KR101557407B1 - Method and Kit for identification of Korean cattle - Google Patents

Method and Kit for identification of Korean cattle Download PDF

Info

Publication number
KR101557407B1
KR101557407B1 KR1020080097566A KR20080097566A KR101557407B1 KR 101557407 B1 KR101557407 B1 KR 101557407B1 KR 1020080097566 A KR1020080097566 A KR 1020080097566A KR 20080097566 A KR20080097566 A KR 20080097566A KR 101557407 B1 KR101557407 B1 KR 101557407B1
Authority
KR
South Korea
Prior art keywords
hanwoo
allelic
locus
kit
supersatellite
Prior art date
Application number
KR1020080097566A
Other languages
Korean (ko)
Other versions
KR20100038550A (en
Inventor
공홍식
이학교
Original Assignee
한경대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한경대학교 산학협력단 filed Critical 한경대학교 산학협력단
Priority to KR1020080097566A priority Critical patent/KR101557407B1/en
Publication of KR20100038550A publication Critical patent/KR20100038550A/en
Application granted granted Critical
Publication of KR101557407B1 publication Critical patent/KR101557407B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/124Animal traits, i.e. production traits, including athletic performance or the like

Abstract

본 발명은 한우 개체 식별 방법 및 키트에 관한 것으로, 더욱 상세하게는 한우의 초위성체 유전자를 증폭하여, 증폭된 산물을 전기영동을 통해 대립유전자를 검출하고, 대립형질 사다리를 적용하여 표준화된 유전자형을 결정하는 한우 개체를 식별하는 방법 및 이를 구현하기 위한 한우개체 식별용 키트에 관한 것이다. The present invention relates to a method and kit for identification of Hanwoo, and more particularly, to a method and kit for identifying Hanwoo, and more particularly, to a method for identifying Hanwoo, The present invention relates to a method for identifying a Hanwoo object to be determined and a kit for Hanwoo object identification for implementing the method.

본 발명에 따른 한우 개체 분석 방법 및 키트는 초위성체의 다수의 대립유전자를 신속하고 정확하게 분석할 수 있는 멀티플렉스 피씨알 기법과 대립형질 사다리를 제공함으로써 대립유전자에 관한 표준화된 통합 데이터베이스 구축을 가능케 하며, 한우 개체를 식별하는데 유용하게 사용될 수 있다. The method and kit for analyzing Hanwoo according to the present invention can provide a standardized integrated database on alleles by providing a multiplex PCR method and an allelic ladder that can quickly and accurately analyze a large number of alleles of a supersatellite , And can be used to identify Hanwoo individuals.

한우, 개체식별, 초위성체, allelic ladder, 멀티플렉스 피씨알 Hanwoo, object identification, super satellites, allelic ladder, multiplex PC

Description

한우의 개체식별방법 및 키트{Method and Kit for identification of Korean cattle}Description: TECHNICAL FIELD The present invention relates to a method and kit for identification of a Korean beef cattle,

본 발명은 한우 개체 식별 방법 및 키트에 관한 것으로, 더욱 상세하게는 한우의 Microsatellites(초위성체) 유전자를 증폭하여, 증폭된 산물을 전기영동을 통해 대립유전자를 검출하고, 대립형질 사다리를 적용하여 표준화된 유전자형을 결정하는 한우 개체를 식별하는 방법 및 이를 구현하기 위한 한우개체 식별용 키트에 관한 것이다. The present invention relates to a method and kit for identification of Hanwoo, and more particularly, to a method and kit for identifying Hanwoo, and more particularly, to a method for identifying Hanwoo, And to a kits for identification of Hanwoo to implement the method.

세계 각국에서는 유전자원으로서 재래가축에 대한 보존 및 활용의 가치를 인식하면서(Notter (1999) J. Anim. Sci. 77:61-69) 가축들의 품종 형성, 유전적 특성, 유전적 다양성, 타 품종간의 유연관계 등의 분석연구를 수행하여 왔다. 소의 품종집단에 대해서는 혈액단백질, 유단백질, 마이크로세틀라이트(microsatellites), 미토콘드리아 DNA(mitochondrial DNA), 등 다양한 유전적 표지인자들을 활용한 연구들이 수행되어 왔다(MacHugh et al (1998) Anim. Genet. 29:333-340; Mannen et al (1998) Genetics 150:1169-1175; Edwards et al (2000) Anim. Genet. 31:127-130; Troy et al (2001) Nature 410:1088-1091; Hanotte et al (2000) Molecular Ecology 9:387-396, (2002) Science 296:336-339). 기존의 혈액형 및 생화학적인 지표의 다형성 분석방법들은 분석을 위해 사용되는 조직들에 한계가 있으며, 한우에 있어서 혈액형검사는 정확한 부계혈통을 결정하지 못하는 단점이 있다(Glowatzki-Mullis et al., 1995. Microsatellite-based parentage control in cattle. Anim. Genet. 26:7-12). 이로 인해 최근 들어 DNA 다형성에 기초한 다양한 유전적 분석방법들이 개발되었으며, 이를 이용하여 품종간 및 개체간의 동정이 이루어지고 있다 (Peelman et al., 1998. Evaluation of the genetic variability of 23 bovine microsatellite markers in four Belgian cattle breeds. Anim. Genet. 29:161-167).Recognizing the value of conservation and utilization of native livestock as a genetic resource in different parts of the world (Notter (1999) J. Anim. Sci . 77: 61-69) And the relationship between them. For the breed of cattle, studies have been performed using various genetic markers such as blood proteins, milk proteins, microsatellites, mitochondrial DNA (MacHugh et al (1998) Anim. Genet. 29: Genetics 150: 1169-1175; Edwards et al (2000) Anim. Genet. 31: 127-130; Troy et al (2001) Nature 410: 1088-1091; Hanotte et al 2000) Molecular Ecology 9: 387-396, (2002) Science 296: 336-339). The existing blood type and biochemical polymorphism analysis methods have limitations on the tissues used for analysis and blood type tests on Hanwoo have a disadvantage in not determining the correct paternal blood lineage (Glowatzki-Mullis et al., 1995 [JoC]; Microsatellite-based parentage control in cattle, Anim. Genet. 26: 7-12). In recent years, various genetic analysis methods based on DNA polymorphisms have been developed and identification has been made between cultivars and individuals (Peelman et al., 1998. Evaluation of the genetic variability of 23 bovine microsatellite markers in four Belgian cattle breeds, Anim Genet., 29: 161-167).

