiencies. The corresponding gene confers resistance to, for example, the antibiotic G418, hygromycin or bleomycin, or confers prototrophy to the yeast auxotrophic mutant strain, and includes, for example, URA3 and LEU.
2, LYS2 or TRP1 gene.

Since the amplification of the hybrid vector is conveniently carried out in E. coli, it is preferred to contain an E. coli genetic marker and an E. coli origin of replication. These are E. coli plasmids such as pBR322 or pU
Obtained from a C plasmid, such as pUC18 or pUC19, which contains both the E. coli origin of replication and the E. coli genetic marker and confers resistance to antibiotics such as ampicillin.

The hybrid vector according to the invention comprises, for example, a yeast promoter and a DNA sequence coding for a glycosyl transferase or a variant thereof, which DNA sequence is controlled by said promoter, by methods known in the art. The expression cassette consisting of or several components of the expression cassette, a DNA fragment containing a selection gene marker for yeast and bacterial hosts and an origin of replication for yeast and bacterial hosts are ligated in a predetermined order It is prepared by

The hybrid vector of the invention is used for the transformation of the yeast strains described below. Yeast Strains and Their Transformation Suitable yeast host organisms are Saccharomyces.
s ) strains, in particular Saccharomyces cerevisiae strains. The yeast strain has optionally been cured of an endogenous 2 micron plasmid and / or optionally yeast peptidase activity, such as yscα,
yscA, yscB, yscY and / or yscS
Strains lacking activity are included.

The present invention further comprises a hybrid vector comprising an expression cassette comprising a yeast promoter and a DNA sequence encoding a membrane-bound glycosyltransferase or variants thereof, which DNA sequence is controlled by said promoter. And a yeast strain transformed with. In a first aspect, a yeast strain according to the invention contains a yeast promoter, a DNA sequence encoding a membrane-bound glycosyltransferase or a variant thereof (which DNA sequence is controlled by said promoter) and a yeast transcription termination signal. It has been transformed with a hybrid vector comprising an expression cassette comprising a DNA sequence.

In a second embodiment, the yeast strain according to the invention acts on a first DNA sequence encoding a signal peptide linked in proper reading frame to a second DNA sequence encoding a membrane-bound glycosyltransferase or a variant thereof. DN containing an operably linked yeast promoter and yeast transcription termination signal
It has been transformed with a hybrid vector comprising an expression cassette comprising the A sequence.

The yeast strain of the invention is used for the preparation of membrane-bound glycosyltransferases or variants thereof. Transformation of yeast using the hybrid vector according to the invention can be carried out by methods known in the art, for example by Hinnen et al. (Proc. Natl. Acad.S.
ci. USA (1978) 75, 1929) and Ito et al. (J. Bact. (1983) 153, 163-168).

The membrane-bound glycosyltransferases or variants thereof prepared by the method according to the invention are used in a manner known per se, for example for the synthesis and / or modification of glycoproteins, oligosaccharides and glycolipids. (US Pat. No. 4,925,796
No .; European Patent Application No. 414 171). The invention relates in particular to the method for producing the membrane-bound glycosyltransferases or variants thereof described in the examples, the transformed yeast strains and the glycosyltransferases obtainable according to the method of the invention.

The following abbreviations are used in the examples: G
T = galactosyl transferase (EC2.4.
1.22); PCR = polymerase chain reaction; ST = sialyltransferase (EC 2.4.9.1);
FT = fucosyl transferase. Example 1: Galactosyl trans from HeLa cells
Cloning of Ferrase (GT) cDNA The GT cDNA was cloned into HeLa cells (Watzele, G. and EG (1
990), Nucleic Acids Res. 18, 7174) by the polymerase chain reaction (PCR) method.

1.1 Preparation of poly (A) ⁺ RNA from HeLa cells For the preparation of RNA, HeLa cells are grown in monolayer culture on 5 plates (23 × 23 cm). Rapid and efficient RNA isolation from cultured cells is performed by extraction with guanidine-HCl (MacD
onald, RJ et al., Meth. Enzymol. (1987) 152, 226-227).
Generally, the yield is about 0.6-1 mg total RNA per plate of confluent cells.

Enrichment of poly (A) ⁺ RNA was performed by affinity chromatography of oligo (dT) -cellulose according to the method described in the Maniatis manual (Sambrook, J., Fritsch, EF and Maniatis,
T. (1989) Molecular Cloning: A Laboratory Manual (2nd edition), Cold Spring Harbor Laboratory Press, ColdSp
ring Harbor, USA), 4 mg total on 400 μL column
Of RNA. 3% of the loaded RNA is recovered as concentrated poly (A) ⁺ RNA, which is aliquoted and precipitated with 3 volumes of ethanol and stored at -70 ° C until use.

1.2 Synthesis of First Strand cDNA for PCR Poly (A) ⁺ RNA (mRNA) was cloned into Moloney murine leukemia virus RNase H ^- reverse transcriptase (M-MLBH ^- RT) (BRT). ) Reverse-transcribes into DNA. BR in a 20 μL reaction mix configuration
Small change to the protocol provided by L: 1
1.5 μL of 1 μg HeLa cell poly (A) ⁺ RNA and 50 ng oligo (dT) in sterile water
_12-18 (Pharmacia) is heated to 70 ° C. for 10 minutes and then quenched on ice. Then 4 μL of BR
Reaction buffer provided by L (250 mM Tris HCl
(PH 8.3) 375 mM KCl, 15 mM MgC
l ₂ ), 2 μL of 0.1 M dithiothreitol, 1 μL
Mixed dNTPs (10 mM of each dATP, dCTP, dG
TP, TTP, Pharmacia), 0.5 μL (17.5 U)
RNAguad (Pharmacia RNase inhibitor) and 1 μL (200 U) of M-MLVH ^- RT. The reaction is carried out at 42 ° C and is stopped after heating the tube to 95 ° C for 10 minutes.

To test the efficiency of this reaction, an aliquot (5 μL) of this mixture was added to 2 μCi of α- ³² PdC.
Incubate in the presence of TP. The amount synthesized is calculated by measuring the incorporated dCTP. The yield of first strand synthesis is routinely 5-15%. 1.3 Oligonucleotide primers used for polymerase chain reaction PCR are phosphoramidite method (MHCaruthers, Chemica
l and Enzymatic Synthesis of Gene Fragments, HGG
Synthesized in vitro on an Applied Biosystems 380 synthesizer by Assen and A. Lang, edited by Verlag Chemie, Weinheim, Germany. They are listed in Table 1.

[0068]

[Table 1]

The standard PCR conditions for 30 μL of the incubation mixture are as follows: 1 μL of the reverse transcriptase reaction (cf. Example 1.2), which was carried out in PCR buffer (10 mM Tris HCl (pH 8). ．
3) (23 ° C.), 50 nmole KCl, 1.5 mmol MgCl ₂ , 0.001% gelatin) 5 ng
First strand cDNA, 15 picomoles of each relevant primer, 200 μmol of each of the four deoxynucleoside triphosphates (dATP, dCTP, dGTP and TTP) and 0.5 U of AmpliTaq polymerase (Perkin Elmer). .. Amplification is carried out in a Thermocycle 60 (Biomed) using the following conditions: denaturation at 95 ° C for 0.5 min, 56 ° C.
Anneal for 1 minute at 72 ° C and 1 at 72 ° C
5 second extension, total 20-25 cycles. In the last cycle, extension of the primer at 72 ° C is carried out for 5 minutes.

For sequencing and screening,
The HeLaGT cDNA is amplified with two overlapping pieces using different primer combinations: (1) Fragment P1-P4: nucleotide positions in the HeLaGT cDNA (SEQ ID NO: 1) using primers P1 and P. 0.55 kb DN covering n-556
A fragment is amplified.

(2) Fragment P3-P2d: primer P3
And nucleotide position 457-1 using P2d.
A 0.77 kb fragment covering 232 (SEQ ID NO: 1) is amplified. Four independent PCRs are performed for each fragment to avoid errors during amplification. The primer Plup (KpnI) is also used in combination with primer P4 to determine the DNA sequence and then the "start" codon.

After PCR amplification, the fragments P1-P4 were digested with the restriction enzymes EcoRI and HindIII, purified on a 1.2% agarose gel and purified by GENECLEAN (b).
eluted from the gel with io101) and the vector p
Subcloned into UC18 (Pharmacia) and digested with the same restriction enzymes. Fragment P3-P2d was digested with SacI and EcoRI, 1.2% gel purified, eluted and subcloned into pUC18, Sa
Digest with cI and EcoRI. The resulting subclones are pUC18 / P1-P4 and pUC1 respectively.
8 / P3-P2d. A standard protocol is performed as described in Example 2 for subcloning, ligation and transformation of E. coli strain DH5α.

A mini-preparation of plasmids pUC18 / P1-P4 and pUC18 / P3-P2d was added to T7 DNA.
Used for dideoxy sequencing of double-stranded DNA denatured by Polymerase Sequencing Kit (Pharmacia). The M13 / pUC sequencing primer and the reverse sequencing primer (Pharmacia) are applied for the sequencing of overlapping fragments produced from both DNA strands by digestion with various restriction enzymes. Further subcloning of the restriction fragment of the GT gene is required for extensive sequencing of overlapping fragments of both chains. Sequencing of the fragments amplified by independent PCR shows that the error of amplification is less than 1 out of 3000 nucleotides. GTc of HeLa cells represented in SEQ ID NO: 1
The complete nucleotide sequence of DNA is 9 relative to that of human placenta (GenBank Accession No. M22921).
9.2% homology. Three differences were found.

(A) Nucleotide position 3 which results in one extra amino acid (Ser) in the N-terminal region of the protein
3 extra base pairs in 7-39 (SEQ ID NO: 1);
(B) bp 98-101 is "TCT" in the human placenta sequence.
“CTCT” instead of “G”, leading to a substitution of two conserved amino acids at amino acid positions 31 and 32 (Ala-Leu instead of Val-Tyr) in the membrane spanning domain of GT; (c) position The nucleotide at 1047 has changed from "A" to "G" without changing the amino acid sequence.

Two Overpapping DNA Fragments P1-P4 and P Encoding the HeLaGT cDNA
3-P2d is joined via a NotI restriction site at nucleotide position 498 that is present in both fragments. GT cDNA of complete HeLa cells (SEQ ID NO: 1)
Plasmid pIC-7 (Mars, which is a derivative of pUC8 having an additional restriction site in the multiple cloning site).
h, JL, Erfle, M. and Wykes, EJ (1984) Gene 32, 4
81-485) and cloned as a 1.2 kb EcoRI-EcoRI restriction fragment, resulting in the vector p4AD113. C for the purpose of creating a GT expression cassette
EcoRI restriction site (bp at 3'end of DNA sequence
1227) is deleted as follows.

The vector p4AD113 was first transformed into EcoRV.
Digest with and linearize, then treat with alkaline phosphatase. In addition, 1 μg of linearized plasmid D
NA is partially digested with 0.25 U EcoRI at 37 ° C. for 1 hour. After electrophoresis on an agarose gel, the fragment corresponding to the linearized plasmid size (3.95 kb) is separated from the gel by Geneclean (Bio 101). The overhanging EcoRI end is used as a maniac (Maniat
Fill in with Klenow polymerase as described in the is) manual (see above). After phenol treatment and ethanol precipitation, the plasmid is religated and used for transformation of E. coli DH5α (Gibco / BRL).

A mini-preparation of plasmid is prepared from 6 transformants. The resulting plasmid was analyzed by restriction enzyme analysis for EcoR at the 3'end of HeLaGT cDNA.
Check for the absence of I and EcoRV restriction sites. The plasmid designated p4AE113 is selected for subsequent experiments. Its DNA sequence is plasmid p4AE
Identical to that of 113, except EcoRI-Eco
Bp1232-1238 with the RV restriction site is deleted.

