KR102143243B1 - Composition for preventing, improving or treating arthritis comprising extract of Ganoderma lucidum, extract of Cirsium japonicum or mixture thereof - Google Patents

Abstract

The present invention relates to a composition for the prevention, improvement or treatment of arthritis comprising an extract, thistle extract, or a mixture thereof as an active ingredient, and more specifically, Mmp3, Mmp13 or Cox2 increased by IL-1β in chondrocytes. A pharmaceutical composition for preventing or treating arthritis and/or a pharmaceutical composition for preventing or improving arthritis, comprising as an active ingredient a deciduous reishi mushroom extract, thistle extract, or a mixture thereof, which exhibits an effect of inhibiting joint inflammation or cartilage destruction by reducing the mRNA or protein expression of It provides a health functional food composition for use.

Description

Composition for preventing, improving or treating arthritis comprising extract of Ganoderma lucidum, extract of Cirsium japonicum or mixture thereof, comprising as an active ingredient

The present invention relates to a composition for the prevention, improvement or treatment of arthritis comprising an extract, thistle extract, or a mixture thereof as an active ingredient, and more specifically, Mmp3, Mmp13 or Cox2 increased by IL-1β in chondrocytes. A pharmaceutical composition for preventing or treating arthritis and/or a pharmaceutical composition for preventing or improving arthritis, comprising as an active ingredient a deciduous reishi mushroom extract, thistle extract, or a mixture thereof, which exhibits an effect of inhibiting joint inflammation or cartilage destruction by reducing the mRNA or protein expression of It provides a health functional food composition for use.

Arthritis is largely divided into degenerative arthritis and rheumatoid arthritis. Degenerative arthritis is a disease that occurs mainly in middle or old age, and causes pain, stiffness and movement disorders in joints that receive a lot of weight, such as knee joints and hip joints. In the past, it was simply thought of as an aging phenomenon, but now it is thought that symptoms appear differently due to a combination of various causes such as age, genetic factors, obesity, joint shape, and hormones.

It is known that degenerative arthritis mainly involves the formation of chronic inflammation due to the gradual damage to the articular cartilage, and thus a process of degeneration of surrounding tissues. More specifically, when chronic inflammation occurs as transcription factors such as NF-kB and AP-1 are activated in cartilage tissue by accumulation of physical stress, factors that mediate and amplify the inflammatory response such as COX-2 and LOX are expressed. And the surrounding blood circulation is suppressed, and tissue destruction factors such as matrix metalloproteinases (MMPs), hyaluronidase, and iNOS are overexpressed to destroy cartilage tissue. , Tendons, ligaments, and other tissues are also affected, causing severe pain.

Rheumatoid arthritis is an inflammatory autoimmune disease that occurs in multiple joints. In the synovial tissue and synovial fluid of patients with rheumatoid arthritis symptoms, inflammatory cells (macrophages, T-cells, B cells, dendritic cells, etc.) act excessively, causing chronic inflammation, causing joint and cartilage damage, and pain. It is characterized by causing.

Until now, no treatment for arthritis has been developed, and non-steroidal anti-inflammatory drugs (NSAIDs) are generally used to relieve joint inflammation. However, since the NSAID series drugs have the main purpose of temporarily alleviating joint inflammation, the use of NSAID drugs is not suitable for degenerative arthritis, which is a non-inflammatory arthritis that requires promotion of cartilage formation and suppression of cartilage tissue destruction. Pritchard MH et al., Annals of the Rheumatic Diseases, 37:493-503, 1978). These nonsteroidal anti-inflammatory drugs (NSAIDs) are suitable for blocking the inflammatory mechanism as a therapeutic agent for rheumatoid arthritis, an inflammatory arthritis, but rather accelerate cartilage damage or have side effects such as cardiovascular, gastrointestinal, kidney, and liver.

In addition, the self-derived chondrocyte transplantation, which is currently developed for cartilage formation, is a method of generating supernatural bone by collecting cartilage and subchondral parts already generated from the normal part of the patient, digging an appropriate hole on the damaged cartilage part, and transplanting it. Although it has been successful in some patients, it cannot be a universal method as it can only be performed on patients with less cartilage tissue destruction and capable of autografting (Peterson L et al., J Bone Joint Surg Am. 85-A Suppl :17-24, 2003).

