BE1005579A5 - METHOD FOR PRODUCING glycosyltransferases, VECTOR HYBRID AND YEAST STRAINS USED FOR THAT PURPOSE. - Google Patents

Abstract

The invention describes a process for the production of a mammalian membrane-bound glycosyltransferase selected from a galactosyltransferase, a sialyltransferase and a fucosyltransferase or a variant thereof, respectively, comprising culturing a yeast strain which has was transformed with a hybrid vector comprising an expression cassette comprising a promoter and a DNA sequence coding for said glycosyltransferase or variant, which DNA is controlled by said promoter, and the recovery of enzymatic activity.

Description

       

    <Desc / Clms Page number 1>
 



  Process for the production of glycosyltransferases, hybrid vector and yeast strains used for this purpose
 EMI1.1
 The invention relates to the field of recombinant DNA technology and provides an improved process for the production of glycosyltransferases using transformed yeast strains.



  Glycosyltransferases catalyze the transfer of carbohydrate moieties from an activated donor substrate, usually a nucleotide sugar, to a specific acceptor sugar, to form a glycosidic bond. Depending on the type of sugar transferred, these enzymes are grouped into families, for example galactosyltransferases, sialyltransferases and fucosyltransferases. Being resident membrane proteins mainly located in the Golgi apparatus, glycosyltransferases have in common a domain structure consisting of a short amino-terminal cytoplasmic tail, an anchor-signal domain, and a region of extended rod which is followed by a large carboxy-terminal catalytic domain.

   The signal anchoring domain plays the role of both an inseparable signal peptide and a membrane covering domain, and directs the catalytic domain of glycosyltransferase in the lumen of the Golgi apparatus. The region of the spacer or the rod in the vicinity of the lumen is supposed to serve as a flexible mooring, which allows the catalytic domain to glycosylate carbohydrate groups of soluble proteins, and bound to the membrane, of the secretory chain,

  <Desc / Clms Page number 2>

 heading towards the Golgi apparatus. In addition, it was discovered that the stem region functioned as a retention signal to maintain the enzyme bound to the membrane of the Golgi apparatus (PCT application No. 91/06635).

   It is assumed that these soluble glycosyltransferases originate from a proteolytic release, by endogenous proteases, from the corresponding forms of enzymes linked to the membrane, probably by cleavage between the catalytic domain and the trans-membrane domain.



   The enzymatic synthesis of carbohydrate structures offers the advantage of great stereoselectivity and great regioselectivity, which makes glycosyltransferases a valuable tool for the modification and synthesis of glycoproteins, glycolipids and oligosaccharides. Unlike chemical methods, the introduction of protecting groups; which takes a long time, is then superfluous. '
Since glycosyltransferases are only found in nature in very small amounts, isolation from natural sources and. subsequent purification are difficult. As a result, production using recombinant DNA technology has been studied.

   For example, galactosyltransferases have been expressed in E. coli (PCT 90/07000) and d! Asian hamster ovary (CHO) [D. F. Smith et al. (1990) J. Biol. Chem., 265, 6225-6234], sialyltransferases have been expressed in CHO cells [E. U. Lee (1990) Diss.



    Abstr. Int. B 50, 3453-3454] and COS-1 cells [J. C. Paulsen et al. (1988) J. Cell. Biol. 107, 10A], and fucosyltransferases were produced in COS-1 cells [S. E. Goelz et al. (1990) Cell., 63, 1349-1356; R. D. Larsen et al. (1990) Proc. Natl. Acad. Sci. USA, 87, 6674-6678] and CHO cells [B. Potvin (1990) J. Biol.



    Chem., 265, 1615-1622]. Given the facts that heterologous expression in prokaryotes has the disadvantage of

  <Desc / Clms Page number 3>

 to provide non-glycosylated products, the glycosyltransferases being however glycoproteins, and that the production of glycosyltranferases by means of mammalian hosts is very expensive and very complicated, due to the presence of numerous endogenous glycosyltransferases contaminating the desired product, it is necessary to be able to have improved processes, allowing the economic production of glycosyltranferases on a large scale.



   An object of the present invention is to provide such a method.



   The present invention provides a process for the production of biologically active glycosyltransferases by recombinant DNA technology using an expression system comprising a yeast-like vector.



   More specifically, the present invention provides a method for the production of a membrane-bound glycosyltransferase, selected from a galadtosyltransferase, a sialyltransferase and a fucosyltransferase, or a variant thereof, respectively, said method comprising culturing a yeast strain having been transformed with a hybrid vector comprising an expression cassette comprising a promoter and a DNA sequence coding for said glycosyltransferase or variant, which DNA is controlled by said promoter, and the recovery of enzymatic activity.



   In a first embodiment, the invention relates to a method for the production of a membrane-bound glycosyltransferase, chosen from a galactosyltransferase, a sialyltransferase and a fucosyltransferase, or a variant thereof, respectively, said method comprising the culture of a yeast strain having been transformed with a hybrid vector comprising an expression cassette comprising a promoter, a DNA sequence coding for said glycosyltransferase or variant, which DNA sequence is controlled by said promoter,

  <Desc / Clms Page number 4>

 and a DNA sequence containing yeast transcription termination signals, and recovery of enzyme activity.



   In a second embodiment, the invention relates to a method for the production of a membrane-bound glycosyltransferase, chosen from a galactosyltransferase, a sialyltransferase and a fucosyltransferase or a variant thereof, respectively, said method comprising the culture of a yeast strain having been transformed with a hybrid vector comprising an expression cassette comprising a promoter functionally linked to a first DNA sequence coding for a signal peptide, linked in the appropriate reading frame to a second sequence of DNA encoding said glycosyltransferase or variant, and a DNA sequence containing yeast transcription termination signals, and recovery of enzymatic activity.



   As used previously or below, the term "glycosyltransferase" is intended to encompass the family of galactosyltransferases, the family of sialyltransferases and the family of fucosyltransferases. Said glycosyltransferases are enzymes existing in nature, of mammalian origin, for example bovine, murine or human. Preferred are naturally occurring human glycosyltransferases, including the enzymes hereinafter designated by their EC numbers.



   The membrane-bound galactosyltransferases and their variants, which can be obtained according to the process of the invention, catalyze the transfer of a galactose residue from an activated donor, usually an activated nucleotide donor such as uridine diphosphate-galactose. (UDP-Gal), to a carbohydrate group.
 EMI4.1
 



  As examples of membrane-bound galactosyltransferases, mention may be made of UDP-galactose: ss-galactoside a (1-3) -galactosyltransferase (EC 2. 4. 1. 151) which uses the

  <Desc / Clms Page number 5>

 galactose as an acceptor substrate, forming a bond a (1-3), and UDP-galactose: ss-N-acetylglucosamine ss (1-4) -galactosyltransferase (EC 2.4. 1.22) which transfers galactose to N-acetylglucosamine (GlcNAc) by forming an ss (1-4) bond, including their variants, respectively.



  In the presence of α-lactalbumin, said ss (1-4) -galactosyl transferase also accepts glucose as an acceptor substrate, thereby catalyzing the synthesis of lactose.



   The membrane-bound galactosyltransferase which is particularly preferred is the enzyme having the amino acid sequence shown in Appendix ID SEQ nO 1.



   The membrane-bound sialyltransferases and their variants, which can be obtained according to the process of the invention, catalyze the transfer of sialic acids [by
 EMI5.1
 example N-acetylneuraminic acid- (NeuAc)], from a donor \. activated, usually cytidin monophosphatesialic acid (CMP-SA), to a carbohydrate acceptor moiety. An example of a membrane-bound sialyltransferase obtainable according to the method of the invention is CMP-NeuAc: ss-galactoside a (2-6) -sialyltransferase (EC 2.4. 99.1) which constitutes the sequence NeuAc -a (2-6) Gal- ss (1-4) GlcNAc common to many carbohydrate groups linked to nitrogen.



   The membrane-bound sialyltransferase which is particularly preferred is the enzyme having the amino acid sequence shown in Appendix ID SEQ No. 3.



   The membrane-bound fucosyltransferases and their variants, which can be obtained according to the process of the invention, catalyze the transfer of a fucose residue from an activated donor, usually an activated nucleotide donor, such as guanosine diphosphate-fucose ( GDP-Fuc), to a carbohydrate group. As examples of such glucosyltransferases, mention may be made of GDP-fucose: ss-galactoside a (1-2) -fucosyltransferase (EC 2. 4. 1.69) and

  <Desc / Clms Page number 6>

   GDP-fucose: N-acetylglucosamine a (1-3 / 4} -fucosyltransferase (EC 2.4. 1.65).



   The membrane-bound fucosyltransferase which is particularly preferred is the enzyme having the amino acid sequence shown in Appendix ID SEQ No. 5.



   As used herein, the term "variants" is intended to encompass both membrane bound and soluble variants of mammalian membrane glycosyltransferases occurring in nature, provided that these variants have an enzymatic activity. Variants of human origin are preferred.



   For example, the term "variants" is intended to include naturally occurring membrane-linked variants of membrane-linked glycosyltransferases encountered within a particular species, for example a
 EMI6.1
 variant of a galactosyltransferase-which differs from the enzyme 1. having the amino acid sequence represented in appendix ID SEQ n 1, by the fact that it is devoid of serine at position 11 and contains the amino acids valine and tyrosine instead of alanine and leucine at positions 31 and 32, respectively. Such a variant can be encoded by a related gene of the same gene family or by an allele variant of a particular gene.

   The term "variants" also includes glycosyltransferases produced from DNA which has been subjected to mutagenesis in vitro, provided that the protein encoded by said DNA has the enzymatic activity of native glycosyltransferase. Such modifications may consist of addition, replacement and / or deletion of amino acids, the latter case leading to shortened variants.



   The preferred variants according to the process of the invention are shortened variants, in particular soluble variants, that is to say variants which are not linked to the membrane. Shortened variants include, for example, soluble forms of glycosyl-

  <Desc / Clms Page number 7>

 membrane-linked transferases and their membrane-bound variants, for example the above-mentioned variants, which can be secreted by a transformed yeast strain, used in the process according to the invention.



  According to the present invention, these soluble enzymes are the preferred truncated variants.



   The invention also relates to a method for the production of a soluble variant of a membrane-bound glycosyltransferase, chosen from a galactosyltransferase, a sialyltransferase and a fucosyltransferase, said method comprising the cultivation of a yeast strain having been transformed by a hybrid vector comprising an expression cassette comprising a promoter operably linked to a first DNA sequence coding for a signal peptide, linked in the appropriate reading frame to a second DNA sequence coding for said variant, and a sequence d DNA containing yeast transcription termination signals, and the isolation of said variant.



   By definition, the soluble form of a glycosyltransferase is a shortened variant which differs from the corresponding complete form, i.e. the membrane-bound form, in the natural state localized in the endoplasmic reticulum of the Golgi complex. , by the absence of the cytoplasmic tail, of the anchoring-signal domain and possibly of part of the region of the stem. As used herein, the term "stem portion" is defined as being a minor portion on the N-terminal side of the stem region, composed of up to 12 amino acids. In other words, the soluble variants prepared according to the process of the present invention consist essentially of the region of the rod as a whole and the catalytic domain.



   The soluble variants are enzymes with enzymatic activity, which differ from the corresponding complete forms by the absence of an NH2-terminal peptide consisting of

  <Desc / Clms Page number 8>

 26 to 67, in particular 26 to 61 amino acid residues, it being understood that the forms devoid of a part of the region of the stem are devoid of only the minor part of the latter, defined above. Preferred are soluble variants which can be obtained from membrane bound glycosyltransferases, previously identified by their EC numbers, as well as soluble variants which can be obtained from membrane bound fucosyltransferase having the sequence shown in appendix ID SEQ nO 5.



   Preferred soluble variants of galactosyltransferases differ from corresponding complete forms in that they lack a peptide
NH2-terminal consisting of 37 to 55, in particular 41 to 44 amino acids. The particularly preferred soluble variant obtained according to the process of the invention is the enzyme having the amino acid sequence represented in appendix ID SEQ nO 2.



   Preferred soluble variants of sialyltransferases are deprived of an NH2-terminal peptide consisting of 26 to 38 amino acids, compared to the complete form. The soluble variant which is particularly preferred according to the process of the invention is the enzyme comprising the amino acid sequence represented in appendix ID SEQ nO 4. Similarly, the soluble variant designated by ST (Lys27-Cys406) consisting of the amino acids 27 to 406 of the amino acid sequence given in appendix ID SEQ nO 3.



   The preferred soluble variants of fucosyltransferases differ from the corresponding complete enzymes in that they lack an NH2terminal peptide consisting of 56 to 67, in particular 56 to 61 amino acids. Particular preference is given to the soluble variant designated by FT (Arg62-Arg405) 'composed of amino acids 62 to 405 of the amino acid sequence given in

  <Desc / Clms Page number 9>

 appendix ID SEQ nO 5.



   The host yeast strains and the components of the hybrid vectors are as specified below.



   The transformed yeast strains are cultivated using methods known in the art.



   Thus, the yeast strains transformed according to the invention are cultivated in a liquid medium containing assimilable sources of carbon, nitrogen and mineral salts.



   Various sources of carbon can be used.



  Examples of preferred carbon sources include assimilable carbohydrates, such as glucose, maltose, mannitol, fructose or lactose, or an acetate such as sodium acetate, which can be used alone or in suitable mixtures. Suitable nitrogen sources include, for example, amino acids, such as casein acid hydrolyzate, peptides and proteins and their breakdown products, such as tryptone, peptone or meat extracts, in addition, yeast extract, malt extract, corn soaking liquor, as well as ammonium salts, such as ammonium chloride, sulfate or nitrate, which can be used alone or in suitable mixtures.

   Mineral salts which can be used include, for example, sodium, potassium, magnesium and calcium sulfates, chlorides, phosphates and carbonates. In addition, the nutrient medium may also contain growth promoters. Substances that stimulate growth include, for example, trace elements, such as iron, zinc, manganese and the like, or individual amino acids.



   Due to the incompatibility between the endogenous 2 jn DNA and the hybrid vectors carrying its replicon, the yeast cells transformed by such hybrid vectors tend to lose the latter. Such yeast cells should be grown under conditions

  <Desc / Clms Page number 10>

 selective, that is to say conditions which require for growth the expression of a gene encoded by a plasmid. The most selective markers currently used and present in the hybrid vectors according to the invention (see below) are genes coding for enzymes of the biosynthesis of purines or amino acids. This makes it necessary to use synthetic minimum media deficient in the corresponding amino acid or purine base.



  However, it is also possible to use genes conferring resistance to an appropriate biocide (for example a gene conferring resistance to the amino glycoside G418). Cells transformed by vectors containing antibiotic resistance genes are cultured in complex media containing the corresponding antibiotic, which makes it possible to achieve higher growth rates and higher cell densities.



   Hybrid vectors comprising the complete 2 g DNA (comprising a functional origin of replication) are maintained stably in strains of Saccharomyces cerevisiae which are devoid of endogenous plasmids 2.jn (so-called cir strains), so that the culture can be carried out under non-selective growth conditions, that is to say in a complex medium.



   Yeast cells containing plasmids hybrid with a constitutive promoter express the DNA coding for a glycosyltransferase, or a variant thereof, controlled by said promoter, without induction.



  However, if said DNA is under the control of a regulated promoter, the composition of the growth site must be adapted so as to obtain maximum levels of mRNA transcripts, for example when the promoter PH05 is used, the medium of growth must contain a low concentration of mineral phosphate, for the depression of this promoter.



   Cultivation is carried out using conventional techniques. Cultivation conditions, such as temperature

  <Desc / Clms Page number 11>

 ture, the pH of the medium and the duration of fermentation, are chosen so that maximum concentrations of the heterologous protein are produced. A selected yeast strain is preferably cultivated under aerobic conditions, in submerged culture with shaking or stirring, at a temperature of about 25 to 35 C, preferably around 28 C, at a pH of 4 to 7, by example at about pH 5, and for at least 1 to 3 days, preferably as long as satisfactory protein yields are obtained.



   After expression in yeast, the glycosyltransferase, or its variant, is either accumulated in the cells, or secreted into the culture medium, and it is isolated by conventional means.



   For example, the first step is usually the separation of d cells! with the culture broth by centrifugation. In the event that glycosyltransferase or its variant has accumulated in cells, the protein must be released from inside the cell by lysis of the cells. The yeast cells can be lysed in various ways well known in the art, for example by application of mechanical forces, such as shaking with glass beads, by ultrasonic vibration, osmotic shock and / or by enzymatic digestion of the cell wall.

   In the case where the glycosyltransferase or its variant to be isolated is associated or linked to a membrane fraction, a higher concentration can be reached, for example, by differential centrifugation of the cell extract, and, possibly, subsequent treatment of the particular fraction. by a detergent, such as Triton.

