KR20230122822A - A composition for the treatment of obesity comprising the extract of gastrodia elata blume - Google Patents

Abstract

The present invention relates to an anti-obesity composition comprising a cinnamon extract as an active ingredient. The effect of the composition according to the present invention is that it has an effect of reducing body weight, liver weight and Epifat weight, and has an effect of reducing serum triglyceride and liver triglyceride, and also has a fat converting enzyme gene, ACC (Acetyl -CoA Carboxylase) and FAS (Fatty Acid Synthase).

Description

Anti-obesity composition containing cheonma extract as an active ingredient {A COMPOSITION FOR THE TREATMENT OF OBESITY COMPRISING THE EXTRACT OF GASTRODIA ELATA BLUME}

The present invention relates to an anti-obesity composition comprising a cinnamon extract as an active ingredient. The effect of the composition according to the present invention is that it has an effect of reducing body weight, liver weight and Epifat weight, and has an effect of reducing serum triglyceride and liver triglyceride, and also has a fat converting enzyme gene, ACC (Acetyl -CoA Carboxylase) and FAS (Fatty Acid Synthase).

Chunma (天麻: Gastrodia elata Blume) is a higher plant belonging to the Orchidachae family and is a parasitic plant that lives by parasitism with mulberry mushroom hyphae because it does not have leaves and roots to produce self-nutrition. It grows straight with a single stem about 30 to 100 cm tall, and the roots are lumpy like sweet potatoes. The stem is reddish brown with sparsely small leaves. It sprouts in May-June and blooms white flowers, then withers soon. The root is called Cheonma, and the stem is called Jeokjeon or Jeongpungcho. It is a semi-parasitic plant that grows in symbiosis with other mushrooms in places where oak roots have died.

Chunma is called the best new drug for diseases of the brain disease system. In particular, it not only exerts a distinct effect on brain diseases such as headache and stroke, but also treats a wide range of diseases ranging from gastric ulcer, epilepsy, cirrhosis of the liver, food poisoning, disc, leukemia and cancer. It is known to exert an excellent effect on diseases. In addition, cheonma is rich in diastase, which shows the action of strengthening the function of the digestive organs, and saponin contained in cheonma affects cholesterol metabolism, not only improves arteriosclerosis, but also induces sound sleep, and strengthens heart contraction. , It is reported that it promotes the expansion of capillaries, and in particular, exhibits an energy-enhancing effect.

On the other hand, obesity refers to a state in which unconsumed calories are excessively accumulated in the body because the amount of calories consumed is higher than the amount of calories consumed. As a numerical concept, obesity is defined as a BMI (body mass index) of 25 or more when measured. The BMI measurement method is a obesity measurement method that estimates the amount of body fat through a value obtained by dividing the weight (kg) by the square of the height (m2).

The causes of obesity can be divided into genetic factors and lifestyle factors. Genetic factors include the case of having an obesity gene such as FTO. About 20 obesity genes have been identified so far, and among them, FTO is a representative obesity gene. It is known that FTO is involved in the center of the hypothalamus that controls satiety and suppresses the secretion of hormones that can feel satiety.

Lifestyle factors include lack of exercise and unbalanced eating habits. If you lack exercise, the fat in your body is not burned and accumulated. In addition, if nutrients are not balanced, such as excessive intake of carbohydrates and fat and low intake of vitamins and fiber, fat in the body does not burn and accumulates, just like in case of lack of exercise.

Treatment of obesity includes drug therapy. Drug therapy is a treatment method in which anti-obesity drugs are administered to obese patients. Types of anti-obesity drugs include appetite suppressants, metabolism boosters, absorption inhibitors, and thermogenesis promoters. Appetite suppressants are also called satiety stimulants, and act on the satiety center of the hypothalamus to produce an effect similar to that of a large amount even when a small amount of food is consumed. phendimetrazine and phentermine. Metabolic boosters increase the basal metabolic rate by increasing energy consumption in the body. Absorption inhibitors inhibit the action of lipolytic enzymes in the gastrointestinal tract, thereby inhibiting fat absorption. Thermogenesis stimulants can maximize the effect of appetite suppressants, so they are supplementally prescribed along with appetite suppressants. However, each drug has side effects. [Table 1] below lists the side effects of each drug.

Types of Obesity Treatments side effect Appetite suppressants (satisfaction stimulants) Headaches, insomnia, etc. Metabolic booster numbness in limbs, etc. absorption inhibitor Fatty stools, frequent farts, etc. heat production accelerator hand shake, etc.

Therefore, the present applicant has devised a composition capable of preventing or improving obesity without side effects by utilizing a natural substance, Cheonma.