Therefore, the development of new drugs for the prevention, improvement or treatment of arthritis is still required, and among them, studies using natural products with little side effects are being conducted. Korean Patent Application Publication No. 10-2017-0111272 discloses a cosmetic composition comprising a fermented extract of reishi mushrooms, and Korean Patent Publication No. 10-2018-0074296 discloses a chocolate for preventing and improving obesity including a reishi mushroom extract and its A manufacturing method is disclosed, and Korean Patent Laid-Open No. 10-2018-0058160 discloses a thistle extract having antidiabetic activity and a method for manufacturing the same, and Korean Patent Laid-Open No. 10-2016-0139953 is an effective thistle flower extract. Disclosed is an anti-obesity composition containing as an ingredient. However, there is no known effect on the treatment of arthritis with the extracts of P. ganoderma lucidum, thistle extract, or mixtures thereof.

The inventors of the present invention confirmed that it is possible to suppress joint inflammation and cartilage destruction by reducing the mRNA or protein expression level of Mmp3, Mmp13, or Cox2 increased by IL-1β in chondrocytes, such as an extract, thistle extract, or a mixture thereof. By doing this, the present invention was completed.

An object of the present invention is Ganoderma lucidum ) extract, thistle ( Cirsium japonicum ) extract or a mixture thereof to provide a composition for preventing, improving or treating arthritis.

In order to solve the above-described problem, the present invention provides a pharmaceutical composition for preventing or treating arthritis, comprising an extract of Ganoderma lucidum , thistle ( Cirsium japonicum ) extract or a mixture thereof as an active ingredient.

In addition, the present invention, Ganoderma lucidum ) extract, thistle ( Artemisia princeps ) extract or a mixture thereof as an active ingredient to provide a health functional food composition for preventing or improving arthritis.

According to a preferred embodiment of the present invention, the extract of Pyeonggak Reishi mushroom is extracted from all parts except the medium of Pyeonggak Gyeongji mushroom, and the thistle extract may be extracted from a flower of thistle.

According to a preferred embodiment of the present invention, the Prunus Ganoderma lucidum extract or thistle extract is extracted by using water, C ₁ to C ₄ lower alcohol or a mixture thereof as a solvent, and the mixture is the Prunus Ganoderma lucidum extract and thistle It may be a mixture of extracts.

According to another preferred embodiment of the present invention, the mixture may be one obtained by mixing the Pyeonggak Reishi mushroom extract and thistle extract in a weight ratio of 1:1 to 1:20.

According to another preferred embodiment of the present invention, the arthritis may be degenerative arthritis or rheumatoid arthritis.

According to another preferred embodiment of the present invention, the composition may suppress joint inflammation or cartilage destruction by reducing the mRNA or protein expression of Mmp3, Mmp-13 or Cox2.

The composition comprising the Ganoderma lucidum extract, thistle ( Artemisia princeps ) extract, or a mixture thereof as an active ingredient of the present invention is the mRNA or protein expression of Mmp3, Mmp13 or Cox2 increased by IL-1β in chondrocytes. By reducing the effect of suppressing joint inflammation or cartilage destruction. Accordingly, the composition of the present invention is useful for preventing, ameliorating or treating arthritis, particularly degenerative arthritis.

1 is a result of confirming that the thistle flower extract does not show cytotoxicity to chondrocytes by treating the thistle flower extract at different concentrations (0, 10, 50, 100 or 200 μg/ml) to chondrocytes.
Figure 2 is a result of confirming that the Pyeongak Ganoderma lucidum extract is treated at different concentrations (0, 5, 10 or 50 μg/ml) to the chondrocytes, and the Prunus Ganoderma lucidum extract does not show cytotoxicity to the chondrocytes.
3A and 3B are results confirming that the expression of mRNA and protein of Mmp3, Mmp13 and Cox2, which induce joint destruction and inflammation in chondrocytes, is increased by IL-1β, but is decreased in a concentration-dependent manner by thistle flower extract. .
4 is a result of confirming that the mRNA expression of Mmp3, Mmp13, and Cox2, which induces joint destruction and inflammation in chondrocytes, is increased by IL-1β, but is decreased in a concentration-dependent manner by the extract of deciduous Ganoderma lucidum.
Figure 5 shows the mRNA expression of Mmp3, Mmp13 and Cox2 that induces joint destruction in chondrocytes is increased by IL-1β, but is reduced by a thistle flower extract or a mixture of a thistle flower extract and a deciduous ganoderma lucidum extract, especially thistle flower This is the result of confirming that the mixture of the extract and the P. ganoderma lucidum extract significantly decreased.

