KR20230076301A - Multiplex pcr primer set for individualization in cat and method using the same - Google Patents

Abstract

The present invention relates to a multiplex PCR primer set for cat identification using genetic markers and its use, and specifically to FCA740, F124, FCA391, F53, F37, FCA738, FCA732, F42, F141, FCA742, FCA441, F85, It relates to a multiplex PCR primer set for identifying a feline individual capable of selectively amplifying FCA749 and SRY markers, a kit including the same, and an individual identification method using the same.

Description

Multiplex PCR primer set for individual identification of cat and method for identifying individual cat using the same {MULTIPLEX PCR PRIMER SET FOR INDIVIDUALIZATION IN CAT AND METHOD USING THE SAME}

The present invention relates to a multiplex PCR primer set for identifying feline individuals using genetic markers and uses thereof.

Cat ( Felis catus ) is one of the most common companion animals in Korea, and its population is gradually increasing. According to the 2020 National Awareness Survey on Animal Protection conducted by the Ministry of Agriculture, Food and Rural Affairs of the Republic of Korea, 2.58 million cats are raised as companion animals, and it is estimated that the number will increase further if non-responders and stray cats are added. As the number of cats increases, the amount of cat-derived biological evidence used in domestic forensic science is also increasing. Such biological evidence is not only direct evidence of animal cruelty, poaching, and human injury cases, but also a silent suspect that connects suspects and crime scenes. Since it also plays a role, the need for entity identification is on the rise. In addition, as the demand for analysis of cat theft accidents increases, the need for cat individual identification is emerging, and a cat identification method that can be used for quick and convenient forensic analysis is required.

Short tandem repeat (STR) markers have individual polymorphisms and high mutation rates, so they are used as an optimal standard for individual identification in the forensic science field, and are used for individual identification not only in humans but also in animals. In 2007, ISAG (International Society for Animal Genetics) proposed nine key STR markers for cats, but eight of these markers are di-nucleotide repeats that are not recommended for analysis due to interpretation difficulties, and only one There is a limit to this tetra-nucleotide STR (tetra-nucleotide STR). Loci with dinucleotide motifs are known to increase stutter products and heterozygous allelic imbalance, so their use is not recommended when forensic analysis is required. In addition, there is a limitation in that markers showing high mutation rates were derived from cats in the United States, Europe, and Brazil, and there is a problem in that it is difficult to apply them as they are in Korea. Until now, the progress of population genetic analysis and forensic individual identification research on cats, especially on cats living in Korea, is still at an insignificant level.

Multiplex PCR (hereinafter referred to as multiplex PCR) is a method of simultaneously amplifying multiple genes to be identified in a single tube and analyzing the results, and analyzing multiple genes simultaneously in one experiment. This has the advantage of reducing the time and cost required for analysis. However, due to problems such as interference between mixed primers and formation of dimers, the amplification efficiency of the target sequence may be lowered or non-specific amplification products may be obtained, which may make it difficult to read the result, so design the primers carefully. shall. In addition, the amplification efficiency for each amplification product should be similar, the amplified products should have different sizes so that they can be distinguished on the gel when designing primers, and at the same time, the peak balance should be considered during capillary electrophoresis analysis. In general, multiplex PCR accuracy improves as the number of target sequences to be amplified increases, but the difficulty of primer design also increases due to the above-mentioned problems.

M.J. Lipinski, Y. Amigues, M. Blasi, T.E. Broad, C. Cherbonnel, G.J. Cho, S. Corley, P. Daftari, D.R. Delattre, S. Dileanis, J.M. Flynn, An international parentage and identification panel for the domestic cat (Felis catus). Anim. Genet. 38 (2007) 371-377.

An object of the present invention is to provide a primer set for multiplex PCR capable of identifying a cat's individual.

In addition, another object is to provide a composition and kit for individual identification of a cat, including the primer set for multiplex PCR.

In addition, another object is to provide a method for individual identification of cats using the primer set for multiplex PCR.

According to one aspect of the present invention, a first primer set comprising the sequences represented by SEQ ID NO: 1 and SEQ ID NO: 2; a second primer set comprising the sequences represented by SEQ ID NO: 3 and SEQ ID NO: 4; a third primer set comprising the sequences represented by SEQ ID NO: 5 and SEQ ID NO: 6; a fourth primer set comprising the sequences represented by SEQ ID NO: 7 and SEQ ID NO: 8; a fifth primer set comprising the sequences represented by SEQ ID NO: 9 and SEQ ID NO: 10; A sixth primer set comprising the sequences represented by SEQ ID NO: 11 and SEQ ID NO: 12; a seventh primer set comprising the sequences represented by SEQ ID NO: 13 and SEQ ID NO: 14; an eighth primer set comprising the sequences represented by SEQ ID NO: 15 and SEQ ID NO: 16; a ninth primer set comprising the sequences represented by SEQ ID NO: 17 and SEQ ID NO: 18; A tenth primer set comprising the sequences represented by SEQ ID NO: 19 and SEQ ID NO: 20; An 11th primer set comprising the sequences represented by SEQ ID NO: 21 and SEQ ID NO: 22; a twelfth primer set comprising the sequences represented by SEQ ID NO: 23 and SEQ ID NO: 24; a thirteenth primer set comprising the sequences represented by SEQ ID NO: 25 and SEQ ID NO: 26; and a 14th primer set comprising the sequences represented by SEQ ID NO: 27 and SEQ ID NO: 28; a primer set composition for multiplex PCR for individual identification of cats is provided.