초위성체(Microsatellite, MS)는 2 내지 6개 정도의 염기서열이 반복되는 DNA군(repetitive DNA group)으로, 게놈 내에 골고루 분포하고 매우 높은 다형성을 나타내는 비암호화 DNA 서열(non-coding DNA sequence)이다(Zajc I and Sampson J (1999) J Hered 90: 104-107). 특정 좌위에서 반복단위의 반복수에 따라 개체간의 다양성이 인정되는데(Koreth J, O'Leary JJand McGee JO (1996) J Pathol 178: 239-248.), 반복수에 품종 간 다형이 있는 경우에 인접영역에 설계한 프라이머를 이용하여 중합효소연쇄반응(Polymerase Chain Reaction; PCR)을 행하면, PCR 산물 길이에 다형이 관찰되고 DNA 다형을 검출하는 것이 가능해진다. 또한, 초위성체는 다른 유전자들과 마찬가지로 멘델의 유전법칙에 따라 자식에게 전달되며 PCR을 이용하여 증폭할 수 있고, 전기영동을 할 경우 공우성(co-dominant)의 양상을 보인다. 특히, 초위성체는 크기가 작기 때문에 2개에서 최대 8개까지의 프라이머를 동 시에 증폭할 수 있으므로(Chamberlain JS et al., (1988) Nucleic Acids Res 16: 11141-11156) 유전자의 다형성을 분석하는데 시간과 비용을 줄일 수 있으며 쉽게 이들의 대립유전자형을 분석할 수 있다. 현재 소에서 약 천개의 초위성체 좌위가 밝혀져 있으며, 이들의 특성 및 염색체상의 위치파악이 이루어져 왔다. 따라서, 이들 중 품종간, 개체간 다형성이 높은 초위성체 마커들을 선별하여 혈통검정을 위한 수단으로서 사용되고 있다(Barendse et al., 1994. A genetic linkage map of the bovine genome. Nat. Genet. 6:227-235). 이 과정에서 여러 개의 프라이머를 혼합하여 증폭하는 multiplex PCR 기법이 사용되고 있으며, 이를 통하여 효율적인 혈통검정 및 연관지도 작성 등이 행해지고 있다. 이러한 분석을 통하여 초위성체는 인간을 포함한 포유류, 어류, 식물 등을 대상으로 이루어지는 집단유전분야에서 유전적 다양성에 기초한 집단간, 집단내 유전성분과 연관성 분석을 위한 중요한 DNA 마커로서 인지되고 있다(Achmann et al., 2004. Microsatellite diversity, population subdividision and gene flow in the Lipizzan horse. Anim. Genet. 35:285-292. Ayub ET AL., 2003. Reconstruction of human evolutionary tree using polymorphic autosomal microsatellites. Am. J. Anthropol. 122:259-268.Microsatellite (MS) is a repetitive DNA group of about 2 to 6 nucleotides, which is a non-coding DNA sequence that is uniformly distributed throughout the genome and exhibits a very high polymorphism (Zajc I and Sampson J (1999) J Hered 90: 104-107). Variability among individuals is recognized according to the number of repeats in a particular locus (Koreth J, O'Leary JJand McGee JO (1996) J Pathol 178: 239-248.), (Polymerase Chain Reaction (PCR)) using a primer designed in the region, it is possible to observe the polymorphism in the PCR product length and to detect the DNA polymorphism. In addition, the supersatellite, like other genes, is transmitted to the offspring according to the Mendel's law of genetics and can be amplified by PCR and co-dominant when electrophoresed. In particular, since the supersatellite is small in size, it can amplify two to eight primers at the same time (Chamberlain JS et al., (1988) Nucleic Acids Res 16: 11141-11156) It can save time and money and can easily analyze their allelic genotypes. At present, about one thousand locomotives are identified in the cattle, and their characteristics and chromosomal location have been identified. (Barendse et al., 1994). A genetic linkage map of the bovine genome has been used as a means of screening and screening for supernatant markers that are highly polymorphic among varieties -235). In this process, a multiplex PCR method is used in which a plurality of primers are mixed and amplified. Thus, an efficient blood flow test and association mapping are performed. Through these analyzes, the supersatellite has been recognized as an important DNA marker for analysis of association with genetic diversity-based group and group genetic components in mammalian, fish, plant, etc., including humans (Achmann et al., 2004. Microsatellite diversity, population subdividing and gene flow in the Lipizzan horse, Gen. 35: 285-292 Ayub et al., 2003. Reconstruction of human evolutionary tree using polymorphic autosomal microsatellites. Anthropol., 122: 259-268.

전 세계적으로 이러한 초위성체 분석은 매우 광범위하게 이루어지고 있으며, 국내에서 또한 학술적 연구와 더불어 쇠고기 이력 추적시스템, 한우와 수입육 판별법 개발 등에 많이 사용되고 있으나, 최종 결과값은 모두 소수점을 갖는 숫자로 표기되어지므로 타 연구결과와의 데이터 공유는 매우 힘든 실정이다. 즉, 동일한 PCR산물을 동일한 분석기기에서 계속적으로 반복하여 분석한다 해도 크기(bp)는 매번 달라지게 된다. 그렇기 때문에 그러한 데이터는 통합하여 관리하거나, 동일성을 알아보고자 할 때는 매우 비효율적인 시스템이다. The analysis of these supersatellites is widely used all over the world. In addition to academic research in Korea, it is widely used for beef traceability system, development of Hanwoo and imported meat discrimination method, but the final result values are all expressed as numbers with decimal points Data sharing with other research results is very difficult. That is, even if the same PCR product is continuously and repeatedly analyzed in the same analyzer, the size (bp) changes each time. Therefore, such data is a very inefficient system when it is integrated or managed, or when it is necessary to check the identity.

대립형질 사다리(allelic ladder)란, 각 초위성체의 각 유전자형들이 나타날 수 있는 최소 또는 최대의 범위를 하나의 allele number로 지정해주고, 그 범위 안에 위치하는 peak들은 무조건 하나의 숫자로 표시되는 절대값으로 변환하여 주는 것을 의미한다. The allelic ladder designates the minimum or maximum range in which each genotype of each supersatellite can appear as a single allele number, and the peaks located within that range are unconditionally represented by a single numerical value. Which means conversion.

본 발명자는 초위성체 유전자좌들의 대립유전자를 정확히 분석하고, 이를 표준화시켜 효율적인 한우 개체 식별방법을 개발하고자 예의 연구 노력한 결과, 한우 집단에 변별력을 가지는 초위성체 유전자좌를 선정, 증폭하여 대립유전자를 검출하고 대립형질 사다리(allelic ladder)를 적용하여 표준화된 유전자형을 결정할 수 있음을 확인하고 본 발명을 완성하였다. As a result of intensive research to develop an efficient Hanwoo identification method by accurately analyzing allele genes of supersatellite loci and standardizing them, the present inventors selected and amplified a supersatellite locus having a discriminating power in a Hanwoo group, We confirmed that standardized genotypes can be determined by applying an allelic ladder, and the present invention has been completed.

따라서 본 발명의 목적은 한우 집단에 변별력을 가지는 초위성체 유전자좌를 선정, 증폭하여 대립유전자를 검출하고 대립형질 사다리를 적용하여 표준화된 유전자형을 결정하는 한우 개체 식별 방법을 제공하는 것이다.Accordingly, it is an object of the present invention to provide a method for identifying a Hanwoo individual, which selects and amplifies a supersatellite locus having discriminative power in a Hanwoo group to detect alleles and determines a standardized genotype by applying an allelic ladder.

또한, 본 발명의 목적은 상기의 증폭용 프라이머 및 이를 대립형질 사다리를 포함하는 방법을 이용하여 한우 개체 식별용 키트를 제공하는 것이다.It is also an object of the present invention to provide a kit for identifying Hanwoo using the above primer for amplification and a method comprising the allelic ladder thereof.