Example 2: Construction of expression cassette for full length GT Saccharomyces cere
visiae ) due to heterologous expression in HeLaGT
The cDNA sequence (SEQ ID NO: 1) is fused to a yeast transcriptional control signal for efficient initiation and termination of transcription. The promoter and terminator sequences are the yeast acid phosphatase gene (PH05) (EP10
0561). The full length PH05 promoter is regulated by the supply of inorganic phosphate in the medium. High P _i
Concentration leads to promoter repression, but low P _i acts by induction. Alternatively, the short 173 bp PH05 promoter fragment is used, which lacks all regulatory elements and thus behaves as a constitutive promoter.

2.1 Construction of a Phosphate-Inducible Expression Cassette The GT cDNA sequence was transformed into yeast PH05 as follows.
Combined with promoter and transcription terminator sequences: (a) Full length HeLaGT cDNA sequence: Full length GTcDN
The vector p4AE113 having the A sequence was transformed with the restriction enzyme Eco.
Digest with RI and BglII. 0.1% DNA fragment
Separation by electrophoresis on agarose gel. HeLaG
The complete cDNA sequence for T was prepared using the Geneclean kit (BIO 101) and
Separated from gel by adsorption to milk). On this fragment, the "ATG" start codon for protein synthesis of GT is located immediately behind the restriction site for EcoRI, but is contributed to the 3'untranslated region of HeLaGT following the stop codon "TAG". There are multiple cloning sites of the vector with 32 bp and a BglII restriction site.

(B) Vector for amplification in E. coli Vector for amplification, ie plasmid p31R which is a derivative of pBR322 (see EP100561).
Is digested with the restriction enzymes BamHI and SalI. The restriction fragments were separated on a 1% agarose gel and 3.5 kb
The vector fragment of is isolated from the gel as described above. This DNA fragment is the HindIII-Bam of pBR322.
A 337 bp PH05 transcription terminator sequence instead of the HI sequence and the large SalI-of the pBR322 derivative.
Contains the HindIII vector fragment.

(C) Sequence for the inducible PH05 promoter The PH05 promoter containing the regulatory element for phosphate induction (UASp) is restricted to the restriction enzymes SalI and Ec.
Separated from plasmid 31R (reference, EP100561) by digestion with oRI. 0.8 kb Sa
The lI-EcoRI DNA fragment was SalI of 276 bp.
-PBR322 sequence of BamHI and 543 bp Ba
It comprises the PH05 promoter fragment of mHI-EcoRI, and Eco at position -8 of the PH05 promoter sequence.
RI linker (5'-GAATTC-3 ') has been introduced.

(D) Construction of plasmid pGTA1132 The three DNA fragments (a) to (c) are ligated in a 12 μL ligation mixture. 100 ng of each DNA fragment (a) and 30 ng of each of the fragments (b) and (c) were supplied with ligase buffer (66 mM Tris HCl (pH 7.5), 1 mM).
Dithioerythritol, 5 mM MgCl ₂ , 1 mM AT
Ligate for 18 hours at 15 ° C. using 0.7 U of T4 DNA ligase (Boehringer) in P). Using half of the ligation mixture, E. coli strain DH
Transform 5α (Gibco / BRL) competent cells.

To prepare and transform competent cells the standard protocol described in the Maniatis manual (see above) is followed. Cells are plated on selective LB medium, supplemented with 75 μg / mL ampicillin and incubated at 37 ° C. About 120 transformants are obtained. A mini-preparation of the plasmid was carried out using the Birnboi (Birnboi) as described in the Maniatis manual (see above).
m), H .; C. And Doly, J .; Is performed from 6 independent transformants by using the modified alkaline lysis protocol of.

The isolated plasmid contained four different enzymes (EcoRI, PstI, HindIII, SalI,
It is also characterized by restriction analysis using (combination). All 6 plasmids show the expected restriction fragments. Select one of the clones and call pGTA11
Call 32. Plasmid pGTA1132 is an expression cassette with the full length HeLaGT cDNA under the control of the phosphate regulated PH05 promoter, and P
It contains the transcription terminator sequence of H05. This expression cassette contains 2.35 kg of SalI from pGTA1132.
It can be excised as a HindIII fragment and is called DNA fragment (1A).

2.2 Construction of a constitutive expression cassette For the construction of an expression cassette with a constitutive unregulated promoter, a 5'truncated PH05 without a phosphate regulatory element.
A promoter fragment was used, which was plasmid p31 /
Separated from PH05 (-173) RIT. (A) Construction of p31 / PH05 (-173) RIT Plasmid p31RIT12 (EP288435)
pBR322-inducible vector BamHI and Hi
A full-length regulatable PH05 promoter (534 bp BamHI cloned in tandem with ndIII.
-With an EcoRI site introduced at nucleotide position -8 on the EcoRI fragment) and the following yeast invertase signal sequence coding sequence (72
bp EcoRI-XhoI) and PH05 transcription termination signal (135 bp XhoI-HindIII).

Plasmid pJDB207 / PH05 (-
173) -The constitutive PH05 (-173) promoter element from YHIR (EP340170) comprises the nucleotide sequence of the yeast PH05 promoter from nucleotide positions -9 to -173 (BstEII restriction site), but with upstream regulatory sequences. Does not have (UASp). Therefore, the PH05 (-173) promoter behaves like a constitutive promoter. This example shows plasmid 3
We describe replacing the regulatable PH05 promoter in 1RIT12 with a short constitutive PH05 (-173) promoter element to give p31 / PH05 (-173) RIT.

Plasmid p31RIT12 (EP288
435) and pJDB207 / PH05 (-173).
-YHIR (EP340170) is digested with the restriction endonucleases SalI and EcoRI. The respective 3.6 kb and 0.4 kb SalI-EcoRI fragments were separated on a 0.8% agarose gel, eluted from this gel, ethanol precipitated and at a concentration of 0.1 pmol / μL in water. Resuspend.

Both DNA fragments were ligated and a 1 μL aliquot of the ligation mixture was used to E. coli HB101.
(ATCC) Transform competent cells. Ampicillin resistant colonies are treated with ampicillin (100 μg / mL)
Are grown individually in LB medium supplemented with. The plasmid was designated Holmes, D. et al. S. (Anal.Biochem. (19
81) Isolate according to the method of 144, 193) and analyze by restriction digest with SalI and EcoRI. The plasmid of one clone with the correct restriction fragments was named p31 / PH
05 (-173) RIT.

(B) Construction of plasmid pGTB1135 Plasmid p31 / PH05 (-173) RIT is digested with restriction enzymes EcoRI and SalI. 0.45 bp SalI-Ec after separation on a 1% agarose gel
The oRI fragment is separated from the gel by Geneclean (BIO 101). This fragment is 276 bp of pBR322
SalI-BamHI sequence and 173 bp BamH
Contains the constitutive PH05 promoter fragment of I (BstEII) -EcoRI.

The 0.45 kg SalI-EcoRI fragment is a 1.2 kb EcoRI-BglII GT cDNA.
(Fragment (a)) and PH05 described in Example 2.1.
3.5 kb for amplification in E. coli with terminator
BamHI-SalI vector part of Ligation and transformation of E. coli strain DH5α is performed as described above to produce 58 transformants.

Plasmids are isolated from 6 independent colonies by miniprep and characterized by restriction analysis. All 6 plasmids show the expected fragment.
One correct clone was called pGTB1135 and used for further cloning experiments to obtain an expression cassette for HeLaGT under the control of the constitutive PH05 (-173) promoter fragment. This expression cassette is 2 kb from the vector pGTB1135.
Can be excised as a SalI-HindIII fragment and is called DNA fragment (1B).

Example 3: Expression vector pDPGTA8
The yeast vector used for the heterologous expression of pDPGTB5 and pDPGTB5 is the episomal vector pDP34 (11.8 kb), which is an ampicillin resistance marker for E. coli and URA3 and d.
YEU-E. Coli shuttle vector with LEU2 yeast selectable marker. Vector pDP34 (see EP3
40170) digested with the restriction enzyme BamHI.

The linearized vector was generated by Geneclean (GEN
ECLEAN) and the overhanging ends are filled in in Klenow polymerase treatment as described in the Maniatis manual (see above).
This reaction was carried out after 30 minutes at 65 ° C. in the presence of 10 mM EDTA.
It is stopped by heating for 20 minutes. After ethanol precipitation, the plasmid was digested with SalI and 0.
Subject to gel electrophoresis on an 8% agarose gel. (Ba
mHI) blunt-ended SalI-cut vector pDP3
4 from gel with GENECLEAN kit
Isolate as a 1.8 kb DNA fragment. Similar to the vector preparation, plasmids pGTA1132 and pGT
Each of B1135 is digested with HindIII. Fill in the protruding ends with Klenow polymerase treatment,
Subsequent digestion with SalI resulted in a 2.35 kb (HindII with a (2A) phosphate regulated expression cassette.
I) blunt ended SalI fragment, or (2B) 2.0 kb (HindIII) blunt ended S with a constitutive expression cassette.
results in an aII fragment.

Ligation of the blunt-ended SalI pDP34 vector part with fragment 2A or fragment 2B and transformation of competent cells of E. coli strain DH5α with 80 ng of vector part and, respectively, as described in Example 2. Perform using 40 ng of fragment 2A or 2B.
58 and 24 transformants respectively are obtained. From each transformant, 6 plasmids are prepared and characterized by restriction analysis.

For constructs with a regulated expression cassette (fragment 2A), the two plasmids show the expected restriction pattern. Select one of the clones and pD
Displayed as PGTA8. Constitutive expression cassette (fragment 2
For the construct with B), one plasmid shows the expected restriction pattern. One of the clones was selected and designated pDPGTB5.

Example 4: Saccharomyces cerevisiae
C of transforming expression vectors pDPGTA8 and pDPGTB5 of S. cerevisiae strain BT150
The sCl-purified DNA was purified by the procedure described by R. R. in the Maniatis manual (see above). Treisma
Prepare according to the protocol in n). Protease lack Saccharomyces cerevisiae (S. Cerevisiae) strain B
T150 (MATα, his4, leu4, ura3
pra1, prb1, prc1, cps1) and H4
49 (MATa, prb1, cps1, ura3Δ5
leu2-3, 2-112, cir ⁰ ) according to the lithium acetate transformation method (Ito, H. et al., supra).
5 μg of pDPGTA8, pDPGTB5 and pDP
Transform with each of 34 (control without expression cassette). Ura ⁺ transformants are isolated and screened for GT activity (see below).
Single transformed T cells are selected and called as follows.

[0097] Saccharomyces cerevisiae BT150 / pDPGTA8 Saccharomyces cerevisiae BT150 / pDPGTB5 Saccharomyces cerevisiae BT150 / pDP34 Saccharomyces cerevisiae H449 / pDPGTA8 Saccharomyces cerevisiae H449 / pDPGTB5 Saccharomyces cerevisiae H449 / pDP34 Example 5: Enzyme activity of GT of the full-length expressed in yeast 5 .1 Preparation of Cell Extract Transformed Saccharomyces cerevisiae ( Saccha
romyces cerevisiae ) strains BT150 and H449
Cells are grown under selection for uracil in minimal medium of yeast (Difco) supplemented with histidine and leucine. Cell growth rate is unaffected by the introduction of any of the expression vectors.

Exponentially growing cells (OD _{578 of} 0.5
Cells) or stationary cells were collected by centrifugation, washed once with 50 mM Tris-HCl buffer (pH 7.1) (buffer 1) and in buffer 1 at a concentration corresponding to 0.1-0.2 OD _578. Resuspend. Mechanical disruption of cells is performed by vigorous shaking for 4 minutes with intermittent cooling in a vortex forming mixer with glass beads (0.45-0.5 mm diameter). The crude extract is used directly for measuring enzyme activity.