   Methods suitable for the purification of crude glycosyltransferase or its variant include conventional chromatographic techniques, such as affinity chromatography, for example with an appropriate carrier, antibodies or

  <Desc / Clms Page number 12>

 concanavalin A, ion exchange chromatography, gel filtration, partition chromatography, HPLC, electrophoresis, precipitation steps such as ammonium sulfate precipitation and other processes, in particular those known from the literature.



   In the case where the glycosyltransferase, or its variant, is secreted by the yeast cell into the periplasmic space, a simplified isolation protocol can be used: the protein is collected without cell lysis, by enzymatic elimination from the cell wall or by chemical agents, for example reagents of the thiol type or EDTA, which give rise to damage to the cell wall allowing the release of the glycosyltransferase produced. In the case where the glycosyltransferase or its variant is secreted in the culture broth, it can be collected directly from it and purified using the methods specified above.



   In order to detect the activity of glycosyltransferase, tests known in the literature can be used. For example, the activity of galactosyltransferase can be measured by determining the amount of radiolabelled galactose incorporated into an appropriate acceptor molecule, such as a glycoprotein or a free carbohydrate residue. Likewise, the activity of sialyltransferase can be assayed, for example, by incorporation of sialic acid into suitable substrates, and the activity of fucosyltransferase can be assayed by the transfer of fucose to an appropriate acceptor.



   The yeast host cells transformed according to the invention can be obtained by recombinant DNA techniques, comprising the following steps: - construction of a hybrid vector comprising a yeast promoter and a DNA sequence coding for a glycosyl- membrane-bound transferase, or a variant thereof

  <Desc / Clms Page number 13>

 ci, which DNA sequence is controlled by said promoter, - transformation of a yeast host strain using said hybrid vector and - selection of transformed yeast cells to separate them from untransformed yeast cells.



  Expression vectors
The hybrid yeast vector according to the invention comprises an expression cassette comprising a yeast promoter and a DNA sequence coding for a membrane-bound glycosyltransferase, or a variant thereof, which DNA sequence is controlled by said promoter.



   In a first embodiment, the hybrid yeast vector according to the invention comprises an expression cassette comprising a yeast promoter, a sequence
 EMI13.1
 DNA encoding a membrane-bound glycosyltransferase, or a variant thereof, which DNA sequence is controlled by said promoter, and a DNA sequence containing yeast transcription termination signals.



   In a second embodiment, the hybrid yeast vector according to the invention comprises an expression cassette comprising a yeast promoter functionally linked to a first DNA sequence coding for a signal peptide, linked in the appropriate reading frame to a second DNA sequence encoding a membrane-bound glycosyltransferase, or a variant thereof, and a DNA sequence containing yeast transcription termination signals.



   The yeast promoter is a regulated or constitutive promoter, preferably originating from a highly expressed yeast gene, in particular from a Saccharomyces cerevisiae gene. Thus, it is possible to use the promoter of the TRPI gene, of the ADHI or ADHII gene, of the acid phosphatase gene (PH05), a promoter of the ap- pheromone genes.

  <Desc / Clms Page number 14>

 yeast facing, encoding factor a or a, or a promoter from a gene encoding a glycolytic enzyme, such as the promoter of the enolase genes, glyceraldehyde-3-phosphate dehydrogenase (GAP), 3-phosphoglycerate kinase (PGK), hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase,

   3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase or glucokinase. It is also possible to use hybrid promoters comprising upstream activation sequences (UAS = upstream activation sequences) of a yeast gene and promoter elements downstream, comprising a functional TATA box of another yeast gene, for example a hybrid promoter comprising the UAS (s) of the yeast PH05 gene and downstream promoter elements comprising a functional TATA box of the yeast GAP gene (hybrid promoter PH05-GAP).

   A preferred promoter is the promoter of the GAP gene, in particular functional fragments thereof, starting from the nucleotides located between the positions -550 and-180, in particular from nucleotide-540, -263 or - 198, and ending at level of nucleotide-5 of the GAP gene. Another preferred promoter of the regulated type is the promoter
 EMI14.1
 PH05. As constitutive promoter, a shortened promoter of PH05 of acid phosphatase is preferred, devoid of the upstream regulatory elements (UAS) such as for example the promoter element PH05 (-173) starting at the level of nucleotide-173 and ending at the level of nucleotide - 9 of the PH05 gene.



   The DNA sequence coding for a signal peptide ("signal sequence") preferably originates from a yeast gene coding for a polypeptide which is normally secreted. It is also possible to choose other signal sequences of heterologous proteins which are normally secreted.



  Yeast signal sequences are, for example,

  <Desc / Clms Page number 15>

 signal and prepro sequences of the genes for invertase, factor a, pheromone peptidase (KEX1), yeast "killer toxin" and repressible acid phosphatase (PH05) and the glucoamylase signal sequence from Aspergillus avamori . Another possibility consists in constructing fused signal sequences, by ligating a part of the signal sequence (if it is present) of the gene which, in its natural state, is linked to the promoter used (for example PH05), with a part of the signal sequence of another heterologous protein. Preference is given to combinations which allow a precise cleavage between the signal sequence and the amino acid sequence of the glycosyltransferase.

   Additional sequences, such as pro or spacer sequences, which may or may not carry specific processing signals, may also be included in the constructs, to facilitate exact processing of precursor molecules. Alternatively, fused proteins can be produced containing internal processing signals which allow for adequate processing in vivo or in vitro. For example, maturation signals contain Lys-Arg, which is recognized by a yeast endopeptidase localized in the membranes of the Golgi apparatus. The preferred signal sequence according to the present invention is that of the yeast invertase gene.



   If a complete glycosyltransferase, or a variant thereof linked to the membrane, is expressed in yeast, the preferred hybrid yeast vector comprises an expression cassette comprising a yeast promoter, a DNA sequence coding for said glycosyltransferase or variant, which DNA sequence is controlled by said promoter, and a DNA sequence containing yeast transcription termination signals. If the DNA codes for a membrane-bound enzyme, an additional signal sequence is not necessary.

  <Desc / Clms Page number 16>

 



   When a soluble variant of a membrane-bound glycosyltransferase is expressed in yeast, the preferred yeast hybrid vector comprises an expression cassette comprising a yeast promoter operably linked to a first DNA sequence coding for a signal peptide , linked in the appropriate reading frame to a second DNA sequence coding for said variant, and a DNA sequence containing yeast transcription termination signals.



   DNA encoding a membrane-bound glycosyltransferase, or a variant thereof, can be prepared by methods known in the art and includes genomic DNA, for example isolated from a library of Mammalian genomic DNA, for example from bovine, human, rat or mouse cells. if necessary, the introns existing in the genomic DNA encoding the enzyme are deleted. In addition, DNA encoding a membrane-bound glycosyltransferase, or a variant of
 EMI16.1
 this includes cDNA which can be isolated from a mammalian cDNA library or produced from the corresponding mRNA. The cDNA library can come from cells of different tissues, for example placental cells or liver cells.

   The preparation of cDNA by the mRNA pathway is carried out by conventional methods, such as the polymerase chain reaction (PCR = polymerase chain reaction).



   For example, following conventional methods known in the art, poly (A) + RNA is isolated from mammalian cells, for example HeLa cells, and subsequent synthesis of the first strand of cDNA. From this synthesized DNA template, PCR can be used to amplify the target sequence, i.e. DNA coding for glycosyltransferase or a fragment thereof, while amplification of non-target sequences, numerically dominant , is minimized. AT

  <Desc / Clms Page number 17>

 this requires knowing the sequence of a small group of nucleotides on each side of the target sequence.

   These adjacent sequences are used to construct two synthetic single-stranded oligonucleotide primers, the sequence of which is chosen so that each has base pair complementarity with its respective adjacent sequence. The PCR begins by denaturing the hybrid strand of DNA-mRNA, followed by the welding of the primers to the sequences framing the target. The addition of DNA polymerase and deoxynucleotide triphosphates causes the formation of two double-stranded DNA fragments, each starting at the primer and extending along the target sequence, thus copying the latter. Each of the newly synthesized products can serve as matrices for hybridization of primers and extensions (next cycle), thus leading to an exponential increase in double-stranded fragments of good length.



   In addition, DNA encoding a membrane-bound glycosyltransferase, or a variant thereof, can be synthesized chemically or enzymatically. A variant of a membrane-bound glycosyltransferase having enzymatic activity and comprising an amino acid sequence in which one or more amino acids are deleted (DNA fragments) and / or replaced by one or more other amino acids, is coded by mutant DNA. In addition, a mutant DNA may include a silent mutant in which one or more nucleotides are replaced by other nucleotides, the new codons coding for the same amino acid (s). Such a mutant sequence is also a degenerate DNA sequence.

   Degenerate DNA sequences are degenerate, in the sense of the genetic code, because an unlimited number of nucleotides are replaced by other nucleotides without this resulting in a modification of the amino acid sequence initially encoded. Such degenerate DNA sequences can be useful, due to

  <Desc / Clms Page number 18>

 their different restriction sites and / or their different frequency of particular codons which are preferred by the specific host, for obtaining optimal expression of a glycosyltransferase or a variant thereof. Such DNA sequences preferably use the codons preferred by yeast.



   A mutant DNA can also be obtained by in vitro mutation of a cDNA or of a genomic DNA existing in nature, according to methods known in the art. For example, partial DNA coding for a soluble form of a glycosyltransferase can be excised from full DNA coding for the corresponding membrane bound glycosyltransferase using restriction enzymes. The availability of an appropriate restriction site is advantageous for this purpose.



   A DNA sequence containing yeast transcription termination signals is preferably the adjacent 3 ′ sequence of a yeast gene which contains signals suitable for termination of transcription and polyadenylation. Adjacent 3 ′ sequences which are suitable are, for example, those of the yeast gene naturally linked to the promoter used. The preferred adjacent sequence is that of the yeast PH05 gene.



   The yeast promoter, the optional DNA sequence encoding the signal peptide, the DNA sequence encoding a membrane-bound glycosyltransferase, or a variant thereof, and the DNA sequence containing termination signals of yeast transcription, are functionally linked in a tandem arrangement, that is to say that they are juxtaposed so that their normal functions are maintained.

   The arrangement is such that the promoter performs adequate expression of the DNA sequence encoding a membrane-bound glycosyltransferase, or a variant thereof (optionally preceded by a signal sequence), the transcrip termination signals -

  <Desc / Clms Page number 19>

 tion terminate adequately with transcription and polyadenylation, and the optional signal sequence is linked in the appropriate reading frame to the DNA sequence mentioned above, so that the last codon of the signal sequence is directly linked to the first codon of said DNA sequence, and that secretion of the protein occurs.

   If the promoter and the signal sequence originate from separate genes, the promoter is preferably linked to the signal sequence at a site located between the major starting point of the mRNA and the ATG of the gene welded in the state natural to the promoter. The signal sequence should have its own ATG for initiating translation. The joining of these sequences can be carried out by means of oligodeoxynucleotide linkers carrying the recognition sequence of an endonuclease.



   Vectors suitable for replication and expression in yeast contain an origin of yeast replication. Hybrid vectors which contain an origin of yeast replication, for example the chromosomal segment with autonomous replication (ars), are conserved extrachromosomically in the yeast cell after transformation, and are replicated autonomously during mitosis. We can also use vectors
 EMI19.1
 hybrids which contain sequences homologous to the plasmid DNA 2 g of yeast. Such hybrid vectors are integrated by recombination into plasmids 2 already present inside the cell, or replicate autonomously.



   Preferably, the hybrid vectors according to the invention comprise one or more, in particular one or two selective genetic markers for yeast and such a marker is an origin of replication for a bacterial host, in particular Escherichia coli.



   With regard to selective genetic markers for yeast, any marker gene which facilitates

  <Desc / Clms Page number 20>

 lite selection of transformants due to phenotypic expression of the marker gene. Suitable markers for yeast are, for example, those expressing resistance to an antibiotic, or, in the case of auxotrophic mutants of yeast, genes which complement host lesions. The corresponding genes confer, for example, resistance to the antibiotics G418, hygromycin or bleomycin, or produce prototrophy in an auxotrophic mutant of yeast, for example the gene URA3, LEU2, LYS2 or TRP1.



   Since the amplification of the hybrid vectors is conveniently carried out in E. coli, a genetic marker for E. coli and an origin of replication for E. coli
 EMI20.1
 are advantageously included. They can be obtained from E. coli plasmids, such as pBR322, or from a pUC plasmid, for example pUC18 or pUC19, which both contain the origin of replication of E. coli and a E. coli genetic marker conferring resistance to antibiotics such as ampicillin.



   The hybrid vectors according to the invention are constructed by methods known in the art, for example by assembling the expression cassette consisting of a yeast promoter and a DNA sequence coding for a glycosyltransferase, or a variant of that -ci, which DNA sequence is controlled by said promoter, or various constituents of the expression cassette, and DNA fragments containing genetic markers selective for yeast and for a bacterial host, and origins of replication for yeast and for a bacterial host, in the pre-established order.



   The hybrid vectors of the invention are used for the transformation of the yeast strains described below.



  Yeast strains and their transformation
Suitable host organisms of the yeast type are strains belonging to the genus Saccharomyces, in particular

  <Desc / Clms Page number 21>

 link strains of Saccharomyces cerevisiae. Said yeast strains include strains which have been optionally deprived of endogenous 2 g plasmids and / or which optionally are devoid of yeast peptidase activity (ies), for example ysc peptidase activity <x, yscA, yscB, yscY and / or yscS.



   The invention further relates to a yeast strain which has been transformed by a hybrid vector comprising an expression cassette comprising a promoter and a DNA sequence coding for a membrane-bound glycosyltransferase, or a variant thereof, which DNA is controlled by said promoter.



   In a first embodiment, the yeast strain according to the invention has been transformed with a hybrid vector comprising an expression cassette comprising a yeast promoter, a DNA sequence coding for a membrane-bound glycosyltransferase or a variant thereof, which DNA sequence is controlled by said promoter, and a DNA sequence containing yeast transcription termination signals.



   In a second embodiment, the yeast strain according to the invention has been transformed with a hybrid vector comprising an expression cassette consisting of a yeast promoter functionally linked to a first DNA sequence, coding for a signal peptide , linked in the appropriate reading frame to a second DNA sequence coding for a membrane-bound glycosyltransferase, or a variant thereof, and a DNA sequence containing yeast transcription termination signals.



   The yeast strains of the invention are used for the production of a membrane-bound glycosyltransferase, or a variant thereof.



   The transformation of the yeast by the hybrid vectors according to the invention is carried out by methods known in the art, for example according to the methods

  <Desc / Clms Page number 22>

 described by Hinnen et al. [Proc. Natl. Acad. Self. USA (1978), 75, 1929] and Ito et al. [J. Bact. (1983), 153, 163-168].



   The membrane-linked glycosyltransferases and their variants produced by the process according to the invention can be used in a manner known per se, for example for the synthesis and / or modification of glycoproteins, oligosaccharides and glycolipids (US- A-4,925,796; EP-A-414,171).



   The invention relates in particular to the process for the production of membrane-bound glycosyltransferases, and to their variants, the hybrid vectors, the transformed yeast strains and the glycosyltransferases obtainable according to the process of the invention, as described in examples.



   The present invention is illustrated by the following descriptive and nonlimiting examples. In the examples, the following abbreviations are used: GT = galactosyltransferase (EC 2.4. 1.22); PCR = polymerase chain reaction; ST = sialyltransferase (EC 2.4. 99.1); FT = fucosyltransferase.



  Example 1-Cloning of the cDNA Encoding for Galactosyl Transferase (GT) from HeLa Cells
The GT cDNA is isolated by the polymerase chain reaction (PCR) method from HeLa cells [G. Watzele and E. G. Berger (1990), Nucleic Acids Res., 18, 7174]: 1. 1- Preparation of RNApoly (A) + from HeLa cells
For the preparation of RNA, HeLa cells are cultured in monolayer culture on 5 plates (23 x 23 cm).



  The rapid and efficient isolation of RNA from cultured cells is carried out by extraction with guanidineHC1, as described by R. J. Mac Donald et al. [Meth.



  Enzymol. (1987), 152, 226-227]. In general, yields

  <Desc / Clms Page number 23>

 range from about 0.6 to 1 mg of total RNA per plate of confluent cells. Enrichment of poly RNA (A) is carried out by affinity chromatography on oligo (dT) -cellulose, according to the method described in the manual by Maniatis [J. Sambrook, EF Fritsch and T. Maniatis (1989), Molecular Cloning: A laboratory Manual (2nd edition), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, USA], by injecting 4 mg of total RNA into a column of 400 ni . 3% of the RNA introduced is collected in the form of enriched polyRNA (A), which is stored until use in aliquot parts precipitated with 3 volumes of ethanol at -700C.