또한, 본 발명의 목적은 각 초위성체 유전자좌에서 출현 가능한 모든 대립유전자(allele)들을 혼합한 대립형질 사다리(allelic ladder)를 통한 통합 데이터베이스 구축 방법을 제공하는 것이다.It is also an object of the present invention to provide a method for constructing an integrated database through an allelic ladder in which all possible alleles in each locus of a supersatellite are mixed.

상기 목적을 달성하기 위하여, 본 발명은 한우 집단에 변별력을 가지는 초위성체 유전자좌를 선정, 증폭하여 대립유전자를 검출하고 대립형질 사다리를 적용하여 표준화된 유전자형을 결정하는 한우 개체 식별 방법을 제공한다. In order to accomplish the above object, the present invention provides a Hanwoo identification method for selecting and amplifying a supersatellite locus having discriminative power in a Hanwoo group to detect alleles and determining a standardized genotype by applying an allelic ladder.

바람직하게는, (a) 분석하고자 하는 핵산 시료를 얻는 단계; (b) 초위성체유전자좌를 선정하고 초위성체 유전자좌 각각에 특이적인 프라이머를 이용하여 멀티플렉스 피씨알로 증폭하는 단계; (c) 상기 (b)단계의 증폭된 산물을 전기영동을 통해 대립유전자를 검출하는 단계; 및 (d) 상기 (b) 단계의 초위성체 유전자좌의 대립유전자들로 이루어진 대립형질 사다리를 적용하여 (c) 단계의 대립유전자의 표준화된 유전자형을 결정하는 단계를 포함하는 한우 개체 식별 방법을 제공한다.Preferably, (a) obtaining a nucleic acid sample to be analyzed; (b) selecting the locus of the supersatellite locus and amplifying with multiplex PCR using a primer specific to each locus of the locus satellites; (c) detecting the allele by electrophoresis of the amplified product of step (b); And (d) determining the normalized genotype of the allele of step (c) by applying an allelic ladder comprising alleles of the supersatellite locus of step (b). .

초위성체 유전자좌 선정은 종합적인 증폭조건(프라이머의 어닐링(annealing)온도, 산물의 크기, 표지형광 물질)을 고려하여 선정하며, 농도에 맞게 프라이머를 혼합하여 증폭반응을 위한 반응액을 만든 다음, 초위성체 유전자좌들을 멀티플렉스피씨알(Multiplex PCR)방법으로 증폭한다. 증폭된 산물을 자동 DNA 시퀀서를 이용하여 분리하고, 각 좌위별 대립유전자(allele)의 분포 및 크기 등을 분석하고, 이러한 분석자료를 근거로하여 한우의 개체식별을 위한 유전자 마커를 선정하고, 감식방법을 제공한다.The selection of the supersatellite loci was made by considering the comprehensive amplification conditions (annealing temperature of the primer, product size, labeling fluorescent material), mixing the primers according to the concentration to prepare the reaction solution for the amplification reaction, The satellite loci are amplified by Multiplex PCR method. The amplified products were separated using an automatic DNA sequencer, and the distribution and size of the alleles of each locus were analyzed. Based on these analysis data, genetic markers were selected for identification of Korean beef cattle, ≪ / RTI >

초위성체 유전자좌의 선정은 대립유전자의 수가 최소 7개 이상, 증폭산물의 크기는 80bp이상 300bp이하의 유전자 표지를 사용하는 것이 바람직하다. 특히 프라이머의 제조는 어닐링(Annealing) 온도, 증폭산물의 크기 등 멀티플렉스 피씨알(Multiplex PCR)조건을 고려하여 제조해야 한다.It is desirable to use a genetic marker of at least 7 alleles and a size of amplified product of 80bp and 300bp. In particular, the preparation of the primer should be carried out in consideration of multiplex PCR conditions such as annealing temperature and amplification product size.

본 발명의 일실시예에서는 상기의 조건에 부합하는 초위성체 유전자좌위 TGLA227, BM2113, TGLA53, ETH10, SPS115, TGLA126, TGLA122, INRA23, ETH3, ETH225, BM1824, CA209, BM741을 선정하였으며, 상기의 초위성체 유전자좌위에서의 모든 출현 가능한 대립유전자들을 혼합한 대립형질 사다리(allelic ladder)를 제조하였다.In one embodiment of the present invention, supergene satellite loci TGLA227, BM2113, TGLA53, ETH10, SPS115, TGLA126, TGLA122, INRA23, ETH3, ETH225, BM1824, CA209 and BM741 were selected in accordance with the above- An allelic ladder was constructed by mixing all possible alleles on the locus.

대립형질 사다리는 TGLA227, BM2113, TGLA53, ETH10, SPS115, TGLA126, TGLA122, INRA23, ETH3, ETH225, BM1824, CA209 및 BM741에 대한 대립유전자 형을 마커별로 선발하는 단계; 선발된 대립유전자형을 중합효소연쇄반응(PCR)에 의하여 증폭하는 단계; 상기 증폭된 PCR 산물을 클로닝하고, 반복되는 염기서열을 확인하 는 단계; 및 상기 확인된 대립유전자형의 플라스미드 DNA를, 형광물질 표지된 프라이머를 이용하여 중합효소연쇄반응에 의하여 증폭하는 단계;를 통해 마커별로 PCR 산물을 수득하고, 상기 수득한 PCR 산물을 혼합하여 제조할 수 있다.Allelopathic ladders are selected by marker for allelic forms for TGLA227, BM2113, TGLA53, ETH10, SPS115, TGLA126, TGLA122, INRA23, ETH3, ETH225, BM1824, CA209 and BM741; Amplifying the selected allelic genotype by polymerase chain reaction (PCR); Cloning the amplified PCR product and identifying the repeated nucleotide sequence; And amplifying the plasmid DNA of the confirmed allelic form by a polymerase chain reaction using a fluorescently labeled primer to obtain a PCR product for each marker and mixing the obtained PCR product have.

본 발명에서 한우의 개체 식별을 위한 분석DNA샘플은 혈액, 모근 등에서 수득될 수 있으며, 상기 DNA 샘플에서 각 좌위별 프라이머들을 이용하여 멀티플렉스 피씨알(Multiplex PCR)로 증폭하고, 증폭된 산물을 자동 전기영동장치를 통해 대립유전자(allele)를 검출하며, 대립형질 사다리(allelic ladder)를 적용하여 표준화된 유전자형을 결정하는 단계를 통하여 한우 개체 식별이 기능하다.In the present invention, analytical DNA samples for individual identification of Hanwoo can be obtained from blood, hair roots, etc., and amplified by Multiplex PCR using the primers for each locus in the DNA sample, An allele is detected through an electrophoresis device, and an allelic ladder is applied to determine a standardized genotype.

본 발명의 프라이머로는 서열번호 1 내지 서열번호 26로 표시되는 염기서열을 가진 것일 수 있다.The primer of the present invention may be one having the nucleotide sequence shown in SEQ ID NO: 1 to SEQ ID NO: 26.