Fractionation of the cellular components is accomplished by differential centrifugation of the extract. First, the extract is centrifuged at 450 g for 5 minutes: second, the resulting supernatant is centrifuged at 20000 g for 45 minutes. Collect the supernatant and resuspend the pellet in buffer 1. Due to the phosphate-induced induction of GT expression under the control of the inducible pDPGTB5 promoter, transformants BT150 / pDPGTA8
And H499 / pDPGTA8 cells, respectively,
Mass-shift to minimal medium with low phosphate (Meyh
ack, B. et al., Embo J. (1982) 1, 675-680). Cell extracts are prepared as described above.

5.2 Protein Assay Protein concentration is determined by use of the BCA-protein assay kit (Pierce). 5.3 Assay for GT activity GT activity is measured by ovalmin, Gl as acceptor site.
It can be measured by radiochemical methods using glycoproteins that exclusively expose cNAc or free GlcNAc as the acceptor substrate. Cell extract (1
˜20 OD ₅₇₈ cells) to 100 mM Tris HCl (p
H7.4), 50 nCi UDP- ¹⁴ C-Gal (32
5 mCi / mmol), 80 nmole UDP-Ga
1, 1 μmol MgCl ₂ , 1% Triton X-100
And 1 mg of ovalmine or 2μ as acceptor
45 or 6 at 37 ° C. in 100 μL immunochromatographic mixture containing moles of GlcNAc.
Assay for 0 minutes.

If a glycoprotein acceptor substrate is used, the reaction is stopped by acid precipitation of the protein,
And the amount of ¹⁴ C galactose incorporated into ovalmin is determined by liquid scintillation counting (Berger, EG et al. (1978) Eur. J. Biochem. 90,
213-222). For GlcNAc as the acceptor substrate, the reaction was stopped by the addition of 0.4 mL ice-cold water and the unused UDP- ¹⁴ C galactose was used as described in the anion exchange column (AGX1-8, BioRad) (Masibay). , AS and Qasaba, PK (1989) Pro
c. Natl. Acad. Sci. USA, 86, 5733-5737) ¹⁴ C product. The assay is performed with or without an acceptor molecule to assess the extent of hydrolysis of UDP-Gal by nucleotide pyrophosphatase. The results are shown in Table 2.

[0102]

[Table 2]

GT of cultures shifted to inducible conditions
The activity (low P _i minimal medium) is almost identical to that of the culture in minimal medium constitutively expressing GT (Table 2). As expected, no enzymatic activity is found in cells transformed with the vector alone. During the fractionation, G
Most of the T activity (70-90%, look-up table 3) and the highest specific activity is always found in the high speed pellet (20,000 g). Enzyme activity is 1-2% for enzyme assay
Can be increased by adding Triton X-100. As both findings suggest, recombinant GT is membrane bound in yeast cells, as in HeLa cells.

[0104]

[Table 3]

Example 6: Purification of recombinant GT To release the membrane-bound enzyme, BT150 / pDPGT
Fraction of 20000 g pellet of B5 cells was 1% (w /
v) Triton X-100 at room temperature for 10 minutes, and 50 mM Tris HCl (pH 7.4), 25 mM
Equilibrate with MgCl ₂ , 0.5 mM UMP and 1% (w / v) Triton X-100.

The supernatant obtained after centrifugation was 0.2 μm filtered and a GlcNAc-p-aminophenyl-Sepharose-column (Berg) with a bed volume of 5 mL.
er, EG et al. (1976) Experientia 32, 690-691) at a flow rate of 0.2 mL / min at 4 ° C. This enzyme was added to 50 mM Tris HCl (pH 7.4), 5 mM GlcN
Ac, 25 mM EDTA and 1% Triton X-10
Elute at 0. A single peak of enzyme activity elutes within 5 fractions (size: 1 mL). These fractions were pooled and 2 x 1 liter of 50 mM Tris HCl (pH
7.4), dialyzing against 0.1% Triton X-100. Purified GT is enzymatically active.

Example 7: Construction of an expression cassette for soluble GT Yeast invertase gene SUC ligated in proper reading frame to a cDNA encoding soluble GT.
When the yeast promoter is operably linked to the first DNA sequence encoding the two signal sequences, the galactosyl transferase expressed in yeast can be secreted into the medium.

(A) Partial HeLaGT cDNA Sequence GTcDNA was cloned from p4AD113 (Example 1) into Eco.
Cut out by digesting with RI. Complete GTcDN
The 1.2 kb fragment containing A was isolated, and Sequence Listing 1
MvnI (Boehri, which cleaves the GT sequence at positions 43, 55, 140 and 288 of the nucleotide sequence shown in
nger) to partially digest. 0.2 μg EcoRI-
When the EcoRI fragment is digested with 0.75 MvnI for 1 hour, the GT cDNA is cleaved only once at nucleotide position 134 to generate the 1.1 kb MvnI-EcoRI fragment.

(B) E. Vector for amplification in E. coli Plasmid pUC18 (Pharmacia) is digested with BamHI and EcoRI at the multiple cloning site.
The plasmid is then treated with alkaline phosphatase as described in the Maniatis manual (see above), electrophoresed on an agarose gel and isolated from the gel as a 2.7 kb DNA fragment.

(C) Constitutive pDPGTB5 (-173)
The promoter and SUC2 signal sequence vector p31 / PH05 (-173) RIT (Example 2) is digested with the restriction enzymes BamHI and XhoI.
A 0.25 kb BamHI-XhoI fragment with the constitutive PH05 (-173) promoter and flanking coding sequences for the invertase signal sequence (inv ss) is isolated. This fragment is then recut with HgaI (BioLabs). The HgaI recognition sequence is present on the antisense DNA strand. The restriction enzyme is used in such an embodiment that the end of the 5'adhesion of the antisense strand coincides with the end of the coding sequence for the invertase signal sequence.
Cleave upstream of the recognition sequence. The 0.24 kb BamHI- and HgaI-cut DNA fragment is a constitutive PH05 (-1) linked to the yeast invertase signal sequence.
73) Contains a promoter sequence.

(D) Adapter Fragment (a) is ligated to fragment (c) by an adapter sequence, which is an equimolar amount of synthetic oligonucleotide (Microtsynt) for complementary strands.
h)) 5'CTGCACTGGCTGGCCG 3'and 5'CGGCCAGCCAG
Prepare from 3 '. The oligonucleotides are annealed to each other by first heating to 95 ° C and then slowly cooling to 20 ° C. Freeze and store the annealed adapters.

(E) Construction of plasmid psGT Linearized vector for ligation (b), GTcDN
The A fragment (a), the fragment (c) containing the promoter and the sequence encoding the signal peptide and the adapter (d) are used in a molar ratio of 1: 2: 2: 30 to 100.
Binding was 12 μL of ligase buffer (66 mM Tris HCl
(PH 7.5), 1 mM dithiothreitol, 5 mM MgC
l ₂ , 1 mM ATP) at 16 ° C. for 18 hours. The ligation mixture is used as described above to transform competent cells of E. coli strain DH5α. Mini-preparations of plasmids are performed from 24 independent transformants.
The isolated plasmid contains four different enzymes (BamH
Characterization by restriction analysis using I, PstI, EcoRI, XhoI and also combinations). A single clone with the expected restriction pattern is called psGT.

The correct sequence at the fusion site between the cDNA encoding soluble GT and the sequence encoding the signal peptide of invertase was identified by the T7-sequencing kit (Pha
rmacia) and the primer 5'AG starting at position -77 in the constitutive PH05 (-173) promoter.
The plasmid psGT is confirmed by using TCGAGGTTAGTATGGC 3'DNA polymerase.

[0114]

[Table 4]

Constitutive PH05 (-173) promoter, D encoding the signal peptide of invertase
NA sequence and partial GTc from plasmid psGT
The expression cassette for the secreted GT containing DNA was 1.35 kb SalI (BamHI) -EcoR
It can be excised as an I fragment. The expression cassette is
It still lacks the PH05 terminator sequence to be added in the next cloning step.

Example 8: Construction of the expression vector pDPGTS For the construction of the expression vector for the soluble GT the following fragments are combined: (a) Part of the vector The plasmid pDP34 is digested as described in Example 3. Then, pretreatment was performed to obtain 11.8 kb of blunt-ended Sal.
Generate an I vector fragment.

(B) Expression Cassette The plasmid psGT is linearized by first digesting with SalI (at the multiple cloning site) and then partially digesting with EcoRI. 1.35 kb DNA
A fragment was isolated which contained the constitutive PH05 (-173) promoter, a DNA sequence encoding the yeast invertase signal peptide and a partial GT cDNA.

(C) Terminator sequence of PH05 Plasmid p as described in EP100561.
From the plasmid p31 constructed starting from 30, the PH
The 05 terminator sequence is isolated. Restriction enzyme Hin
After digestion with dIII, the protruding ends are filled in by Klenow polymerase treatment as described above. This plasmid is then digested with EcoRI and PH05
0.39 kb blunt-ended Eco with terminator sequence
RI fragments are separated.

Ligation of fragments (a), (b) and (c) and transformation of E. coli strain DH5α is carried out as described in Example 2. From the transformants obtained, plasmids are isolated and characterized by restriction analysis. A physical map of one clone with the correct restriction fragments was created using pDPG.
Call it TS. Example 9: Expression of Soluble GT in Yeast As in Example 4, CsCl purified DNA of the expression vector pDPGTS was used to transform S. S. cerevisiae strains BT150 and H449 are transformed. Ura ⁺ transformants isolated and GT
Screen for activity. 1 in each case
Two transformants were selected and Saccharomyces cerevisiae BT respectively
150 / pDPGTS and Saccharomyces cerevisiae H449 / pDP
Called GTS. Using the assay described in Example 5,
GT activity is found in the culture broth of both transformants.

Example 10: From human HepG2 cells
Sialyltransferase (ST) cDNA clone
The training STcDNA, by PCR in the same manner as GTcDNA, separated from HepG2 cells. Poly (A) ⁺ RNA
And the synthesis of first-strand cDNA are performed as described in Example 1. Polymerases listed in Table 5 (Micr
osynth) for PCR.

[0121]

[Table 5]

The HepG2ST cDNA is a 1.2 kb single D using the promoters SIA1 and SIA3.
It can be amplified as an NA fragment. PCR is GT
Perform as described for cDNA under slightly modified cycling conditions: 0.5 min denaturation at 95 ° C., 1 min 15 sec annealing at 56 ° C., and 1 min 30 sec extension at 72 ° C., total. 25-35
cycle. In the last cycle, extension of the primer at 72 ° C is carried out for 5 minutes.

After PCR amplification, the 1.2 kb fragment was digested with the restriction enzymes BamHI and PstI, analyzed on a 1.2% agarose gel, eluted from the gel and vector p was digested.
Subcloned into UC18. Example 11: Constitutive ST Expression Cassette Constitutive For constitutive heterologous expression , ST cDNA was constitutive PH0.
5 (-173) promoter fragment and PH05 terminator sequence.

The plasmid pSIA2 was first digested with the restriction enzyme Ba.
Linearized by digestion with mHI, followed by E
Partially digest with coRI. Since the ST cDNA also contains an internal restriction site (at bp 144) for the enzyme EcoRI, a 1.2 kb fragment (SEQ ID NO: 3) with the complete ST cDNA was used with 1 μg DNA and 0.25 U EcoRI. And partially digested with EcoRI (1 hour, 37 ° C).

After gel electrophoresis, a 1.2 kb EcoRI-BamHI fragment (SEQ ID NO: 3) containing the complete ST cDNA is isolated. On this DNA fragment, the "ATG" start codon for translation of ST is located closely to the EcoRI restriction site. The three adenosine phosphates (reference, PCR primer SIA1) provide an "A" at position 12, which is found in the consensus sequence near "ATG" from a gene highly expressed in yeast (Hamilton, R. et al. (1987) Nucleic Acids Res. 14,
5125-5149). There is a BamHI site following the stop codon "TAA" and 5 bp of the 3'untranslated region of the gene.