As described above, conventionally, non-steroidal anti-inflammatory drugs (NSAIDs) have been used for the purpose of relieving joint inflammation, but NSAID-based drugs have the main purpose of temporarily alleviating joint inflammation, so that it promotes cartilage formation and promotes cartilage. It is not suitable for degenerative arthritis, which is a non-inflammatory arthritis that requires tissue destruction, and the autologous chondrocyte transplantation developed for cartilage formation involves collecting the cartilage and subchondral parts already generated in the normal part of the patient together, and the damaged cartilage part. The method of generating supernatural bone by digging a suitable hole in the top and transplanting has been successful in some patients, but there was a problem that it could not be a universal method because it can only be performed on patients with less cartilage tissue destruction and capable of autografting. .

The present inventors have sought a solution to the above-described problem by providing a composition for preventing, improving or treating arthritis using an extract of P. ganoderma lucidum, thistle extract, or a mixture thereof. The composition comprising the extract, thistle extract, or a mixture thereof according to the present invention as an active ingredient reduces the expression level of mRNA or protein of Mmp3, Mmp13 or Cox2 increased by IL-1β in chondrocytes, thereby reducing joint inflammation and cartilage. Destruction can be suppressed. Accordingly, the composition of the present invention is useful for preventing, ameliorating or treating arthritis, particularly degenerative arthritis.

Terms used in the present invention are defined as follows.

The term “pharmaceutical composition” refers to a mixture of Ganoderma lucidum extract, thistle ( Artemisia princeps ) extract or mixtures thereof with other chemical components such as a diluent or carrier.

The term “carrier” is defined as a compound that facilitates the addition of the compound into a cell or tissue. For example, dimethyl sulfoxide (DMSO) is a commonly used carrier that facilitates the introduction of many organic compounds into a cell or tissue of an organism.

The term “diluent” is defined as a compound that is diluted in water that will dissolve the compound as well as stabilize the biologically active form of the subject compound. Salts dissolved in buffer solutions are used as diluents in the art. A commonly used buffer solution is phosphate buffered saline, because it mimics the salt state of human solutions. Because buffer salts can control the pH of the solution at low concentrations, buffer diluents rarely modify the biological activity of the compound.

The term “treatment” refers to an approach to obtaining beneficial or desirable clinical outcomes. For the purposes of the present invention, beneficial or desirable clinical outcomes include, but are not limited to, alleviation of symptoms, reduction of disease range, stabilization of disease state (i.e., not exacerbation), delay or decrease in disease progression, disease state. Amelioration or temporal alleviation and alleviation of (partially or entirely), detectable or undetectable. In addition, “treatment” may mean increasing the survival rate compared to the expected survival rate when not receiving treatment. “Treatment” refers to both therapeutic treatment and prophylactic or preventative measures. These treatments include the disorder to be prevented as well as the treatment required for a disorder that has already occurred. “Alleviating” the disease is a reduction in the extent of the condition and/or undesirable clinical signs and/or a delayed or prolonged time course of progression compared to untreated. Means to lose.

“Synergistic” means that the effect that occurs when each component is administered in combination (combination) is greater than the sum of the effects that occur when administered alone as a single component [Chou and Talalay, Adv. Enzyme. Regul., 22:27-55, 1984]. The mixture of the extract of P. ganoderma lucidum and thistle flower extract of the present invention exhibits a synergistic effect in reducing the mRNA or protein expression of Mmp3, Mmp13 or Cox2.

All technical terms used in the present invention, unless defined otherwise, are used in the sense as commonly understood by those skilled in the art in the relevant field of the present invention. In addition, although preferred methods or samples are described in the present specification, those similar or equivalent are included in the scope of the present invention.

Hereinafter, the present invention will be described in more detail.

The present invention is Ganoderma ( Ganoderma) lucidum ) extract, thistle ( Artemisia princeps ) provides a pharmaceutical composition for the prevention or treatment of arthritis comprising an extract or a mixture thereof as an active ingredient.

Ganoderma lucidum (Fr) is a mushroom that has been used as a rare medicinal material in Korea, China, and Japan, and is widely distributed worldwide in tropical, subtropical and temperate regions. says karst. In addition to polysaccharides, reishi mushrooms contain various substances such as triterpenes, nucleosides, steroids, fatty acids, alkaloids, proteins, amino acids, and inorganic salts, among which high molecular substances (polysaccharides, etc.) and low molecular substances (triterpenes, etc.) are various. Do. Low-molecular substances have anti-inflammatory, antioxidant, hepatocellular protection, anti-hypertension, cholesterol lowering, and platelet aggregation inhibition, and high molecular substances have reported effects such as lowering blood pressure, blood stasis, improving hyperlipidemia, lowering blood sugar, immunity, and anti-tumor. Became. In particular, the main secondary metabolites having physiological activity and pharmacological function of Ganoderma lucidum are polysaccharides and triterpenes, and various medicinal effects and active ingredients related to these substances have been scientifically identified.