In addition, the first to fourteenth primer sets are sequentially based on molarity: 1:0.6 to 0.9:3.5 to 4.5:0.1 to 0.4:0.5 to 0.8:3 to 3.5:0.5 to 0.8:0.6 to 0.9:1 to 1.3: It can be mixed in a ratio of 1 to 1.5:0.7 to 1:1 to 1.5:1 to 1.3:1 to 1.3.

In addition, at least one of the sequences included in each primer set in the first to fourteenth primer sets is labeled with a fluorescent marker, and the labeled sequence included in the first to third primer sets is labeled with a first fluorescent marker. and the labeled sequence included in the fourth to eighth primer sets is labeled with a second fluorescent marker, and the labeled sequence included in the ninth to eleventh primer sets is labeled with a third fluorescent marker, The labeled sequence included in the 12th to 14th primer sets may be labeled with a fourth fluorescent marker.

In addition, the primer set composition for the multiplex PCR may be cat ( Felis catus ) species specific.

According to another aspect of the present invention, a kit for individual identification of a cat comprising the primer set composition for multiplex PCR is provided.

According to another aspect of the present invention, isolating a nucleic acid molecule from the identified subject; performing multiplex PCR using the nucleic acid molecule as a template and using the primer set composition for multiplex PCR and obtaining an amplification product; and subjecting the amplification product to electrophoresis or capillary electrophoresis.

The primer set composition for multiplex PCR according to one aspect of the present invention has excellent specificity for cat species and accuracy for identifying cat individuals, has a remarkably low appearance rate of the same individual, and excellent accuracy even using a low concentration of DNA sample. It has the advantage of being able to identify objects as Therefore, it can be particularly useful in forensic science cases where DNA samples of various species are mixed and low-quality and low-concentration DNA samples are analyzed.

In addition, since peak balance is excellent during capillary electrophoresis, genotyping results are easy to interpret and accuracy is excellent.

The primer set composition for multiplex PCR according to one aspect of the present invention has excellent individual discrimination even for the Korean shorthair, which is a native cat breed in Korea, so the analysis accuracy is very excellent when identifying individuals for domestic cats. It is particularly suitable for application in forensic science cases.

Figure 1 shows the results of confirming the fluorescent labeling and size range of amplification products using a multiplex PCR system according to an aspect of the present invention for 301 domestic cats,
Figure 2 is a chromatogram result of multiplex PCR products amplified in two domestic cats of different sexes,
Figure 3 is the result of confirming the species specificity of the multiplex PCR system according to one aspect of the present invention,
4 is a chromatogram result for a wild animal of a multiplex PCR system according to an aspect of the present invention;
5 is a result of confirming the DNA concentration sensitivity of the multiplex PCR system according to an aspect of the present invention in 4% agarose gel electrophoresis and chromatogram.

The present invention relates to a primer set for multiplex PCR capable of selectively amplifying genetic markers for individual identification of cats, a kit including the same, and an individual identification method using the same.

Hereinafter, the present invention will be described in more detail.

Unless otherwise defined, technical and scientific terms used in this specification may be interpreted as meanings commonly understood by those of ordinary skill in the art to which this invention belongs. Also, singular expressions include plural expressions unless the context clearly dictates otherwise. In addition, terms such as 'comprise' or 'having' are intended to designate that the features, numbers, steps, components, or combinations thereof described in the specification exist, but one or more other features, numbers, steps, or components. It should not be construed as excluding the possibility of the presence or addition of elements or combinations thereof.

The term polymorphism used in the present invention refers to the case where two or more alleles exist in one locus, and includes single nucleotide polymorphism (SNP), short tandem repeat (STR) and variable Includes variable number tandem repeat (VNTR).

The term primer used in the present invention is a short gene sequence for DNA amplification, and refers to a sequence synthesized for the purpose of binding to a complementary gene sequence and amplifying the sequence through a PCR reaction. It is used as a pair of forward and reverse primers, and when performing PCR, a primer set including a pair of primers may be used, or a primer set including multiple pairs of primers may be used. .

The term multiplex PCR used in the present invention refers to a PCR technique that simultaneously amplifies several genes, unlike single PCR that amplifies one gene for one template DNA. In multiplex PCR, multiple primer pairs are included in a single PCR mixture, and at this time, it is preferable to indicate the size ranges of amplification products specific to each different DNA sequence so that the sizes do not overlap with each other. In multiplex PCR, since several types of different primer sets are put into one tube and reacted, interference and inhibition between primers may occur. Selection is very important. In addition, since the suitable binding temperature may be different for each primer pair included, when applying multiplex PCR, optimization of the binding temperature suitable for multiplex PCR is required so that all PCR primer sets included in a single PCR reaction can be effectively combined.

According to one aspect of the present invention, a primer set composition for multiplex PCR for individual identification of a cat may be provided.

The primer set can amplify a genetic marker set for individual identification of a cat. The genetic marker set is a combination of markers showing a high mutation rate among cats, with an expected heterozygosity of more than 0.6 and a tri-nucleotide motif or preferably a tetranucleotide. -nucleotide) motif, among STR loci having 5 or more alleles, it is designed to include loci capable of constructing a primer set suitable for constructing a multiplex PCR system.

The genetic marker set may include 14 loci, specifically 13 autosomal STRs and 1 sex chromosome locus. The autosomal STR locus may include FCA740, F124, FCA391, F53, F37, FCA738, FCA732, F42, F141, FCA742, FCA441, F85 and FCA749. The sex chromosome locus may be an SRY gene located on the Y chromosome.