1.2 kb EcoRI-BamHI ST
The cDNA fragment was cloned into a 0.45 kb SalI-EcoRI fragment containing the constitutive PH05 (-173) promoter (Example 2.2 (b)) and 3 for amplification in E. coli containing the PH05 terminator sequence. It ligates to the .5 bp BamHI-SalI vector part (see Example 2.1, fragment (b)). Ligation and transformation of E. coli strain DH5α is performed as detailed in Example 2.1. One clone showing the expected restriction pattern is designated pST2.

The vector pST2 contains the constitutive PH05 (-1
73) DNA fragment (1
It comprises the expression cassette for HepG2ST as a 0.2 kb SalI-HindIII fragment designated C). Example 12: ST expression vector pDP34 in yeast (see EP340170) is digested with restriction enzyme BamHI. The linearized vector was isolated with Geneclean and the overhanging ends were labeled with mania (Ma
niatis) fill in with Klenow polymerase treatment as described in the manual (see above). This reaction was carried out after 30 minutes 65 minutes in the presence of 10 mM EDTA for 65 minutes.
Stop by heating to ° C. After ethanol precipitation, the plasmid is digested with SalI and subjected to gel electrophoresis on a 0.8% agarose gel. This (Bam
HI) blunt-ended SalI cut vector pDP34
11.8 kb DNA with GENECLEAN kit
Separated as fragments.

The plasmid pST is a restriction enzyme HindIII.
Digest with, and as in the preparation of the vector part,
The HindIII site is filled in by Klenow polymerase treatment. The product is digested with SalI and constitutive ST
2.0 kb of (Hin containing the expression cassette (2C)
dIII) A blunt-ended SalI fragment is generated. Ligation of 80 ng of pDP34 vector with 40 ng of Fragment 2C and transformation of competent cells of E. coli strain DH5α are performed as described in Example 2. One clone showing the expected restriction pattern was selected and pDPST
Call it 5.

For the transformation of yeast, the expression vector p
DST5 CsCl-purified DNA was used as a mania (Ma
niatis) (see above) according to standard procedures. S. Cerevisiae ( S. cerevi
siae ) strains BT150 and H449 were each subjected to 5 according to the lithium acetate transformation method (Ito, H. et al., supra).
Transform with μg of plasmid DNA. Ura ⁺ transformants are selected and screened for ST activity. In each case one transformant was selected,
And Saccharomyces
cerevisiae ) BT150 / pDPST5 and Saccharomyces cerevisiae
e ) Called H449 / pDPST5.

Example 13: Full length expressed in yeast
Enzyme activity of ST 13.1 Preparation of cell extract Saccharomyces cere
visiae ) BT150 / pDPST5 cells are grown under selection of uracil in minimal medium of yeast supplemented with histidine and leucine. Exponentially growing cells (OD _{578 of} 0.5) or stationary cells were collected by centrifugation, washed once with 50 mM imidazole buffer (pH 7.0) (buffer 1) and 0 in buffer 1. 1 to 0.
Resuspend at a concentration corresponding to 2 OD ₅₇₈ . Mechanical disruption of cells is performed by vigorous shaking for 4 minutes with intermittent cooling in a vortex forming mixer with glass beads (0.45-0.5 mm diameter).

ST activity can be measured in crude extracts using the assay described below. 13.2 Assay for ST activity ST activity can be determined by measuring the amount of radiolabeled sialic acid that transfers from CMP-sialic acid to the acceptor of the glycoprotein. After stopping the reaction by acid precipitation, the precipitate was filtered through a glass fiber filter (Whatm
an GFA), washed extensively with ice-cold ethanol, and assayed for radioactivity by liquid scintillation counting (Hesford et al. (1
984), Glycoconjugate J. 1, 141-153).

The cell extract corresponds to approximately 0.5 mg of protein, 37 μL of cell extract, 3 μL of imidazole buffer 50 mmol / L (pH 7.0), 50 nmole of CMP-N-acetylneuraminic acid (Sigma ) (To this C
MP-N-acetylneuraminic acid (Amersham) was 7.3.
Ci / mol added to final specific activity), and 7
5 μg of asialo-fetuin (0.
Acid hydrolysis with 1 MH ₂ SO ₄ for 60 minutes at 80 ° C., then neutralized, dialyzed and lyophilized) for 45 minutes in an incubation mixture.

ST activity is S. Cerevisiae ( S. cerevi
siae ) BT150 / pDPST5 and H449 / pD
It is found in crude extracts prepared from PST5 cells. Example 14: of soluble ST (Lys ₃₉ -Cys ₄₀₆ )
The soluble ST, designated as the constitutive ST (Lys ₃₉ -Cys ₄₀₆ ) of the expression cassette, is a variant of this reaction at the N-terminus and consists of 368 amino acids (SEQ ID NO: 4).

(A) Partial HepG2ST cDNA Sequence Plasmid pSIA2 is digested with EcoRI and the 1.1 kb EcoRI-EcoRI fragment is isolated. (B) E. Vector for amplification in E. coli Plasmid pUC18 (Pharmacia) is digested with BamHI and EcoRI at the multiple cloning site.
The plasmid is then treated with alkaline phosphatase as described in the Maniatis manual (see above), electrophoresed on an agarose gel and isolated from the gel as a 2.7 kb DNA fragment.

(C) The constitutive PH05 (-173) promoter and SUC2 signal sequence vector p31 / PH05 (-173) RIT (Example 2) are digested with the restriction enzymes BamHI and XhoI.
0.25 kg of BamHI-Xho with the constitutive PH05 (-173) promoter and flanking coding sequences for the invertase signal sequence (inv ss).
Isolate the I fragment. The fragment is then Hgal (BioLabs)
To disconnect again. HgaI recognition sequence is antisense DNA
It exists on the chain. The restriction enzyme cleaves upstream from the recognition sequence in such a way that the five staggered ends of the antisense strand align with the ends of the coding sequence for the invertase signal sequence. 0.24 kb BamHI and Hga
The l-cleaved DNA fragment contains the constitutive PH05 (-173) promoter sequence linked to the yeast invertase signal sequence.

(D) Adapter Fragment (a) is linked to fragment (c) by an adapter sequence, which is an equimolar amount of synthetic polynucleotide 5'CTGCAAAATTGCAAACCAAGG 3'for the complementary strand.
And 5'AATTCCTTGGTTTGCAATTT 3 '. The oligonucleotide is first heated to 95 ° C., then 20
Anneal to each other by slow cooling to ° C. Freeze and store the annealed adapters.

(E) Construction of plasmid psST Linearized vector for ligation (b), STcDN
Fragment A (a), fragment (c) containing sequences encoding promoter and signal peptide and adapter (d) are used in a molar ratio of 1: 2: 1: 30-100. Binding was 12 μL of ligase buffer (66 mM Tris H
Cl (pH 7.5), 1 mM dithiothreitol, 5 mM M
gCl ₂ , 1 mM ATP) at 16 ° C. for 18 hours. This ligation mixture is used to transform competent cells of E. coli strain DH5α as described above.

Mini-preparation of plasmids is performed from 24 independent transformants. Four different enzymes (BamHI,
PstI, EcoRI, XhoI, and combinations)
A single clone that exhibits the expected restriction pattern after characterization by restriction analysis using is called psST. The correct sequence at the fusion site between the cDNA encoding soluble ST (Lys ₃₉ -Cys ₄₀₆ ) and the sequence encoding the signal peptide of invertase is the T7-sequencing kit (Pharmacia) and the position of the constitutive PH05 (-173) promoter. Primer 5'starting at -77
The plasmid psST is validated by using ACGAGGTTAATGGC3 '.

[0139]

[Table 6]

Constitutive PH05 (-173) promoter, D encoding the signal peptide of invertase
NA sequence and partial STc from plasmid psST
The expression cassette for the secreted ST containing DNA is 1.35 kb SalI (BamHI) -EcoRI.
It can be cut out as fragments. This expression cassette is PH05 to be added in the next cloning step.
It still lacks the terminator sequence.

Example 15: Construction of expression vector pDPSTS For construction of the expression vector for soluble ST (Lys ₃₉ -Cys ₄₀₆ ), the following fragments are combined: (a) Vector part Plasmid pDP34 in Example 3. Digested and pretreated as described, 11.8 kb of blunt ended Sal
Generate an I vector fragment.

(B) The plasmid psST was first treated with SalI
Is linearized (at the multiple cloning site) by digestion with and then partially digested with EcoRI.
A 1.35 kb DNA fragment was isolated and this fragment was constitutive P
It contains the H05 (-173) promoter, a DNA sequence encoding the yeast invertase signal peptide and a partial ST cDNA.

(C) PH05 Terminator Sequence The PH05 terminator sequence is isolated from plasmid p31, which is constructed starting from plasmid 30 as described in EP100561. After digestion with the restriction enzyme HindIII, the protruding ends are filled in by Klenow polymerase treatment as described above. The plasmid is then digested with EcoRI and the blunt-ended EcoRI fragment with the 0.39 kb PH05 terminator sequence is isolated.

Ligation of fragments (a), (b) and (c) and transformation of competent cells of E. coli strain DH5α is carried out as described in Example 2. The plasmid of one clone with the correct restriction fragments is called pDPSTS. Example 16: Expression of soluble ST in yeast As in Example 4, CsCl purified DNA of the expression vector pDPSTS was used to transform S. Transform S. cerevisiae BT150 and H449. Ura ⁺ transformants are isolated and screened for ST activity. In each case, one transformant was selected and Saccharomyces cerevisiae BT150 / pD
PSTS and Saccharomyces cerevisiae ( Saccha
romyces cerevisiae ) H449 / pDPSTS. Using the assay described in Example 13, ST activity is found in the culture broth of both transformants.

Example 17: Soluble ST (Lys ₂₇ -C
Construction of the expression cassette for ys ₄₀₆ ) ST (Lys ₂₇ -Cys ₄₀₆ )
Is an N-terminal truncated variant containing the catalytic domain and entire stem region and consisting of 380 amino acids, amino acids 27-406 of the amino acid sequence set forth in SEQ ID NO: 3.

(A) Partial HepG2ST cDNA Sequence Plasmid pSIA2 is digested with EcoRI and the 1.1 kb EcoRI-EcoRI fragment is isolated. (B) Vector for amplification in E. coli The plasmid pUC18 (Pharmacia) is digested with BamHI and EcoRI at the multiple cloning site.
The plasmid is then treated with alkaline phosphatase as described in the Maniatis manual (see above), electrophoresed on an agarose gel and isolated from the gel as a 2.7 kb DNA fragment.

(C) The constitutive PH05 (-173) promoter and SUC2 signal sequence vector p31 / PH05 (-173) RIT (Example 2) are digested with the restriction enzymes BamHI and XhoI.
0.25 kg of BamHI-Xho with the constitutive PH05 (-173) promoter and flanking coding sequences for the invertase signal sequence (inv ss).
Isolate the I fragment. The fragment is then Hgal (BioLabs)
To disconnect again. HgaI recognition sequence is antisense DNA
It exists on the chain. The restriction enzyme cleaves upstream from the recognition sequence in such a way that the five staggered ends of the antisense strand align with the ends of the coding sequence for the invertase signal sequence. 0.24 kb BamHI and Hg
The al-cleaved DNA fragment contains the constitutive PH05 (-173) promoter sequence linked to the yeast invertase signal sequence.

(D) Adapter Fragment (a) is ligated to fragment (c) by an adapter sequence, which is an equimolar amount of synthetic polynucleotide 5'CTGCAAAGGAAAAGAAGAAAGGGAGT for the complementary strand.
TACTATGATTCCTTTAAATTGCAAACCAAGG 3'and 5'AATT
CCTTGTTGCAATTTAAAGGAATCATAGTAACTCCCTTTCTTCTTTTCCTT
Prepare from 3 '. First of all, the oligonucleotide
Anneal to each other by heating to room temperature and then slowly cooling to 20 ° C. Freeze and store the annealed adapters.