Ganoderma lucidum mushrooms are largely divided into flat and green squares. Ganodermalucidum is the same as Ganodermalucidum, but the physiologically active substances and physiological efficacy are different. Antler-shaped Ganoderma lucidum is a type of Ganoderma lucidum mushroom that grows naturally on the stump of a broad-leaved tree in the shape of an antler shape. It is not easily found in nature and is highly evaluated medically in China and Japan. In Korea, nogak ganoderma lucidum has a high yield but poor marketability, so it has been cultivated a lot in the early 1980s, the early stage of cultivation of ganoderma lucidum, but has not been cultivated thereafter, but is recently cultivated in some farms for ornamental and processed products. However, it has recently been reported that P. ganoderma lucidum mushrooms contain higher amounts of beta-D-glucan and triterpenoids than prunus ganoderma lucidum mushrooms, and have a stronger physiological activity in enhancing immunity and suppressing tumors. Kidney-shaped Ganoderma lucidum refers to Ganoderma lucidum mushrooms that grow naturally on broad-leaved tree stumps that have a flat shape without a sack. Generally, Ganoderma lucidum on the market are Pyeonggak Ganoderma mushrooms. The pharmaceutical composition of the present invention was used in all parts except the medium of Pyeonggak Reishi mushroom.

Thistle ( Cirsium japonicum ) is a perennial plant of the Asteraceae family, and the soft plants and young shoots are eaten as herbs and mature roots are used as medicine. The drug has remarkable hemostatic action and is used for urine bleeding, fecal bleeding, nosebleeding, uterine bleeding, and traumatic bleeding. The thistle extract used in the present invention may be prepared from thistle outpost as a raw material, and preferably may be prepared from a flower part.

Pyeongak ganoderma lucidum mushrooms and thistles used in the present invention may be purchased and used commercially, or may be directly harvested or cultivated in nature.

The term "extract" of the present invention refers to an extract obtained by the extraction treatment of the P. ganoderma lucidum mushroom or thistle flower, a dilution or pesticide solution of the extract, a dried product obtained by drying the extract, a preparation or purified product of the extract, or these It includes the extract of all formulations that can be formed using the extract itself and the extract, such as a mixture of the extract. Specifically, the extract of the present invention may be prepared and used in a dry powder form after extraction.

In the present invention, the type of the extraction solvent used to extract P. ganoderma lucidum mushroom and thistle flower is not particularly limited, and any solvent known in the art may be used. Non-limiting examples of the extraction solvent include water; C ₁ to C ₄ lower alcohols such as methanol, ethanol, propyl alcohol and butyl alcohol; Polyhydric alcohols such as glycerin, butylene glycol, and propylene glycol; And hydrocarbon-based solvents such as methyl acetate, ethyl acetate, acetone, benzene, hexane, diethyl ether, and dichloromethane; Alternatively, a mixture thereof may be used, and water, a C ₁ to C ₄ lower alcohol or a mixture thereof is preferably used as a solvent, and the lower alcohol is preferably ethanol, methanol or butanol.

It is preferable that the Pyeonggak Reishi mushroom extract and thistle flower extract are prepared by a manufacturing method including the following steps, but are not limited thereto:

1) extracting by adding an extraction solvent to the P. ganoderma lucidum mushroom or thistle flower;

2) filtering the extract of step 1); And

3) A step of drying after concentrating the filtered extract of step 2) under reduced pressure.

In the above method, as the extraction method in step 1), conventional methods in the art such as filtration, hot water extraction, immersion extraction, reflux cooling extraction, and ultrasonic extraction may be used. The extraction process may be performed at, for example, 50°C to 150°C, or 75°C to 120°C, or 90°C to 110°C, but is not limited thereto. In addition, the extraction time is not particularly limited, but may be 10 minutes to 12 hours, or 30 minutes to 6 hours, or 2 hours to 4 hours.

In the above method, the vacuum concentration in step 3) is preferably a vacuum vacuum concentrator or a vacuum rotary evaporator, but is not limited thereto. In addition, the drying is preferably vacuum drying, vacuum drying, boiling drying, spray drying, or freeze drying, but is not limited thereto.

In the pharmaceutical composition of the present invention, the mixture is a mixture of a single extract and thistle flower extract, and the extract and thistle flower extract may be mixed in a weight ratio of 1:1 to 1:20. , Preferably 1:2 to 1:10, more preferably 1:2 or more and less than 1:10 may be mixed in a weight ratio. When mixing at a weight ratio outside the above range, the synergistic effect of the mixture decreases, and the optimum activity cannot be exhibited.