  1. 2- synthesis of first strand cDNA for PCR
RNApoly (A) + (mRNA) is inverted-transcribed into DNA using reverse transcriptase H - RNase from Moloney murine leukemia virus (TI H- from VLM-M) (BRL). In the preparation of the 20 gl reaction mixture, the protocol provided by BRL is followed, with slight variations: heating for 10 minutes at 700C 1 ng of RNApoly (A) +
 EMI23.1
 HeLa cells and 500 ng of oligo (dT) 12-18 (Pharmacia) in - i-JLo 11, 5 g of sterile water and then cooled. quickly mix on ice.

   Then add 4 g of reaction buffer provided by BRL [250 mM tris-HCl (pH 8.3), KCl
 EMI23.2
 375 mM, 15 mM MgCl2], 2 jul of 0.1 M dithiothreitol, 1 ni of mixed dNTP (10 mM each of dATP, dCTP, dGTP, TTP, Pharmacia), 0.5 ni (17.5 U) of RNAguard (RNase inhibitor from Pharmacia) and 1 gl (200 U) of TI H- from VLM-M. The reaction is carried out at 420C and stopped after 1 hour by heating the tube for 10 minutes at 95 C.



   In order to control the efficiency of the reaction, an aliquot part (5 g) of the mixture is incubated.
 EMI23.3
 32 of 2 Ci d / o-P-dCTP. By measuring the incorporated dCTP, the amount of synthesized cDNA is calculated. The yield of the synthesis of the first strand is usually between 5 and 15%.

  <Desc / Clms Page number 24>

 



  1. 3-Amplification by polymerase chain (PCR)
The oligodeoxynucleotide primers used for the PCR are synthesized in vitro by the phosphoramidite method [M. H. Caruthers in Chemical and Enzymatic Synthesis of Gene Fragments, H. G. Gassen and A. Lang editors, Verlag Chemie, Weinheim, RFA] on an Applied Biosystems model 380B synthesizer. They are listed in Table 1.



   Table 1
Primers for PCR
Corresponding to pb in
Primer Sequences (5 ′ to 3 ′) cDNA for GT2) Plup (KpnI) cgctACCCTTCTTAAAGCGGCGÇCGGGAAGATG (-26) -3 PI (EcoRI) gccgaattcATGAGGCTTCGGGAGCCGCTCCTGAGCG 1- 28 P3 (SacI) CTGGAGCCCC4
 EMI24.1
 P2d (EcoRI) xccsaaTTCAGTCTCTTATCCGTGTACCAAAAAGGCCTA 1222-1192 P4 (HindII cccaagctTGGAATGATGATGGCCACCTTGTGAGG 546-520 Capital letters represent sequences from GT, lowercase letters represent additional sequences, sites for enzymes are. start "and" stop "of RNA translation appear in bold.



  2) GT cDNA sequence from the human placenta, as published in GenBank (deposit # M22921).



   The normal PCR conditions for an incubation mixture of 30 ml are as follows: 1 μl of the reaction mixture of reverse transcriptase (see example 1.2), containing approximately 5 ng of first strand cDNA, 15 pmol each of the primers concerned, 200 gnoles each of the four deoxy-

  <Desc / Clms Page number 25>

 nucleoside triphosphates (dATP, dCTP, dGTP and TTP) in PCR buffer [10 mM tris-HCl (pH 8.3) (at 23 C), 50 mM KCl, 1.5 mMCl2, 0.001% gelatin] and 0 , 5 U of AmpliTaq Polymerase polymerase (Perkin Elmer).

   Amplification is carried out in the Thermocycler 60 device (Biomed) using the following conditions: 0.5 minute denaturation at 95 ° C., 1 minute hybridization at 560 ° C. and 1 minute 15 seconds extension at 72 ° C. total of 20-25 cycles. In the last cycle, the primer extension to 720C is carried out for 5 minutes.



   For sequencing and subcloning, the HeLa GT cDNA is amplified into two overlapping segments, using different combinations of primers: (1) Fragment P1-P4: the primers PI and P4 are used to amplify a 0.55 kb DNA fragment covering nucleotide positions 7-556 in the HeLa GT cDNA (ID SEQ nO 1).



  (2) P3-P2d fragment: the primers P3 and P2d are used to amplify a 0.77 kb fragment covering the nucleotide positions 457-1 232 (ID SEQ nO 1).



   In order to avoid errors during amplification, four independent PCRs are carried out for each fragment. The primer Plup (KpnI) is also used in combination with the primer P4, to determine the DNA sequence followed by the initiation codon.



   After the polymerase chain reaction, the P1-P4 fragment is digested using the restriction enzymes EcoRI and HindIII, analyzed on a 1.2% agarose gel, eluted from the gel by GENECLEAN (BIO 101) and subclone in the vector pUC18 (Pharmacia) having been digested using the same enzymes. The P3-P2d fragment is digested using SacI and EcoRI, analyzed on a 1.2% gel, eluted and subcloned in pUC18 which has been digested with SacI and EcoRI. The resulting subclones are pUC18 / P1-P4 and pUC18 / P3-P2d, respectively. For subcloning, ligation and

  <Desc / Clms Page number 26>

 transformation of the E. coli strain DH5a, standard procedures are followed as described in Example 2.

   Mini-preparations of plasmids pUC18 / P1-P4 and pUC18 / P3-P2d are used for the dideoxy sequencing of denatured double-stranded DNA using the T7 polymerase sequencing kit (Pharmacia). M13 / pUC sequencing primers and reverse sequencing primers (Pharmacia) are applied to sequencing overlapping fragments produced from the two strands of DNA, by digestion with various restriction enzymes. A new subcloning of restriction fragments of the GT gene is necessary for the advanced sequencing of overlapping fragments of the two strands. The sequence of fragments amplified by several independent PCR shows that the amplification error is less than 1 per 3000 nucleotides.

   The complete nucleotide sequence of the GT cDNA of HeLa cells which is given in ID SEQ nO 1 is 99.2% homologous to that of the human placenta (Genbank deposit nO M22921). There are three differences: (a) three additional base pairs at positions of nucleotides 37-39 (ID SEQn 1) resulting in an additional amino acid (Ser) in the N-terminal part of the protein; (b) bases 98 to 101 are "CTCT" instead of "TCTG" in the human placenta sequence, which leads to two replacements of conservative amino acids (AlaLeu instead of ValTyr) at amino acid positions 31 and 32 in the GT membrane covering area;

   (c) from "A", the nucleotide at position 1047 is changed to "G", without causing a change in the amino acid sequence.



   The two overlapping DNA fragments P1-P4 and P3-P2d encoding the GT cDNA of HeLa are assembled by the restriction site NotI at nucleotide position 498, which is present in the two fragments.

  <Desc / Clms Page number 27>

 



     The complete HeLa cell GT cDNA (ID SEQ nO 1) is cloned as a 1.2 kb EcoRI-EcoRI restriction fragment in the plasmid pIC-7, a derivative of pUC8 with additional restriction sites in the multiple cloning site [J. L. Marsh, M. Erfle and E. J. Wykes (1984), Gene, 32, 481-485], which gives the vector p4AD113. In order to create the GT expression cassette, the EcoRI restriction site (bp 1227) at the 3 ′ end of the cDNA sequence is deleted as follows: the vector p4AD113 is first linearized by digestion with EcoRV, and then treated with alkaline phosphatase. Furthermore, partially digested for 1 hour at 37 ° C., with 0.25 U of EcoRI, 1 g of the linearized plasmid DNA.

   After agarose gel electrophoresis, a fragment corresponding to the size of the linearized plasmid (3.95 kb) is isolated from the gel using GENECLEAN (Bio 101). The protruding EcoRI end is completed using the Klenow fragment of the polymerase, as described in the Maniatis manual (see above). After phenolization and precipitation with ethanol, the plasmid is religated and used to transform E. coli DH5a (Gibco / BRL).



  Plasmids are mini-prepared from six transformants. The plasmids obtained are checked by restriction analysis, with regard to the absence of the EcoRI and EcoRV restriction sites at the 3 ′ end of the GT cDNA of HeLa cells. The plasmid designated by p4AE113 is chosen for the following experiment, because its DNA sequence is identical to that of the plasmid p4AD113, except that pb 1,232-1,238 with the EcoRI-EcoRV restriction sites are deleted.



  Example 2-Construction of pressure cassettes for complete GT
For the heterologous expression in Saccharomyces cerevisiae, the complete cDNA sequence of GT of HeLa cells (ID SEQ nO 1) is welded to signals for regulating yeast transcription, for a start and a termination.

  <Desc / Clms Page number 28>

 effective transcription. The promoter and terminator sequences start from the yeast acid phosphatase gene (PH05) (EP-100 561). The complete PH05 promoter is regulated by the supply of inorganic phosphate into the culture medium. High concentrations of Pi lead to repression of the promoter, while a low concentration of Pi acts by induction.

   One can also use a short promoter fragment PH05 of 173 bp which is devoid of any regulatory elements and therefore behaves like a constitutive promoter.



  2. 1- Construction of a phosphate-inducible expression cassette
The GT cDNA sequence is associated with the yeast promoter PH05 and the transcription terminator sequences, as follows: (a) complete GT DNA sequence of HeLa cells:
The p4AE113 vector containing the complete GT cDNA sequence is digested with the restriction enzymes EcoRI and BglII. The DNA fragments are separated by electrophoresis on a 1% agarose gel. The gel is isolated, by adsorption on glasmilk, using the GENECLEAN kit (Bio 101), a 1.2 kb DNA fragment containing the complete cDNA sequence coding for the GT of HeLa cells.

   On this fragment, the initiation codon "ATG" for the protein synthesis of GT is located directly behind the restriction site for EcoRI, while the
 EMI28.1
 stop codon "TAG" is followed by 32 bp provided by the 3'-untranslated region of the GT of HeLa cells, and the multiple cloning site of the vector, comprising the BglII restriction site.



  (b) Vector for amplification in E. coli:
The vector for amplification, the plasmid p31R (see EP-100 561), a derivative of pBR322, is digested using the restriction enzymes BamHI and SalI. The restriction fragments are separated on a 1% agarose gel, and a

  <Desc / Clms Page number 29>

 3.5 kb vector fragment is isolated from the gel as described above. This DNA fragment contains the large vector fragment SalI-HindIII of the derivative of pBR322, as well as a transcription terminator sequence of PH05 of 337 bp, instead of the HindIII-BamHI sequence of pBR322.



  (c) Sequence of the inducible PH05 promoter:
The promoter fragment PH05 containing the regulatory elements (UASp) for induction by a phosphate is isolated from the plasmid p31R (see EP-100 561) by digestion using the restriction enzymes SalI and EcoRI. The 0.8 kb SalI-EcoRI DNA fragment comprises the 276 bp SalI-BamHI sequence from pBR322 and the 534 bp PH05 BamHIEcoRI promoter fragment with the EcoRI linker (5'-GAATTC-3 ') introduced at position-8 of the PHOS promoter sequence.



  (d) Construction of the plasmid pGTA1132
The three DNA fragments (ar to (c) are ligated in 12 μl of a ligation mixture: 100 ng of DNA fragment (a) and 30 ng each of fragments (b) and (c) are ligated, for 18 hours at 15 ° C, using 0.3 U of T4 DNA ligase (Boehringer) in the supplied ligase buffer [66 mM tris-HCl (pH 7.5), 1 mM dithioerythritol, 5 mM MgCl2, ATP 1 mM). Half of the ligation mixture is used to transform competent cells of E. coli strain DH5a (Gibco / BRL). For the preparation of competent cells and for the transformation, the conventional protocol is followed as given in the manual of Maniatis (see above).

   The cells are spread on selective LB medium, supplemented with 75 g / ml of ampicillin, and they are incubated at 37 ° C. About 120 transformants are obtained. Plasmid mini-preparations are made from six independent transformants, using the modified alkaline lysis protocol of H. C. Birnboim and J. Doly, as described in the manual by Maniatis (see above). The isolated plasmids are characterized by restriction analysis using four

  <Desc / Clms Page number 30>

 different enzymes (EcoRI, PstI, HindIII and SalI, also in combination). The six plasmids display all of the expected restriction fragments. One of the clones is chosen and it is designated by pGTA1132.

   The plasmid pGTA1132 contains the expression cassette comprising the complete GT cDNA of HeLa cells under the control of the PH05 promoter regulated by phosphate, and the transcription terminator sequence of PH05. This expression cassette can be excised from pGTA1132, in the form of a 2.35 kb SalI-HindIII fragment, called "DNA fragment (1A)".



  2. 2- Construction of a constitutive expression cassette
For the construction of an expression cassette comprising an unregulated constitutive promoter, use is made of a promoter fragment PH05 truncated in 5 ′, devoid of regulatory elements by phosphate, which is isolated from the plasmid P31jPH05 (-173) RIT.



  (a) Construction of the plasmid p31 / PH05 (-173) RIT
Plasmid p31RIT12 (EP-288,435) comprises the complete regulated PH05 promoter [with an EcoRI site introduced at the nucleotide-8 position on a BamHI-EcoRI fragment of 534 bp, followed by the coding sequence for the signal sequence of the yeast invertase (EcoRI-XhoI of 72 bp) and of the transcription termination signal of PHO (XhoI-HindIII of 135 bp) cloned in a tandem arrangement between BamHI and HindIII on the vector derived from pBR322].



     The promoter element PH0. 5 (-173) constitutive, originating from the plasmid pJDB207 / PH05 (-173) -YHIR (EP-340 170) comprises the nucleotide sequence of the yeast promoter PH05, from the position of nucleotide-9 to-173 (restriction site BstEII ) but does not contain upstream regulatory sequences (UASp). The promoter PH05 (-173) therefore behaves like a constitutive promoter. This example describes the replacement of the promoter PH05 regulated in the plasmid p31RIT12 by the short promoter element PH05 (-173) constitutive, in order to obtain the plasmid p31jPHOS (-173) RIT.

  <Desc / Clms Page number 31>

 



   The plasmids p31RIT12 (EP-288 435) and pJDB207 / PH05 (-173) -YHIR (EP-340 170) are digested with the restriction endonucleases SalI and EcoRI. The respective SalIEcoRI fragments, of 3.6 kb and 0.4 kb, are isolated on a 0.8% agarose gel, eluted from the gel, precipitated with ethanol and resuspended in H2O at a concentration of 0.1 pmole / gl. We ligate the two DNA fragments and we
 EMI31.1
 mixing 1 g aliquots of the ligation mixture, to transform competent cells of E. coli HB101 (ATCC). Colonies resistant to ampicillin are grown individually in LB medium supplemented with ampicillin (100 gg / ml). Plasmid DNA is isolated according to the method of D. S. Holmes et al. [Anal. Biochem.

   (1981), 144, 193] and analyzed by restriction digests using SalI and EcoRI. The plasmid of a clone containing the correct restriction fragments is designated by p31 / PH05 (-173) RIT.



  (b) Construction of the plasmid pGTBl135)
The plasmid p31 / PH05 (-173) RIT is digested with the restriction enzymes EcoRI and SalI. After separation on a 1% agarose gel, a 0.45 kb SalI-EcoRI fragment is isolated from the gel using GENECLEAN (Bio 101). This fragment contains the 276 bp SalI-BamHI sequence of pBR322 and the constituting PH05 promoter fragment BamHI (BstEII) -EcoRI of 173 bp. The 0.45 kb SalI-EcoRI fragment is welded to the 1.2 kb GT EcoRI-BglII cDNA [fragment (a)] and to the 3.5 kb BamHI-SalI vector part for amplification in E coli with the terminator of PH05 fragment (b)] described in Example 2. 1. The ligation and transformation of E. coli strain DH5a is carried out, as described above, to obtain 58 transformants.

   Plasmids are isolated by mini-preparations from six independent colonies, and characterized by restriction analysis.



  The six plasmids present all the expected fragments. A correct clone is designated by pGTB1135 and used for

  <Desc / Clms Page number 32>

 other cloning tests, to give the expression cassette coding for the GT of HeLa cells, under the control of the promoter fragment PH05 (-173) constituting. This expression cassette can be excised from the vector pGTB1135, in the form of a 2 kb SalI-HindIII fragment called DNA fragment (1B).



  Example 3-Construction of the pDPGTA8 and pDPGTB5 expression vectors
The yeast vector used for the heterologous expression is the episomal vector pDP34 (11.8 kb), which is a yeast-E shuttle vector. coli containing the ampicillin resistance marker for E. coli and the selective yeast markers URA3 and dLEU2. The vector pDP34 is digested with the BamHI restriction enzyme (see EP-340 170). The linearized vector is isolated using GENECLEAN, and the projecting ends are completed by treatment with the Klenow fragment of the polymerase, as described in the manual by Maniatis (see above). The reaction is terminated after 30 minutes, by heating to 650C for 20 minutes in the presence of 10 mM EDTA.