Looking at the prior art, Korean Registered Patent Publication No. 10-1517828 describes 'a composition for preventing, improving or treating obesity containing red ginseng complex as an active ingredient'. Looking at the claims, a composition containing as an active ingredient a red ginseng complex obtained by mixing red ginseng extract, ginseng extract, red ginseng extract, and red ginseng extract, and red ginseng complex is based on 300 parts by weight of red ginseng extract, 100 parts by weight of ginseng extract, and 100 parts by weight of red ginseng extract. It is described to be prepared by mixing 100 parts by weight and 100 parts by weight of upper leaf extract. In other words, it is characterized in that the red ginseng extract has the largest weight and is included in a 1/3 weight ratio of the remaining three materials.

In contrast to the present invention, it can be said that it is similar in that it contains the Cheonma extract, but the prior art found the weight ratio combination of four materials based on cell experiments, whereas the present invention is the result of animal testing on the Cheonma extract. The difference lies in the fact that the optimal dose was found based on

Republic of Korea Registered Patent Publication No. 10-1517828 (registered on April 29, 2015)

The problem is to provide an anti-obesity composition containing an optimal concentration of cinnamon extract as an active ingredient.

The solution is an anti-obesity composition containing cheonma extract as an active ingredient.

In the above, the Chunma extract is characterized by containing 100 to 500 mg/kg/day based on oral administration to mice.

In the above, the Chunma extract is effective in reducing weight gain, liver weight and Epifat weight, serum triglyceride and liver triglyceride, and fat converting enzyme genes ACC (Acetyl-CoA Carboxylase) and FAS (Fatty Acid) Synthase) is characterized in that it has the effect of inhibiting the expression.

Another solution is an anti-obesity functional food containing the composition described above.

In the above, the composition is characterized by containing 100 ~ 500 mg / kg / day of Chunma extract based on oral administration to mice.

Another solution is an anti-obesity functional beverage comprising the composition described above.

The effect of the composition according to the present invention has the effect of reducing weight gain, liver weight and Epifat weight. In addition, it has the effect of reducing serum triglyceride and liver triglyceride. In addition, it has the effect of suppressing the expression of fat converting enzyme genes, FAS (Fatty Acid Synthase) and ACC (Acetyl-CoA Carboxylase).

Figure 1 is a graph showing the results of the decrease in weight gain in a concentration-dependent manner compared to the high-fat diet group when oral administration of 100, 200, or 500 mg/kg/day of Chunma with a high-fat diet.
Figure 2 is a graph showing the result of reducing the weight of the liver in a concentration-dependent manner compared to the high-fat diet group when oral administration of 100, 200, or 500 mg/kg/day of Chunma with a high-fat diet.
Figure 3 is a graph showing the result of reducing the weight of Epifat in a concentration-dependent manner compared to the high-fat diet group when oral administration of 100, 200, or 500 mg/kg/day of Chunma with a high-fat diet.
Figure 4 is a graph showing the results of concentration-dependent decrease in serum triglyceride density compared to the high-fat diet group upon oral administration of 100, 200, and 500 mg/kg/day of Chunma along with a high-fat diet.
Figure 5 is a graph showing the results of concentration-dependent decrease in the density of neutral fat in the liver compared to the high-fat diet group at the time of oral administration of 100, 200, and 500 mg/kg/day of Chunma along with the high-fat diet.
Figure 6 is a graph showing the results of the suppression of the expression of ACC (Acetyl-CoA Carboxylase), a fat converting enzyme gene, compared to the high-fat diet group when Chunma 100, 200, and 500 mg/kg/day was orally administered with a high-fat diet.
Figure 7 is a graph showing the results of suppression of the expression of the fat converting enzyme gene FAS (Fatty Acid Synthase) compared to the high-fat diet group at the time of oral administration of 100, 200, and 500 mg/kg/day of Chunma together with a high-fat diet.

The terms or words used in this specification and claims should not be construed as being limited to their ordinary or dictionary meanings, and the inventors can properly define the concept of terms in order to best explain their invention. Based on the principle, it should be interpreted as a meaning and concept consistent with the technical idea of the present invention.

Therefore, the matters described in the embodiments, reference examples, and drawings described in this specification are only the most preferred examples of the present invention and do not represent all the technical ideas of the present invention, so that they can be replaced at the time of the present application. It should be understood that there may be many equivalents and variations.

experimental example. Anti-obesity effect of Chunma extract using high-fat diet-induced obesity model

1. Preparation of Cheonma extract

Chunma ( Gastodia elata ) was provided by the Jinan Agricultural Research and Extension Services and confirmed for authenticity in the herbal medicine department of the College of Oriental Medicine, Wonkwang University. Chunma water extract was concentrated and lyophilized, and then used in the experiment while being refrigerated.