In the pharmaceutical composition of the present invention, the arthritis may be degenerative arthritis or rheumatoid arthritis, preferably degenerative arthritis.

The degenerative arthritis refers to arthritis caused by degenerative changes in cartilage and surrounding bones in a synovial joint. In other words, degenerative arthritis is characterized by gradual loss of articular cartilage, as well as enlargement of bone located below the cartilage, bone formation at the edge of the joint, and non-specific synovial inflammation, and aging or excessive physical pressure (e.g., obesity, It is a disease caused by damage to cartilage due to trauma). Therefore, degenerative arthritis shows severe pain and movement disorders in joints that receive a lot of weight, ie, knee (knee) joints, hip (hip) joints, etc., and when left unattended for a long period of time, even joint deformation is caused.

Mmp3, Mmp13, or Cox2 mRNA increased by IL-1β, a cytokine associated with degenerative arthritis, as shown in Figs. 3 to 5, as shown in Figs. Or by reducing protein expression, joint inflammation or cartilage destruction is suppressed. Particularly, a mixture of P. reishi mushroom extract and thistle flower extract at a specific weight ratio exhibits a synergy effect on reducing the mRNA or protein expression of Mmp3, Mmp13, or Cox2. Therefore, the pharmaceutical composition of the present invention is useful for preventing, ameliorating or treating degenerative arthritis induced by IL-1β.

The pharmaceutical composition of the present invention may further include suitable carriers, excipients, and diluents commonly used in the preparation of pharmaceutical compositions.

The pharmaceutical composition according to the present invention is formulated in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, etc., external preparations, suppositories, and sterile injectable solutions, respectively, according to a conventional method. Can be used.

Carriers, excipients, and diluents that may be contained in the pharmaceutical composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate. , Gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oils.

When formulating the pharmaceutical composition of the present invention, it is prepared using diluents or excipients such as generally used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient for the compound, such as starch, calcium carbonate, sucrose or lactose. , Gelatin, etc. are mixed to prepare it. In addition, lubricants such as magnesium stearate and talc are used in addition to simple excipients. Liquid preparations for oral use include suspensions, liquid solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweetening agents, fragrances, and preservatives may be included. .

Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate. As a base for suppositories, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogelatin, and the like may be used.

The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount.

In the present invention, the term "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is the type and severity of the individual, age, sex, progression of the disease The degree, activity of the drug, sensitivity to the drug, time of administration, route of administration and rate of excretion, duration of treatment, factors including drugs used concurrently, and other factors well known in the medical field. The composition of the present invention may be administered as an individual therapeutic agent or administered in combination with other therapeutic agents, and may be administered sequentially or simultaneously with a conventional therapeutic agent. And it can be administered single or multiple.

The composition may be administered to mammals such as mice, mice, livestock, and humans by various routes. All modes of administration can be expected and can be administered, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine dural or cerebrovascular injection.

In addition, the present invention, Ganoderma lucidum ) extract, thistle ( Artemisia princeps ) It provides a health functional food composition for preventing or improving arthritis comprising an extract or a mixture thereof as an active ingredient.

In the health functional food composition, since the description of the Pyeonggak Ganoderma lucidum extract, thistle extract, or a mixture thereof is the same as described above, the description thereof will be omitted in order to avoid excessive complexity of the present specification due to redundant description.

Likewise, since the description of arthritis in the health functional food composition is the same as described above, the description thereof will be omitted in order to avoid excessive complexity of the present specification due to redundant description.

In the present invention, the term "health functional food" refers to a food manufactured and processed using raw materials or ingredients having useful functions for the human body according to the Health Functional Food Act No.6727, and nutrients for the structure and function of the human body It means ingestion for the purpose of controlling or obtaining useful effects for health purposes such as physiological effects.

The health functional food of the present invention may contain ordinary food additives, and whether it is suitable as a food additive is determined according to the general rules and general test methods of food additives approved by the Food and Drug Administration, unless otherwise specified. It is judged according to the standards and standards.

Examples of the items listed in the "Food Additives Code" include chemical compounds such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamic acid; Natural additives such as reduced pigment, licorice extract, crystalline cellulose, high color pigment, and guar gum; Mixed preparations, such as a sodium L-glutamate preparation, an alkali additive for noodles, a preservative preparation, and a tar color preparation, etc. are mentioned.

The health functional food composition of the present invention may contain various flavoring agents or natural carbohydrates as an additional component, like a conventional food composition.