   After precipitation with ethanol, the plasmid is digested with SalI and subjected to gel electrophoresis on a 0.8% agarose gel. The vector pDP34 cut by SalI, with blunt ends (BamHI) is isolated from the gel, using the GENECLEAN kit, in the form of a DNA fragment of 11.8 kb.



   By analogy with the preparation of vectors, the plasmids pGTA1132 and pGTB1135 are each digested with HindIII. The projecting ends of the linearized plasmids are completed by treatment with the Klenow fragment of the polymerase, and they are then subjected to digestion with SalI, to obtain (2A) a SalI-blunt end fragment (HindIII) of 2.35 kb, containing the phosphate-regulated expression cassette, or

  <Desc / Clms Page number 33>

 (2B) a 2.0 kb SalI-blunt end fragment (HindIII), comprising the constitutive expression cassette.



   The vector part pDB34 SalI-blunt end is ligated with the fragment 2A or the fragment 2B, and the transformation of competent cells of E. coli strain DH5, as described in example 2, using 80 ng of the vector part and 40 ng of fragment 2A or 2B, respectively. 58 and 24 transformants are obtained respectively. From each transformation, six plasmids are prepared and characterized by restriction analysis.



  For the construction with the regulated expression cassette (fragment 2A), two plasmids exhibit the expected restriction profile. One of the clones is chosen and designated by pDPGTA8. For the construction with the constitutive expression cassette (fragment 2B), a plasmid exhibits the expected restriction profile, and is designated by pDPGTB5.



  Example 4-Transformation of the BT150 strain of
S. cerevisiae Il
CsCl purified DNA of the expression vectors pDPGTA8 and pDPGTB5 is prepared, following the protocol of R. Treisman in the manual of Maniatis (see above). The protease-deficient S. cerevisiae strains BT150 (MATa, his4, leu2, ura3, pral, prbl, prcl, cpsl) and H449 (MATa, prbl, cpsi, ura3A5, leu2-3,2-112, cir) are transformed each with 5 jug of each of the plasmids pDPGTA8, pDPGTB5 and pDP34 (regulation without expression cassette) according to the method of transformation with lithium acetate (H. Ito et al., see above). Ura transformants are isolated and screened for GT activity (see below).

   Individual transformed yeast cells are selected and named as follows: Saccharomyces cerevisiae BT150 / pDPGTA8 Saccharomyces cerevisiae BT150 / pDPGTB5 Saccharomyces cerevisiae BT150 / pDP34 Saccharomyces cerevisiae H449 / pDPGTA8

  <Desc / Clms Page number 34>

 Saccharomyces cerevisiae H449 / pDPGTB5 Saccharomyces cerevisiae H449 / pDP34.



  Example 5-Enzyme Activity of Complete GT Expressed in Yeast 5. 1- Preparation of Cell Extracts
Cells of transformed strains of Saccharomyces cerevisiae BT150 and H449 are each cultured under uracil selection, in minimal media for yeast (Difco) supplemented with histidine and leucine. The rate of cell growth is not affected by the introduction of any of the expression vectors. Cel-
 EMI34.1
 cells growing exponentially (at OD - = 0.5) or 0 / e stationary cells are collected by centrifugation, washed once with 50 mM tris-HCl buffer (pH 7.4) (buffer 1), then returned suspended in buffer 1, at a
 EMI34.2
 concentration corresponding to 0, 1-0, 2 DO ---.

   A mechanical lysis of the cells is carried out by vigorous shaking on a vortex agitator, with glass beads (0.45-0.5 mm in diameter) for 4 minutes, with intermittent cooling. The crude extracts are used directly for the determination of the enzymatic activity.



   The fractionation of the cellular components is carried out by differential centrifugation of the extract. First, the extract is centrifuged at 450 g for 5 minutes; secondly, the supernatant obtained is centrifuged at 20,000 g for 45 minutes.



   The supernatant is collected and the pellets are resuspended in buffer 1.



   For the phosphate induction of the expression of GT under the control of the inducible PH05 promoter, the cells of transformants BT150 / pDPGTA8 and H449 / pDPGTA8 are transferred in mass, in a minimal medium with low phosphate content [ B. Meyhack et al., Embo J. (1982) 1, 675-680]. Cell extracts are prepared as described above.

  <Desc / Clms Page number 35>

 



  5. 2- Protein dosage
Protein concentration is determined using
 EMI35.1
 BCA protein assay kit (Pierce).



  5. 3- Determination of the activity of GT We can measure the activity of GT using radiochemical methods, using as acceptor substrates either ovalbumin, a glycoprotein which
 EMI35.2
 only exposes GlcNAc as an acceptor site, that is, free GlcNAc. The cell extracts (number of cells corresponding to DO --- = 1-2) are assayed for 45 or 3 / o 60 minutes at 37 ° C., in 100 g of incubation medium containing 100 mM of tris-HCl (pH 7 , 4), 50 nCi of UDP¯14C-Gal (325 mCi / mmol), 80 nmoles of UDP-Gal, 1 gmole of MnCI2'1% Triton X-100 and 1 mg of ovalbumin or 2 gnoles of GlcNAc as an acceptor.

   In the case where a glycoprotein type acceptor substrate is used, the
 EMI35.3
 acid precipitation reaction of the protein and the amount of C-galactose incorporated in ovalbumin is determined by scintillation counting in liquid medium [E. G. Berger et al. (1978) Eur. J. Biochem., 90, 213-222]. When GlcNAc is used as the acceptor substrate, the reaction is terminated by the addition of 0.4 ml
 EMI35.4
 14 of ice-cold water and the unused UDP-C-galactose is separated from the products 14C on a column with exchanged anions (AGX1-8, BioRad) as described [A. S. Masibay and P. K. Qasaba (1989), Proc. Natl. Acad. Sci. USA, 86, 5733-5737].

   The assays are carried out with or without acceptor molecules, to determine the degree of hydrolysis of UDP-Gal by the nucleotide pyrophosphatases. The results are given in Table 2.

  <Desc / Clms Page number 36>

 



   Table 2 GT activity in the S. cerevisiae BT150 strain transformed by different plasmids
 EMI36.1
 
 <tb>
 <tb> Activity <SEP> specific <SEP> from
 <tb> the <SEP> GT <SEP> (mU / mg <SEP> from <SEP> protein)
 <tb> High <SEP> content <SEP> Low <SEP> content
 <tb> Plasmid <SEP> Promoter <SEP> PHQ-5in <SEP> P. <SEP> in <SEP> P
 <tb> @i
 <tb> pDP34- <0, <SEP> 01 <SEP> n. <SEP> d. <SEP> 1)
 <tb> pDPGTA8 <SEP> regulated <SEP> by <SEP> phosphate <SEP> 0.1 <SEP> 0.6-1
 <tb> pDPGTB5 <SEP> constituent <SEP> 0, <SEP> 6 <SEP> n. <SEP> d. <SEP> 1)
 <tb>
 Not determined.



   The GT activity of cultures which have been passed to inducible conditions (minimal medium with low Pi content) is approximately the same as the activity of culture.
 EMI36.2
 tures in minimal mediums constituting the GT in a constitutive manner,. tive (table 2). As expected, there is no enzyme activity in cells transformed by the vector alone.



   During fractionation, most of the GT activity (70-90%, see Table 3) and the highest specific activity are always found in the pellet obtained by high speed centrifugation (20,000 g). Enzyme activity can be increased by the addition of 1-2% Triton X-100 to the enzyme assay mixture. These two facts suggest that recombinant GT is bound to the membrane in yeast cells, as it is in HeLa cells.

  <Desc / Clms Page number 37>

 



   Table 3
Distribution of GT activity during BT150 / pDPGT5 cell fractionation
 EMI37.1
 
 <tb>
 <tb> Activity <SEP> GT
 <tb> cpm <SEP> of UDP-C-Gal
 <tb> Fraction <SEP> incorporated <SEP> in <SEP> GlcNAc <SEP>%
 <tb> Extract <SEP> gross <SEP> 19 <SEP> 400
 <tb> Base <SEP> (400 <SEP> g) <SEP> 1 <SEP> 000 <SEP> 4.6
 <tb> Base <SEP> (20 <SEP> 000 <SEP> g) <SEP> 15 <SEP> 800 <SEP> 72.5
 <tb> Supernatant <SEP> (20 <SEP> 000 <SEP> g) <SEP> 5 <SEP> 00022, <SEP> 9
 <tb> total <SEP>:

    <SEP> 21 <SEP> 800 <SEP> 100
 <tb>
 Example 6 Purification of the Recombinant GT
In order to release the membrane-bound enzyme, the pellet fraction, obtained by centrifugation at 20,000 g, of BT150 / pDPGTB5 cells is treated with 1% (w / v) of
 EMI37.2
 Triton X-100 for 10 minutes at room temperature, and equilibrated with 50 mM tris-HCl (pH 7, 4), 25 mM MgCI2'0, 5 mM UMP and 1% (w / v) Triton X-100. The supernatant obtained is filtered (0.2 µm) after centrifugation, then passed through a column of GlcNAc-p-aminophenyl-Sepharose [E. G. Berger et al. (1976), Experientia, 32, 690-691], with a bed volume of 5 ml, at a flow rate of 0.2 ml / min, at 4 C. The enzyme is eluted with 50 mM of tris-HCl ( pH 7.4), 5 mM GlcNAc, 25 mM EDTA and 1% Triton X-100.

   A single peak of enzymatic activity is eluted in 5 fractions (size: 1 ml). These fractions are combined and dialyzed against 2 × 1 1 of 50 mM tris-HCl (pH 7.4), 0.1% of Triton X-100. Purified GT is enzymatically active.



  Example 7 Construction of an Expression Cassette Coding for Soluble GT
The galactosyltransferase expressed in yeast can be secreted into the culture medium if a yeast promoter is functionally linked to a first sequence

  <Desc / Clms Page number 38>

 of DNA coding for the signal sequence of the yeast invertase gene SUC2 linked, in the appropriate reading frame, to a cDNA coding for soluble GT.



  (a) Partial GT cDNA sequence of HeLa cells
The GT cDNA is excised from the plasmid p4AD113 (Example 1) by digestion with EcoRI. the 1.2 kb fragment containing the complete GT cDNA is isolated, then it is partially digested with MvnI (Boehringer) by cutting the GT sequence at positions 43.55, 140 and 288 of the nucleotide sequence represented in ID SEQ nO 1. During the digestion of 0.2 gg of the EcoRI-EcoRi fragment with 0.75 U of MvnI for 1 hour, the GT cDNA is only cut once at the position of nucleotide 134, to give a 1.1 kb MvnI-EcoRI fragment (b) Vector for amplification in E. coli
The plasmid pUC18 (Pharmacia) is digested with BamHI and EcoRI in the multiple cloning site.

   The plasmid is then treated with alkaline phosphatase, as described in the manual of Maniatis (see above), it is subjected to an electrophoresis in agarose gel. then it is isolated from the gel, in the form of a DNA fragment of 2.7 kb.



  (c) Constituent PH05 (-173) promoter and SUC2 signal sequence
The p31 / PHOS (-173) RIT vector is digested with the restriction enzymes BamHI and XhoI (example 2). A 0.25 kb BamHI-XhoI fragment is isolated, comprising the constitutive promoter PH05 (-173) and the adjacent coding sequence for the signal sequence of invertase (ss inv). The fragment is then cut using HgaI (BioLabs). The HgaI recognition sequence is on the strand of antisense DNA. The restriction enzyme cuts-upstream of the recognition sequence, so that the step end of the antisense strand coincides with the end of the coding sequence of the signal sequence of invertase.

   The DNA fragment cut by BamHI and HgaI, 0.24 kb, contains the promoter sequence PHOJ (-173) constitutive linked to the signal sequence of

  <Desc / Clms Page number 39>

 yeast invertase.



  (d) Connection segment
The fragment (a) is linked to the fragment (c) by means of a connecting sequence which is prepared from equimolar amounts of the synthetic oligonucleotides (Microsynth) 5'CTGCACTGGCTGGCCG3 'and 5'CGGCCAGCCAG3'for the complementary strand. The oligonucleotides are hybridized to each other firstly by heating to 950C and then slow cooling down to 20 C. The hybridized connecting segment is stored in the frozen state.



  (e) Construction of the plasmid psGT
For the ligation, the linearized vector (b), the GT cDNA fragment (a), the fragment (c) containing the promoter and the sequence coding for the signal peptide, and the connecting segment (d) are used in a molar ratio of 1: 2: 2: 30-100. The ligation is carried out in 12 g of ligase buffer (66 mM tris-HCl (pH 7.5), 1 mM dithioerythritol, 5 mM MgCl2, 1 mM ATP) for hours at 16 C. The ligation mixture is used to transform competent cells of E. coli strain DH5, as described above. Plasmid mini-preparations are made from 24 independent transformants.

   The isolated plasmids are characterized by restriction analysis, using four different enzymes (BamHI, PstI, EcoRI, XhoI, also in combination). A single clone having the expected restriction profile is designated by psGT.



   The correct sequence at the fusion site of the sequence coding for the signal peptide of invertase, with the cDNA coding for soluble GT, is confirmed for the plasmid psGT, by means of the sequencing kit T7 (Pharmacia) and of the primer 5'-AGTCGAGGTTAGTATGGC-3 'starting at position-77 in the constitutive promoter PH05 (-173).

  <Desc / Clms Page number 40>

 
 EMI40.1
 



  Mvnl sequence for DNA: 5'AAA ATA Tct gca ctg gct ggc cgC GAC CTG AGC 3 '3'TTT TAT AGA CGT gac cga ccg gcG CAG GAC TCG 5' protein: Lys rle Ser Ala Leu Ala Gly Arg Asp Leu Ser
16 19 42 ss inv sequence of the GT cut-off site for the endopeptidase signal The lower case letters represent the connection sequence.



   The expression cassette for secreted GT, containing the constitutive PHO5 promoter (-173), the DNA sequence coding for the signal peptide of invertase and the partial GT cDNA originating from the plasmid psGT, can be excised under form of a 1.35 kb SalI (BamHI) -EcoRI fragment. The expression cassette is also devoid of the PH05 terminator sequences, to be added in the next step of cloning.



  Example 8 Construction of the Expression Vector pDPGTS
For the construction of the expression vector for the Soluble GT, the following fragments are combined: (a) Vector part
The plasmid pDP34 is digested and pretreated as described in Example 3, which gives a vector fragment SalI-blunt end of 11.8 kb.



  (b) Expression cassette
The psGT plasmid is first linearized by digestion with SalI (in the multiple cloning site) and it is then partially digested with EcoRI. A 1.35 kb DNA fragment is isolated, containing the constitutive promoter PH05 (-173), a DNA sequence coding for the signal peptide of yeast invertase, and the partial cDNA of GT.

  <Desc / Clms Page number 41>

 



  (c) PHOS terminator sequence
The terminator sequence of PH05 is isolated from the plasmid p31 which is constructed from the plasmid p30, as described in EP-100 561. After digestion with the restriction enzyme HindIII, the projecting ends are completed by treatment with the fragment of Klenow of the polymerase, as described above. The plasmid is then digested with EcoRI and an EcoRI fragment with a blunt end of 0.39 kb is isolated, comprising the terminator sequences of PHOS.



   As described in Example 2, the fragments (a), (b) and (c) are ligated and the transformation of competent cells of E. coli strain DH5a is carried out. From the transformants obtained, plasmids are isolated and characterized by restriction analysis. The plasmid of a clone containing the correct restriction fragments is designated by pDPGTS.



  EXAMPLE 9 Expression of GT Solubil in Yeast
By analogy with Example 4, DNA, purified with CsCl, from the expression vector pDPGTS, is used to transform strains BT150 and H449 of S. cerevisiae. Ura + transformants are isolated and screened for GT activity. In each case, a transformant is selected and named Saccharomyces cerevisiae BT150 / pDPGTS and Saccharomyces cerevisiae H449 / pDPGTS, respectively. Using the test described in Example 5, the presence of GT activity is observed in the culture broths of the two transformants.



  EXAMPLE 10 Cloning of the Sialyltransferase (ST) cDNA from Human HepG2 Cells
ST cDNA is isolated from HepG2 cells by CPR, by analogy with GT cDNA. The preparation of RNApoly (A) + and the synthesis of first strand cDNA are carried out as described in Example 1. For the PCR, the primers (Microsynth) listed in Table 5 are used.