(E) Construction of plasmid psST1 Linearized vector for ligation (b), STcDN
The A fragment (a), the fragment containing the sequences coding for the promoter and the signal peptide (c) and the adapter (d) are used in a molar ratio of 1: 2: 1: 30-100. Binding was 12 μL of ligase buffer (66 mM Tris H
Cl (pH 7.5), 1 mM dithiothreitol, 5 mM M
gCl ₂ , 1 mM ATP) at 16 ° C. for 18 hours.

This ligation mixture is used to transform competent cells of E. coli strain DH5α as described above. Mini-preparations of plasmids are performed from 24 independent transformants. 4 different enzymes (BamHI, Pst
A single clone showing the expected restriction pattern after characterization by restriction analysis using I, EcoRI, XhoI, and also in combination) is called psST1.

The correct sequence at the fusion site between the cDNA encoding soluble ST (Lys ₂₇ -Cys ₄₀₆ ) and the sequence encoding the signal peptide of invertase is:
T7-Sequencing Kit (Pharmacia) and constitutive PH0
The plasmid psST1 is validated by using the primer 5'AGTCGAGTAGTATGGC3 'starting at position -77 of the 5 (-173) promoter.

[0152]

[Table 7]

Constitutive PH05 (-173) promoter, D encoding the signal peptide of invertase
NA sequence and partial ST from plasmid psST1
Secreted ST (Lys ₂₇ -Cys containing cDNA
The expression cassette for ₄₀₆ ) is 1.35 kb SalI
It can be excised as a (BamHI) -EcoRI fragment. This expression cassette still lacks the PH05 terminator sequence to be added in the next cloning step.

Example 18: Construction of the expression vector pDPSTS1 The following fragments are combined to create an expression vector for soluble ST (Lys ₂₇ -Cys ₄₀₆ ): (a) Vector part The plasmid pDP34 is described in Example 3. Digested and pretreated to yield a 11.8 kb blunt ended SalI
Generate a vector fragment.

(B) First, the plasmid psST1 was Sal
Digest with I (at multiple cloning sites)
Linearize and then partially digest with EcoRI. 1.
A 35 kb DNA fragment was isolated, which fragment was constitutive PH0.
It contains the 5 (-173) promoter, a DNA sequence encoding the yeast invertase signal peptide and a partial ST cDNA.

(C) PH05 Terminator Sequence The PH05 terminator sequence is isolated from plasmid p31, which is constructed starting from plasmid 30 as described in EP100561. After digestion with the restriction enzyme HindIII, the protruding ends are filled in by Klenow polymerase treatment as described above. The plasmid is then digested with EcoRI and the blunt-ended EcoRI fragment with the 0.39 kb PH05 terminator sequence is isolated.

Ligation of fragments (a), (b) and (c) and transformation of competent cells of E. coli strain DH5α is carried out as described in Example 2. The plasmid of one clone with the correct restriction fragments is called pDPSTS1. Example 16: Soluble yeast (Lys ₂₇ -Cys
₄₀₆ ) Expression as in Example 4 Expression vector pDPSTS1
CsCl purified DNA of S. Transform S. cerevisiae BT150 and H449. Ura ⁺ transformants are isolated and screened for ST activity. In each case, one transformant was selected and Saccharomyces cerevisiae BT150 / pD
PSTS1 and Saccharomyces cerevisiae ( Sacc
haromyces cerevisiae ) H449 / pDPSTS1. Using the assay described in Example 13, ST
The activity is found in the culture broth of both transformants.

Example 20: From Human HL60 Cell Line
Cloning of FT cDNA cDNA sequence published for ELFT (ELFT-1 ligand fucosyltransferase) encoding α (1-3) -fucosyltransferase (Goelz,
SE (1990) Cell 63, 1349-1356) and designed a primer for the following oligonucleotide to amplify a DNA fragment encompassing the ELFT cdna open reading frame by PCR technology: 5'-CAGCGCTGCCTGTTCGCGCCAT-3 '(ELFT-1
B) and 5'-GGAGATGCACAGTAGAGGATCA-3 '(ELFT-2
B).

ELFT-1B primes at base pairs 38-59 of the published sequence, and ELFT-
2B is antisense and primes at bp 1347-1326. These primers are used to amplify a 1.3 kb fragment with the Perkin-Elmer Cetus Taq polymerase kit. Fragments are fresh HL60cD
Amplify in the presence of 5% DMSO and 2 mM MgCl ₂ from NA in the following cycle: 95 ° C. 5 min, 25 × (95 ° C. 1 min, 60 ° C. 1 min, 72 ° C. 1.5 min), 10 × ( 95 ℃ 1 minute, 60 ℃ 1 minute, 72 ℃ 1.5 minutes +1
5 seconds / cycle 72 ° C).

Electrophoresis of agarose gel is mainly 1.3
A kb band was revealed, which was SmaI or Apa.
Digestion with I gives the pattern predicted by the published sequence. The 1.3 kb band is purified using the Gene-Clean kit (Bio101) and subcloned into the pCR1000 vector (Invitrogen). A single clone with the correct 1.3 kb insert was selected, and BRD. ELF
Called T / pCR1000-13. The FT cDNA is inserted into this vector in the reverse orientation with respect to the T7 promoter. The open reading frame of the FT cDNA was fully sequenced and is identical to the published sequence (SEQ ID NO: 5).

Example 21: Soluble FT (A in yeast
rg ₆₂ -Arg ₄₀₅₎ were inducible and constitutive expression of
Nucleotide position 2 lacking the N-terminal region and the membrane-binding domain encoding N- terminal region encoding the configuration cytoplasmic tail because the plasmid
FTcDN starting at 41 (NruI restriction site)
From A, to express soluble FT (Arg ₆₂ -Arg ₄₀₅₎ (see SEQ ID NO: 5).

Plasmid BRD. ELFT / pCR10
00-13 was digested with HindIII which gave FTcDN
Cut in the multiple region 3'of the A insert. In reaction with Klenow DNA polymerase, the sticky ends are converted to blunt ends. XhoI linker (5'CCTCGAGG
3 ', Biolabs) is kinased, annealed, and ligated to the blunt ends of the plasmid using a 100-fold molar excess of linker.

Unreacted linkers were removed by isopropanol precipitation of DNA, which was further digested with XhoI and N
Digest with ruI (cleavage at nucleotide position 240 of the FT cDNA according to SEQ ID NO: 5). 1.1kb Nru
The 1-XhoI fragment (a) contains the FT cDNA sequence lacking the region encoding the cytoplasmic tail and the membrane spanning domain up to amino acid 61.

Plasmids p31RIT12 and p31
Each / PH05 (-173) RIT (see Example 2) is digested with SalI and XhoI. 0.9 for each
The kb and 0.5 kb fragments were isolated, and these were H
Cut with gaI. The resulting sticky ends are filled in with Klenow DNA polymerase. The blunt end created corresponds to the 3'end of the coding sequence for the yeast invertase signal sequence. Subsequent cleavage of BamHI results in a 596 bp BamHI blunt end fragment (b) or 2
The 34 bp BamHI blunt ended fragment (c) is released, fragment (b) comprises the inducible PH05 promoter and the invertase signal sequence with its own ATG, and fragment (c) is a short constitutive PH05. (-
173) Comprising a promoter and an invertase signal sequence.

P31RIT12 is linearized with the restriction enzyme SalI. Partial Hind in the presence of ethidium bromide
III digestion yielded a 1 kb SalI-HindIII fragment,
This fragment is a 276 bp SalI-BamHIpBR32
2 sequence, yeast acid phosphatase PH05 534 bp promoter, yeast invertase signal sequence (1
It encodes 9 amino acids) and the PH05 transcription terminator. 1 kb Sal of p31RIT12
The I-HindIII fragment was transformed into yeast-E. coli shuttle vector pJDB207 (Beggs, JD, Molecular Genetic
s in yeast, Alfred Benzon Symposium 16, Copenhagen, 1981, pp.383-389) (This is SalI and Hi.
cleaved with ndIII).
The resulting plasmid containing the 1 kb insert was pJD
Called B207 / PH05-RIT12.

Plasmid pJDB207 / PH05-R
IT12 is digested with BamHI and XhoI and the large 6.8 kb BamHI-XhoI fragment (d) is isolated. This fragment contains all pJDB207 vector sequences and the PH05 transcription terminator. 5
A 96 bp BamHI blunt end fragment (b), a 1.1 kb NruI-XhoI fragment (a) and a 6.8 kb Xho.
The I-BamHI vector fragment (d) is ligated under standard conditions for blunt end ligation. An aliquot of the ligation mixture is used to transform competent E. coli HB101 cells. Plasmid DNA from ampicillin resistant colonies is analyzed by restriction digest. A single clone with the correct expression plasmid was designated pJDB207 / PH05-
Called I-FT. The DNA fragments (c), (a) and (d) are ligated to each other using the expression plasmid pJDB207 / PH0.
Lead to 5 (-173) -I-FT.

The expression cassettes of these plasmids were inducible PH05 and constitutive PH05 (-, respectively).
173) is expressed under the control of a promoter,
It comprises the coding sequence for the signal sequence of invertase fused in frame to that of soluble α (1-3) -fucosyltransferase. Expression cassette in yeast
BamH in E. coli shuttle vector pJDB207
Clone between the I and HindIII restriction sites.

Invertase signal sequence and soluble F
The nucleotide sequence at the fusion site between the T-encoding cDNA and the primer 5'AGTCGAGGTTAG represents the nucleotide sequence at position -70--60 of PH05.
DN for double-stranded plasmid DNA using TATGGC3 ', as well as the PH05 (-173) promoter
Confirmed by A sequencing. The correct splice is:

[0169]

[Table 8]

Example 22: Induction of membrane-bound FT in yeast
Construction of plasmids for inducible and constitutive expression These constructs are FTcDNAs with their own ATG.
Use the code array of. However, nucleotide sequences immediately upstream from ATG are rather unsuitable for expression in yeast due to their high G-C content. This region has been replaced with an AT-rich sequence using the PCR method. At the same time, an EcoRI restriction site is introduced at the new nucleotide position -4--9.

[0171]

[Table 9]

Primer F using standard PCR conditions
Amplify with T1 and FT2 (see Table 6): 30 cycles of DNA synthesis (Taq DNA polymerase, Per
kin-Ellmer, 5 U / μL, 1 minute 72 ° C.), denaturation (10 seconds 93 ° C.) and annealing (40 seconds 60 ° C.). The resulting 1.25 kb DNA fragment is purified by phenol extension and ethanol precipitation, then digested with EcoRI, XhoI and NruI.

Preparative preparation of a 191 bp EcoRI-NruI fragment (e) 4% Nusieve 3: 1 agarose (FMC BioProducts, Rockland, ME, USA).
Separation by gel in Tris-borate buffer pH 8.3,
The gel was eluted and ethanol precipitated. Fragment (e)
Comprises the 5'portion of the FT gene encoding amino acids 1-61. The DNA has a 5'extension with an EcoRI site as in PCR primer FT1.

Plasmids p31RIT12 and p31
Each of the / PH05 (-173) RITs is digested with EcoRI and XhoI. The large vector fragments (f and g, respectively) are separated on a preparative 0.8% agarose gel, eluted and purified. 4.1 kb XhoI-
The EcoRI fragment (f) is a pBR322 inducible vector,
It comprises a 534 bp PH05 promoter (3'EcoRI site) and a 131 bp PH05 transcription terminator (5'XhoI site). 3.7 kb Xho
The I-EcoRI fragment (g) has a short constitutive 172 bp PH05 (-17) instead of the full length PH05 promoter.
3) Only differ in having a promoter (3'EcoRI site).

The 191 bp EcoRI-NruI fragment (e), the 1.1 kb NruI-XhoI fragment (a) and the 4.1 kb XhoI-EcoRI fragment (f) are ligated. A 1 μL aliquot of the ligation mixture is used to transform competent E. coli HB101 cells. Analyze plasmid DNA from ampicillin resistant colonies.
P31R / P plasmid DNA from a single clone
It is called H05-ssFT.