2. Breeding and Diet of Experimental Animals

As experimental animals, 6-week-old C57BL/6J male mice were purchased (Orientbio, Seongnam, Korea) and adapted to the breeding room environment for 1 week. Mice with an average weight of about 20 to 22 g were selected from a normal diet control group (Control), a high-fat diet control group (High fat diet), and a high-fat diet with 100 mg/kg Cheonma extract administered group (High fat diet + GE (100 mg/kg) ), 200 mg/kg (High fat diet + GE (200mg/kg) administration group, 500 mg/kg (High fat diet + GE (500mg/kg) administration group) randomly assigned to 5 groups and raised for 5 weeks. was maintained at 18-24°C and relative humidity 50-60%, and the light and shade were adjusted at 12-hour cycles (8:00-20:00) About 60% of the total calories in the high-fat feed used in this experiment came from fat. 15% lard was additionally added to the basic diet to be supplied, and body weight was measured once a week.Animal experiments were approved by Wonkwang University Animal Experiment Ethics Committee, and laboratory animal use and care followed institutional guidelines.

3. Experimental group setup and sample administration

At the end of the experimental period, the animals were weighed. The experimental groups were a control group, a high fat diet group, a high-fat feed + cheonma extract 100 mg/kg administration group, a high-fat feed + cheonma extract 200 mg/kg administration group, and a high-fat feed + cheonma extract 500 mg/kg. The administration groups were divided, and 10 animals per group were used in the experiment, and Chunma extract was administered orally for 5 weeks using a mouse solubilized zone every day at a predetermined concentration.

4. Biomarker analysis and necropsy

Body weight was measured every week after the start of the experiment, and at autopsy, after anesthesia with ether, blood was collected from the abdominal vena cava and used for blood analysis.

5. Total RNA Isolation

After the experiment, total RNA was isolated from the liver and adipose tissue excised using Trizol reagent (Life Technologies, UK) according to the method provided by the manufacturer. Each tissue was finely cut, dissolved with 1000 μl RNAzol B, and then reacted in ice for 5 minutes with the addition of 200 μl chloroform. After the reaction was completed, 500 μl of the supernatant was transferred to a new tube by centrifugation at 4° C. at 13,000 rpm for 20 minutes. The same amount of isopropanol was added to the supernatant, mixed, and reacted on ice for 30 minutes. After the reaction was completed, centrifugation was performed at 4° C. at 13,000 rpm for 20 minutes, and the precipitate was washed twice with 75% EtOH. After drying the washed RNA, it was dissolved in 20 μl of DEPC water and quantified by measuring the absorbance in a spectrophotometer.

6. Real Time Reverse Transcriptase Polymerization (Real Time PCR)

Reverse transcription reaction was performed using 2 μg total RNA and Prime Script TM reagent kit (perfect realtime) (TaKaRa BIOINC.) according to the method provided by the manufacturer. Reverse transcription reaction was performed with a reaction solution containing total RNA (2 μg), oligo d(T)primer (25pmol), PrimeScript RT enzyme Mix I, and 5X primeScript Buffer at 37°C for 15 minutes and at 85°C for 5 hours to obtain cDNA. was synthesized. Real-time reverse transcriptase polymerization was performed using Power SYBY Green PCR Master Mix for 10-fold diluted cDNA. The mRNA amount of each expressed gene was calculated as a relative amount to GAPDH using LightCycler System software (Roche). The sequences of the primers used are listed in Table 2.

Gene Sequence for Primers Accession no. GAPDH Forward: CGTCCCGTAGACAAAATGGT
Reverse: TTGATGGCAACAATCTCCAC NM_008084 FAS Forward: GCGATGAAGAGCATGGTTTAG
Reverse: GGCTCAAGGGTTCCATGTT NM_007988 ACC Forward: TGGCACAGACCGTGGTAG
Reverse: GTCTTAAATGCAGAGTCTGGGAA NM_133360.2

7. Liver triglyceride (triglyceride) assay

Liver triglyceride content was measured as follows. The liver tissue was homogenized in chloroform-methanol solution (2:1, v/v), reacted at room temperature for 1 hour, centrifuged, and the organic solvent layer was dried for 24 hours. After dissolution in ethanol, the triglyceride content of the liver was investigated using the TG kit (AM 157S-K and AM 202-K, Asan Pharmaceutical, Korea) and normalized to protein concentration.