  <Desc / Clms Page number 42>

 



   Table 5
Primers for PCR
Corresponding to bp in Primer Sequence (5 'to 3') 1) the cDNA of ST2)
 EMI42.1
 
 <tb>
 <tb> PstI / EcoRI
 <tb> SIAI <SEP> cgctgcagaattcaaaATGATTCACACCAACCTGAAGAAAAAGT <SEP> 1 <SEP> - <SEP> 28
 <tb> BamHI
 <tb> SIA3 <SEP> cscgaatCCTGTGCTTAGCAGTGAATGGTCCGGAAGCC <SEP> 1228-1198
 <tb>
 The capital letters represent sequences from ST, the lower case letters represent additional sequences with sites for restriction enzymes (underlined). Codons coding for "start" and "stop" of protein synthesis are indicated in bold.



    2) ST DNA sequence from the human placenta (27) as published in EMBL Data Bank (deposit no X17247).



   ST cDNA from HepG2 can be amplified, in the form of a 1.2 kb DNA fragment, using the primers SIA1 and SIA3. The PCR is carried out as described for the GT cDNA, under slightly modified cycle conditions: 0.5 minute of denaturation at 95 ° C., 1 minute 15 seconds of hybridization at 560C and 1 minute 30 seconds of extension at 72OC , for a total of 25-35 cycles. In the last cycle, the primer extension to 720C is carried out for 5 minutes.



   After PCR, the 1.2 kb fragment is digested with the restriction enzymes BamHI and PstI, analyzed on a 1.2% agarose gel, eluted from the gel and subcloned into the vector pUC18. The resulting subclone is called pSIA2.

  <Desc / Clms Page number 43>

 



  Example 11 Construction of the constitutive ST expression cassette
For constitutive heterologous expression, the ST cDNA is ligated to the constitutive promoter fragment PH05 (-173) and to the terminator sequences of PH05.



   The plasmid pSIA2 is first linearized by digestion with the restriction enzyme BamHI, and then partially digested with EcoRI. Since the ST cDNA also contains an internal restriction site for the enzyme EcoRI (at 144 bp), a 1.2 kb fragment comprising the complete ST cDNA (ID SEQ n 3) is created by digestion partial by EcoRI, using 1 mg of DNA and 0.25 U of EcoRI (1 hour, 37 ° C.). After gel electrophoresis, the 1.2 kb EcoRI-BamHI fragment is isolated, comprising the complete ST cDNA (ID SEQ nO 3). On this DNA fragment, the initiation codon "ATG" for the translation of ST is located in the vicinity of the EcoRI restriction site.

   Three adenosine phosphates (see primer SIA1 for PCR} provide an "A" at pb position 12, which is in the consensus sequence surrounding "ATG" coming from genes strongly expressed in yeast [R. Hamilton et al. ( 1987) Nucleic Acids Res., 14, 5125-5149] The stop codon "TAA" and 5 bp of the 3 'untranslated region of the gene are followed by the BamHI site.



   The 1.2 kb ST EcoRI-BamHI cDNA fragment is ligated to the 0.45 kb SalI-EcoRI fragment, containing the constitutive promoter PH05 (-173), example 2. 2 (b)] and a vector part BamHI-SalI of 3.5 kb, for amplification in E. coli containing the terminator sequence of PH05 [see example 2.1, fragment (b)]. The ligation and transformation of E. coli strain DH5 are carried out as described in Example 2.1. A clone exhibiting the expected restriction profile is designated by pST2.



   The vector pST2 comprises the expression cassette coding for the ST of HepG2, under the control of the constitutive promoter PH05 (-173), in the form of a SalI- fragment

  <Desc / Clms Page number 44>

 
 EMI44.1
 2.0 kb HindIII, referred to as "DNA fragment (1C)".



  Example 12-Expression of the ST in a yeast The vector pDP34 is digested with the restriction enzyme BamHI (see EP-340 170). The linearized vector is isolated using GENECLEAN and the projecting ends are completed by treatment with the Klenow fragment of the polymerase, as described in the manual by Maniatis (see above). After 30 minutes, the reaction is terminated by heating at 650C for 20 minutes in the presence of 10 mM EDTA. After ethanol precipitation, the plasmid is digested with SalI and subjected to gel electrophoresis on a 0.8% agarose gel. The vector pDP34 cut by SalI-blunt end (BamHI) is isolated using the GENECLEAN kit, in the form of a DNA fragment of 11.8 kb.



   The plasmid pST2 is digested with the restriction enzyme HindIII, and, by analogy with the preparation of the vector part, it is completed at the HindIII site by treatment with the Klenow fragment of the polymerase. The product is subjected to a digestion with SalI, in order to obtain a SalI-blunt end fragment (HindIII) of 2.0 kb, comprising the constitutive ST expression cassette (2C).



   Is carried out as described in Example 2 ligation of 80 ng of the vector pDP34 with 40 ng of fragment 2C, and the transformation of competent cells of the DH5a strain of E. coli. A clone exhibiting the expected restriction profile is chosen and designated by pDPST5.



   For the transformation of a yeast, DNA, purified by CsCl, of the expression vector pDPST5 is prepared, by following the conventional procedure given in the manual of Maniatis (see above). The BT150 and H449 strains of S. cerevisiae are each transformed using 5 g of plasmid DNA, according to the lithium acetate transformation method (H. Ito et al., See above). Ura + transformants are selected and screened for

  <Desc / Clms Page number 45>

 relates to ST activity. A positive transformant is selected in each case, and they are designated by, respectively, Saccharomyces cerevisiae BT150 / pDPST5 and Saccharomyces cerevisiae H449 / pDPSTS.



  Example 13-Enzymatic activity of complete ST expressed in yeast 13. 1-Preparation of cell extracts
Saccharomyces cerevisiae BT150 / pDPST5 cells are cultured under uracil selection conditions, in minimal media for yeast, supplemented with histidine and leucine. Exponentially growing cells (at an OD578 of 0.5) or stationary cells are collected by centrifugation, washed once with 50 mM imidazole buffer (pH 7.0) (buffer 1) and then resuspended in buffer 1 , at a concentration corresponding to an OD --- of 0.1-0.2. The mechanical lysis of the cells is carried out by vigorous shaking on a vortex mixer, with glass beads (0.45 and 0.5 mm in diameter) for 4 minutes, with intermittent cooling.



   ST activity can be measured in crude extracts, using the assay described below.



  13. 2- Determination of ST activity
ST activity can be determined by measuring the amount of radiolabelled sialic acid that is transferred from CMP-sialic acid to a glycoprotein acceptor. After terminating the reaction by acid precipitation, the precipitate is separated by filtration using glass fiber filters (Whatman GFA), washed completely with ice-cold ethanol, then its radioactivity is determined by liquid scintillation counting [Hesford et al.

   (1984), Glycoconjugate J., 1, 141-153]. The cell extracts are assayed for 45 minutes in an incubation mixture containing 37 g of cell extracts corresponding to approximately 0.5 mg of protein; 3 µl of 50 mM imidazole buffer (pH 7.0); 50 nM of CMP-N-acetylneuraminic acid

  <Desc / Clms Page number 46>

 (Sigma) to which is added CMP-H-N-acetylneuraminic acid (Amersham) to give a final specific activity of 7.3 Ci / mole, and 75 Mg of asialofetuin (prepared by acid hydrolysis using 0, 1 M H2SO4 at 80 ° C for 60 minutes, followed by neutralization, dialysis and lyophilization).



   The ST activity is found in the crude extracts prepared from cells of S. cerevisiae BT150 / pDPST5 and H449 / pDPST5.



  Example 14 Construction of an Expression Cassette for
 EMI46.1
 soluble ST (Lys39-cys406) 39,406 Soluble ST, called ST (Lys39-Cys406) is a truncated variant at the N-terminal which consists of 368 amino acids (ID SEQ nO 4).
 EMI46.2
 



  (a) enant de Hep¯ (a) Partial sequence of ST cDNA from HepG2
The plasmid pSIA2 is digested with EcoRI and an EcoRI-EcoRI fragment of 1.1 kb is isolated.



  (b) Vector for amplification in E. coli
The plasmid pUCIS (Pharmacia) is digested with BamHI and EcoRI in the multiple cloning site. The plasmid is then treated with alkaline phosphatase, as described in the manual of Maniatis (see above), it is subjected to an electrophoresis in agarose gel, then it is isolated from the gel, in the form of a fragment. 2.7 kb DNA.



  (c) Constituent PH05 (-173) promoter and SUC2 signal sequence
The p31 / PH05 (-173) RIT vector is digested with the restriction enzymes BamHI and Xhol. A 0.25 kb BamHI-XhoI fragment is isolated comprising the constitutive promoter PH05 (-173) and the adjacent coding sequence, coding for the signal sequence of invertase (ss inv). The fragment is then cut with Hgal (Biolabs). The HgaI recognition sequence is found on the strand of antisense DNA. The restriction enzyme cuts upstream of the recognition sequence, so that the step end 5 of the antisense strand coincides with the end of the sequence

  <Desc / Clms Page number 47>

 coding of the invertase signal sequence.

   The DNA fragment cut by BamHI and HgaI, 0.24 kb, contains the sequence of the promoter PH05 (-173) constitutive linked to the signal sequence of the yeast invertase.



  (d) Connection segment
The fragment (a) is welded to the fragment (c) using a connecting sequence which is prepared from equimolar amounts of the synthetic oligonucleotides 5'-CTGCAAAATTGCAAACCAAGG-3 'and 5'-AATTCCTTGGTTTGCAATTT-3' for the complementary strand . The oliginucleotides are hybridized to each other first by heating to 950C and then slow cooling to 200C. The hybrid connector segment is kept frozen.



  (e) Construction of the plasmid psST
For the ligation, the linearized vector (b), the ST cDNA fragment (a), the fragment (c) containing the promoter and the sequence coding for the signal peptide, and the connecting segment (d) are used. ), 'in a molar ratio of 1: 2: 2: 30-100. Ligation is carried out for 18 hours at 160C in 12 g of 66 mM tirais-cl ligase buffer.
 EMI47.1
 (pH 7.5), 1 mM dithioerythritol, 5 mM MgCl 2, 1 mM ATP]. The ligation mixture is used to transform competent cells of E. coli strain DH5a, as described above. Plasmid mini-preparations are made from 24 independent transformants.

   A single clone, exhibiting the expected restriction profile, after characterization by restriction analysis using four different enzymes (BamHI, PstI, EcoRI, XhoI, also in combination) is called psST.



   The correct sequence at the fusion site of
 EMI47.2
 the sequence coding for the signal peptide of invertase, with the cDNA coding for soluble ST (Lys39-Cys406) is confirmed for the plasmid psST by means of the sequencing kit T7 (Pharmacia) and the primer 5'- ACGAGGTTAATGGC-3 'starting from position-77 in promoter PH05 (-173)

  <Desc / Clms Page number 48>

 constitutive.



  Sequence for DNA1): 4 'AAA ATA Tct gca aaa ttg caa acc aag gAA 3' 3'TTT TAT AGA GTG ttt aac gtt tgg ttc ctt 5 'Protein: Lys Ile Ser Ala | Tys Leu Gln Thr Lys Glu 16 19 39 ss inv sequence of the ST cut-off site for endopeptidase signal 1) The lower case letters represent the connection sequence.



   The secreted ST expression cassette. containing the constitutive PHO5 promoter (-173), the DNA sequence coding for the signal peptide of invertase and the partial ST cDNA originating from the plasmid psST, can be excised in the form of a SAlI fragment (BamHI) - EcoRI of 1.35 kb. The expression cassette is also devoid of the PH03 terminator sequences, to be added in the next step of cloning.



  Example 15 Construction of the Expression Vector pDPSTS
For the construction of the expression vector for soluble ST (Ly-g-Cys. G), the following fragments are combined: (a) Vector part
The plasmid pD34 is digested and pretreated as described in Example 3, which gives a vector fragment SalIex blunt end of 11.8 kb.



  (b) Expression cassette
The psST plasmid is first linearized by digestion with SalI (in the multiple cloning site) and then partially digested with EcoRI. A 1.35 kb DNA fragment is isolated, containing the constitutive promoter PH05 (-173), a DNA sequence coding for the signal peptide of yeast invertase, and the partial cDNA of ST.

  <Desc / Clms Page number 49>

 



  (c) PH05 terminator sequence
The terminator sequence of PH05 is isolated from the plasmid p31 which is constructed from the plasmid p30, as described in EP-100 561. After digestion with the restriction enzyme HindIII, the projecting ends are completed by treatment with the fragment of Klenow of the polymerase, as described above. The plasmid is then digested with EcoRI and an EcoRI fragment with a blunt end of 0.39 kb is isolated comprising the PHO5 terminator sequences.



   As described in Example 2, the fragments (a), (b) and (c) are ligated and the transformation of competent cells of E. coli strain DH5a is carried out. From the transformants obtained, plasmids are isolated and characterized by restriction analysis. The plasmid of a clone containing the correct restriction fragments is called pDPSTS. \ Example 16-Expression of ST soluble in yeast
By analogy with Example 4, DNA, purified by CsCI, from the expression vector pDPSTS, is used to transform the strains BT150 and H449 of S. cerevisiae. Ura + transformants are isolated and screened for ST activity. A transformant is selected in each case, and these transformants are called Saccharomyces cerevisiae BT150 / pDPSTS and Saccharomyces cerevisiae H449 / pDPSTS.

   Using the test described in Example 13, the presence of ST activity is observed in the culture broths of the two transformants.



  Example 17 Construction of an Expression Cassette for Soluble ST (Lysy-Cys)
The soluble ST, called ST (Lys27-Cys406) is a truncated variant at the N-terminal end which contains the catalytic domain and the entire region of the stem, and consists of 380 amino acids, namely amino acids 27 to 406 of the amino acid sequence given in ID SEQ No. 3.

  <Desc / Clms Page number 50>

 



  (a) Partial HepG2 ST cDNA sequence
The plasmid pSIA2 is digested with EcoRI and an EcORI-EcoRI fragment of 1.1 kb (b) Vector is isolated for amplification in E. coH
The plasmid pUC18 (Pharmacia) is digested with BamHI and EcoRI in the multiple cloning site. The plasmid is then treated with alkaline phosphatase, as described in the manual of Maniatis (see above), subjected to an electrophoresis in agarose gel, then isolated from the gel in the form of a DNA fragment of 2, 7 kb.



  (c) Constituent PHO5 (-173) promoter and SUC2 signal sequence
The p31 / PH05 (-173) RIT vector is digested with the restriction enzymes BamHI and XhoI (example 2). We. isolates a 0.25 kb BamHI-XhoI fragment, comprising the constitutive promoter PH05 (-173) and the adjacent coding sequence for the invertase signal sequence (ss inv). The fragment is then cut with HgaI (BioLabs). The HgaI recognition sequence is found on the strand of antisense DNA. The restriction enzyme cuts upstream of the recognition sequence, so that the stepped 5 end of the antisense strand coincides with the end of the coding sequence of the invertase signal sequence.

   The fragment cut with BamHI and HgaI, of 0.24 kb, contains the promoter sequence PH05 (-173) constitutive linked to the signal sequence of the yeast invertase.



  (d) Connection segment
The fragment (a) is joined to the fragment (c) by means of a connecting sequence which is prepared from equimolar amounts of the synthetic oligonucleotides 5'-CTGCAAAGGAAAAGAAGAAAGGGAGTTACTATGATTCCTTTAAATTGCAAACCAAGG-3 'and 5'-AATTCCTTGTTGCAATTTAACTTTCTATTTTTAGTCCTTTATTAGATCCT . The oligonucleotides are hybridized to each other first by heating to 950C and then slow cooling to 200C. The segment of

  <Desc / Clms Page number 51>

 hybrid connection is kept frozen.



  (e) Construction of the plasmid psTI
For the ligation, the linearized vector (b), the fragment (a) of ST cDNA, the fragment (c) containing the promoter and the sequence coding for the signal peptide, and the connecting segment (d) are used. , in a molar ratio of 1: 2: 2: 30-100. Ligation is carried out for 18 hours at 16 ° C. in 12 μl of ligase buffer [66 mM tris-HCl (pH 7.5), 1 mM dithioerythritol, 5 mM MgCl2, 1 mM ATP. The ligation mixture is used to transform competent cells of E. coli strain DH5a as described above.



  Plasmid mini-preparations are made from 24 independent transformants. A single clone exhibiting the expected restriction profile, after characterization by restriction analysis using four different enzymes (BamHI, PstI, EcoRI, XhoI, also in combination) is called psST1. '
The correct sequence is confirmed for the plasmid psST1 at the fusion site of the sequence coding for the signal peptide of invertase, comprising the cDNA
 EMI51.1
 encoding soluble ST (Lys27-cys406), using the 27,406 T7 sequencing kit (Pharmacia) and the primer 5'-AGTCGAGTAGTATGGC-3 'starting at position-77 in the constitutive promoter PH05 (-173).