A primer set for multiplex PCR according to one aspect of the present invention may include a primer set for amplifying the 14 loci. The primer set is a set of optimized sequences devised to show accurate identification results by preventing cross-reaction or interference between primers in a multiplex PCR system for individual identification of cats, SEQ ID NO: 1 to SEQ ID NO: 28 It may include a primer sequence represented by. Specifically, a first primer set comprising the sequences represented by SEQ ID NO: 1 and SEQ ID NO: 2 as forward and reverse primers for amplifying the FCA740 marker sequence, respectively; a second primer set comprising the sequences represented by SEQ ID NO: 3 and SEQ ID NO: 4 for amplifying the F124 marker; A third primer set comprising the sequences represented by SEQ ID NO: 5 and SEQ ID NO: 6 for amplifying the FCA391 marker; A fourth primer set comprising the sequences represented by SEQ ID NO: 7 and SEQ ID NO: 8 for amplifying the SRY marker; A fifth primer set comprising the sequences represented by SEQ ID NO: 9 and SEQ ID NO: 10 for amplifying the F53 marker; A sixth primer set comprising the sequences represented by SEQ ID NO: 11 and SEQ ID NO: 12 for amplifying the F37 marker; A seventh primer set comprising the sequences represented by SEQ ID NO: 13 and SEQ ID NO: 14 for amplifying the FCA738 marker; An eighth primer set comprising the sequences represented by SEQ ID NO: 15 and SEQ ID NO: 16 for amplifying the FCA732 marker; A ninth primer set comprising the sequences represented by SEQ ID NO: 17 and SEQ ID NO: 18 for amplifying the F42 marker; A tenth primer set comprising the sequences represented by SEQ ID NO: 19 and SEQ ID NO: 20 for amplifying the F141 marker; An 11th primer set comprising the sequences represented by SEQ ID NO: 21 and SEQ ID NO: 22 for amplifying the FCA742 marker; A twelfth primer set comprising the sequences represented by SEQ ID NO: 23 and SEQ ID NO: 24 for amplifying the FCA441 marker; a thirteenth primer set comprising the sequences represented by SEQ ID NO: 25 and SEQ ID NO: 26 for amplifying the F85 marker; and a 14th primer set comprising the sequences represented by SEQ ID NO: 27 and SEQ ID NO: 28 for amplifying the FCA749 marker.

The primer set for multiplex PCR according to one aspect of the present invention may be a mixture of the first to 14th primer sets, and in this case, the mixing ratio of each primer set is set to 1 as a reference value based on molarity. 0.6 to 0.9 of the second primer set, 3.5 to 4.5 of the third primer set, 0.1 to 0.4 of the fourth primer set, 0.5 to 0.8 of the fifth primer set, 3 to 3.5 of the sixth primer set, 7 primer sets 0.5 to 0.8, the eighth primer set 0.6 to 0.9, the ninth primer set 1 to 1.3, the tenth primer set 1 to 1.5, the eleventh primer set 0.7 to 1, the twelfth primer set 1 to 1. 1.5, the 13th primer set 1 to 1.3, and the 14th primer set 1 to 1.3 may have a molar concentration ratio of 1 to 1.3. In this case, the concentrations of the forward and reverse primers for each marker included in each primer set may be included the same.

If necessary, the primer sequences represented by SEQ ID NO: 1 to SEQ ID NO: 28 may be labeled with a fluorescent marker to improve the identification of the amplification product. A known fluorophore can be used as the fluorescent marker, for example, fluorescein, fluorescein chlorotriazinyl, rhodamine green, rhodamine red (rhodamine red), tetramethylrhodamine, FITC, Oregon green, Alexa Fluor, fluorescein amidite (FAM), VIC, NED, PET, JOE, ROX (6-Carboxyl-X -At least one selected from the group consisting of Rhodamine), HEX, Texas Red, TET, TRITC, TAMRA, cyanine-based dyes and thiadicarbocyanine-based dyes can be used, but is limited thereto it is not going to be In the first to fourteenth primer sets, at least one of the sequences included in each primer set may be labeled with a fluorescent marker. For example, in the case of the first primer set including the primer sequences represented by SEQ ID NO: 1 and SEQ ID NO: 2, the primer of SEQ ID NO: 1 included in the set is labeled alone, or the primer of SEQ ID NO: 2 is labeled alone. , or both primers of SEQ ID NOs: 1 and 2 may be labeled.

The primer set for multiplex PCR according to a preferred embodiment of the present invention is divided into at least four groups, and each group may be labeled with a fluorescent marker of a different color. Specifically, the labeled sequences included in the first to third primer sets are labeled with a first fluorescent marker, and the labeled sequences included in the fourth to eighth primer sets are labeled with a second fluorescent marker, The labeled sequences included in the ninth to eleventh primer sets may be labeled with a third fluorescent marker, and the labeled sequences included in the twelfth to fourteenth primer sets may be labeled with a fourth fluorescent marker. Classification by group may be performed to improve the identification of products amplified through multiplex PCR and to facilitate analysis of the results.

The primer set for multiplex PCR according to one aspect of the present invention has a high amplification yield even with a small amount added and can amplify a short-length product, enabling amplification even in a degraded sample. Therefore, there is an advantage in that the individual of the cat can be excellently identified even when the DNA content is very small or old and the DNA quality is poor. In addition, since only a target sequence derived from a cat ( Felis catus ) species can be specifically amplified, individual identification can be performed specifically for only a cat species in a sample in which several mammals are mixed. In addition, since it has excellent individual identification ability for domestic cat species, including the Korean shorthair, which is a domestic cat breed, it is particularly suitable to be applied to cat individual identification in domestic events.

The primer set for multiplex PCR according to one aspect of the present invention may be applied to a kit or microarray for identifying a cat, but is not limited thereto. The kit may be a multiplex PCR kit and may include reagents for performing an amplification reaction. Examples include, but are not limited to, DNA polymerase, dNTPs, and buffer solutions.