8. Statistical analysis

All experimental results were calculated as mean±standard error (Mean±S.D.). Statistical analysis according to the statistical significance test between each group was performed by ANOVA (one-way analysis of variance test) Duncan post-test comparison, and it was determined that it was significant when p<0.05 (SPSS V12., SPSS Inc, Chicago, IL, USA).

9. Experimental results

1 to 7 are graphs showing experimental results according to experimental examples of the present invention.

Referring to Figure 1, when oral administration of 100, 200, 500 mg / kg / day Cheonma with a high-fat diet, the weight gain was smaller in a concentration-dependent manner compared to the high-fat diet group. As time passed, the width of the decrease in weight gain became larger and closer to the control group. In particular, looking at the results after 5 weeks, the 100mg administration group was about 33g, the 200, 500mg administration group was about 30g, compared to about 40g in the high-fat diet group. Since the control group weighed about 28g, it can be seen that the body weight of the Cheonma-administered group is closer to that of the control group.

Referring to FIG. 2, when oral administration of 100, 200, or 500 mg/kg/day of Chunma along with a high-fat diet, the weight of the liver decreased in a concentration-dependent manner compared to the high-fat diet group. In particular, compared to 1.4 g of the high-fat diet group and 1.25 g of the control group, the 100, 200, and 500 mg administration groups were about 1.1, 1, and 0.9 g, respectively. Of course, it can be said that it suggests the effect of suppressing the occurrence of fatty liver.

Referring to FIG. 3, when oral administration of 100, 200, or 500 mg/kg/day of Chunma along with a high-fat diet, the weight of Epifat decreased in a concentration-dependent manner compared to the high-fat diet group. Compared to 2.0 g of the high-fat diet group, the 100, 200, and 500 mg administration groups were about 1.6, 1.3, and 1.25 g, respectively.

Referring to FIG. 4, when oral administration of 100, 200, or 500 mg/kg/day of Chunma with a high-fat diet was performed, the density of serum neutral fat decreased in a concentration-dependent manner compared to the high-fat diet group. In particular, compared to about 270 mg/dl of the high-fat diet group, the 500 mg administration group was about 170 mg/dl, indicating that the serum neutral fat density was reduced by about 63%.

Referring to FIG. 5, when oral administration of 100, 200, or 500 mg/kg/day of Chunma with a high-fat diet was performed, the density of neutral fat in the liver decreased in a concentration-dependent manner compared to the high-fat diet group. In particular, compared to about 590 mg/100mg protein in the high-fat diet group, the 200 and 500mg administration groups were about 300 mg/100mg protein, indicating that the density of neutral fat in the liver was reduced by about 50%.

Referring to FIG. 6, when 100, 200, or 500 mg/kg/day of Chunma was orally administered with a high-fat diet, the expression of the fat converting enzyme gene ACC (Acetyl-CoA Carboxylase) was suppressed compared to the high-fat diet group. Compared to 1.25 in the high-fat diet group, it was suppressed to about 1.1 in the 100mg administration group, and especially in the 200 and 500mg administration groups, it can be seen that the ACC expression is almost the same as or smaller than that of the control group.

Referring to FIG. 7, when oral administration of 100, 200, or 500 mg/kg/day of Chunma with a high-fat diet was suppressed, the expression of fat converting enzyme FAS (Fatty Acid Synthase) was suppressed compared to the high-fat diet group. Compared to 1.25 in the high-fat diet group, it was suppressed to about 1.1 in the 100 mg administration group, and in particular, in the 200 and 500 mg administration groups, it can be seen that the FAS expression is smaller than that of the control group.

6 and 7, the expression of the fat-converting enzyme gene is reduced due to administration of cheonma, which shows that the production of fat-converting enzyme is suppressed, and the anti-obesity effect of cheonma is biochemically clearly demonstrated. .

Example 1. Anti-Obesity Composition Containing Chunma Extract as an Active Ingredient

The composition according to the present invention contains the Chunma extract as an active ingredient.

Chunma extract has the effect of reducing body weight, liver weight and Epifat weight, and has the effect of reducing serum triglyceride and liver triglyceride, and also fat converting enzyme genes FAS (Fatty Acid Synthase) and ACC (Acetyl-CoA Carboxylase).

Based on the results of Experimental Example 1, a pharmaceutical unit containing 100 to 500 mg/kg/day of Chunma extract as an active ingredient and adding pharmaceutically acceptable carriers, excipients, or diluents based on oral administration to mice It is possible to provide an anti-obesity prevention agent formulated in a dosage form.