  Sequence
 EMI51.2
 for DNA 5'MA ATA Tet gea aag gaa aag aag aaa ggg 3 1
3'TTT TAT AGA GTG ttc ctt ttc ttc ttt cee 5 'Protein: Lys Ile Ser Ala Lys Glu Lys Lys Lys Gly 16 19 27 ss inv sequence from ST cleavage site for endopeptidase signal
The lower case letters represent the connection sequence.

  <Desc / Clms Page number 52>

 



   The secreted ST expression cassette (Lys27-Cys406) containing the PH0 promoter. 5 (-173) constituting, the DNA sequence coding for the signal peptide of invertase, and the partial cDNA of ST originating from the plasmid psST1, can be excised in the form of a SalI (BamHI) -EcoRI fragment 1.35 kb. The expression cassette is also devoid of the PH05 terminator sequences, to be added in the next step of cloning.



  Example 18 Construction of the Expression Vector pDPSTS1
For the construction of the expression vector for soluble ST (Lys --- Cys .--), the following fragments are combined: (a) Vector fragment
The plasmid pDP34 is digested and pretreated as described in Example 3, to give a vector fragment
 EMI52.1
 SalI-blunt end of 11.8 kb.



  (b) Cassetted / expression The plasmid psST1 is first linearized by digestion with SalI (in the multiple cloning site) and then partial digestion with EcoRI. A 1.35 kb DNA fragment containing the constitutive promoter PH03 (-173), a DNA sequence coding for the yeast invertase signal peptide, and the partial ST cDNA is isolated.



  (c) PHO terminator sequence
The terminator sequence of PH05 is isolated from the plasmid p31, which is constructed from the plasmid p30, as described in EP-100 561. After digestion with the restriction enzyme HindIII, the projecting ends are completed by treatment with the fragment Klenow of the polymerase, as described above. The plasmid is then digested with EcoRI and an EcoRI fragment with a blunt end of 0.39 kb is isolated, comprising the terminator sequences of PHOS.



   As described in Example 2, the fragments (a), (b) and (c) are ligated and the transformation of competent cells of E. coli strain DH5a is carried out. From

  <Desc / Clms Page number 53>

 transformants obtained, plasmids are isolated and characterized by restriction analysis. The plasmid of a clone containing the correct restriction fragments is called pDPSTS1.
 EMI53.1
 



  Example 19-Expression of ST (Lys27-Cys406) soluble in yeast
By analogy with Example 4, the DNA, purified by CsCl, of the expression vector pDPSTS1 is used to transform the strains BT50 and H449 of S. cerevisiae. The Ura transformants are isolated and screened for ST activity. A transformant is selected in each case, and these are called Saccharomyces cerevisiae BT150 / pDPSTS1 and Saccharomyces cerevisiae H449 / pDPSTS1. Using the test described in Example 13, the presence of ST activity is observed in the culture broths of the two transformants.



  Example 20-Cloning of the FT cDNA from the Human HL60 Cell Line,
Based on the published cDNA sequence [S. E. Goelz et al. (1990) Cell, 63, 1349-1356] for ELFT (fucosyltransferase with ligand ELAM-1) coding for lia (1-3) fucosyltransferase, the following oligonucleotide primers are synthesized to amplify by a PCR method an encompassing DNA fragment the open reading frame of the ELFT cDNA: 5'-CAGCGCTGCCTGTTCGCGCCAT-3 '(ELFT-1B) and 5'-GGAGATGCACAGTAGAGGATCA-3' (ELFT-2B). ELFT-1B primer at base pairs 38-59 of the published sequence, and ELFT-2B primer at base pairs 1 347-1 346 of the antisense. The primers are used to amplify a 1.3 kb fragment, using the Taq polymerase Cetus Perkin-Elmer kit.

   The fragment is amplified from cDNA of new HL60, in the presence of 5% of DMSO and 2 mM of MgCl-, with the following cycle: 95 ° C., 5 minutes 25 × (1 minute at 95 ° C., 1 minute at 60 C, 1.5 minutes at 72 C)

  <Desc / Clms Page number 54>

 10 x (1 minute at 95 C, 1 minute at 60 C, 1.5 minutes +
15 s / cycle at 72 C).



  Agarose gel electrophoresis reveals a main band of 1.3 kb which, when digested with SmaI or ApaI, gives the structure predicted by the published sequence. The 1.3 kb band is purified using a GENECLEAN kit (Bio 101) and is subcloned into the vector pCR1000 (Invitrogen). A single clone with the correct 1.3 kb insertion segment is selected and named BRB. ELFT / pCR1000-13. The FT cDNA is inserted into the vector in reverse orientation with respect to the T7 promoter. The open reading frame of the Ft cDNA has been completely sequenced and is identical to the published sequence (ID SEQ No. 5).



  Example 21 Construction of Plasmids for the Inducible and Constitutive Expression of the
FT (Arg62-Arg405) soluble in yeast
Soluble FT (Arg - Arg .--) is expressed from the FT cDNA starting from nucleotide position 241 (NruI restriction site) with omission of the N-terminal region coding for the cytoplasmic tail and the membrane covering area (see ID SEQ n 5).



   The BRB plasmid is digested. ELFT / pCR1OO-13 by HindIII, which cuts into the 3 'multiple cloning region of the FT cDNA insert. The cohesive ends are converted to blunt ends in a reaction with the Klenow fragment of DNA polymerase. XhoI linkers (5'-CCTCGAGG-3 ', BioLabs) are subjected to kinase, hybridized and ligated to the blunt ends of the plasmid, using a 100 M excess of linkers. Unreacted linkers are removed by isopropanol precipitation from DNA, which is still digested with XhoI and NruI (cleavage at nucleotide position 240 of FT cDNA, according to ID SEQ n 5).

   The 1.1 kb NruI-XhoI fragment (a) contains the cDNA sequence of

  <Desc / Clms Page number 55>

 TF lacking the region coding for the cytoplasmic tail and the membrane covering domain, up to the amino acid 61.



   The plasmids p31RIT12 and p31 / PH05 (-173} RIT (see example 2) are each digested with SalI and XhoI. The fragments of 0.9 kb and 0.5 kb, respectively, are isolated and cut with HgaI. The resulting cohesives are completed using the Klenow fragment of DNA polymerase.The blunt ends created coincide with the 3 'end of the coding sequence for the signal sequence of yeast invertase.

   The subsequent cut by BamHI releases a fragment (b) BamHI-blunt end of 596 bp, which includes the inducible PH03 promoter and the signal sequence of invertase, with its own ATG codon, or a fragment (c) BamHI-blunt end 234 bp, including the constitutive short promoter PH05 (-173) and the signal sequence of invertase.



   The plasmid p31RIT12 is linearized using the restriction endonuclease SalI. Partial digestion with HindIII, in the presence of ethidium bromide, gives a 1 kb SalI-HindIII fragment comprising the SalI-BamHI sequence of pBR322 of 276 bp, the 534 bp promoter of the acid phosphatase PH05 of the yeast, the signal sequence of yeast invertase (coding for 19 amino acids) and the PH05 transcription terminator. The 1 kb SalI-HindIII fragment of p31RIT12 is cloned into the yeast-E shuttle vector. coli pJDB207 [J. D. Beggs in: Molecular Genetics in yeast, Alfred Benzon Symposium 16, Copenhagen, 1981, p. 383-389], which was cut by SalI and HindIII.

   The resulting plasmid, containing the 1 kb insert, is called pJDB207 / PHOS-RIT12.



   The plasmid pJDB207 / PH05-RIT12 is digested with BamHI and XhoI and the large fragment (d) BamHI-XhoI of 6.8 kb is isolated. This fragment contains all the sequences of the

  <Desc / Clms Page number 56>

 vector pJDB207 and the PHOS transcription terminator.



   Using standard conditions for blunt end ligation, the BamHI blunt end fragment (b) of 596 bp, the fragment (a) NruI-XhoI of 1.1 kb and the vector fragment (d) XhoI-BamHI of 6 are ligated. , 8 kb. Aliquots of the ligation mixture are used to transform competent cells of E. coli HB101. Plasmid DNA from ampicillin-resistant colonies is analyzed by restriction digests.

   A single clone comprising the correct expression plasmid is called pJDB207 / PH05-I-FT. Ligation of the DNA fragments (c), (a) and (d) leads to the expression plasmid pJDB207 / PHOS (-173) -I-FT. The expression cassettes of these plasmids comprise the coding sequence of the signal sequence of invertase, fused, in reading frame, to that of soluble α (1-3) fucosyltransferase which is expressed under the control of the PH05 gene. inducible - or of the constitutive promoter PH05 (-173), respectively. The expression cassettes are cloned into the yeast shuttle vector. coli pJDB207, between the BamHI and HindIII restriction sites.

   The nucleotide sequence at the site of the fusion between the invertase signal sequence and the cDNA coding for soluble FT is confirmed by DNA sequencing on double-stranded plasmid DNA, using primer 5 '-AGTCGAGGTTAGTATGGC-3'representing the nucleotide sequence at positions -77 to -60 of PH05, as well as of the promoter PHOS (-173).

   The correct junction is as follows: 5'AAA ATA TCT GCA CGA CCG GTG 3 '3'TTT TAT AGA CGT GCT GGC CAC 5'
Lys Ile Ser Ala Arg Pro Val
19 62
FT ss inv cleavage site for signal peptidase

  <Desc / Clms Page number 57>

 Example 22 Construction of Plasmids for the Inducible and Constitutive Expression of the Membrane-Linked FT in Yeast
These constructs use the coding sequence of the FT cDNA, with its own ATG codon. The nucleotide sequence immediately upstream of the ATG is however rather unfavorable for expression in yeast, because of its high content of G-C. Using PCR methods, we. replaced this region with an A-T rich sequence. At the same time, an EcoRI restriction site is introduced at the new nucleotide-4 to -9 positions.



   Table 6
 EMI57.1
 
 <tb>
 <tb> Primers <SEP> for <SEP> PCR
 <tb> Correspondent <SEP> to <SEP> bp
 <tb> Leader <SEP> Sequence <SEP> (5 ' <SEP> to <SEP> 3 ') 1) <SEP> in <SEP> cDNA <SEP> from <SEP> FT
 <tb> FT1 <SEP> cgagaattcataATGGGGGCACCGTGGGGC <SEP> 58 <SEP> to <SEP> 75
 <tb> FT2 <SEP> ccgctcqaqGAGCGCGGCTTCACCGCTCG <SEP> 1285 <SEP> to <SEP> 1266
 <tb>
 The capital letters represent nucleotides from TF, the lower case letters are new additional sequences; restriction sites are underlined; the `` initiation '' and `` stop '' codons are indicated in bold.



   Normal PCR conditions are used to amplify the FT cDNA with the primers FT1 and FT2 (see
 EMI57.2
 Table 6) in 30 cycles of DNA synthesis (Taq DNA polymerase, Perkin-Elmer, 5 U / l, 1 minute at 72 ° C.), denaturation (10 seconds at 93 ° C.) and hybridization (40 seconds at 600 ° C. ).



  The resulting 1.25 kb DNA fragment is purified by phenol extraction and ethanol precipitation, then digested with EcoRI, XhoI and NruI. The EcoRI-NruI fragment (e)

  <Desc / Clms Page number 58>

 of 191 bp is isolated on a 4% Nusieve 3: 1 preparative agarose gel (FMC BioProducts, Rockland, ME, USA) in Tris-borate buffer pH 8.3, eluted from the gel and precipitated with ethanol. Fragment (e) comprises the 5 ′ part of the FT gene coding for amino acids 1 to 61. The DNA has a 5 ′ extension with the EcoRI site, as in the FT1 primer for PCR.



   The plasmids p31RIT12 and p31 / PH05 (-173) RIT are each digested with EcoRI and Xhol. The large vector fragments (f and g, respectively) are isolated on a preparative 0.8% agarose gel, eluted and purified. The 4.1 kb XhoI-EcoRI fragment (f) comprises the vector derived from
 EMI58.1
 pBR322, the promoter PH05 of 534 bp (EcoRI site in 3 ') and the transcription terminator of Phots of 131 bp (XhoI site in 5'). The 3.7 kb XhoI-EcoRI fragment (g) differs only in the short constitutive promoter 'PH05 (-173) of 172 bp (EcoRI site in 3') instead of the complete PH05 promoter.



   The EcoRI-NruI fragment of 191 bp is ligated, the fragment (a) NruI-XhoI of 1.1 kb and the fragment (f) XhoI-EcoRI of 4.1 kb. A 1 IU aliquot of the ligation mixture is used to transform competent E. coli HB101 cells. Plasmid DNA from ampicillin-resistant colonies is analyzed. Plasmid DNA from a single clone is called p31R / PHO5-ssFT.
 EMI58.2
 



  Ligation of the DNA fragments (e), (a) and (g) leads to the plasmid p31R / PHOS (-173) -ssFT. These plasmids comprise the membrane coding sequence of FT, under the control of the inducible PH05 gene or of the constitutive PH05 (-173) promoter, respectively.



  Example 23-Cloning of FT Expression Cassettes in pDP34
 EMI58.3
 The plasmids p31R / PHOS-ssFT and p31R / PHOS (-173) -ssFT are digested with HindIII, which cuts in 3 ′ of the transcription terminator of PH05. After a reaction with the Klenow fragment of DNA polymerase, the DNA is digested by

  <Desc / Clms Page number 59>

 SalI. The SalI-blunt end fragments of 2.3 kb and 1.9 kb are isolated, respectively.



   The plasmids pJDB207 / PH05-I-FT and pJDB207 / PH05 (-173) -I-Ft are partially digested with HindIII in the presence of 0.1 mg / ml of ethidium bromide (to avoid cleavage at a HindIII site additional in the invertase signal sequence) and are then treated with the Klenow fragment of DNA polymerase and SalI, as above.



  The 2.1 kb and 1.8 kb fragments are isolated, respectively.



   The four DNA fragments are each ligated to the 11.8 kb SalI-blunt vector fragment of pDP34 (see example 3). After transformation of competent cells of E. coli HB101 and analysis of the plasmid DNA of individual transformants, four expression plasmids
 EMI59.1
 correct are called pDP34 / PHOS-I-FTi pDP34 / PN0. 5 (-173) -I-FT; pDP34R / PH05-ssFT and pDP34R / PHOS (-173) -ssFT.



   The BT150 and H449 strains of S. cerevisiae are transformed with 5 g each of the four expression plasmids (above) according to Example 4. Individual transformed yeast colonies are selected and given the following names:
 EMI59.2
 Saccharomyces cerevisiae BT150 / pDP34 / PHOS-I-FTi "" BT150 / pDP34 / PHOS (-173) -I-FTi "" BT150 / pDP34R / PH03-ssFT; BT150 / pDP34R / PH05 (-173) -ssFT; H449 / pDP34 / PH05-I-FT; "" H449 / pDP34 / PHO5 - (- 173) -I-FT; H449 / pDP34R / PH05-ssFT; "" H449 / pDP34R / PHO5 (-173) -ssFT.



   The fermentation and preparation of the cell extracts are carried out as in Example 5. Using a test similar to that described by Goelz et al. (see above), the presence of FT activity is observed in the crude extracts prepared from the strains

  <Desc / Clms Page number 60>

 
 EMI60.1
 BT150 / pDP34R / PH05-ssFT, BT150 / pDP34R / PH05 (-173) -ssFT, H449 / pDP34R / PH05-SSFT and H449 / pDP34R / PHOS (-173) -ssFT and in the culture broth of strains H449 / pDP34 / PH05-I-FT, H449 / pDP34 / PH05 (-173) -I-FT, BT150 / pDP34 / PH05-I-FT and BT150 / pDP34 / PH05 (-173) -I-FT.



  Deposits of microorganisms
The following strains of microorganisms have been deposited with the Deutsche Sammlung von Mikroorganismen (DSM), Mascheroder Weg 16, D-3300 Braunschweig (deposit dates and numbers given below): Escherichia coli JM109 / pDP34: March 14, 1988; DSM 4473 Escherichia coli HB101 / p30: October 23, 1987; DSM 4297 Escherichia coli HB101 / p31R: December 19, 1988; DSM 5116 Saccharomyces cerevisiae H449: February 18, 1988; DSM 4413 Saccharomyces cerevisiae BT150: May 23, 1991;

   DSM 6530.

  <Desc / Clms Page number 61>

 Appendices-Identification of sequences ID SEQ nO 1
 EMI61.1
 7 Type of sequence: nucleotide with corresponding protein Length of sequence: 1,265 bp Number of strands: double strand Topology: linear Type of molecule: recombinant Direct experimental source: plasmid p4AD113 from E. coli
DH5a / p4AD113 Characteristics: from 6 to 1,200 bp cDNA sequence coding for the galactosyltransferase of HeLa cells from 1 to 6 bp EcoRI site from 497 to 504 bp NotI site from 1,227 to 1,232 bp EcoRI site from 1,236 to 1 241 bp EcoRV site from 1,243 to 1,248 bp site BglII, 'Properties: EcoRI-HindIII fragment originating from the plasmid p4AD113 comprising the cDNA of HeLa cells coding for the complete galactosyltransferase (EC 2.4. 1.22).