According to another aspect of the present invention, a cat individual identification method using the multiplex PCR primer set according to one aspect of the present invention can be provided.

The individual identification method may include separating a nucleic acid molecule from an object to be identified; Amplifying a target sequence and obtaining an amplification product by performing multiplex PCR using the isolated nucleic acid molecule of a target as a template and using the primer set for multiplex PCR according to one aspect of the present invention; and analyzing the amplification product to identify the individual. The size of the DNA fragment, which is the amplification product, can be compared by electrophoresis or capillary electrophoresis (CE), and the gel band pattern due to the polymorphism of the fragment size, the peak pattern of the capillary electrophoresis result, and the different fluorescent labels Individual identification can be performed by analyzing the pattern.

Hereinafter, preferred embodiments are presented to aid understanding of the present invention, but these embodiments are only illustrative of the present invention and do not limit the scope of the appended claims, and embodiments within the scope and spirit of the present invention It is obvious to those skilled in the art that various changes and modifications to the are possible, and it is natural that these variations and modifications fall within the scope of the appended claims.

Example

<Preparation of cat-derived DNA sample>

Cat samples were obtained from 306 cats of 17 breeds and mixes with the consent of the owners. The remaining swabs (blood, ear, nose, and buccal swabs) after veterinary examination were provided by Korea Animal Hospital. The cat's breed was identified by a veterinarian and followed the standards of the International Cat Association (TICA) (https://tica.org/). In the case of the Korean Shorthair, although it is not officially registered with TICA, it is classified as a breed because it is most distributed in Korea. The number of individuals by breed is summarized in Table 1 below.

Breed Number of objects (No.) Abyssinian 3 American Shorthair 7 Bengal 5 British Shorthair One Exotic Shorthair 2 Korean Shorthair 180 Maine Coon 9 Munchkin 2 Norwegian forest One Persian 9 Ragdoll 6 Russian Blue 12 Scottish Fold 11 Selkirk Rex One Siamese 8 Sphinx One Turkish Angora 8 Mix cat 40 Total 306

DNA was extracted from swabs using the QIAsymphony® SP (Qiagen, Hilden, Germany) with the QIAsymphony® DNA Investigator kit (Qiagen) according to the manufacturer's instructions and stored at 4°C. DNA concentration was measured using the Qubit™ dsDNA HS Assay Kit (Thermo Fisher Scientific, Waltham, MA, USA) with a Qubit™ 2.0 Fluorometer (Invitrogen, Carlsbad, CA, USA).

<Marker selection for individual identification and multiplex PCR using it>

Seventeen autosomal STR loci meeting the three criteria of i) expected heterozygosity > 0.6, ii) tri- and tetra-nucleotide motifs, and iii) loci with five or more alleles were selected as marker candidates for individual identification. selected. A single PCR was performed from 8 Korean shorthair cats (4 males, 4 females) for each locus using primers for each marker to confirm amplification efficiency, size range and number of alleles. Some of the primer pairs referred to prior literature, and some were designed and used in the flanking region using Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/).

All PCRs were performed using the ProFlex PCR system (Thermo Fisher Scientific). Single PCR amplification conditions were performed as follows. The PCR mixture in a final volume of 15 μL contained 1.5 μl 10X Gold ST*R buffer (Promega, Madison, WI, USA), 1 μL of 10 pmol primer F/R, 0.25 μl Eagle Taq polymerase (5 U/μL, Roche, Mannheim). , Germany), 1μL template DNA (1ng/μL), and 9.25μl distilled water. PCR conditions were 95 ° C for 11 minutes, followed by 94 ° C for 15 seconds, 59 ° C for 75 seconds and 72 ° C for 60 seconds as one cycle, so that 30 cycles were performed, and finally at 72 ° C for 15 minutes. made it After screening the amplification products, 13 autosomal loci and 1 sex-determining locus were selected by excluding loci that were not suitable for constructing a multiplex PCR system. Thirteen autosomal loci were determined for FCA740, F124, FCA391, F53, F37, FCA738, FCA732, F42, F141, FCA742, FCA441, F85 and FCA749, and one sex chromosome locus for SRY.