The ligation of the DNA fragments (e), (a) and (g) was carried out using the plasmid p31R / PH05 (-173) -s.
Guide sFT. Each of these plasmids comprises the codon sequence of a membrane-bound FT under the control of the inducible PH05 or constitutive PH05 (-173) promoter. Example 23: of FT expression cassette into pDP34
Cloning plasmids p31R / PH05-ssFT and p31
R / PH05 (-173) -ssFT is digested with HindIII, which cleaves the PH05 transcription terminator 3 '. After reaction with Klenow DNA polymerase, DN
Digest A with SalI. 2.3 kb and 1.9 kb S
Fragments with bl bl ends are each separated.

Plasmid pJDB207 / PH05-I
-FT and pJDB207 / PH05 (-173)-
H-I-FT in the presence of 0.1 mg / mL ethidium bromide
Digest with indIII (avoid cleavage at an additional HindIII in the invertase signal sequence) and then treat with Klenow DNA polymerase and SalI as described above. The 2.1 kb and 1.8 kb fragments
Each is separated.

Each of the four DNA fragments was cloned into pDP34
It ligates to a 1.8 kb SalI blunt-ended vector fragment (see Example 3). Competent E. coli HB101 cells were transformed and individual transformants plasmid D
NA was analyzed and four correct expression plasmids were identified as pDP3
4 / PH05-I-FT; pDP34 / PH05 (-1
73) -I-FT; pDP34R / PH05-ssFT
And pDP34R / PH05 (-173) -ssFT
Call.

S. S. cerevisiae strains BT150 and H449 are transformed according to Example 4 with 5 μg of each of the four expression plasmids (above). A single transformed yeast colony was selected and called: Saccharomyces cerevisiae BT150 / pDP34 / PH05-I-FT; 〃 〃 BT150 / pDP34 / PH05 (-173) -I-FT; 〃 〃 BT150 / pDP34R / PH05-ssFT; 〃 BT150 / pDP34R / PH05 (-173) -ssFT; 〃 〃 H449 / pDP34 / PH05-I-FT; 〃 〃 H449 / pDP34 / PH05 (-173) -I-FT 〃 〃 H449 / pDP34R / PH05-ssFT; 〃 〃 H449 / pDP34R / PH05 (-173) -ssFT; Fermentation and cell extract preparation are carried out according to Example 5. Using an assay similar to that described by Goelz et al. (See above), FT activity was determined by strain BT150 / pDP34R / PH05-ssFT, BT.
150 / pDP34R / PH05 (-173) -ssF
T, H449 / pDP34R / PH05-ssFT and H449 / pDP34R / PH05 (-173) -s
Crude extract prepared from sFT, as well as H449 / p
DP34 / PH05-I-FT, H449 / pDP34
/ PH05 (-173) -I-FT, BT150 / pD
P34 / PH05-I-FT and BT150 / pDP
34 / PH05 (-173) -I-FT.

Deposit of Microorganisms The following strains of microorganisms are Deutsche Sammlung von Mikroorga
nsmen) (DMS), Maschero del Bagh 16, D-330
0 Commissioned by Braunschweig. The deposit date and accession number are as follows: Escherichia coli JM109 / pDP3
4: March 14, 1988; DSM4473 Escherichia coli HM101 / pP30:
October 23, 1987; DSM4297 Escherichia coli HM101 / p31R:
December 19, 1988; DSM5116 Saccharomyces cere
visiae ) H449: February 18, 1988; DSM44
13 Saccharomyces cere
visiae ) BT150: May 23, 1991; DSM6
530

[0181]

[Sequence Listing] SEQ ID NO: 1 Sequence type: Nucleotides and corresponding proteins Sequence length: 1265 bp Number of chains: Double strand Topology: Linear Sequence type: Recombinant Direct origin: From E. coli DH5α / p4AD113 Plasmid
p4AD113 Features: cDNA sequence encoding 6 to 1200 bp HeLa cell galactosyltransferase 1 to 6 bp EcoRI site 497 to 504 bp NotI site 1227 to 1232 bp EcoRI site 1236 to 1241 bp EcoRV site 1243 to 1248 bp BglII site Properties: Full length galactosyltransferase (EC2.4.1. 2
Plasmid p4 comprising the HeLa cell cDNA encoding 2)
EcoRI-HindIII fragment sequence from AD113: GAATTC ATG AGG CTT CGG GAG CCG CTC CTG AGC GGC AGC GCC GCG 45 Met Arg Leu Arg Glu Pro Leu Leu Ser Gly Ser Ala Ala 5 10 ATG CCA GGC GCG TCC CTA CAG CGG GCC TGC CGC CTG CTC GTG GCC 90 Met Pro Gly Ala Ser Leu Gln Arg Ala Cys Arg Leu Leu Val Ala 15 20 25 GTC TGC GCT CTG CAC CTT GGC GTC ACC CTC GTT TAC TAC CTG GCT 135 Val Cys Ala Leu His Leu Gly Val Thr Leu Val Tyr Tyr Leu Ala 30 35 40 GGC CGC GAC CTG AGC CGC CTG CCC CAA CTG GTC GGA GTC TCC ACA 180 Gly Arg Asp Leu Ser Arg Leu Pro Gln Leu Val Gly Val Ser Thr 45 50 55 CCG CTG CAG GGC GGC TCG AAC AGT GCC GCC GCC ATC GGG CAG TCC 225 Pro Leu Gln Gly Gly Ser Asn Ser Ala Ala Ala Ile Gly Gln Ser 60 65 70 TCC GGG GAG CTC CGG ACC GGA GGG GCC CGG CCG CCG CCT CCT CTA 270 Ser Gly Glu Leu Arg Thr Gly Gly Ala Arg Pro Pro Pro Pro Leu 75 80 85 GGC GCC TCC TCC CAG CCG CGC CCG GGT GGC GAC TCC AGC CCA GTC 315 Gly Ala Ser Ser Gln Pro Arg Pro Gly Gly Asp Ser Ser Pro Val 90 95 100 GTG GAT TCT GGC CCT GGC CCC GCT AGC A AC TTG ACC TCG GTC CCA 360 Val Asp Ser Gly Pro Gly Pro Ala Ser Asn Leu Thr Ser Val Pro 105 110 115 GTG CCC CAC ACC ACC GCA CTG TCG CTG CCC GCC TGC CCT GAG GAG 405 Val Pro His Thr Thr Ala Leu Ser Leu Pro Ala Cys Pro Glu Glu 120 125 130 TCC CCG CTG CTT GTG GGC CCC ATG CTG ATT GAG TTT AAC ATG CCT 450 Ser Pro Leu Leu Val Gly Pro Met Leu Ile Glu Phe Asn Met Pro 135 140 145 GTG GAC CTG GAG CTC GTG GCA AAG CAG AAC CCA AAT GTG AAG ATG 495 Val Asp Leu Glu Leu Val Ala Lys Gln Asn Pro Asn Val Lys Met 150 155 160 GGC GGC CGC TAT GCC CCC AGG GAC TGC GTC TCT CCT CAC AAG GTG 540 Gly Gly Arg Tyr Ala Pro Arg Asp Cys Val Ser Pro His Lys Val 165 170 175 GCC ATC ATC ATT CCA TTC CGC AAC CGG CAG GAG CAC CTC AAG TAC 580 Ala Ile Ile Ile Pro Phe Arg Asn Arg Gln Glu His Leu Lys Tyr 180 185 190 TGG CTA TAT TAT TTG CAC CCA GTC CTG CAG CGC CAG CAG CTG GAC 630 Trp Leu Tyr Tyr Leu His Pro Val Leu Gln Arg Gln Gln Leu Asp 195 200 205 TAT GGC ATC TAT GTT ATC AAC CAG GCG GGA GAC ACT ATA TTC AAT 675 Tyr Gly Ile Tyr Val I le Asn Gln Ala Gly Asp Thr Ile Phe Asn 210 215 220 CGT GCT AAG CTC CTC AAT GTT GGC TTT CAA GAA GCC TTG AAG GAC 720 Arg Ala Lys Leu Leu Asn Val Gly Phe Gln Glu Ala Leu Lys Asp 225 230 235 TAT GAC TAC ACC TGC TTT GTG TTT AGT GAC GTG GAC CTC ATT CCA 765 Tyr Asp Tyr Thr Cys Phe Val Phe Ser Asp Val Asp Leu Ile Pro 240 245 250 ATG AAT GAC CAT AAT GCG TAC AGG TGT TTT TCA CAG CCA CGG CAC 810 Met Asn Asp His Asn Ala Tyr Arg Cys Phe Ser Gln Pro Arg His 255 260 265 ATT ATT TCC GTT GCA ATG GAT AAG TTT GGA TTC AGC CTA CCT TAT GTT 855 Ile Ser Val Ala Met Asp Lys Phe Gly Phe Ser Leu Pro Tyr Val 270 275 280 CAG TAT TTT GGA GGT GTC TCT GCT CTA AGT AAA CAA CAG TTT CTA 900 Gln Tyr Phe Gly Gly Val Ser Ala Leu Ser Lys Gln Gln Phe Leu 285 290 295 ACC ATC AAT GGA TTT CCT AAT AAT TAT TGG GGC TGG GGA GGA GAA 945 Thr Ile Asn Gly Phe Pro Asn Asn Tyr Trp Gly Trp Gly Gly Glu 300 305 310 GAT GAT GAC ATT TTT AAC AGA TTA GTT TTT AGA GGC ATG TCT ATA 990 Asp Asp Asp Ile Phe Asn Arg Leu Val Phe Arg Gly Met Ser Ile 315 320 3 25 TCT CGC CCA AAT GCT GTG GTC GGG AGG TGT CGC ATG ATC CGC CAC 1035 Ser Arg Pro Asn Ala Val Val Gly Arg Cys Arg Met Ile Arg His 330 335 340 TCA AGA GAC AAG AAA AAT GAA CCC AAT CCT CAG AGG TTT GAC CGA 1080 Ser Arg Asp Lys Lys Asn Glu Pro Asn Pro Gln Arg Phe Asp Arg 345 350 355 ATT GCA CAC ACA AAG GAG ACA ATG CTC TCT GAT GGT TTG AAC TCA 1125 Ile Ala His Thr Lys Glu Thr Met Leu Ser Asp Gly Leu Asn Ser 360 365 370 CTC ACC TAC CAG GTG CTG GAT GTA CAG AGA TAC CCA TTG TAT ACC 1170 Leu Thr Tyr Gln Val Leu Asp Val Gln Arg Tyr Pro Leu Tyr Thr 375 380 385 CAA ATC ACA GTG GAC ATC GGG ACA CCG AGC TAGGACTTTT 20GGTACA Gln Ile Thr Val Asp Ile Gly Thr Pro Ser 390 395 AAGACTGAAT TCATCGATAT CTAGATCTCG AGCTCGCGAA AGCTT 1265