  GAATTC ATG AGG CTT CGG GAG CCG CTC CTG AGC GGC AGC 39
Met Arg Leu Arg Glu Pro Leu Leu Ser Gly Ser
5 10 GCC GCG ATG CCA GGC GCG TCC CTA CAG CGG GCC TGC CGC 78 Ala Ala Met Pro Gly Ala Ser Leu Gln Arg Ala Cys Arg
15 20 CTG CTC GTG GCC GTC TGC GCT CTG CAC CTT GGC GTC ACC 117 Leu Leu Val Ala Val Cys Ala Leu His Leu Gly Val Thr 25 30 35 CTC GTT TAC TAC CTG GCT GGC CGC GAC CTG AGC CGC CTG 156 Leu Val Tyr Tyr Leu Ala Gly Arg Asp Leu Ser Arg Leu
40 45 50

  <Desc / Clms Page number 62>

 CCC CAA CTG GTC GGA GTC TCC ACA CCG CTG CAG GGC GGC 195 Pro Gln Leu Val Gly Val Ser Thr Pro Leu Gln Gly Gly
55 60 TCG AAC AGT GCC GCC GCC ATC GGG CAG TCC TCC GGG GAG 234 Ser Asn Ser Ala Ala Ala Ile Gly Gln Ser Ser Gly Glu
65 70 75 CTC CGG ACC GGA GGG GCC CGG CCG CCG CCT CCT CTA GGC 273 Leu Arg Thr Gly Gly Ala Arg Pro Pro Pro Pro Leu Gly
80 85 GCC TCC TCC CAG CCG

  CGC CCG GGT GGC GAC TCC AGC CCA 312 Ala Ser Ser Gln Pro Arg Pro Gly Gly Asp Ser Ser Pro
 EMI62.1
 90 95 100! GTC GTG GAT TCT GGC CCT GGC CCC GCT AGC AAC TTG ACC 351 Val Val Asp Ser Gly Pro Gly Pro Ala Ser Asn Leu Thr
105 110 115 TCG GTC CCA GTG CCC CAC ACC ACC GCA CTG TCG CTG CCC 390 Ser Val Pro Val Pro His Thr Thr Ala Leu Ser Leu Pro
120 125 GCC TGC CCT GAG GAG TCC CCG CTG CTT GTG GGC CCC ATG 429 Ala Cys Pro Glu Glu Ser Pro Leu Leu Val Gly Pro Met
120 135 140 CTG ATT GAG TTT AAC ATG CCT GTG GAC CTG GAG CTC GTG 468 Leu Ile Glu Phe Asn Met Pro Val Asp Leu Glu Leu Val
145 150 GCA AAG CAG AAC CCA AAT GTG AAG ATG GGC GGC CGC TAT 507 Ala Lys Gln Asn Pro Asn Val Lys Mer Gly Gly Arg Tyr 155 160 165

  <Desc / Clms Page number 63>

 GCC CCC AGG GAC TGC GTC TCT CCT CAC AAG GTG GCC ATC 546 Ala Pro Arg Asp Cys Val Ser Pro His Lys Val Ala Ile
170 175 180 ATC ATT CCA TTC

  CGC AAC CGG CAG GAG CAC CTC AAG TAC 585 Ile Ile Pro Phe Arg Asn Arg Gln Glu His Leu Lys Tyr
185 190 TGG CTA TAT TAT TTG CAC CCA GTC CTG CAG CGC CAG CAG 624 Trp Leu Tyr Tyr Leu His Pro Val Leu Gln Arg Gln Gln
195 200 205 CTG GAC TAT GGC ATC TAT GTT ATC AAC CAG GCG GGA GAC 663 Leu Asp Tyr Gly Ile Tyr Val Ile Asn Gln Ala Gly Asp
210 215 ACT ATA TTC AAT CGT GCT AAG CTC CTC AAT GTT GGC TTT 702 Thr Ile Phe Asn Arg Ala Lys Leu Leu Asn Val Gly Phe 220 225 230 CAA GAA GCC TTG AAG GAC TAT GAC TAC ACC TGC TTT GTG 741 Gln Glu Ala Leu Lys Asp Tyr Asp Tyr Thr Cys Phe Val
235 240 245 TTT AGT GAC GTG GAC CTC ATT CCA ATG AAT GAC CAT AAT 780 Phe Ser Asp Val Asp Leu Ile Pro Met Asn Asp His Asn
250 255 GCG TAC AGG TGT TTT TCA CAG CCA CGG CAC ATT TCC GTT 819 Ala Tyr Arg

  Cys Phe Ser Gln Pro Arg His Ile Ser Val
260 265 270
 EMI63.1
 GCA ATG GAT AAG TTT GGA TTC AGC CTA CCT TAT GTT CAG 858 Ala Met Asp Lys Phe Gly Phe Ser Leu Pro Tyr Val Gln 275 280

  <Desc / Clms Page number 64>

 TAT TTT GGA GGT GTC TCT GCT CTA AGT AAA CAA CAG TTT 897 Tyr Phe Gly Gly Val Ser Ala Leu Ser Lys Gin Gin Phe 285 290 295 CTA ACC ATC AAT GGA TTT CCT AAT AAT TAT TGG GGC TGG 936 Leu Thr Ile Asn Gly Phe Pro Asn Asn Tyr Trp Gly Trp
300 305 310 GGA GGA GAA GAT GAT GAC ATT TTT AAC AGA TTA GTT TTT 975 Gly Gly Glu Asp Asp Asp Ile Phe Asn Arg Leu Val Phe
315 320 AGA GGC ATG TCT ATA TCT CGC CCA AAT GCT GTG GTC GGG 1014 Arg Gly Met Ser Ile Ser Arg Pro Asn Ala Val Val Gly
325 330 335 AGG TGT CGC ATG ATC CGC CAC TCA AGA GAC AAG AAA AAT 1053 Arg Cys Arg Met Ile Arg His Ser Arg Asp Lys Lys Asn
340 345 GAA CCC AAT CCT CAG AGG TTT GAC CGA ATT GCA CAC ACA 1092 Glu Pro

  Asn Pro Gln Arg Phe Asp Arg Ile Ala His Thr 350 355 360 AAG GAG ACA ATG CTC TCT GAT GGT TTG AAC TCA CTC ACC 1131 Lys Glu Thr Met Leu Ser Asp Gly Leu Asn Ser Leu Thr
365 370 375 TAC CAG GTG CTG GAT GTA CAG AGA TAC CCA TTG TAT ACC 1170 Tyr Gln Val Leu Asp Val Gln Arg Tyr Pro Leu Tyr Thr
380 385 CAA ATC ACA GTG GAC ATC GGG ACA CCG AGC TAGGACTTTT 1210 Gln Ile Thr Val Asp Ile Gly Thr Pro Ser
390,395

  <Desc / Clms Page number 65>

 GGTACAGGTA AAGACTGAAT TCATCGATAT CTAGATCTCG 1250 AGCTCGCGAA AGCTT 1265

  <Desc / Clms Page number 66>

 ID SEQ nO 2 Type of sequence: protein Length of sequence: 357 amino acids Type of molecule: C-terminal fragment of the complete galactosyltransferase of HeLa cells Properties:

  * soluble galactosyltransferase (EC 2.4. 1.22) from HeLa cells
Leu Ala Gly Arg Asp Leu Ser Arg Leu
5
Pro Gin Leu Val Gly Val Ser Thr Pro Leu Gin Gly Gly
10 15 20
Ser Asn Ser Ala Ala Ala Gly Gln Island Ser Ser Gly Glu
25 30 35
Leu Arg Thr Gly Gly Ala Arg Pro Pro Pro Pro Leu Gly
40 45
Ala Ser Ser Gln Pro Arg Pro Gly Gly Asp Ser Ser Pro
50 55 60
Val Val Asp Ser Gly Pro Gly Pro Ala Ser Asn Leu Thr
65 70
Ser Val Pro Val Pro His Thr Thr Ala Leu Ser Leu Pro
75 80 85
Ala Cys Pro Glu Glu Ser Pro Leu Leu Val Gly Pro Met
90 95 100
Leu Ile Glu Phe Asn Met Pro Val Asp Leu Glu Leu Val
105 110
Ala Lys Gln Asn Pro Asn Val Lys Met Gly Gly Arg Tyr
115 120 125

  <Desc / Clms Page number 67>

 Ala Pro Arg Asp Cys Val Ser Pro His Lys Val Ala Ile
130 135 Ile Ile Pro Phe Arg Asn Arg Gln Glu His Leu Lys Tyr 140 145 150 Trp Leu Tyr Tyr Leu Leu His Pro

  Val Leu Gln Arg Gln Gln
155 160 165 Leu Asp Tyr Gly Ile Tyr Val Ile Asn Gln Ala Gly Asp
170 175 Thr Ile Phe Asn Arg Ala Lys Leu Leu Asn Val Gly Phe
180 185 190 Gln Glu Ala Leu Lys Asp Tyr Asp Tyr Thr Cys Phe Val
195 200 Phe Ser Asp Val Asp Leu Ile Pro Met Asn Asp His Asn 205 210 215 Ala Tyr Arg Cys Phe Ser Gin Pro Arg His Ile Ser Val
220 225 230 Ala Met Asp Lys Phe Gly Phe Ser Leu Pro Tyr Val Gln
235 240 Tyr Phe Gly Gly Val Ser Ala Leu Ser Lys Gln Gln Phe
245 250 255 Leu Thr Ile Asn Gly Phe Pro Asn Asn Tyr Trp Gly Trp
260 265 Gly Gly Glu Asp Asp Asp Ile Phe Asn Arg Leu Val Phe 270 275 280

  <Desc / Clms Page number 68>

 Arg Gly Met Ser Ile Ser Arg Pro Asn Ala Val Val Gly
285 290 295 Arg Cys Arg Met Ile Arg His Ser Arg Asp Lys Lys Asn
300 305 Glu Pro Asn Pro Gln Arg Phe Asp Arg Ile Ala His

  Thr
310 315 320 Lys Glu Thr Met Leu Ser Asp Gly Leu Asn Ser Leu Thr
325 330 Tyr Gln Val Leu Asp Val Gln Arg Tyr Pro Leu Tyr Thr 335 340 345 Gln Ile Thr Val Asp Ile Gly Thr Pro Ser-
350 355

  <Desc / Clms Page number 69>

 ID SEQ nO 3 Type of sequence: nucleotide with corresponding protein Length of sequence: 1,246 bp Number of strands: double strand Topology: linear Type of molecule: recombinant Direct experimental source: plasmid pSIA2 from E. coli DH5cx / pSIA2 Characteristics: of 15 at 1,232 bp cDNA sequence coding for the sialyl transferase of HepG2 cells from 1 to 6 bp PstI site from 6 to 11 bp EcoRI site from 144 to 149 bp EcoRI site from 1,241 to 1,246 bp BamHI site Properties:

   PstI-BamHI fragment from the plasmid pSIA2 comprising the HepG2 cDNA coding for complete sialyltransferase (EC 2.4. 99.1)
CTGCAGAATT CAAA ATG ATT CAC ACC AAC CTG AAG AAA 38
 EMI69.1
 Met Ile His Thr Asn Leu Lys Lys 5 AAG TTC AGC TGC TGC GTC CTG GTC TTT CTT CTG TTT GCA 77 Lys Phe Ser Cys Cys Val Leu Val Phe Leu Leu Phe Ala
10 15 20 GTC ATC TGT GTG TGG AAG GAA AAG AAG AAA GGG AGT TAC 116 Val Ile Cys Val Trp Lys Glu Lys Lys Lys Gly Ser Tyr
25 30 TAT GAT TCC TTT AAA TTG CAA ACC AAG GAA TTC CAG GTG 155 Tyr Asp Ser Phe Lys Leu Gln Thr Lys Glu Phe Gln Val
35 40 45

  <Desc / Clms Page number 70>

 TTA AAG AGT CTG GGG AAA TTG GCC ATG GGG TCT GAT TCC 194 Leu Lys Ser Leu Gly Lys Leu Ala Met Gly Ser Asp Ser
50 55 60 CAG TCT GTA TCC TCA AGC AGC ACC CAG GAC CCC CAC AGG 233 Gln Ser Val Ser Ser Ser Ser Thr

    Gln Asp Pro His Arg
65 70 GGC CGC CAG ACC CTC GGC AGT CTC AGA GGC CTA GCC AAG 272 Gly Arg Gln Thr Leu Gly Ser Leu Arg Gly Leu Ala Lys
75 80 85 GCC AAA CCA GAG GCC TCC TTC CAG GTG TGG AAC AAG GAC 311 Ala Lys Pro Glu Ala Ser Phe Gln Val Trp Asn Lys Asp
90 95 AGC TCT TCC AAA AAC CTT ATC CCT AGG CTG CAA AAG ATC 350 Ser Ser Ser Lys Asn Leu Ile Pro Arg Leu Gln Lys Ile 100 105 110 TGG AAG AAT TAC CTA AGC ATG AAC AAG TAC AAA GTG TCC 389 Trp Lys Asn Tyr Leu Ser Met Asn Lys Tyr Lys Val Ser
115.

   120 125 TAC AAG GGG CCA GGA CCA GGC ATC AAG TTC AGT GCA GAG 428 Tyr Lys Gly Pro Gly Pro Gly Ile Lys Phe Ser Ala Glu
130 135 GCC CTG CGC TGC CAC CTC CGG GAC CAT GTG AAT GTA TCC 467 Ala Leu Arg Cys His Leu Arg Asp His Val Asn Val Ser
140 145 150 ATG GTA GAG GTC ACA GAT TTT CCC TTC AAT ACC TCT GAA 506 Met Val Glu Val Thr Asp Phe Pro Phe Asn Thr Ser Glu
155,160

  <Desc / Clms Page number 71>

 TGG GAG GGT TAT CTG CCC AAG GAG AGC ATT AGG ACC AAG 545 Trp Glu Gly Tyr Leu Pro Lys Glu Ser Ile Arg Thr Lys 165 170 175 GCT GGG CCT TGG GGC AGG TGT GCT GTT GTG TCG TCA GCG 584 Ala Gly Pro Trp Gly Arg Cys Ala Val Val Ser Ser Ala
180 185 190 GGA TCT CTG AAG TCC TCC CAA CTA GGC AGA GAA ATC GAT 623 Gly Ser Leu Lys Ser Ser Gln Leu Gly Arg Glu Ile Asp
195 200 GAT CAT GAC GCA GTC CTG AGG TTT AAT GGG GCA CCC ACA 662 Asp His Asp Ala Val Leu Arg Phe Asn Gly Ala Pro Thr
205 210 215

  
 EMI71.1
 GCC AAC TTC CAA CAA GAT GTG GGC ACA AAA ACT ACC ATT 701 Ala Asn Phe Gln Gln Asp Val Gly Thr Lys Thr Thr Ile
220 225 CGC CTG ATG AAC TCT CAG TTG GTT ACC ACA GAG AAG CGC 740 Arg Leu Met Asn Ser Gln Leu Val Thr Thr Glu Lys Arg 230 235.240 TTC CTC AAA GAC AGT TTG TAC AAT GAA GGA ATC CTA ATT 779 Phe Leu Lys Asp Ser Leu Tyr Asn Glu Gly Ile Leu Ile
245 250 255 GTA TGG GAC.