locus chromosome sign Motif Primer (5'-3') product
size FCA740 C1 6FAM (TATC)x F: SEQ ID NO: 1 (GAGTGATTTCTCTATCCTTTTGTCG) 140-168 R: SEQ ID NO: 2 (AACCAAATGGGAGTTTGTGG) F124 E1 6FAM (AGGA)x(AGAA)x F: SEQ ID NO: 3 (TGTGCTGGGTATGAAGCCTACTG) 255-305 R: SEQ ID NO: 4 (GTGTCTTCCATGCCCATAAAGGCTCTGA) FCA391 B3 6FAM (GATA)x F: SEQ ID NO: 5 (TGTGCTCTGTATGTCATTCCTCA) 373-409 R: SEQ ID NO: 6 (TCATTTAGGTAGCCCATTTTCATC) SRY Y VIC - F: SEQ ID NO: 7 (TGCGAACTTTGCACGGAGAG) 96-97 R: SEQ ID NO: 8 (GCGTTCATGGGTCGTTTGACG) F53 A1 VIC (AAGA)x F: SEQ ID NO: 9 (GTGTCTTGAGTGGCTGTGGCATTTCC) 109-180 R: SEQ ID NO: 10 (CCTATGTTGGGAGTAGAGATCACCT) F37 C1 VIC (TTTA)x(GA)x F: SEQ ID NO: 11 (CGCCTTTCTCACATTACCAT) 198-221 R: SEQ ID NO: 12 (AGCCTGCTTCGGATTCTGT) FCA738 C1 VIC (AAC)x F: SEQ ID NO: 13 (TCTTCACTGCTTCTGCCTCA) 245-262 R: SEQ ID NO: 14 (GGTCCACACTTGACAAAACACG) FCA732 B2 VIC (ATCT)x F: SEQ ID NO: 15 (GCACATCCGAGAGATGTTCTACT) 327-356 R: SEQ ID NO: 16 (AGAATTGCAAGGAGGCCACT) F42 A1 NED (GAAA)x F: SEQ ID NO: 17 (TGAGTGATAATTATGAGGTGCT) 82-106 R: SEQ ID NO: 18 (GTTTCCTCTTTCCCTTCCTCCTC) F141 A1 NED (GATA)x(GAAA)x F: SEQ ID NO: 19 (GAGACTAGATGGAAGGATGAAG) 188-246 R: SEQ ID NO: 20 (AGTACCATGTCTCTCTCAACT) FCA742 D4 NED (CTTT)x F: SEQ ID NO: 21 (CAGTTAGAGTGGTCTATCTGC) 334-386 R: SEQ ID NO: 22 (CCCACCTTTCCTTATAATCAGG) FCA441 D3 PET (ATAG)x F: SEQ ID NO: 23 (GTGTCTTGATCGGTAGGTAGGTAGATATAG) 99-127 R: SEQ ID NO: 24 (AGCCTTGAAGCAAACTATCATT) F85 B1 PET (TTTC)x(TCTC)x F: SEQ ID NO: 25 (TCTGGTCCTCACGTTTTCCT) 211-337 R: SEQ ID NO: 26 (ATGTCTGTATGAGATGCGGT) FCA749 F2 PET (AGAT)x(ACAT)x F: SEQ ID NO: 27 (AGCATGCGTTCTCTGTCTCTC) 339-443 R: SEQ ID NO: 28 (TGGGGTGATGTGACCTCTTG)

Some primers were redesigned to improve coverage correction and amplification efficiency, and forward primers were labeled using four fluorescent tags: FAM, VIC, NED, and PET to avoid overlap between adjacent loci. Table 2 shows marker and primer information for constructing the STR four-color fluorescence multiplex PCR system using 14 loci.

To determine the optimal multiplex PCR, the concentrations of the PCR primers were adjusted to balance the peaks of the locus. The multiplex PCR mixture in a final volume of 20 μL consists of 2 μL 10X Gold ST*R buffer, 2 μL primer mixture, 1 μL Eagle Taq polymerase, 1 μL template DNA (1 ng/μL) and 14 μL distilled water. Here, the primer mixture has 2, 1.5, 8, 0.5, 1.25, 6.25, 1.25, 1.5, 2.25, 2.5, 1.75, 2.5, 2.25 and 2.25 picomolar (pM) in order from the first primer set to the 14th primer set. ) was prepared by mixing at the concentration. PCR was performed several times to find the optimal multiplex PCR conditions, and the finally selected multiplex PCR conditions were 95 ° C for 11 minutes, followed by 94 ° C for 30 seconds, 59 ° C for 30 seconds, and 72 ° C for 45 seconds in one cycle. So, after 30 cycles were performed, it was determined that the final extension was performed at 72° C. for 45 minutes. These amplification conditions are optimized amplification conditions devised so that a primer set including 14 pairs of primers can specifically amplify the sequence of each target marker without mutual cross-reaction.

Amplification and size confirmation of multiplex PCR products were performed using capillary electrophoresis. Capillary electrophoresis was performed by mixing 10 μL Applied Biosystems Hi-Di Formamide, 0.2 μL Applied Biosystems Liz500 size standard (all Thermo Fisher Scientific) and 1 μL PCR product. The mixture was denatured at 96° C. for 3 min and immediately cooled on an ice block for 5 min. Separation and detection of the mixture was performed on an ABI 3500xl Genetic Analyzer, POP-4™, 36 cm capillary (all Thermo Fisher Scientific) and an injection voltage of 1.2 kV for 24 seconds, a constant run voltage of 15 kV. Electropherograms were analyzed with GeneMapper™ ID-X Software v1.4 (Thermo Fisher Scientific) and the threshold for allele peak calling was set at 150 RFU (relative fluorescence units).

When using the primer set in Table 2, single PCR and multiplex PCR were performed well, and it was confirmed that the selected 14 loci were suitable for multiplex PCR for individual identification. As a result of analyzing 306 cats with the constructed multiplex PCR, the entire genotype was obtained in 301 cats (98.37%). Five samples that failed full genotyping showed a null allele at the FCA740 locus: Ragdoll (n=1), Russian Blue (n=1), FCA391: Siamese (n=1) and American Shorthair (n=2). )). Samples that failed full genotyping were excluded from subsequent statistical analysis including allele frequencies.

Fluorescence colors and size ranges of amplification products for 13 loci determined based on genotyping results obtained from 301 cats are shown in FIG. 1 . Multiplex PCR results revealed a genotype profile that could be readily interpreted as a chromatogram via electrophoresis on an ABI 3500xL, a portion of which is shown in 2. In Figure 2, (A) is the analysis result of a Korean shorthair male cat, (B) is a Korean shorthair female cat, and sex is identified by the on-off form of the peak at the SRY locus, so there was no amplification product in the female. . The peak portion of the SRY locus, which can be distinguished by gender, is indicated by a red box in FIG. 2 . It was confirmed that different peak patterns appeared between cats of two different individuals, and as a result of genotyping analysis of the constructed multiplex system, up to 26 alleles could be detected in 13 STR loci of female cats, and gender determination in male cats. It was confirmed that up to 27 alleles could be detected, including the locus SRY.