상기 프라이머의 염기서열의 일부를 다른 염기로 치환, 삭제하거나 일부 염기서열의 위치와 방향이 바뀐 염기서열도 본 발명에 따른 프라이머의 범위에 속한다. The nucleotide sequence of the nucleotide sequence of the nucleotide sequence of the nucleotide sequence of the nucleotide sequence of SEQ ID NO:

본 발명에 따른 한우 개체 분석 방법은 초위성체의 다수의 대립유전자를 신속하고 정확하게 분석할 수 있는 멀티플렉스 피씨알 기법과 대립형질 사다리(allelic ladder)를 제공함으로써 대립유전자에 관한 표준화된 통합 데이터베이스 구축을 가능케 하며, 한우 개체를 식별하는데 유용하게 사용될 수 있다.The method of analyzing Hanwoo according to the present invention provides a standardized integrated database on alleles by providing a multiplexed PCA technique and an allelic ladder that can quickly and accurately analyze a large number of alleles of a supersatellite And can be useful for identifying Hanwoo individuals.

따라서, 본 발명에 따른 한우 개체 분석 방법을 이용한 초위성제 유전자좌에 특이적인 프라이머, 초위성체 유전자좌의 대립형질 사다리(allelic ladder)를 포함하는 한우개체 식별용 키트도 본 발명의 범위 내에 포함되며, 이를 바탕으로 한 대 립유전자에 관한 표준화된 통합 데이터베이스 역시 본 발명의 기술적 사상에 포함될 수 있다. Therefore, a kennel identification kit including an allelic ladder of a primer and a supersatellite locus specific to a supersatellite locus using the method of analyzing a Korean native cattle according to the present invention is also included within the scope of the present invention. A standardized integrated database on an allele gene based on the present invention can also be included in the technical idea of the present invention.

본 발명에 따른 한우 개체 분석 방법 및 키트는 초위성체의 다수의 대립유전자를 신속하고 정확하게 분석할 수 있는 멀티플렉스 피씨알 기법과 대립형질 사다리(allelic ladder)를 제공함으로써 대립유전자에 관한 표준화된 통합 데이터베이스 구축을 가능케 하며, 한우 개체를 식별하는데 유용하게 사용될 수 있다. The method and kit for analyzing Hanwoo according to the present invention can provide a multiplexed PCA technique and an allelic ladder that can quickly and accurately analyze a large number of alleles of a supersagget, And can be used to identify Hanwoo entities.

이하, 본 발명의 이해를 돕기 위하여 바람직한 실시예 및 실험예를 제시한다. 그러나 하기의 실시예 및 실험예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐, 실시예에 의해 본 발명의 내용이 한정되는 것은 아니다.Hereinafter, preferred embodiments and experimental examples are provided to facilitate understanding of the present invention. However, the following examples and experimental examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the examples.

<실시예> 한우 개체 식별<Example> Identification of Korean Cattle

1.1. 공시 동물과 DNA1.1. Disclosure Animal and DNA

한우의 혈액은 경기도 지역의 5개 브랜드사업체의 번식우 165두의 혈액을 채취하여 공시재료로 사용하였다. 한우의 혈액에서 genomic DNA의 분리는 Genomic DNA 추출 키트(Qiagen, USA)를 이용하였다.The blood of Hanwoo was collected from 165 breeding stocks of five brand businesses in Gyeonggi province. Genomic DNA extraction kit (Qiagen, USA) was used for the isolation of genomic DNA from blood of Hanwoo.

1.2. 초위성체 유전자좌의 선발1.2. Selection of ultra-satellites locus

본 실험에 사용된 초위성체 유전자좌는 Applied Biosystems사의 Stockmarker™, International Society for Animal Genetics(http://www.isag.org.uk/ISAG/all/02_PVpanels_LPCGH.doc)과 Roslin 연구소(http://www.projects.roslin.ac.uk/cdiv/markers.html) 그리고, 미국국립생물공학정보센터(NCBI,National Center for Biotechnology Information, http://www.ncbi.nlm.nih.gov/genome/sts/sts.cgi?uid=250931, http://www.ncbi.nlm.nih.gov/genome/sts/sts.cgi?uid=48737)에서 제안한 소의 다형성 분석용 초위성체 유전자좌들을 기초로 하여 선정하였다(표1).The supersatellite loci used in this experiment were obtained from Applied Biosystems' Stockmarker (TM), International Society for Animal Genetics (http://www.isag.org.uk/ISAG/all/02_PVpanels_LPCGH.doc) and the Roslin Institute .projects.roslin.ac.uk / cdiv / markers.html), and the National Center for Biotechnology Information (NCBI), http://www.ncbi.nlm.nih.gov/genome/sts/ sts.cgi? uid = 250931 , http://www.ncbi.nlm.nih.gov/genome/sts/sts.cgi?uid=48737) were selected based on the supersatellite loci for polymorphism analysis Table 1).

소의 다형성 분석용 초위성체 유전자좌Supersatellite locus for polymorphism analysis of cattle 유전자좌Locus 염색체위치Chromosome location (bp)(bp) 프라이머 서열Primer sequence 서열번호SEQ ID NO: TGLA227TGLA227 1818 76~10476 ~ 104 FF CGAATTCCAAATCTGTTAATTTGCTCGAATTCCAAATCTGTTAATTTGCT 1One RR ACAGACAGAAACTCAATGAAAGCAACAGACAGAAACTCAATGAAAGCA 22 BM2113BM2113 22 123~143123 ~ 143 FF GCTGCCTTCTACCAAATACCCGCTGCCTTCTACCAAATACCC 33 RR CTTCCTGAGAGAAGCAACACCCTTCCTGAGAGAAGCAACACC 44 TGLA53TGLA53 1616 154~188154 ~ 188 FF GCTTTCAGAAATAGTTTGCATTCAGCTTTCAGAAATAGTTTGCATTCA 55 RR ATCTTCACATGATATTACAGCAGAATCTTCACATGATATTACAGCAGA 66 ETH10ETH10 55 212~224212-224 FF GTTCAGGACTGGCCCTGCTAACAGTTCAGGACTGGCCCTGCTAACA 77 RR CCTCCAGCCCACTTTCTCTTCTCCCTCCAGCCCACTTTCTCTTCTC 88 SPS115SPS115 1515 246~260246-260 FF AAAGTGACACAACAGCTTCTCCAGAAAGTGACACAACAGCTTCTCCAG 99 RR AACGAGTGTCCTAGTTTGGCTGTGAACGAGTGTCCTAGTTTGGCTGTG 1010 TGLA126TGLA126 2121 95-12195-121 FF CTAATTTAGAATGAGAGAGGCTTCTCTAATTTAGAATGAGAGAGGCTTCT 1111 RR TTGGTCTCTATTCTCTGAATATTCCTTGGTCTCTATTCTCTGAATATTCC 1212 TGLA122TGLA122 2121 137~181137-181 FF CCCTCCTCCAGGTAAATCAGCCCCTCCTCCAGGTAAATCAGC 1313 RR AATCACATGGCAAATAAGTACATACAATCACATGGCAAATAAGTACATAC 1414 INRA23INRA23 33 196~222196-222 FF GAGTAGAGCTACAAGATAAACTTCGAGTAGAGCTACAAGATAAACTTC 1515 RR TAACTACAGGGTGTTAGATGAACTCTAACTACAGGGTGTTAGATGAACTC 1616 ETH3ETH3 1919 90-11890-118 FF GAACCTGCCTCTCCTGCATTGGGAACCTGCCTCTCCTGCATTGG 1717 RR ACTCTGCCTGTGGCCAAGTAGGACTCTGCCTGTGGCCAAGTAGG 1818 ETH225ETH225 99 141~159141 ~ 159 FF GATCACCTTGCCACTATTTCCTGATCACCTTGCCACTATTTCCT 1919 RR ACATGACAGCCAGCTGCTACTACATGACAGCCAGCTGCTACT 2020 BM1824BM1824 1One 178~192178-192 FF GAGCAAGGTGTTTTTCCAATCGAGCAAGGTGTTTTTCCAATC 2121 RR CATTCTCCAACTGCTTCCTTGCATTCTCCAACTGCTTCCTTG 2222 CA209CA209 113~150113-150 FF GTAGAAGTTAGTGACTGTCATCCGTAGAAGTTAGTGACTGTCATCC 2323 RR CCTCAGAGCCCCATACATTTCCCCTCAGAGCCCCATACATTTCC 2424 BM741BM741 186~196186-196 FF GCCCCTGAAGGAATGGTGGCCCCTGAAGGAATGGTG 2525 RR CCAAAAGGTCCTATCTCCAAACCAAAAGGTCCTATCTCCAAA 2626