   CCA TCT GTA TAC CAC TCA GAT ATC CCA AAG 818 Val Trp Asp Pro Ser Val Tyr His Ser Asp Ile Pro Lys
260 265 TGG TAC CAG AAT CCG GAT TAT AAT TTC TTT AAC AAC TAC 857 Trp Tyr Gln Asn Pro Asp Tyr Asn Phe Phe Asn Asn Tyr
270,275,280

  <Desc / Clms Page number 72>

 AAG ACT TAT CGT AAG CTG CAC CCC AAT CAG CCC TTT TAC 896 Lys Thr Tyr Arg Lys Leu His Pro Asn Gin Pro Phe Tyr
285 290 ATC CTC AAG CCC CAG ATG CCT TGG GAG CTA TGG GAC ATT 935 Ile Leu Lys Pro Gln Met Pro Trp Glu Leu Trp Asp Ile 295 300 305 CTT CAA GAA ATC TCC CCA GAA GAG ATT CAG CCA AAC CCC 974 Leu Gln Glu Ile Ser Pro Glu Glu Ile Gln Pro Asn Pro
310 315 320 CCA TCC TCT GGG ATG CTT GGT ATC ATC ATC ATG ATG ACG 1013 Pro Ser Ser Gly Met Leu Gly Ile Ile Ile Met Met Thr
325 330 CTG TGT GAC CAG GTG GAT ATT TAT GAG TTC CTC CCA TCC 1052 Leu Cys Asp Gln Val Asp Ile Tyr Glu Phe Leu Pro Ser
335,340

  345 AAG CGC AAG ACT GAC GTG TGC TAC TAC TAC CAG AAG TTC 1091 Lys Arg Lys Thr Asp Val Cys Tyr Tyr Tyr Gln Lys Phe 350. 355 TTC GAT AGT GCC TGC ACG ATG GGT GCC TAC CAC CCG CTG 1130 Phe Asp Ser Ala Cys Thr Met Gly Ala Tyr His Pro Leu 360 365 370 CTC TAT GAG AAG AAT TTG GTG AAG CAT CTC AAC CAG GGC 1169 Leu Tyr Glu Lys Asn Leu Val Lys His Leu Asn Gln Gly
375 380. 385 ACA GAT GAG GAC ATC TAC CTG CTT GGA AAA GCC ACA CTG 1208 Thr Asp Glu Asp Ile Tyr Leu Leu Gly Lys Ala Thr Leu
390,395

  <Desc / Clms Page number 73>

 CCT GGC TTC CGG ACC ATT CAC TGC TAAGCACAGG ATCC 1246 Pro Gly Phe Arg Thr Ile His Cys
400 405

  <Desc / Clms Page number 74>

 ID SEQ No. 4 Sequence type: protein Sequence length: 368 amino acids Molecule type: C-terminal fragment of complete sialyl transferase Properties:

   soluble sialyltransferase (EC 2.4. 99.1) from human HepG2 cells
Lys Leu Gln Thr Lys Glu Phe Gln Val
5
Leu Lys Ser Leu Gly Lys Leu Ala Met Gly Ser Asp Ser
10 15 20
Gin Ser Val Ser Ser Ser Ser Thr Gin Asp Pro His Arg
25 30 35
Gly Arg Gln Thr Leu Gly Ser Leu Arg Gly Leu Ala Lys
40 45
Ala Lys Pro Glu Ala Ser Phe Gln Val Trp Asn Lys Asp
50 55 60
Ser Ser Ser Lys Asn Leu Ile Pro Arg Leu Gin Lys Ile
65 70
Trp Lys Asn Tyr Leu Ser Met Asn Lys Tyr Lys Val Ser
75 80 85
Tyr Lys Gly Pro Gly Pro Gly Ile Lys Phe Ser Ala Glu
90 95 100
Ala Leu Arg Cys His Leu Arg Asp His Val Asn Val Ser
105 110
Met Val Glu Val Thr Asp Phe Pro Phe Asn Thr Ser Glu
115 120 125

  <Desc / Clms Page number 75>

 Trp Glu Gly Tyr Leu Pro Lys Glu Ser Ile Arg Thr Lys
130 135 Ala Gly Pro Trp Gly Arg Cys Ala Val Val Ser Ser Ala 140 145

  150 Gly Ser Leu Lys Ser Ser Gin Leu Gly Arg Glu Ile Asp
155 160 165 Asp His Asp Ala Val Leu Arg Phe Asn Gly Ala Pro Thr
170 175 Ala Asn Phe Gln Gln Asp Val Gly Thr Lys Thr Thr Ile
180 185 190 Arg Leu Met Asn Ser Gln Leu Val Thr Thr Glu Lys Arg
195 200 Phe Leu Lys Asp Ser Leu Tyr Asn Glu Gly Ile Leu Ile 205 210 215 Val Trp Asp Pro Ser Val Tyr His Ser Asp Ile Pro Lys
220 225 230 Trp Tyr Gln Asn Pro Asp Tyr Asn Phe Phe Asn Asn Tyr
235 240 Lys Thr Tyr Arg Lys Leu His Pro Asn Gin Pro Phe Tyr
245 250 255 Ile Leu Lys Pro Gln Met Pro Trp Glu Leu Trp Asp Ile
260 265 Leu Gln Glu Ile Ser Pro Glu Glu Ile Gln Pro Asn Pro 270 275 280

  <Desc / Clms Page number 76>

 Pro Ser Ser Gly Met Leu Gly Ile Ile Ile Met Met Thr
285 290 295 Leu Cys Asp Gln Val Asp Ile Tyr Glu Phe Leu Pro Ser
300 305 Lys Arg Lys Thr Asp Val Cys Tyr Tyr Tyr

    Gln Lys Phe
310 315 320 Phe Asp Ser Ala Cys Thr Met Gly Ala Tyr His Pro Leu
325 330 Leu Tyr Glu Lys Asn Leu Val Lys His Leu Asn Gln Gly 335 340 345 Thr Asp Glu Asp Ile Tyr Leu Leu Gly Lys Ala Thr Leu
350 355 360 Pro Gly Phe Arg Thr Ile His Cys
365

  <Desc / Clms Page number 77>

 ID SEQ No. 5 Type of sequence: nucleotide sequence with corresponding protein Length of sequence: 1400 bp Number of strands: double strand Topology: linear Direct experimental source: BRB. ELFT / pCR1000-13 Characteristics: from 58 to 1,272 bp cDNA sequence coding for lla (1-3) - human fucosyltransferase from 238 to 243 bp NruI site Properties:

   HL60 cell cDNA encoding lia (1-3) - complete fucosyltransferase CGCTCCTCCA CGCCTGCGGA CGCGTGGCGA GCGGAGGCAG CGCTGCCTGT 50 TCGCGCC ATG GGG GCA CCG TGG GGC TCG CCG ACG GCG GCG 90
Met Gly Ala Pro Trp Gly Ser'Pro Thr Ala Ala
5 10 GCG GGC GGG CGG CGC GGG TGG CGC CGA GGC CGG GGG CTG 129 Ala Gly Gly Arg Arg Gly Trp Arg Arg Gly Arg Gly Leu
15 20 CCA TGG ACC GTC TGT GTG CTG GCG GCC GCC GGC TTG ACG 168 Pro Trp Thr Val Cys Val Leu Ala Ala Ala Gly Leu Thr
25 30 35 TGT ACG GCG CTG ATC ACC TAC GCT TGC TGG GGG CAG CTG 207 Cys Thr Ala Leu Ile Thr Tyr Ala Cys Trp Gly Gln Leu
40 45 50 CCG CCG CTG CCC TGG GCG TCG CCA ACC CCG TCG CGA CCG 246 Pro Pro Leu Pro Trp Ala Ser Pro Thr Pro Ser Arg Pro
55 60

  <Desc / Clms Page number 78>

 GTG GGC GTG CTG CTG TGG TGG GAG CCC TTC GGG GGG CGC 285 Val Gly Val Leu Leu Trp Trp Glu Pro Phe Gly Gly Arg
65 70 75 GAT AGC GCC CCG AGG

  CCG CCC CCT GAC TGC CGG CTG CGC 324 Asp Ser Ala Pro Arg Pro Pro Pro Asp Cys Arg Leu Arg
80 85 TTC AAC ATC AGC GGC TGC CGC CTG CTC ACC GAC CGC GCG 363 Phe Asn Ile Ser Gly Cys Arg Leu Leu Thr Asp Arg Ala
90 95 100 TCC TAC GGA GAG GCT CAG GCC GTG CTT TTC CAC CAC CGC 402 Ser Tyr Gly Glu Ala Gln Ala Val Leu Phe His His Arg
105 110 115 GAC CTC GTG AAG GGG CCC CCC GAC TGG CCC CCG CCC TGG 441 Asp Leu Val Lys Gly Pro Pro Asp Trp Pro Pro Pro Trp
120 125 GGC ATC CAG GCG CAC ACT GCC GAG GAG GTG GAT CTG CGC 480 Gly Ile Gln Ala His Thr Ala Glu Glu Val Asp Leu Arg
130 135 140 GTG TTG GAC TAC GAG GAG GCA GCG GCG GCG GCA GAA GCC 519 Val Leu Asp Tyr Glu Glu Ala Ala Ala Ala Ala Glu Ala
145 150 CTG GCG ACC TCC AGC CCC AGG CCC CCG GGC CAG CGC TGG 558 Leu Ala Thr Ser Ser Pro Arg Pro Pro Gly Gln Arg Trp 155 160 165 GTT TGG ATG AAC TTC GAG

  TCG CCC TCG CAC TCC CCG GGG 597 Val Trp Met Asn Phe Glu Ser Pro Ser His Ser Pro Gly
170 175 180

  <Desc / Clms Page number 79>

 CTG CGA AGC CTG GCA AGT AAC CTC TTC AAC TGG ACG CTC 636 Leu Arg Ser Leu Ala Ser Asn Leu Phe Asn Trp Thr Leu
185 190 TCC TAC CGG GCG GAC TCG GAC GTC TTT GTG CCT TAT GGC 675 Ser Tyr Arg Ala Asp Ser Asp Val Phe Val Pro Tyr Gly
195 200 205 TAC CTC TAC CCC AGA AGC CAC CCC GGC GAC CCG CCC TCA 714 Tyr Leu Tyr Pro Arg Ser His Pro Gly Asp Pro Pro Ser
210 215 GGC CTG GCC CCG CCA CTG TCC AGG AAA CAG GGG CTG GTG 753 Gly Leu Ala Pro Pro Leu Ser Arg Lys Gln Gly Leu Val 220 225 230 GCA TGG GTG GTG AGC CAC TGG GAC GAG CGC CAG GCC CGG 792 Ala Trp Val Val Ser His Trp Asp Glu Arg Gln Ala Arg
235 240.

   245 GTC CGC TAC TAC CAC CAA CTG AGC CAA CAT GTG ACC GTG 831 Val Arg Tyr Tyr His Gln Leu Ser Gln His Val Thr Val
250 255 GAC GTG TTC GGC CGG GGC GGG CCG GGG CAG CCG GTG CCC 870 Asp Val Phe Gly Arg Gly Gly Pro Gly Gln Pro Val Pro
260 265 270 GAA ATT GGG CTC CTG CAC ACA GTG GCC CGC TAC AAG TTC 909 Glu Ile Gly Leu Leu His Thr Val Ala Arg Tyr Lys Phe
275 280 TAC CTG GCT TTC GAG AAC TCG CAG CAC CTG GAT TAT ATC 948 Tyr Leu Ala Phe Glu Asn Ser Gln His Leu Asp Tyr Ile 285 290 295

  <Desc / Clms Page number 80>

 ACC GAG AAG CTC TGG CGC AAC GCG TTG CTC GCT GGG GCG 987 Thr Glu Lys Leu Trp Arg Asn Ala Leu Leu Ala Gly Ala
300 305 310 GTG CCG GTG GTG CTG GGC CCA GAC CGT GCC AAC TAC GAG 1026 Val Pro Val Val Leu Gly Pro Asp Arg Ala Asn Tyr Glu
315 320 CGC TTT GTG CCC CGC GGC GCC TTC ATC CAC GTG GAC GAC 1065 Arg Phe Val Pro Arg Gly Ala Phe Ile His Val Asp Asp
325 330 335 TTC CCA AGT GCC TCC TCC

  CTG GCC TCG TAC CTG CTT TTC 1104 Phe Pro Ser Ala Ser Ser Leu Ala'Ser Tyr Leu Leu Phe
340 345 CTC GAC CGC AAC CCC GCG GTC TAT CGC CGC TAC TTC CAC 1143 Leu Asp Arg Asn Pro Ala Val Tyr Arg Arg Tyr Phe His 350 355 360 TGG CGC CGG AGC TAC GCT GTC CAC ATC ACC TCC TTC TGG 1182 Trp Arg Arg Ser Tyr Ala Val His Ile Thr Ser Phe Trp
365 370 375 GAC GAG CCT TGG TGC CGG GTG TGC CAG GCT GTA CAG AGG 1221 Asp Glu Pro Trp Cys Arg Val Cys Gln Ala Val Gln Arg
380 385 GCT GGG GAC CGG CCC AAG AGC ATA CGG AAC TTG GCC AGC 1260 Ala Gly Asp Arg Pro Lys Ser Ile Arg Asn Leu Ala Ser
390 395 400 TGG TTC GAG CGG TGAAGCCGCG CTCCCCTGGA AGCGACCCAG 1302 Trp Phe Glu Arg
405

  <Desc / Clms Page number 81>

   3GGAGGCCAA GTTGTCAGCT TTTTGATCCT CTACTGTGCA TCTCCTTGAC 1352 TGCCGCATCA TGGGAGTAAG TTCTTCAAAC ACCCATTTTT GCTCTATG 1400
The strains mentioned in

  the description has been deposited in the name of CIBA-GEIGY AG with
Deutsche Sammlung
Von Mikroorganismen
Mascheroder Weg 1 b
D 3300 Braunschweig
REFERENCE DATE OF DEPOSIT NO DEPOSIT 1) HB101 / p30 October 23, 1987 DSM 4297 2) H449 February 18, 1988 DSM 4413 3) JM109 / pDP34 March 14, 1988 DSM 4473 4) HB101 / p31R December 19, 1988-DSM 5116
50) 5 / BT 150 May 23, 1991 DSM 6530


    

Claims (19)

CLAIMS 1. A process for the production of a mammalian membrane-bound glycosyltransferase selected from the group consisting of a galactosyltransferase, a sialyltransferase and a fucosyltransferase, or a variant thereof, respectively, comprising culturing a yeast strain which has been transformed with a hybrid vector comprising an expression cassette comprising a promoter and a DNA sequence coding for said glycosyltransferase or variant, which DNA is controlled by said promoter, and the recovery of free cell enzymatic activity.  2. Method according to claim 1, characterized in that the glycosyltransferase is of human origin.  3. Method for the production of a variant according to claim 1, characterized in that the variant differs from the corresponding complete glycosyltransferase by the absence of the cytoplasmic tail, of the anchoring-signal domain and, optionally, of a minor part of the stem region.  4. Method for the production of a variant according to claim 3, comprising the culture of a yeast strain comprising an expression cassette comprising a promoter functionally linked to a  EMI82.1  first DNA sequence coding for a signal peptide, linked in the appropriate reading frame to a second DNA sequence coding for said variant, which DNA sequence is controlled by said promoter, and the recovery of enzymatic activity.  5. Method according to claim 1, characterized in that the glycosyltransferase is a galactosyltransferase.  6. Method according to claim 5, characterized in that the galactosyltransferase is chosen from UDP-galactose: ss-galactoside-  <Desc / Clms Page number 83>  a (1-3) -galactosyltransferase (EC 2.4. 1.151) and UDP-galactose: ss-N- acetylglucosamine-ss (1-4) -galactosyltransferase (EC 2.4. 1.22).  7. Method according to claim 5, characterized in that the galactosyltransferase comprises the amino acid sequence represented in the ID SEQn l.  8. Method according to claim 5, characterized in that the galactosyltransferase comprises the amino acid sequence represented in ID SEQ n 2.  9. Method according to claim 1, characterized in that the glycosyltransferase is a sialyltransferase.  10. Method according to claim 9, characterized in that the sialyltransferase is CJ \ 1P-NeuAc: P-galactoside-a (2-6) sialyltransferase (EC 2.4. 99.1).    11. Method according to claim 9, 'characterized in that the sialyltransferase comprises the amino acid sequence represented in ID SEQ n 3.  12. Method according to claim 9, characterized in that the sialyltransferase is designated by ST (Lys27-Cys406) and consists of amino acids 27 to 406 of the amino acid sequence listed in ID SEQ No. 3.  13. Method according to claim 9, characterized in that the sialyltransferase comprises the amino acid sequence represented in ID SEQ n 4.  14. Method according to claim 1, characterized in that the glycosyltransferase is a fucosyltransferase.  15. Method according to claim 14, characterized in that the fucosyltransferase is chosen from GDP-fucose: p-galactoside-a (1-2) -  <Desc / Clms Page number 84>  fucosyltransferase (EC 2.4. 1.69) and GDP-fucose: N-acetylglucosaminea (1-3 / 4) -fucosyltransferase (EC 2. 4. 1. 65).  16. Method according to claim 14, characterized in that the fucosyltransferase comprises the amino acid sequence represented in ID SEQ no 5.  17. Method according to claim 14, characterized in that the fucosyltransferase is designated by FT (Arg62-Arg405) and consists of amino acids 62 to 405 of the amino acid sequence represented in ID SEQn 5.  18. Hybrid yeast vector comprising an expression cassette comprising a yeast promoter and a DNA sequence coding for a mammalian membrane-bound glycosyltransferase, chosen from a galactosyltransferase, a sialyltransferase and a fucosyltransferase, or a variant thereof ci, respectively, which DNA sequence is controlled by said promoter.  19. A yeast strain which has been transformed with a hybrid vector according to claim 18.