<Check species specificity>

When collecting biological evidence at a crime scene, animal-derived samples, such as tissues or biological secretions, can be mixed with samples from other species, especially human-derived samples, thus confirming the species specificity of the constructed system. It is an important element for evaluation in entity identification systems. To confirm that the constructed multiplex PCR system specifically amplifies the cat species, tests were performed on various species under the same multiplex PCR conditions. Species used as controls other than cats were humans, dogs, cows, pigs, rabbits, raccoons, weasels, and wildcats (n = 3), and each DNA was extracted from tissues derived from each species using the QIAamp micro kit (Qiagen), or , used by purchasing or purchasing from other institutions. Tissues from cows, pigs, and rabbits were purchased individually, and DNA from raccoons, weasels, and wildcats was purchased from the National Institute of Biological Services (accession numbers: NIBRGR0000051489, NIBRGR0000076609, NIBRGR0000076676, NIBRGR0000158947, NIBRGR0000184220). The purchased DNA was human DNA (female: K562, male: 2800) and dog DNA (control DNA in Thermo Scientific Canine Genotypes™ Panel 2.1 Kit, Thermo Fisher Scientific). 1 ng of DNA from samples of each species was amplified using the constructed multiplex system, and the experiment was repeated twice. Distilled water was used as a negative control.

The results of amplification of cat and other mammalian DNA samples using the constructed multiplex PCR system are shown in FIG. 3 . Figure 3 (A) is the result of agarose gel electrophoresis, (B) is the chromatogram result obtained by capillary electrophoresis, 1 in (B) is a cat ( Felis catus ), 2 is a wild cat ( Prionailurus bengalensis ), 3 A is a cow ( Bos taurus ), 4 is a pig ( Sus scrofa domesticus ), 5 is a dog (control DNA in Thermo Scientific Canine Genotypes™ Panel 2.1 Kit), and 6 is the amplification result of a human (human control DNA K562).

Referring to FIG. 3 , no amplification was observed in species other than wildcat in the agarose gel. The rabbit and raccoon results also failed to amplify as well as the human species (not shown). 4 shows the results of capillary electrophoresis of the amplification products of the three wildcats whose amplification products were observed in the agarose gel. In FIG. 4, OMR means an outside marker range and OL means an offladder. Referring to FIG. 4, it seems that the peak was obtained in the outside range or was not amplified, and in the cat, the allele appeared as an out-range or null allele, confirming that there was a difference in amplification pattern from that of the domestic cat.

<Sensitivity evaluation>

Considering the use in the forensic science field, which mainly analyzes old and decomposed samples, a sensitivity test was performed under the same PCR conditions assuming a low DNA concentration. To evaluate the sensitivity of the constructed multiplex PCR system, a sensitivity test was performed by randomly selecting DNA from Korean shorthairs (1 male, 1 female). 2 ng of the quantified DNA was serially diluted to 1, 0.5, 0.25, 0.125, and 0.065 ng with distilled water and used as a template. Multiplex PCR was performed under the same concentration of each DNA, and the results are shown in FIG. 5 . Multiplex PCR was performed in duplicate, and the threshold for allele peak calling was set at 50 RFU.

Referring to FIG. 5 , all peaks were detected when 0.25 to 2 ng of template DNA was amplified for both male and female samples that were doubly amplified (RFU>50). Allele drop-out results were obtained when the amount of DNA template was reduced to 0.125 ng. From the 0.125 ng sample, no allele was detected in F124 or F141 heterozygotes. In the amplification of the 0.125 ng sample, one of the two heterozygous alleles, F124 in female DNA and F141 in male DNA, was below the interpretation threshold. When the amount of DNA template was 0.065 ng, the genotyping success rates were 88.46% and 74.07% in females and males, respectively. In female DNA, one of the two heterozygous alleles of FCA738 was knocked out and both heterozygous alleles of F124 were below the interpretation threshold. In male DNA, one of the two heterozygous alleles of FCA391, FCA732, and F42 was a dropout, and heterozygous alleles of F124 and FCA738 were both below the interpretation threshold.

<Performing population genetic analysis>

Estimating allele frequencies requires considering a reasonable number of individuals to avoid sampling error. Sample size depends on the number of potential contributors and the level of diversity of the locus, but a de facto standard of 200 individuals is often sampled as a representative population.

To evaluate the constructed multiplex system, allele frequency calculation and population gene analysis were performed for 301 cat individuals representing 17 cat breeds and mix breeds in Korea. Alleles amplified for each locus were grouped in units of 1 bp according to the size obtained as a result of capillary electrophoresis in GeneMapper™ ID-X Software v1.4. Details of the allele size and frequency of each locus are presented in Table 3.