1.3. 프라이머의 제작 및 형광물질 표지1.3. Preparation of primers and labeling of fluorescent materials

본 발명에 사용된 프라이머는 AppliedBiosystems사(USA)에서 주문 제작하였으며, 각 유전자좌의 명칭, 표지 형광물질 및 프라이머 염기서열은 상기 표1과 같다. The primers used in the present invention were customized by Applied Biosystems (USA), and the names of the respective loci, the label fluorescent materials and the primer base sequences are shown in Table 1 above.

형광물질은 한쌍의 증폭 프라이머 중 한 가지의 서열에만 표지시켰으며, 표지에 사용된 형광물질은 6-FAM(6-carboxylfluorescein), VIC, NED, PET등이었다.The fluorescent material was labeled only in one of the pair of amplification primers, and the fluorescent materials used in the labeling were 6-FAM (6-carboxylfluorescein), VIC, NED, PET and the like.

1.4. Multiplex PCR 및 MS 분석1.4. Multiplex PCR and MS analysis

Multiplex PCR은 최종 부피가 15㎕가 되도록 하였으며, 주형 DNA는 50ng, 프라이머 혼합물 2ul, dNTP의 농도는 0.25mM로 하였다. 또한 Taq DNA polymerase 0.5 unit((주)젠닥스), 10 × buffer 1.5㎕를 첨가하였고, 멸균 3차 증류수로 최종 부피를 맞추었다. PCR 조건은 95℃에서 15분간 denaturation을 실시한 후 95℃에서 50초, 56℃에서 70초, 72℃에서 70초를 1 cycle로 하여 32회 반복하였다. 그 후 65℃에서 30분 후 8℃에서 종료하였다.Multiplex PCR was performed to obtain a final volume of 15 μl, 50 ng of template DNA, 2 μl of primer mixture, and dNTP concentration of 0.25 mM. In addition, 0.5 unit of Taq DNA polymerase (Zengdaks Co., Ltd.) and 1.5 10 of 10 × buffer were added and the final volume was adjusted with sterilized tertiary distilled water. The PCR conditions were denaturation at 95 ° C for 15 minutes, followed by 32 cycles of 95 ° C for 50 seconds, 56 ° C for 70 seconds, and 72 ° C for 70 seconds. And then terminated at 65 ° C for 30 minutes and then at 8 ° C.

초위성체 유전자좌 분석을 위하여, 각각의 PCR 최종산물의 증폭 여부 및 농도를 확인하기 위하여 3% 아가로스젤에서 1차 전기영동을 실시한 후, 자동염기서열 분석장치인 AppliedBiosystems 3130xl Genetic Analyzer(AppliedBiosystems, USA)에서 2차 전기영동을 하기위하여 약 80배 증류수로 희석을 하였다. 크기별로 분획을 시키기 위하여, GeneScanTM-500 LIZ Size Standard 및 Hi-Di Formamide (AppliedBiosystems, USA)혼합물을 1:9로 희석하여 전기영동을 실시하였다. In order to confirm the amplification status and the concentration of each PCR product, first electrophoresis was carried out on 3% agarose gel, and then, using Applied Biosystems 3130xl Genetic Analyzer (Applied Biosystems, USA) Was diluted with distilled water to about 80 times for the second electrophoresis. For fractionation by size, a 1: 9 mixture of GeneScan ™ 500 LIZ Size Standard and Hi-Di Formamide (Applied Biosystems, USA) was diluted and electrophoresed.

또한 모든 초위성체에 대한 대립형질 사다리(allelic ladder)를 PCR 최종산물의 전기영동과 마찬가지로 GeneScanTM-500 LIZ Size Standard 및 Hi-Di Formamide (AppliedBiosystems, USA)혼합물과 1:9로 희석하여 전기영동을 실시하였다.The allelic ladder for all supersell bodies was diluted 1: 9 with a mixture of GeneScan ™ 500 LIZ Size Standard and Hi-Di Formamide (Applied Biosystems, USA) as well as electrophoresis of PCR final products. Respectively.

전기영동이 끝난 후, GeneMapper 4.0(AppliedBiosystems, USA)을 이용하여 각 초위성체 유전자좌의 증폭 크기와 표식자의 종류를 확인하고, 표 2처럼 대립형질 사다리(allelic ladder)를 통해 표준화된 결과값을 도출하였다.After the electrophoresis, amplification size and marker type of each supersatellite locus were confirmed using GeneMapper 4.0 (Applied Biosystems, USA), and standardized results were obtained through an allelic ladder as shown in Table 2 .

샘플Sample 초위성체Super satellites Size 1Size 1 Size 2Size 2 A1A1 A2A2 ControlControl TGLA227TGLA227 88.0788.07   1414   BM2113BM2113 140.54140.54 142.65142.65 2020 2121 TGLA53TGLA53 164.41164.41 174.48174.48 2323 2828 ETH10ETH10 221.96221.96 227.74227.74 1919 2222 SPS115SPS115 249.59249.59 251.51251.51 2121 2222 TGLA126TGLA126 123.49123.49 131.93131.93 1717 2121 TGLA122TGLA122 147.15147.15 151.81151.81 2424 2626 INRA23INRA23 211.62211.62 219.32219.32 2020 2424 ETH3ETH3 122.81122.81   2323   ETH225ETH225 146.38146.38 148.57148.57 2323 2424 BM1824BM1824 189.45189.45   1414   CA209CA209 142.52142.52   2424   BM741BM741 192.23192.23 194.32194.32 1717 1818

SAS V8.2(USA) 통계프로그램을 이용하여 도출된 값들에 대한 통계처리를 실시하였으며, 표 3과 같은 이형접합률(He, Heterozygosity), 다형정보지수(PIC, Polymorphic Information Content) 등을 확보하였다.Statistical analysis was performed on the values derived using the SAS V8.2 (USA) statistical program, and the heterozygosity (He, Heterozygosity) and polymorphic information content (PIC) .