SEQ ID NO: 2 Sequence type: Protein Sequence length: 357 amino acids Sequence type: C-terminal fragment of full-length HeLa cell galactosyltransferase Properties: Soluble galactosyltransferase (EC2.4.1.22) sequence from HeLa cells : Leu Ala Gly Arg Asp Leu Ser Arg Leu Pro Gln Leu Val Gly Val 5 10 15 Ser Thr Pro Leu Gln Gly Gly Ser Asn Ser Ala Ala Ala Ile Gly 20 25 30 Gln Ser Ser Gly Glu Leu Arg Thr Gly Gly Ala Arg Pro Pro Pro 35 40 45 Pro Leu Gly Ala Ser Ser Gln Pro Arg Pro Gly Gly Asp Ser Ser 50 55 60 Pro Val Val Asp Ser Gly Pro Gly Pro Ala Ser Asn Leu Thr Ser 65 70 75 Val Pro Val Pro His Thr Thr Ala Leu Ser Leu Pro Ala Cys Pro 80 85 90 Glu Glu Ser Pro Leu Leu Val Gly Pro Met Leu Ile Glu Phe Asn 95 100 105 Met Pro Val Asp Leu Glu Leu Val Ala Lys Gln Asn Pro Asn Val 110 115 120 Lys Met Gly Gly Arg Tyr Ala Pro Arg Asp Cys Val Ser Pro His 125 130 135 Lys Val Ala Ile Ile Ile Pro Phe Arg Asn Arg Gln Glu His Leu 140 145 150 Lys Tyr Trp Leu Tyr Tyr Leu His Pro Val Leu Gln Arg Gln Gln 155 160 165 Leu Asp Tyr Gly Ile Tyr Val Ile Asn Gln Ala Gly Asp Thr Ile 170 175 180 Phe Asn Arg Ala Lys Leu Leu Asn Val Gly Phe Gln Glu Ala Leu 185 190 195 Lys Asp Tyr Asp Tyr Thr Cys Phe Val Phe Ser Asp Val Asp Leu 200 205 210 Ile Pro Met Asn Asp His Asn Ala Tyr Arg Cys Phe Ser Gln Pro 215 220 225 Arg His Ile Ser Val Ala Met Asp Lys Phe Gly Phe Ser Leu Pro 230 235 240 Tyr Val Gln Tyr Phe Gly Gly Val Ser Ala Leu Ser Lys Gln Gln 245 250 255 Phe Leu Thr Ile Asn Gly Phe Pro Asn Asn Tyr Trp Gly Trp Gly 260 265 270 Gly Glu Asp Asp Asp Asp Asp Ile Phe Asn Arg Leu Val Phe Arg Gly Met 275 280 285 Ser Ile Ser Arg Pro Asn Ala Val Val Gly Arg Cys Arg Met Ile 290 295 300 Arg His Ser Arg Asp Lys Lys Asn Glu Pro Asn Pro Gln Arg Phe 305 310 315 Asp Arg Ile Ala His Thr Lys Glu Thr Met Leu Ser Asp Gly Leu 320 325 330 Asn Ser Leu Thr Tyr Gln Val Leu Asp Val Gln Arg Tyr Pro Leu 335 340 345 Tyr Thr Gln Ile Thr Val Asp Ile Gly Thr Pro Ser 350 355

SEQ ID NO: 3 Sequence type: Nucleotides and corresponding proteins Sequence length: 1246 bp Number of chains: Double stranded Topology: Linear Sequence type: Recombinant Direct origin: From E. coli DH5α / pSIA2 Plasmid pS
IA2 Characteristics: 15 to 1232 bp cDNA sequence encoding HepG2 cell sialyltransferase 1 to 6 bp PstI site 6 to 11 bp EcoRI site 144 to 149 bp EcoRI site 1241 to 1246 bp BamHI site Properties: Full-length sialyltransferase (EC2.4.99.1)
Is the plasmid pSIA2 containing the encoding HepG2 cDNA?
PstI-BamHI fragment sequence: CTGCAGAATT CAAA ATG ATT CAC ACC AAC CTG AAG AAA AAG TTC AGC 47 Met Ile His Thr Asn Leu Lys Lys Lys Phe Ser 5 10 TGC TGC GTC CTG GTC TTT CTT CTG TTT GCA GTC ATC TGT GTG TGG 92 Cys Cys Val Leu Val Phe Leu Leu Phe Ala Val Ile Cys Val Trp 15 20 25 AAG GAA AAG AAG AAA GGG AGT TAC TAT GAT TCC TTT AAA TTG CAA 137 Lys Glu Lys Lys Lys Gly Ser Tyr Tyr Asp Ser Phe Lys Leu Gln 30 35 40 ACC AAG GAA TTC CAG GTG TTA AAG AGT CTG GGG AAA TTG GCC ATG 182 Thr Lys Glu Phe Gln Val Leu Lys Ser Leu Gly Lys Leu Ala Met 45 50 55 GGG TCT GAT TCC CAG TCT GTA TCC TCA AGC AGC ACC CAG GAC CCC 227 Gly Ser Asp Ser Gln Ser Val Ser Ser Ser Ser Thr Gln Asp Pro 60 65 70 CAC AGG GGC CGC CAG ACC CTC GGC AGT CTC AGA GGC CTA GCC AAG 272 His Arg Gly Arg Gln Thr Leu Gly Ser Leu Arg Gly Leu Ala Lys 75 80 85 GCC AAA CCA GAG GCC TCC TTC CAG GTG TGG AAC AAG GAC AGC TCT 317 Ala Lys Pro Glu Ala Ser Phe Gln Val Trp Asn Lys Asp Ser Ser 90 95 100 TCC AAA AAC CTT ATC CCT AGG CTG CAA AAG ATC TGG AAG AAT T AC 362 Ser Lys Asn Leu Ile Pro Arg Leu Gln Lys Ile Trp Lys Asn Tyr 105 110 115 CTA AGC ATG AAC AAG TAC AAA GTG TCC TAC AAG GGG CCA GGA CCA 407 Leu Ser Met Asn Lys Tyr Lys Val Ser Tyr Lys Gly Pro Gly Pro 120 125 130 GGC ATC AAG TTC AGT GCA GAG GCC CTG CGC TGC CAC CTC CGG GAC 452 Gly Ile Lys Phe Ser Ala Glu Ala Leu Arg Cys His Leu Arg Asp 135 140 145 CAT GTG AAT GTA TCC ATG GTA GAG GTC ACA GAT TTT CCC TTC AAT 497 His Val Asn Val Ser Met Val Glu Val Thr Asp Phe Pro Phe Asn 150 155 160 ACC TCT GAA TGG GAG GGT TAT CTG CCC AAG GAG AGC ATT AGG ACC 542 Thr Ser Glu Trp Glu Gly Tyr Leu Pro Lys Glu Ser Ile Arg Thr 165 170 175 AAG GCT GGG CCT TGG GGC AGG TGT GCT GTT GTG TCG TCA GCG GGA 587 Lys Ala Gly Pro Trp Gly Arg Cys Ala Val Val Ser Ser Ala Gly 180 185 190 TCT CTG AAG TCC TCC CAA CTA GGC AGA GAA ATC GAT GAT CAT GAC 632 Ser Leu Lys Ser Ser Gln Leu Gly Arg Glu Ile Asp Asp His Asp 195 200 205 GCA GTC CTG AGG TTT AAT GGG GCA CCC ACA GCC AAC TTC CAA CAA 677 Ala Val Leu Arg Phe Asn Gly Ala Pro Thr A la Asn Phe Gln Gln 210 215 220 GAT GTG GGC ACA AAA ACT ACC ATT CGC CTG ATG AAC TCT CAG TTG 722 Asp Val Gly Thr Lys Thr Thr Ile Arg Leu Met Asn Ser Gln Leu 225 230 235 GTT ACC ACA GAG AAG CGC TTC CTC AAA GAC AGT TTG TAC AAT GAA 767 Val Thr Thr Glu Lys Arg Phe Leu Lys Asp Ser Leu Tyr Asn Glu 240 245 250 GGA ATC CTA ATT GTA TGG GAC CCA TCT GTA TAC CAC TCA GAT ATC 812 Gly Ile Leu Ile Val Trp Asp Pro Ser Val Tyr His Ser Asp Ile 255 260 265 CCA AAG TGG TAC CAG AAT CCG GAT TAT AAT TTC TTT AAC AAC TAC 857 Pro Lys Trp Tyr Gln Asn Pro Asp Tyr Asn Phe Phe Asn Asn Tyr 270 275 280 AAG ACT TAT CGT AAG CTG CAC CCC AAT CAG CCC TTT TAC ATC CTC 902 Lys Thr Tyr Arg Lys Leu His Pro Asn Gln Pro Phe Tyr Ile Leu 285 290 295 AAG CCC CAG ATG CCT TGG GAG CTA TGG GAC ATT CTT CAA GAA ATC 947 Lys Pro Gln Met Pro Trp Glu Leu Trp Asp Ile Leu Glu Glu Ile 300 305 310 TCC CCA GAA GAG ATT CAG CCA AAC CCC CCA TCC TCT GGG ATG CTT 992 Ser Pro Glu Glu Ile Gln Pro Asn Pro Pro Ser Ser Gly Met Leu 315 320 325 GGT ATC ATC ATC A TG ATG ACG CTG TGT GAC CAG GTG GAT ATT TAT 1037 Gly Ile Ile Ile Met Met Thr Leu Cys Asp Gln Val Asp Ile Tyr 330 335 340 GAG TTC CTC CCA TCC AAG CGC AAG ACT GAC GTG TGC TAC TAC TAC 1082 Glu Phe Leu Pro Ser Lys Arg Lys Thr Asp Val Cys Tyr Tyr Tyr 345 350 355 CAG AAG TTC TTC GAT AGT GCC TGC ACG ATG GGT GCC TAC CAC CCG 1127 Gln Lys Phe Phe Asp Ser Ala Cys Thr Met Gly Ala Tyr His Pro 360 365 370 CTG CTC TAT GAG AAG AAT TTG GTG AAG CAT CTC AAC CAG GGC ACA 1172 Leu Leu Tyr Glu Lys Asn Leu Val Lys His Leu Asn Gln Gly Thr 375 380 385 GAT GAG GAC ATC TAC CTG CTT GGA AAA GCC ACA CTG CCT GGC TTC 1217 Asp Glu Asp Ile Tyr Leu Leu Gly Lys Ala Thr Leu Pro Gly Phe 390 395 400 CGG ACC ATT CAC TGC TAAGCACAGG ATCC 1246 Arg Thr Ile His Cys 405

SEQ ID NO: 4 Sequence type: Protein Sequence length: 368 amino acids Sequence type: C-terminal fragment of full length sialyltransferase Properties: Soluble sialyltransferase (EC2.4.99.1) sequence from human HepG2 cells Sequence: Lys Leu Gln Thr Lys Glu Phe Gln Val Leu Lys Ser Leu Gly Lys 5 10 15 Leu Ala Met Gly Ser Asp Ser Gln Ser Val Ser Ser Ser Ser Thr 20 25 30 Gln Asp Pro His Arg Gly Arg Gln Thr Leu Gly Ser Leu Arg Gly 35 40 45 Leu Ala Lys Ala Lys Pro Glu Ala Ser Phe Gln Val Trp Asn Lys 50 55 60 Asp Ser Ser Ser Lys Asn Leu Ile Pro Arg Leu Gln Lys Ile Trp 65 70 75 Lys Asn Tyr Leu Ser Met Asn Lys Tyr Lys Val Ser Tyr Lys Gly 80 85 90 Pro Gly Pro Gly Ile Lys Phe Ser Ala Glu Ala Leu Arg Cys His 95 100 105 Leu Arg Asp His Val Asn Val Ser Met Val Glu Val Thr Asp Phe 110 115 120 Pro Phe Asn Thr Ser Glu Trp Glu Gly Tyr Leu Pro Lys Glu Ser 125 130 135 Ile Arg Thr Lys Ala Gly Pro Trp Gly Arg Cys Ala Val Val Ser 140 145 150 Ser Ala Gl y Ser Leu Lys Ser Ser Gln Leu Gly Arg Glu Ile Asp 155 160 165 Asp His Asp Ala Val Leu Arg Phe Asn Gly Ala Pro Thr Ala Asn 170 175 180 Phe Gln Gln Asp Val Gly Thr Lys Thr Thr Ile Arg Leu Met Asn 185 190 195 Ser Gln Leu Val Thr Thr Glu Lys Arg Phe Leu Lys Asp Ser Leu 200 205 210 Tyr Asn Glu Gly Ile Leu Ile Val Trp Asp Pro Ser Val Tyr His 215 220 225 Ser Asp Ile Pro Lys Trp Tyr Gln Asn Pro Asp Tyr Asn Phe Phe 230 235 240 Asn Asn Tyr Lys Thr Tyr Arg Lys Leu His Pro Asn Gln Pro Phe 245 250 255 Tyr Ile Leu Lys Pro Gln Met Pro Trp Glu Leu Trp Asp Ile Leu 260 265 270 Gln Glu Ile Ser Pro Glu Glu Ile Gln Pro Asn Pro Pro Ser Ser 275 280 285 Gly Met Leu Gly Ile Ile Ile Met Met Thr Leu Cys Asp Gln Val 290 295 300 Asp Ile Tyr Glu Phe Leu Pro Ser Lys Arg Lys Thr Asp Val Cys 305 310 315 Tyr Tyr Tyr Gln Lys Phe Phe Asp Ser Ala Cys Thr Met Gly Ala 320 325 330 Tyr His Pro Leu Leu Tyr Glu Lys Asn Leu Val Lys His Leu Asn 335 340 345 Gln Gly Thr Asp Glu Asp Ile Tyr Leu Leu Gly Lys Ala Thr Leu 350 355 360 Pr o Gly Phe Arg Thr Ile His Cys 365