Referring to Table 3, the alleles were distributed between frequencies of 0.0017 (12 loci except FCA740) and 0.495 (FCA738). Allele frequency, number of alleles, expected heterozygosity (Hexp), observed heterozygosity (Hobs), and polymorphic information content (PIC) were measured using MS toolkit and CERVUS v.3.0. was calculated by The number of effective alleles was calculated using GenAlEx, and the probability of identity (PI) is the probability that two unrelated individuals share the same genetic profile. It was calculated. The results for the number of alleles per locus (No), the number of effective alleles per locus (Ne), expected and observed heterozygotes (Hexp and Hobs), polymorphic information content (PIC) and probability of identity (PI) are shown in Table 4 below. shown in PI in Table 4 means the probability that identities in 13 loci are combined (combined PI).

locus
(Locus) No. Ne Hobs Hexp PIC PI FCA740 10 3.462 0.356 0.712 0.668 0.126 F124 21 7.151 0.797 0.862 0.846 0.034 FCA391 10 3.514 0.628 0.717 0.669 0.127 F53 24 10.89 0.694 0.910 0.901 0.015 F37 15 6.853 0.771 0.856 0.839 0.037 FCA738 7 2.898 0.581 0.656 0.603 0.171 FCA732 8 4.295 0.701 0.769 0.729 0.092 F42 12 5.647 0.731 0.824 0.800 0.054 F141 22 11.323 0.821 0.913 0.905 0.014 FCA742 22 6.310 0.774 0.843 0.827 0.04 FCA441 10 2.910 0.585 0.657 0.594 0.181 F85 63 26.628 0.784 0.964 0.961 0.003 FCA749 17 5.576 0.724 0.822 0.798 0.055 Mean 18.538 7.497 0.688 0.808 0.780 3.916 x 10 ^-18

Referring to Table 4, as a result of genetic diversity analysis of 301 Korean cats, the range of allele sizes ranged from 82 bp (F42) to 443 bp (FCA749). A total of 241 alleles were detected in 301 samples, and as a result of polymorphism analysis, an average of 18.53 alleles ranging from 7 (FCA738) to 63 (F85) were detected per locus. Even if 63 of F85 are excluded, the average is 14.83, which is sufficient to verify genetic diversity. The number of effective alleles per locus ranged from 2.91 (FCA441) to 26.62 (F85), with a mean value of 7.49. The range of observed heterozygosity ranged from 0.356 (FCA740) to 0.821 (F141), and the average value was 0.688. Expected heterozygosity varied between 0.656 (FCA738) and 0.964 (F85), with a mean value of 0.808. The range of PIC values for the 13 loci was 0.594 (FCA441) to 0.961 (F85), with an average value of 0.780.

Expected heterozygosity values represent genetic diversity, and loci with Hexp > 0.6 and PIC > 0.5 are known to have high polymorphism information. > 0.594, suggesting sufficient allele frequency and polymorphism.

As a result of calculating the probability of identical genotypes among feline individuals in this population, the lowest and highest PI values were 0.003 (F85) and 0.181 (F441), respectively, and the combined identity probability of 13 loci in the constructed multiplex system was 3.916 x 10 ^-18 . As a result of analyzing 180 Korean shorthair breeds, the combined identity probability was 1.8 x 10 ^-16 , indicating that the individual identification accuracy was very good even in domestic cat breeds.

As a result of implementing the multiplex PCR system constructed in one embodiment of the present invention on 301 Korean cats satisfying the population suitable for standard sampling, high polymorphisms were confirmed in 13 STR loci included in the system, and 13 The appearance rate of the same individual combined from the locus was 3.916 x 10 ^-18 , confirming that it had remarkably high individual discrimination. In addition, the entire genotype could be successfully obtained using a low-concentration DNA sample, and as a result of the specificity test, it was confirmed that cat species-specific amplification was performed, and the constructed multiplex PCR system was used for forensic identification of feline individuals. The following was found to be suitable. In addition to forensic analysis, the multiplex PCR system constructed in one embodiment of the present invention can be usefully used for constructing a database of cat breeds and for breed-based research.