Here, the carrier, excipient, and diluent include toze, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, undecided quality cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

In addition, the pharmaceutical dosage form may be used in the form of a pharmaceutically acceptable salt, and may be used alone or in combination with other pharmaceutically active compounds as well as in a suitable set. In addition, when formulating the active ingredient, it may be prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. In addition, the pharmaceutical dosage form is formulated according to conventional methods into oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories, and sterile injection solutions. can

The solid preparation for oral administration may be prepared by mixing the extract with at least one excipient, for example, starch, calcium carbonate, sucrose or lactose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used.

Formulations for parenteral administration may include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, and injectable ester such as ethyl oleate may be used as the non-aqueous solvent or suspending agent.

As a base for the suppository, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogeratin and the like may be used.

A preferred dose of the extract of the present invention varies depending on the condition and weight of the patient, the severity of the disease, age, sex, drug type, administration route and period, but can be appropriately selected by those skilled in the art. Administration may be administered once a day, or may be administered in several divided doses. The dosage is not intended to limit the scope of the present invention in any way.

The extract of the present invention can be administered to mammals such as rats, mice, livestock, and humans through various routes. All modes of administration are contemplated, eg oral, rectal or intravenous, intramuscular or subcutaneous administration.

Example 2. Anti-obesity functional food or functional beverage composition containing cinnamon extract as an active ingredient

An anti-obesity health functional food composition or functional beverage can be provided by adding a food additive to the active ingredient of the present invention.

Foods to which the active ingredient can be added include, for example, various foods, beverages, chewing gum, tea, vitamin complexes, health functional foods, and the like.

The amount of the active ingredient in the food or beverage may be added in an amount of 0.01 to 20% by weight of the total weight of the food or beverage, and the health drink composition may be added in an amount of 0.02 to 5 g, preferably 0.3 to 1 g, based on 100 ml. there is.

The health functional beverage composition of the present invention is not particularly limited in other ingredients other than containing the extract, and may contain various flavoring agents or natural carbohydrates as additional ingredients like conventional beverages. Examples of the aforementioned natural carbohydrates include monosaccharides such as glucose, fructose; disaccharides such as maltose, sucrose and the like and polysaccharides such as dextrin, cyclodextrin and the like, and sugar alcohols such as xylitol, sorbitol and erythritol. In addition to the above, natural flavors (thaumatin, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.) and synthetic flavors (saccharin, aspartame, etc.) can be advantageously used as flavoring agents. The proportion of the natural carbohydrate is generally about 1 to 20 g, preferably about 5 to 12 g per 100 ml of the composition of the present invention.

In addition to the above, the composition of the present invention is various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, colorants and enhancers (cheese, chocolate, etc.), pectic acid and its salts, organic acids, protection It may contain a colloidal thickener, a pH adjusting agent, a stabilizer, a preservative, glycerin, alcohol, a carbonating agent used in carbonated beverages, and the like.

In addition, the composition of the present invention may contain fruit flesh for preparing natural fruit juice, fruit juice beverages, and vegetable beverages. These components may be used independently or in combination. The proportion of these additives is not critical, but is generally selected from the range of 0 to about 20 parts by weight per 100 parts by weight of the extract of the present invention.

So far, the present invention has been mainly looked at with respect to preferred embodiments.

The embodiments described in this specification and the configurations shown in the drawings relate to one of the most preferred embodiments of the present invention, and do not represent all of the technical spirit of the present invention, so various equivalents and modifications that can replace them It should be understood that there may be examples.

Therefore, the present invention is not limited to the presented embodiments, and within the equivalent scope of the technical idea of the present invention and the technical idea described in the claims to be described below by those skilled in the art to which the present invention belongs There may be embodiments in which various modifications and changes are possible.

Claims (6)

An anti-obesity composition containing cinnamon extract as an active ingredient. The method of claim 1,
The Chunma extract is an anti-obesity composition, characterized in that it contains 100 ~ 500 mg / kg / day based on oral administration of mice. The method of claim 1,
The Chunma extract has the effect of reducing weight gain, liver weight and Epifat weight, reducing serum triglyceride and liver triglyceride, and fat converting enzyme genes ACC (Acetyl-CoA Carboxylase) and FAS (Fatty Acid Synthase) Characterized in that it retains the efficacy of inhibiting the expression of, anti-obesity composition. An anti-obesity functional food comprising the composition according to claim 1. The method of claim 4,
The composition is an anti-obesity functional food, characterized in that it contains 100 ~ 500 mg / kg / day of Chunma extract based on oral administration to mice. An anti-obesity functional beverage comprising the composition according to claim 1.