SEQ ID NO: 5 Sequence Type: Nucleotide Sequence and Corresponding Protein Sequence Length: 1400 bp Number of Chains: Duplex Topology: Linear Direct Origin: BRB.ELFT / pCR1000-13 Features: From 58 1272bp cDNA sequence encoding human α (1-3) fucosyltransferase 238 to 243bp NruI site Properties: Full length α (1-3) Fucosyltransferase encoding HL60 cDNA sequence: CGCTCCTCCA CGCCTGCGGA CGCGTGGCGA GCGGAGGCAG CGCTGCCTGT 50 TCGCGCC ATG GGG GCA CCG TGG GGC TCG CCG ACG GCG GCG GCG GGC 96 Met Gly Ala Pro Trp Gly Ser Pro Thr Ala Ala Ala Gly 5 10 GGG CGG CGC GGG TGG CGC CGA GGC CGG GGG CTG CCA TGG ACC GTC 141 Gly Arg Arg Gly Trp Arg Arg Gly Arg Gly Leu Pro Trp Thr Val 15 20 25 TGT GTG CTG GCG GCC GCC GGC TTG ACG TGT ACG GCG CTG ATC ACC 186 Cys Val Leu Ala Ala Ala Gly Leu Thr Cys Thr Ala Leu Ile Thr 30 35 40 TAC GCT TGC TGG GGG CAG CTG CCG CCG CTG CCC TGG GCG TCG CCA 231 Tyr Ala Cys Trp Gly Gln Leu Pro P ro Leu Pro Trp Ala Ser Pro 45 50 55 ACC CCG TCG CGA CCG GTG GGC GTG CTG CTG TGG TGG GAG CCC TTC 276 Thr Pro Ser Arg Pro Val Gly Val Leu Leu Trp Trp Glu Pro Phe 60 65 70 GGG GGG CGC GAT AGC GCC CCG AGG CCG CCC CCT GAC TGC CGG CTG 321 Gly Gly Arg Asp Ser Ala Pro Arg Pro Pro Pro Asp Cys Arg Leu 75 80 85 CGC TTC AAC ATC AGC GGC TGC CGC CTG CTC ACC GAC CGC GCG TCC 366 Arg Phe Asn Ile Ser Gly Cys Arg Leu Leu Thr Asp Arg Ala Ser 90 95 100 TAC GGA GAG GCT CAG GCC GTG CTT TTC CAC CAC CGC GAC CTC GTG 411 Tyr Gly Glu Ala Gln Ala Val Leu Phe His His Arg Asp Leu Val 105 110 115 AAG GGG CCC CCC GAC TGG CCC CCG CCC TGG GGC ATC CAG GCG CAC 456 Lys Gly Pro Pro Asp Trp Pro Pro Pro Trp Gly Ile Gln Ala His 120 125 130 ACT GCC GAG GAG GTG GAT CTG CGC GTG TTG GAC TAC GAG GAG GCA 501 Thr Ala Glu Glu Val Asp Leu Arg Val Leu Asp Tyr Glu Glu Ala 135 140 145 GCG GCG GCG GCA GAA GCC CTG GCG ACC TCC AGC CCC AGG CCC CCG 546 Ala Ala Ala Ala Glu Ala Leu Ala Thr Ser Ser Pro Arg Pro Pro 150 155 160 GGC CAG CGC TGG GTT TGG ATG AAC TTC GAG TCG CCC TCG CAC TCC 591 Gly Gln Arg Trp Val Trp Met Asn Phe Glu Ser Pro Ser His Ser 165 170 175 CCG GGG CTG CGA AGC CTG GCA AGT AAC CTC TTC AAC TGG ACG CTC 636 Pro Gly Leu Arg Ser Leu Ala Ser Asn Leu Phe Asn Trp Thr Leu 180 185 190 TCC TAC CGG GCG GAC TCG GAC GTC TTT GTG CCT TAT GGC TAC CTC 681 Ser Tyr Arg Ala Asp Ser Asp Val Phe Val Pro Tyr Gly Tyr Leu 195 200 205 TAC CCC AGA AGC CAC CCC GGC GAC CCG CCC TCA GGC CTG GCC CCG 726 Tyr Pro Arg Ser His Pro Gly Asp Pro Pro Ser Gly Leu Ala Pro 210 215 220 CCA CTG TCC AGG AAA CAG GGG CTG GTG GCA TGG GTG GTG AGC CAC 771 Pro Leu Ser Arg Lys Gln Gly Leu Val Ala Trp Val Val Ser His 225 230 235 TGG GAC GAG CGC CAG GCC CGG GTC CGC TAC TAC CAC CAA CTG AGC 816 Trp Asp Glu Arg Gln Ala Arg Val Arg Tyr Tyr His Gln Leu Ser 240 245 250 CAA CAT GTG ACC GTG GAC GTG TTC GGC CGG GGC GGG CCG GGG CAG 861 Gln His Val Thr Val Asp Val Phe Gly Arg Gly Gly Pro Gly Gln 255 260 265 CCG GTG CCC GAA ATT GGG CTC CTG CAC ACA GTG GCC CGC TAC AAG 906 Pro Val Pro Glu Ile Gly Leu Leu His Thr Val Ala Arg Tyr Lys 270 275 280 TTC TAC CTG GCT TTC GAG AAC TCG CAG CAC CTG GAT TAT ATC ACC 951 Phe Tyr Leu Ala Phe Glu Asn Ser Gln His Leu Asp Tyr Ile Thr 285 290 295 GAG AAG CTC TGG CGC AAC GCG TTG CTC GCT GGG GCG GTG CCG GTG 996 Glu Lys Leu Trp Arg Asn Ala Leu Leu Ala Gly Ala Val Pro Val 300 305 310 GTG CTG GGC CCA GAC CGT GCC AAC TAC GAG CGC TTT GTG CCC CGC 1041 Val Leu Gly Pro Asp Arg Ala Asn Tyr Glu Arg Phe Val Pro Arg 315 320 325 GGC GCC TTC ATC CAC GTG GAC GAC TTC CCA AGT GCC TCC TCC CTG 1086 Gly Ala Phe Ile His Val Asp Asp Phe Pro Ser Ala Ser Ser Leu 330 335 340 GCC TCG TAC CTG CTT TTC CTC GAC CGC AAC CCC GCG GTC TAT CGC 1131 Ala Ser Tyr Leu Leu Phe Leu Asp Arg Asn Pro Ala Val Tyr Arg 345 350 355 CGC TAC TTC CAC TGG CGC CGG AGC TAC GCT GTC CAC ATC ACC TCC 1176 Arg Tyr Phe His Trp Arg Arg Ser Tyr Ala Val His Ile Thr Ser 360 365 370 TTC TGG GAC GAG CCT TGG TGC CGG GTG TGC CAG GCT GTA CAG AGG 1221 Phe Trp Asp Glu Pro Trp Cys Arg Val Cys Gln Al a Val Gln Arg 375 380 385 GCT GGG GAC CGG CCC AAG AGC ATA CGG AAC TTG GCC AGC TGG TTC 1266 Ala Gly Asp Arg Pro Lys Ser Ile Arg Asn Leu Ala Ser Trp Phe 390 495 400 GAG CGG TGAAGCCGCG CTCCCCTGGA GluGAGGGCCCCAG12 405 GTTGTCAGCT TTTTGATCCT CTACTGTGCA TCTCCTTGAC TGCCGCATCA 1362 TGGGAGTAAG TTCTTCAAAC ACCCATTTTT GCTCTATG 1400

 ─────────────────────────────────────────────────── ─── Continuation of the front page (72) Inventor Eric G. Berger Switzerland, 8165 Schaefflisdorf, Zum Mulibaiher 4 (72) Inventor Bernd Mayhac Switzerland, 4312 McDen, Haembek 9 (72) Inventor Manfred Bazel Germany, 8120 Beilheim, Spiegelstraße 7

Claims (19)

[Claims] 1. A method for producing a mammalian membrane-bound glycosyltransferase selected from the group consisting of galactosyltransferase, sialyltransferase and fucosyltransferase, or a variant thereof, which comprises a promoter and the glycosyltransferase or variant. DNA sequence (the DN
A sequence is controlled by the promoter), the yeast strain transformed with a hybrid vector comprising an expression cassette comprising the above, and the enzymatic activity is recovered. 2. The method of claim 1, wherein the glycosyltransferase is of human origin. 3. The method of variants according to claim 1, wherein the variant differs from the corresponding full length glycosyltransferase by the lack of a cytoplasmic tail, a signal anchor and optionally a small portion of the stem region. 4. A promoter operably linked to a first DNA sequence encoding a signal peptide linked in proper reading frame to a second DNA sequence encoding the variant (wherein the DNA sequence is controlled by the promoter). The method according to claim 3, characterized in that a yeast strain comprising an expression cassette comprising a) is cultured and the enzymatic activity is recovered. 5. The method of claim 1, wherein the glycosyl transferase is a galactosyl transferase. 6. The galactosyltransferase is UDP-galactose: β-galactoside α (1-
3) -galactosyl transferase (EC2.4.
1.151) and UDP-galactose: β-N-acetylglucosamine β (1-4) -galactosyl transferase (EC 2.4.1.22). 7. The method of claim 5, wherein the galactosyl transferase has the amino acid sequence set forth in SEQ ID NO: 1. 8. The method according to claim 5, wherein the galactosyltransferase has the amino acid sequence shown in Sequence Listing 2. 9. The method of claim 1, wherein the glycosyltransferase is a sialyltransferase. 10. The CMP-NeuAcβ-galactoside α (2-6) -sialyltransferase (EC
2.4.99.1). 11. The method of claim 9, wherein the galactosyl transferase has the amino acid sequence set forth in SEQ ID NO: 3. 12. The sialyltransferase is S
10. The method of claim 9, designated T (Lys ₂₇ -Cys ₄₀₆ ) and consisting of 27-406 amino acids of the amino acid sequence set forth in SEQ ID NO: 3. 13. The method of claim 9, wherein the sialyltransferase has the amino acids set forth in SEQ ID NO: 4. 14. The method of claim 1, wherein the glycosyl transferase is a fucosyl transferase. 15. The fucosyltransferase is
GDP-fucose: β-galactoside α (1-2) -fucosyltransferase (EC 2.4. 1.69) and GDP-fucose: N-acetylglucosamine α
(1-3 / 4) -fucosyltransferase (EC
15. The method according to claim 14, selected from the group consisting of 2.4. 1.65). 16. The method according to claim 14, wherein the fucosyltransferase has an amino acid sequence shown in the sequence shown in Sequence Listing 5. 17. The fucosyltransferase is F
Is displayed T (Arg ₆₂ -Arg _405), and consists of amino acids 62-405 of the amino acid sequence shown in the sequence shown in SEQ ID NO: 5, The method of claim 14. 18. A promoter and a DNA sequence encoding a mammalian membrane-bound glycosyltransferase selected from the group consisting of galactosyltransferase, sialyltransferase and fucosyltransferase, or a variant thereof, wherein said DNA sequence is controlled by said promoter. And an expression cassette comprising: 19. A yeast strain transformed with the hybrid vector of claim 18.