<110> Republic of Korea (National Forensic Service Director Ministry of Interior and Safety) <120> MULTIPLEX PCR PRIMER SET FOR INDIVIDUALIZATION IN CAT AND METHOD USING THE SAME <130> NP-2021-0822 <160> 28 <170> KoPatentIn 3.0 <210> 1 <211> 25 <212> DNA <213> artificial sequence <220> <223> FCA740 F primer <400> 1 gagtgatttc tctatccttt tgtcg 25 <210> 2 <211> 20 <212> DNA <213> artificial sequence <220> <223> FCA740 R primer <400> 2 aaccaaatgg gagtttgtgg 20 <210> 3 <211> 23 <212> DNA <213> artificial sequence <220> <223> F124 F primer <400> 3 tgtgctgggt atgaagccta ctg 23 <210> 4 <211> 28 <212> DNA <213> artificial sequence <220> <223> F124 R primer <400> 4 gtgtcttcca tgcccataaa ggctctga 28 <210> 5 <211> 23 <212> DNA <213> artificial sequence <220> <223> FCA391 F primer <400> 5 tgtgctctgt atgtcattcc tca 23 <210> 6 <211> 24 <212> DNA <213> artificial sequence <220> <223> FCA391 R primer <400> 6 tcatttaggt agcccatttt catc 24 <210> 7 <211> 20 <212> DNA <213> artificial sequence <220> <223> SRY F primer <400> 7 tgcgaacttt gcacggagag 20 <210> 8 <211> 21 <212> DNA <213> artificial sequence <220> <223> SRY R primer <400> 8 gcgttcatgg gtcgtttgac g 21 <210> 9 <211> 26 <212> DNA <213> artificial sequence <220> <223> F53 F primer <400> 9 gtgtcttgag tggctgtggc atttcc 26 <210> 10 <211> 25 <212> DNA <213> artificial sequence <220> <223> F53 R primer <400> 10 cctatgttgg gagtagagat cacct 25 <210> 11 <211> 20 <212> DNA <213> artificial sequence <220> <223> F37 F primer <400> 11 cgcctttctc acattaccat 20 <210> 12 <211> 19 <212> DNA <213> artificial sequence <220> <223> F37 R primer <400> 12 agcctgcttc ggattctgt 19 <210> 13 <211> 20 <212> DNA <213> artificial sequence <220> <223> FCA738 F primer <400> 13 tcttcactgc ttctgcctca 20 <210> 14 <211> 22 <212> DNA <213> artificial sequence <220> <223> FCA738 R primer <400> 14 ggtccacact tgacaaaaca cg 22 <210> 15 <211> 23 <212> DNA <213> artificial sequence <220> <223> FCA732 F primer <400> 15 gcacatccga gagatgttct act 23 <210> 16 <211> 20 <212> DNA <213> artificial sequence <220> <223> FCA732 R primer <400> 16 agaattgcaa ggaggccact 20 <210> 17 <211> 22 <212> DNA <213> artificial sequence <220> <223> F42 F primer <400> 17 tgagtgataa ttatgaggtg ct 22 <210> 18 <211> 23 <212> DNA <213> artificial sequence <220> <223> F42 R primer <400> 18 gtttcctctt tcccttcctc ctc 23 <210> 19 <211> 22 <212> DNA <213> artificial sequence <220> <223> F141 F primer <400> 19 gagactagat ggaaggatga ag 22 <210> 20 <211> 21 <212> DNA <213> artificial sequence <220> <223> F141 R primer <400> 20 agtaccatgt ctctctcaac t 21 <210> 21 <211> 21 <212> DNA <213> artificial sequence <220> <223> FCA742 F primer <400> 21 cagttagagt ggtctatctg c 21 <210> 22 <211> 22 <212> DNA <213> artificial sequence <220> <223> FCA742 R primer <400> 22 cccacctttc cttataatca gg 22 <210> 23 <211> 30 <212> DNA <213> artificial sequence <220> <223> FCA441 F primer <400> 23 gtgtcttgat cggtaggtag gtagatatag 30 <210> 24 <211> 22 <212> DNA <213> artificial sequence <220> <223> FCA441 R primer <400> 24 agccttgaag caaactatca tt 22 <210> 25 <211> 20 <212> DNA <213> artificial sequence <220> <223> F85 F primer <400> 25 tctggtcctc acgttttcct 20 <210> 26 <211> 20 <212> DNA <213> artificial sequence <220> <223> F85 R primer <400> 26 atgtctgtat gagatgcggt 20 <210> 27 <211> 21 <212> DNA <213> artificial sequence <220> <223> FCA749 F primer <400> 27 agcatgcgtt ctctgtctct c 21 <210> 28 <211> 20 <212> DNA <213> artificial sequence <220> <223> FCA749 R primer <400> 28 tggggtgatg tgacctcttg 20

Claims (6)

A first primer set comprising the sequences represented by SEQ ID NO: 1 and SEQ ID NO: 2;
a second primer set comprising the sequences represented by SEQ ID NO: 3 and SEQ ID NO: 4;
a third primer set comprising the sequences represented by SEQ ID NO: 5 and SEQ ID NO: 6;
a fourth primer set comprising the sequences represented by SEQ ID NO: 7 and SEQ ID NO: 8;
a fifth primer set comprising the sequences represented by SEQ ID NO: 9 and SEQ ID NO: 10;
A sixth primer set comprising the sequences represented by SEQ ID NO: 11 and SEQ ID NO: 12;
a seventh primer set comprising the sequences represented by SEQ ID NO: 13 and SEQ ID NO: 14;
an eighth primer set comprising the sequences represented by SEQ ID NO: 15 and SEQ ID NO: 16;
a ninth primer set comprising the sequences represented by SEQ ID NO: 17 and SEQ ID NO: 18;
A tenth primer set comprising the sequences represented by SEQ ID NO: 19 and SEQ ID NO: 20;
An 11th primer set comprising the sequences represented by SEQ ID NO: 21 and SEQ ID NO: 22;
a twelfth primer set comprising the sequences represented by SEQ ID NO: 23 and SEQ ID NO: 24;
a thirteenth primer set comprising the sequences represented by SEQ ID NO: 25 and SEQ ID NO: 26; and
A 14th primer set comprising the sequences represented by SEQ ID NO: 27 and SEQ ID NO: 28; a primer set composition for multiplex PCR for individual identification of cats, comprising:
According to claim 1,
The first to fourteenth primer sets are sequentially based on molarity: 1:0.6 to 0.9:3.5 to 4.5:0.1 to 0.4:0.5 to 0.8:3 to 3.5:0.5 to 0.8:0.6 to 0.9:1 to 1.3:1 to A primer set composition for multiplex PCR for individual identification of cats, mixed at a ratio of 1.5:0.7 to 1:1 to 1.5:1 to 1.3:1 to 1.3.
According to claim 1,
In the first to fourteenth primer sets, at least one of the sequences included in each primer set is labeled with a fluorescent marker,
The labeled sequences included in the first to third primer sets are labeled with a first fluorescent marker,
The labeled sequences included in the fourth to eighth primer sets are labeled with a second fluorescent marker,
The labeled sequence included in the ninth to eleventh primer sets is labeled with a third fluorescent marker,
The labeled sequence included in the 12th to 14th primer sets is labeled with a fourth fluorescent marker, a primer set composition for multiplex PCR for individual identification of cats.
According to claim 1,
Cat ( Felis catus ) Species-specific primer set composition for multiplex PCR for individual identification of cats.
A kit for individual identification of a cat comprising the primer set composition for multiplex PCR according to any one of claims 1 to 4.
isolating the nucleic acid molecule from the subject to be identified;
Performing multiplex PCR using the nucleic acid molecule as a template and using the primer set composition for multiplex PCR according to any one of claims 1 to 4 and obtaining an amplification product; and
Electrophoresis or capillary electrophoresis of the amplification product; including, a method for identifying a cat.

Images