각 유전자좌위별 다형성지수인 및 기타 정보들을 하기에 표시한 표 3과 같이 알 수 있었다.The polymorphism index and other information for each gene locus were found as shown in Table 3 below.

초위성체의 다형성 지수Polymorphism index of supersatellite LocusLocus
LableLable
NN
No. of allelesNo. of alleles
Size(bp)Size (bp)
HeHe
PICPIC
TGLA227
TGLA227
B(FAM)
B (FAM)
351
351
13
13
76~115
76 ~ 115
0.830
0.830
0.808
0.808
BM2113
BM2113
B(FAM)
B (FAM)
339
339
11
11
123~156
123 ~ 156
0.744
0.744
0.708
0.708
TGLA53
TGLA53
B(FAM)
B (FAM)
315
315
17
17
158~196
158-196
0.872
0.872
0.858
0.858
ETH10
ETH10
B(FAM)
B (FAM)
345
345
8
8
212~230
212-230
0.761
0.761
0.720
0.720
SPS115
SPS115
B(FAM)
B (FAM)
351
351
7
7
240~270
240 ~ 270
0.766
0.766
0.733
0.733
TGLA126
TGLA126
G(VIC)
G (VIC)
318
318
7
7
116~136
116-136
0.661
0.661
0.616
0.616
TGLA122
TGLA122
G(VIC)
G (VIC)
334
334
19
19
137~195
137-195
0.863
0.863
0.847
0.847
INRA23
INRA23
G(VIC)
G (VIC)
347
347
11
11
196~222
196-222
0.756
0.756
0.721
0.721
ETH3
ETH3
Y(NED)
Y (NED)
298
298
8
8
105~137
105 ~ 137
0.759
0.759
0.720
0.720
ETH225
ETH225
Y(NED)
Y (NED)
345
345
8
8
141~170
141-170
0.651
0.651
0.609
0.609
BM1824
BM1824
Y(NED)
Y (NED)
357
357
7
7
176~200
176-200
0.656
0.656
0.600
0.600
CA209
CA209
R(PET)
R (PET)
343
343
11
11
113~150
113-150
0.467
0.467
0.447
0.447
BM741
BM741
R(PET)
R (PET)
251
251
3
3
186~196
186-196
0.326
0.326
0.275
0.275

가장 많은 대립유전자(allele)의 개수는 TGLA122에서 나타난 19개였으며, TGLA53은 가장 높은 He(0.872)와 PIC(0.858)값을 갖는 초위성체였다. 이러한 결과는 대립유전자(allele)의 개수가 많더라도 출현빈도가 편귀될 수 있음을 나타내는 것이며, He와 PIC 값의 최상위 초위성체가 다른 것은 대립유전자(allele)의 개수와 빈도에 의한 추정 계산식 차이에 의한 것이다.The highest number of alleles was 19 in TGLA122 and TGLA53 was the highest in He (0.872) and PIC (0.858). These results indicate that the frequency of occurrence of alleles can be increased even though the number of alleles is large. The difference between the He and PIC values is different from that of the estimation formula due to the number and frequency of alleles .

아래 표 4에서처럼 13개의 초위성체 마커를 사용하여 통계처리 하였을 경우 무작위 교배집단에서 동일개체가 출현할 확률은 2.27 × 10-28로 나타났으며, 이는 국내 한육우의 전체 사육두수 2,448,305 두(2008년 2사분기 , 농림부 통계자료)를 고려하더라도 동일개체가 출현할 확률이 없는 것으로 판단된다. As shown in Table 4 below, the probability of occurrence of the same individuals in the random mating group was 2.27 × 10 -28 when the statistical treatment was performed using the 13 satellites markers, which was 2,448,305 The statistics of the Ministry of Agriculture and Forestry), it is considered that there is no probability that the same individuals will appear.

통계분석 결과Statistical analysis results HH ee PICPIC PEPE PEPE pupu PIPI PIPI half-sibshalf-sibs 0.70100.7010 0.66640.6664 0.9999420.999942 0.9966230.996623 2.27× 10-28 2.27 x 10 -28 5.19 × 10-20 5.19 × 10 -20

도 1은 13개의 초위성체 유전자좌에 대한 멀티플렉스 피씨알(multiplex PCR)로 획득된 산물을 자동염기서열 분석장치에서 분석한 전기영동상을 나타낸다.FIG. 1 shows an electrophoresis image obtained by analyzing products obtained by multiplex PCR on 13 locus loci of a satellites in an automatic base sequence analyzer.

도 2는 13개 초위성체 유전자좌에 대한 대립형질 사다리(allelic ladder)를 자동염기서열 분석장치에서 분석한 전기영동상을 나타낸다.FIG. 2 shows an electrophoresis image obtained by analyzing an allelic ladder to 13 locus locus loci in an automatic base sequence analyzer.

도 3a는 13개의 초위성체 유전자좌에 대한 멀티플렉스 피씨알(multiplex PCR)로 획득된 산물을 자동염기서열 분석장치에서 전기영동 한 후,대립형질 사다리(allelic ladder)를 적용하지 않고 분석한 결과이다.FIG. 3A shows the results obtained by performing an electrophoresis on products obtained by multiplex PCR on 13 loci of the supersatellite loci in an automatic base sequence analyzer, and then analyzing them without applying an allelic ladder.

도 3b는 13개의 초위성체 유전자좌에 대한 멀티플렉스 피씨알(multiplex PCR)로 획득된 산물을 자동염기서열 분석장치에서 전기영동 한 후 대립형질 사다리(allelic ladder)를 적용하여 표준화된 결과값으로 변환된 결과이다.FIG. 3B shows a result obtained by multiplex PCR of 13 loci of a supersatellite locus by electrophoresis in an automatic sequencer, and then transformed into a standardized result by applying an allelic ladder Results.