Examples of the above-described natural carbohydrates include monosaccharides such as glucose, fructose, and the like; Disaccharides such as maltose, sucrose, etc.; And polysaccharides, for example, conventional sugars such as dextrin, cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. The above-described flavoring agent may advantageously be used a natural flavoring agent (taumatin), a stevia extract (eg, rebaudioside A, glycyrrhizin, etc.) and a synthetic flavoring agent (saccharin, aspartame, etc.).

The health functional food composition of the present invention may be formulated in the same manner as the pharmaceutical composition and used as a functional food or added to various foods. Foods to which the composition of the present invention can be added include, for example, beverages, meat, chocolate, foods, confectionery, pizza, ramen, other noodles, gum, candy, ice cream, alcoholic beverages, vitamin complexes and health supplements, etc. There is this.

For example, in the health functional food in the form of a tablet, a mixture obtained by mixing the active ingredient of the present invention with an excipient, a binder, a disintegrant, and other additives is granulated by a conventional method, and then a lubricant, etc. The mixture can be directly compression molded. In addition, the health functional food in the form of a tablet may contain a mating agent or the like if necessary.

Among the health functional foods in the form of capsules, hard capsules can be prepared by filling a conventional hard capsule with a mixture of the extract, which is the active ingredient of the present invention, with additives such as excipients, and the soft capsules contain the active ingredient with additives such as excipients. The mixed mixture can be prepared by filling a capsule base such as gelatin. The soft capsules may contain plasticizers such as glycerin or sorbitol, colorants, preservatives, and the like, if necessary.

The cyclic health functional food can be prepared by molding a mixture of the active ingredient of the present invention, a mixture of herbal extracts, excipients, binders, disintegrants, etc., by conventionally known methods. It can be stripped, or the surface can be coated with a material such as starch or talc.

The health functional food in the form of granules can be prepared in granular form by a mixture of the mixed herbal medicine extract, the active ingredient of the present invention, excipients, binders, disintegrants, etc., by a conventionally known method, and if necessary, flavoring agents and flavoring agents. And the like.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as limited by these examples.

Preparation of Thistle and Pleurotus erysipelas Mushroom Extract

1-1. Preparation of thistle flower extract

Harvested Thistle ( Cirsium japonicum ) flowers were washed with water and lyophilized with a freeze dryer (Martin Christ, Osterode, Germany). The lyophilized sample was pulverized and extracted with 99% ethanol (EtOH) by repeating three times for 24 hours at room temperature. The extract was filtered using filter paper (No. 4), and the filtered extract was concentrated under reduced pressure at 45°C with a rotary vacuum concentrator (Heidolph, Germanay). The concentrate was obtained in powder form after lyophilization.

1-2. Preparation of Pyeongak Reishi Mushroom Extract

Purchasing a commercially available Pyeonggak Reishi mushroom was powdered, except for the medium, and then extracted indoors for 24 hours with water (repeat twice), filtered with filter paper, and freeze-dried with a freeze dryer to powder .

Measurement of Chondrocyte Toxicity by Extract of Thistle Flower or Pleurotus erythema

2-1. Measurement of chondrocyte toxicity by thistle flower extract

Chondrocytes were obtained from cartilage tissue derived from femoral heads, femoral condyles, and tibial plateaus of a 5-day-old normal mouse (Central Experimental Animal Co., Ltd.). The obtained chondrocytes were 10% (v/v) fetal bovine serum (Gibco, USA), 50 μg/ml of streptomycin (Sigma-Aldrich, USA) and 50 unit/ml penicillin (Sigma-Aldrich, USA). ) Was cultured in DMEM medium (Gibco, USA) containing.

In order to confirm that the thistle flower extract does not show toxicity to chondrocytes, chondrocytes were cultured in a 96-well culture vessel on a 9×10 ³ cell/well basis, and then the thistle flower extract was 0, 10, 50, 100 and 200. Each treatment was performed at a concentration of μg/ml and incubated in an incubator at 37° C. and 5% CO ₂ for 24 hours. The toxicity of thistle flower extract to chondrocytes was confirmed by measuring absorbance at 450 nm using an EZ-Cytox cell survival assay kit (Dozen, Korea).

As a result, as shown in Fig. 1, the thistle flower extract did not show cytotoxicity to chondrocytes at all concentrations of 10, 50, and 100 μg/ml, and it was confirmed that it did not negatively affect chondrocyte proliferation.

2-2. Measurement of Chondrocyte Toxicity by Extract of Prunus Ganoderma lucidum Mushroom

Chondrocyte toxicity was measured in the same manner as in Example 2-1, except that the concentrations of the chondrocytes treated P. ganoderma lucidum extract were 5, 10, and 50 μg/ml, respectively.

As shown in FIG. 2, it was confirmed that the P. ganoderma lucidum extract did not show cytotoxicity to chondrocytes at all concentrations of 5, 10 and 50 μg/ml, and did not negatively affect chondrocyte proliferation.

Checking the effect of thistle flower extract to inhibit joint inflammation and cartilage destruction

3-1. Confirmation of the inhibitory effect of Mmp3, Mmp13 and Cox2 on transcription levels

IL-1β is a representative inflammatory cytokine that promotes joint inflammation and cartilage tissue destruction in chondrocytes. In order to confirm the effect of inhibiting joint inflammation and cartilage destruction, the chondrocytes obtained in Example 2-1 were treated with 1 ng/ml of IL-1β (GeneScript, USA) and cultured for 36 hours, and then thistle flower extract was Each was treated with 0, 10, 50, and 100 μg/ml and cultured for an additional 24 hours. Chondrocytes not treated with anything were used as a control (Con).

Then, to perform qRT-PCR, RNA was extracted from chondrocytes using TRI reagent (Molecular Research Center Inc.), and cDNA obtained by reverse transcription of the RNA was used as SEQ ID NOs: 1, 2, 3, and Using the primers of 4, 5 and 6, PCR amplified under the annealing temperature of 58°C to confirm the expression of Mmp3 and Mmp13, which are important for cartilage destruction, and the expression of Cox2, which is involved in arthritis. As a control, Gapdh (450bp, annealing temperature 58°C) was confirmed with the primers of SEQ ID NOs: 7 and 8 shown in Table 1 below.

Sequence number Sequence (5'-3') sense/
Antisense gene Size (bp) Annealing temperature
(AT, ℃) One TCCTGATGTTGGTGGCTTCAG S Mmp3
102
58
2 TGTCTTGGCAAATCCGGTGTA AS 3 TGATGGACCTTCTGGTCTTCTGG S Mmp13
473
58
4 CATCCACATGGTTGGGAAGTTCT AS 5 GGTCTGGTGCCTGGTCTGATGAT S Cox2 724 58 6 GTCCTTTCAAGGAGAATGGTGC AS 7 TCACTGCCACCCAGAAGAC S Gapdh 450 58 8 TGTAGGCCATGAGGTCCAC AS

As a result, as shown in Fig. 3A, it was confirmed that the transcriptional expression of Mmp3, Mmp13 and Cox2 increased by IL-1β in chondrocytes was suppressed in a concentration-dependent manner by thistle flower extract.

3-2. Confirmation of the effect of Mmp, Mmp13 or Cox2 on inhibiting protein expression levels

The degree of protein expression of Mmp3, Mmp13 and Cox2 by treating the chondrocytes obtained in Example 2-1 with 1 ng/ml of IL-1β and thistle flower extract for 0, 10, 50 and 100 μg/ml, respectively, for 24 hours Was confirmed. Chondrocytes not treated with anything were used as a control (Con).

The secreted proteins Mmp3 and Mmp13 were reacted with 900 µl of a serum-free conditioned medium with 100 µl trichloroacetic acid (TCA) and then reacted at 0°C for 20 minutes. Then, the supernatant was removed through a centrifuge at 12,000 rpm and 4° C. for 10 minutes, and reacted with 500 μl of cold 100% acetone at 20° C. for 1 hour. 100% acetone and the reacting sample was removed by centrifugation, and the protein was finally precipitated and detected. Western blotting and Western blotting using anti-Mmp3 antibody (Abcam) and anti-Mmp13 antibody (Abcam) The band thickness and concentration were measured using a computer program, and their relative values were expressed with a densitometer.

In addition, Cox2 elutes the cells from chondrocytes using RIPA buffer, and then detects the protein in the supernatant through a centrifuge at 12,000 rpm for 10 minutes at 4° C., and western blotting using an anti-Cox2 antibody (Abcam). And Western blot bands were confirmed with a densitometer.

As a result, as shown in FIG. 3B, it was confirmed that the protein expression of Mmp3, Mmp13 and Cox2 increased by IL-1β in chondrocytes was decreased in a concentration-dependent manner by thistle flower extract. This indicates that joint and cartilage tissue destruction can be alleviated or suppressed by thistle flower extract.

Confirmation of the effect of suppressing joint inflammation and cartilage destruction by the extract of P.

Except that the concentration of IL-1β treated on chondrocytes is 5 ng/ml, and the concentrations of the Prunus Ganoderma lucidum extract are 5, 10 and 50 μg/ml, respectively, in the same manner as in Example 3-1. The effect of inhibiting the transcription level of Mmp3 and Mmp13 by mushroom extract was confirmed.