<110> HANKYONG INDUSTRY ACADEMIC COOPERATION CENTER <120> Method and Kit for identification of Korean cattle <160> 26 <170> KopatentIn 1.71 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> TGLA227 forward primer <400> 1 cgaattccaa atctgttaat ttgct 25 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> TGLA227 reverse primer <400> 2 acagacagaa actcaatgaa agca 24 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> BM2113 forward primer <400> 3 gctgccttct accaaatacc c 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> BM2113 reverse primer <400> 4 cttcctgaga gaagcaacac c 21 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> TGLA53 forward primer <400> 5 gctttcagaa atagtttgca ttca 24 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> TGLA53 reverse primer <400> 6 atcttcacat gatattacag caga 24 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> ETH10 forward primer <400> 7 gttcaggact ggccctgcta aca 23 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> ETH 10 reverse primer <400> 8 cctccagccc actttctctt ctc 23 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SPS115 forward primer <400> 9 aaagtgacac aacagcttct ccag 24 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SPS115 reverse primer <400> 10 aacgagtgtc ctagtttggc tgtg 24 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> TGLA126 forward primer <400> 11 ctaatttaga atgagagagg cttct 25 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> TGLA126 reverse primer <400> 12 ttggtctcta ttctctgaat attcc 25 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TGLA122 forward primer <400> 13 ccctcctcca ggtaaatcag c 21 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> TGLA122 reverse primer <400> 14 aatcacatgg caaataagta catac 25 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> INRA23 forward primer <400> 15 gagtagagct acaagataaa cttc 24 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> INRA23 reverse primer <400> 16 taactacagg gtgttagatg aactc 25 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ETH3 forward primer <400> 17 gaacctgcct ctcctgcatt gg 22 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ETH3 reverse primer <400> 18 actctgcctg tggccaagta gg 22 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ETH225 forward primer <400> 19 gatcaccttg ccactatttc ct 22 <210> 20 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ETH225 reverse primer <400> 20 acatgacagc cagctgctac t 21 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> BM1824 forward primer <400> 21 gagcaaggtg tttttccaat c 21 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> BM1824 reverse primer <400> 22 cattctccaa ctgcttcctt g 21 <210> 23 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CA209 forward primer <400> 23 gtagaagtta gtgactgtca tcc 23 <210> 24 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CA209 reverse primer <400> 24 cctcagagcc ccatacattt cc 22 <210> 25 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> BM741 forward primer <400> 25 gcccctgaag gaatggtg 18 <210> 26 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> BM741 reverse primer <400> 26 ccaaaaggtc ctatctccaa a 21 <110> HANKYONG INDUSTRY ACADEMIC COOPERATION CENTER <120> Method and Kit for identification of Korean cattle <160> 26 <170> Kopatentin 1.71 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> TGLA227 forward primer <400> 1 cgaattccaa atctgttaat ttgct 25 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> TGLA227 reverse primer <400> 2 acagacagaa actcaatgaa agca 24 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> BM2113 forward primer <400> 3 gctgccttct accaaatacc c 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> BM2113 reverse primer <400> 4 cttcctgaga gaagcaacac c 21 <210> 5 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> TGLA53 forward primer <400> 5 gctttcagaa atagtttgca ttca 24 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> TGLA53 reverse primer <400> 6 atcttcacat gatattacag caga 24 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> ETH10 forward primer <400> 7 gttcaggact ggccctgcta aca 23 <210> 8 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> ETH 10 reverse primer <400> 8 cctccagccc actttctctt ctc 23 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SPS115 forward primer <400> 9 aaagtgacac aacagcttct ccag 24 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> SPS115 reverse primer <400> 10 aacgagtgtc ctagtttggc tgtg 24 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> TGLA126 forward primer <400> 11 ctaatttaga atgagagag cttct 25 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> TGLA126 reverse primer <400> 12 ttggtctcta ttctctgaat attcc 25 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> TGLA122 forward primer <400> 13 ccctcctcca ggtaaatcag c 21 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> TGLA122 reverse primer <400> 14 aatcacatgg caaataagta catac 25 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> INRA23 forward primer <400> 15 gagtagagct acaagataaa cttc 24 <210> 16 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> INRA23 reverse primer <400> 16 taactacagg gtgttagatg aactc 25 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ETH3 forward primer <400> 17 gaacctgcct ctcctgcatt gg 22 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ETH3 reverse primer <400> 18 actctgcctg tggccaagta gg 22 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ETH225 forward primer <400> 19 gatcaccttg ccactatttc ct 22 <210> 20 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> ETH225 reverse primer <400> 20 acatgacagc cagctgctac t 21 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> BM1824 forward primer <400> 21 gagcaaggtg tttttccaat c 21 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> BM1824 reverse primer <400> 22 cattctccaa ctgcttcctt g 21 <210> 23 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> CA209 forward primer <400> 23 gtagaagtta gtgactgtca tcc 23 <210> 24 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> CA209 reverse primer <400> 24 cctcagagcc ccatacattt cc 22 <210> 25 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> BM741 forward primer <400> 25 gcccctgaag gaatggtg 18 <210> 26 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> BM741 reverse primer <400> 26 ccaaaaggtc ctatctccaa a 21

Claims (10)