As can be seen in Figure 4, it was confirmed that the transcriptional expression of Mmp3 and Mmp13 increased by IL-1β in chondrocytes was suppressed in a concentration-dependent manner by the extract of P.

Thistle flower extract and Pyeongak Reishi Mushroom Confirmation of inhibition of joint inflammation and cartilage destruction by mixture of extracts

The above implementation, except that the concentration of IL-1β treated on chondrocytes was 1 ng/ml, and 100 μg/ml of thistle flower extract and 0, 10 or 50 μg/ml of P. In the same manner as in Example 3-1, the effect of inhibiting transcription levels of Mmp3, Mmp13, and Cox2 by a mixture of thistle flower extract and P. ganoderma lucidum extract was confirmed.

As a result, as shown in FIG. 5, it was confirmed that the effect of inhibiting the transcription level of Mmp3, Mmp13, and Cox2 by the mixture of the thistle flower extract and the P. ganoderma lucidum extract was significantly superior to the inhibitory effect of each single extract.

Statistical analysis

The results of all examples of the present invention were analyzed using non-parametric statistical methods as data quantified based on an ordinal rating system such as Mankin score. QRT-PCR data expressed as relative fold changes are first checked for the normal distribution using the Shapiro-wilk test, followed by pair-wisecomparisons and multi-comparisons. ), ANOVA (analysis of variance) including Student's t test and post hoc test was used, respectively. Statistical significance was accepted as a probability of 0.05 level (P <0.05).

As described above, specific parts of the present invention have been described in detail, and it will be apparent to those of ordinary skill in the art that these specific techniques are only preferred embodiments, and the scope of the present invention is not limited thereby. will be. Therefore, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> REPUBLIC OF KOREA(MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Composition for preventing, improving or treating arthritis comprising extract of Ganoderma lucidum, extract of Cirsium japonicum or mixture thereof <130> 1064324 <160> 8 <170> KopatentIn 2.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Mmp3 primer(sense) <400> 1 tcctgatgtt ggtggcttca g 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Mmp3 primer (antisense) <400> 2 tgtcttggca aatccggtgt a 21 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Mmp13 primer(sense) <400> 3 tgatggacct tctggtcttc tgg 23 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Mmp13 primer (antisense) <400> 4 catccacatg gttgggaagt tct 23 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Cox2 primer(sense) <400> 5 ggtctggtgc ctggtctgat gat 23 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Cox2 primer (antisense) <400> 6 gtcctttcaa ggagaatggt gc 22 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Gapdh primer(sense) <400> 7 tcactgccac ccagaagac 19 <210> 8 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Gapdh primer (antisense) <400> 8 tgtaggccat gaggtccac 19

Claims (10)

Ganoderma lucidum ( Ganoderma lucidum ) extract and thistle ( Cirsium japonicum ) extract 1: 2 to 1: A pharmaceutical composition for the prevention or treatment of arthritis comprising a complex extract mixed in a weight ratio of 1: 10 as an active ingredient. The method according to claim 1, wherein the Prunus Ganoderma lucidum extract or thistle extract is extracted using water, C ₁ to C ₄ lower alcohol or a mixture thereof as a solvent, and the mixture is a mixture of the Prunus Ganoderma lucidum extract and thistle extract. A pharmaceutical composition for preventing or treating arthritis, characterized in that. delete The pharmaceutical composition for preventing or treating arthritis according to claim 1, wherein the arthritis is degenerative arthritis or rheumatoid arthritis. The pharmaceutical composition for preventing or treating arthritis according to claim 1, wherein the composition inhibits joint inflammation or cartilage destruction by reducing the mRNA or protein expression of Mmp3, Mmp13 or Cox2. Ganoderma lucidum ( Ganoderma lucidum ) extract and thistle ( Cirsium japonicum ) extract 1: 2 to 1: A health functional food composition for preventing or improving arthritis, comprising a complex extract obtained by mixing in a weight ratio of 1: 2 to 1: 10. The method according to claim 6, wherein the Prunus Ganoderma lucidum extract or thistle extract is extracted using water, C ₁ to C ₄ lower alcohol or a mixture thereof as a solvent, and the mixture is a mixture of the Prunus Ganoderma lucidum extract and thistle extract. Health functional food composition for preventing or improving arthritis, characterized in that. delete The health functional food composition for preventing or improving arthritis according to claim 6, wherein the arthritis is degenerative arthritis or rheumatoid arthritis. The health functional food composition for preventing or improving arthritis according to claim 6, wherein the composition suppresses joint inflammation or cartilage destruction by reducing the mRNA or protein expression of Mmp3, Mmp13 or Cox2.

Images