(a) 분석하고자 하는 핵산 시료를 얻는 단계;(a) obtaining a nucleic acid sample to be analyzed; (b) TGLA227, BM2113, TGLA53, ETH10, SPS115, TGLA126, TGLA122, INRA23, ETH3, ETH225, BM1824, CA209 및 BM741 로 이루어진 13개의 초위성체 유전자좌에 특이적인 프라이머를 이용하여 멀티플렉스 피씨알로 증폭하는 단계;(b) amplifying with multiplex PCR using primers specific to 13 locus loci comprising TGLA227, BM2113, TGLA53, ETH10, SPS115, TGLA126, TGLA122, INRA23, ETH3, ETH225, BM1824, CA209 and BM741; (c) 상기 (b)단계의 증폭된 산물을 전기영동을 통해 대립유전자를 검출하는 단계; 및(c) detecting the allele by electrophoresis of the amplified product of step (b); And (d) 상기 (b) 단계의 초위성체 유전자좌의 대립유전자들로 이루어진 대립형질 사다리를 적용하여 (c) 단계의 대립유전자의 표준화된 유전자형을 결정하는 단계를 포함하는 한우 개체 식별 방법.(d) determining the normalized genotype of the allele of step (c) by applying an allelic ladder consisting of alleles of the supersatellite locus of step (b). 제1항에 있어서, 상기 초위성체 유전자좌는 대립유전자 수가 7 이상이고, 증폭산물의 크기가 80bp이상 300bp이하 인 것을 특징으로 하는 한우 개체 식별 방법.2. The method of claim 1, wherein the locus of the supersatellite locus has an allele number of 7 or more and a size of the amplified product is 80 bp or more and 300 bp or less. 삭제delete 제1항에 있어서, 상기 (a) 단계의 핵산 시료는 분석하고자 하는 소의 혈액 또는 모근임을 특징으로 하는 한우 개체 식별 방법.[2] The method of claim 1, wherein the nucleic acid sample in step (a) is blood or hair roots of cow to be analyzed. 제1항에 있어서, 상기 (b) 단계의 프라이머는 서열번호 1 내지 26으로 표시되는 염기서열로 이루어진 프라이머 세트 중에서 선택되는 것임을 특징으로 하는 한우 개체 식별 방법.The method according to claim 1, wherein the primer of step (b) is selected from a set of primers consisting of the nucleotide sequences of SEQ ID NOS: 1 to 26. 제1항에 있어서, 상기 대립형질 사다리는 TGLA227, BM2113, TGLA53, ETH10, SPS115, TGLA126, TGLA122, INRA23, ETH3, ETH225, BM1824, CA209 및 BM741에 대한 대립유전자 형을 마커별로 선발하는 단계; 선발된 대립유전자형을 중합효소연쇄반응(PCR)에 의하여 증폭하는 단계; 상기 증폭된 PCR 산물을 클로닝하고, 반복되는 염기서열을 확인하는 단계; 및 상기 확인된 대립유전자형의 플라스미드 DNA를, 형광물질 표지된 프라이머를 이용하여 중합효소연쇄반응에 의하여 증폭하는 단계;를 통해 마커별로 PCR 산물을 수득하고, 상기 수득한 PCR 산물을 혼합하여 얻어진 것을 특징으로 하는 한우 개체 식별 방법.2. The method of claim 1, wherein the allelic ladder comprises allelic forms selected by markers for TGLA227, BM2113, TGLA53, ETH10, SPS115, TGLA126, TGLA122, INRA23, ETH3, ETH225, BM1824, CA209 and BM741. Amplifying the selected allelic genotype by polymerase chain reaction (PCR); Cloning the amplified PCR product and confirming the repeated base sequence; And amplifying the plasmid DNA of the confirmed allelic form by a polymerase chain reaction using a fluorescent substance-labeled primer to obtain a PCR product for each marker and mixing the obtained PCR product To identify Hanwoo individuals. TGLA227, BM2113, TGLA53, ETH10, SPS115, TGLA126, TGLA122, INRA23, ETH3, ETH225, BM1824, CA209 및 BM741 로 이루어진 13개의 초위성체 유전자좌에 특이적인 프라이머 및; 초위성체 유전자좌의 대립형질 사다리를 포함하는 한우 개체 식별용 키트.Primers specific for 13 locus loci consisting of TGLA227, BM2113, TGLA53, ETH10, SPS115, TGLA126, TGLA122, INRA23, ETH3, ETH225, BM1824, CA209 and BM741; A kennel identification kit containing an allelic ladder of supersatellite loci. 제7항에 있어서, 상기 프라이머가 서열번호 1 내지 26으로 표시되는 염기서열로 이루어진 프라이머 세트 중에서 선택되는 것임을 특징으로 하는 한우개체 식 별용 키트. 8. The kit according to claim 7, wherein the primer is selected from the set of primers consisting of the nucleotide sequence shown in SEQ ID NOs: 1-26. 삭제delete 제7항에 있어서, 상기 대립형질 사다리는 TGLA227, BM2113, TGLA53, ETH10, SPS115, TGLA126, TGLA122, INRA23, ETH3, ETH225, BM1824, CA209 및 BM741에 대한 대립유전자 형을 마커별로 선발하는 단계; 선발된 대립유전자형을 중합효소연쇄반응(PCR)에 의하여 증폭하는 단계; 상기 증폭된 PCR 산물을 클로닝하고, 반복되는 염기서열을 확인하는 단계; 및 상기 확인된 대립유전자형의 플라스미드 DNA를, 형광물질 표지된 프라이머를 이용하여 중합효소연쇄반응에 의하여 증폭하는 단계;를 통해 마커별로 PCR 산물을 수득하고, 상기 수득한 PCR 산물을 혼합하여 얻어진 것을 특징으로 하는 한우 개체 식별용 키트.The method according to claim 7, wherein the allelic ladder comprises alleles of the TGLA227, BM2113, TGLA53, ETH10, SPS115, TGLA126, TGLA122, INRA23, ETH3, ETH225, BM1824, CA209 and BM741 by marker. Amplifying the selected allelic genotype by polymerase chain reaction (PCR); Cloning the amplified PCR product and confirming the repeated base sequence; And amplifying the plasmid DNA of the confirmed allelic form by a polymerase chain reaction using a fluorescent substance-labeled primer to obtain a PCR product for each marker and mixing the obtained PCR product A kit for identifying a Hanwoo body.
KR1020080097566A 2008-10-06 2008-10-06 Method and Kit for identification of Korean cattle KR101557407B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020080097566A KR101557407B1 (en) 2008-10-06 2008-10-06 Method and Kit for identification of Korean cattle

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020080097566A KR101557407B1 (en) 2008-10-06 2008-10-06 Method and Kit for identification of Korean cattle

Publications (2)

Publication Number Publication Date
KR20100038550A KR20100038550A (en) 2010-04-15
KR101557407B1 true KR101557407B1 (en) 2015-10-12

Family

ID=42215241

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020080097566A KR101557407B1 (en) 2008-10-06 2008-10-06 Method and Kit for identification of Korean cattle

Country Status (1)

Country Link
KR (1) KR101557407B1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN107794304B (en) * 2017-09-18 2021-02-26 中国农业科学院兰州畜牧与兽药研究所 Genotyping detection kit for yak individual identification and paternity test

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Int. J. Legal. Med., Vol. 111, No. 5, pp. 267-272 (1998)*

Also Published As

Publication number Publication date
KR20100038550A (en) 2010-04-15

Similar Documents

Publication Publication Date Title
Ramamoorthi et al. Genetic characterization of Barbari goats using microsatellite markers
Oliveira et al. Species identification using a small nuclear gene fragment: application to sympatric wild carnivores from South-western Europe
US20100016653A1 (en) Quantitative Trait Loci and Somatostatin
KR101777161B1 (en) A Multiplex SNP marker composition and a method for diagnosis or prediction of canine hip dysplasia using same marker
MXPA06009452A (en) Leptin promoter polymorphisms and uses thereof.
Rincón et al. Genomic polymorphism in Uruguayan Creole cattle using RAPD and microsatellite markers
KR20160080858A (en) Composition for identifying meat
Fernández et al. DNA tests based on coat colour genes for authentication of the raw material of meat products from Iberian pigs
KR101448121B1 (en) Method for identifying duck using multiplex PCR
KR101351990B1 (en) Single Nucleotide Polymorphisms for Individual Identification of Hanwoo and Use Thereof
KR101557407B1 (en) Method and Kit for identification of Korean cattle
KR101535925B1 (en) Microsatellite markers for identification of goats
KR101557408B1 (en) Method and Kit for identification of Korean cattle
KR101677127B1 (en) Primer set for genotyping of horse
KR20180050470A (en) Microsatellite Marker For Identification of Korean Native Chicken And Method For Identification Using The Same
KR102043119B1 (en) The composition comprising SNP marker for identifying breed of jejuwoo, a kit containing the same, and a discriminant method using the same
KR101355914B1 (en) Single Nucleotide Polymorphism Marker Useful for Identification of Hanwoo from Imported Cow and Its Use
KR20090028894A (en) Method for identification korean cattle using multiplex pcr
CA2533078A1 (en) Improving production characteristics of cattle
KR100901817B1 (en) A primer sets for constructing traceability in hanwoo and method of selecting hanwoo by using the said primer set same
KR101821554B1 (en) Method for identification of Chikso breed genotype using microsatellite markers
KR102083675B1 (en) Method for identification of Chikso breed using single nucleotide polymorphism markers
KR102336624B1 (en) Marker for predicting collagen content in pork and use thereof
KR101289484B1 (en) Method of genetic test for diagnosis of marbling trait in Korean cattle
KR102001528B1 (en) Gene marker for discrimination of Korean Native pig and use thereof

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
FPAY Annual fee payment

Payment date: 20190702

Year of fee payment: 5