KR20220110443A - Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Rhododendron brachycarpum extract, Codonopsis Pilosulae Radix extract, or Sophora flavescens extract, or active component separated therefrom as an active ingredient - Google Patents

Abstract

The present invention relates to a composition for preventing or treating muscle disease or improving muscle functions, containing extracts of Rhododendron fauriei, Codonopsis pilosula, or Sophora flavescens, or a substance separated from the same as an active component. Extracts of Rhododendron fauriei, Codonopsis pilosula, and sophora flavescens, icariside B2, creoside IV, or kuraridinol improves the function of mitochondria and promotes the differentiation of myoblasts and the formation of myotubes, so that it is possible to be used as a material for medicines and foods by having an effect of preventing or treating muscle diseases or improving muscle functions.

Description

A composition for preventing or treating or improving muscle function, comprising an extract or a substance isolated therefrom as an active ingredient Pilosulae Radix extract, or Sophora flavescens extract, or active component separated therefrom as an active ingredient}

The present invention relates to a composition for preventing or treating muscle disease, or for improving muscle function, comprising, as an active ingredient, an extract of Manbyeongcho, Dangsaeng ginseng, or ginseng extract or a substance isolated therefrom.

Muscle is an important component of the human body and is a tissue expressed in stem cells of the mesoderm. Muscles are responsible for about 40% of our body, are supported by bones and tendons, and are made up of bundles of muscle fibers to move with each other and change the size of cells to cause contraction. Muscles are divided into skeletal muscles, cardiac muscles, and visceral muscles, which generate force at each position and induce movement, and also play a role in protecting body organs such as bones, joints, and internal organs. In addition, the muscle has the ability to regenerate, and when the muscle is damaged, it can be regenerated into a muscle having the original contractility and relaxation ability after being denatured by the satellite cells and the surrounding environment.

Muscle diseases are caused by congenital genetic or environmental causes, and diseases related to muscle loss are increasing with the recent aging society and the flow of life extension. Human muscle decreases by more than 1% every year after the age of 40, and 50% of the maximum muscle mass decreases at the age of 80, so muscle loss in old age is recognized as the most important cause of lowering overall physical function. These muscle diseases are on the increase worldwide compared to the past.

However, since the causes of muscle diseases are more diverse than other diseases, accurate diagnosis is not easy, symptoms and disease intensity vary depending on the type, and the exact mechanism is often unknown in the form of rare diseases. In addition, the symptoms of muscle disease progress rapidly, and as the disease progresses, patients with muscle disease suffer to the extent that it is difficult for them to live their daily lives alone. there is no situation.

On the other hand, "Rhododendron brachycarpum" is a plant belonging to the family Rhododendron, and has been known to be effective in bronchial diseases such as asthma, cough, and phlegm from ancient times. "Dangsam (Codonopsis pilosulate radix)" is a plant of the Bellflower family, and its roots have been mainly used since ancient times, and it is known to be effective in increasing leukocytes and lung cancer. "Sophora flavescens" is a plant belonging to the legume family, and has been mainly used for root parts since ancient times and is known for its anti-tumor, antibacterial, and immune-suppressing effects, such as lowering blood sugar.

However, there was no known previously known effect of preventing or treating muscle-related diseases, or improving muscle function, for panacea, ginseng, ginseng, or icaricide B2, creoside IV, or curaridinol isolated therefrom.

Under this background, the present inventors made diligent efforts to develop a composition effective for the prevention or treatment of muscle-related diseases or improvement of muscle function from substances derived from natural materials, and as a result, Manbyeongcho, ginseng, ginseng extract or icaricide, an active substance isolated therefrom The present invention was completed by confirming that B2, creoside IV or claridinol had an effect.

Republic of Korea Patent Publication No. 10-2016-0066253

It is an object of the present invention to provide a composition for preventing or treating muscle disease or improving muscle function, which includes a bay leaf extract, ginseng extract, ginseng extract, Icaricide B2, creoside IV, or curaridinol as an active ingredient.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating muscle disease, or for improving muscle function, comprising a panacea extract, ginseng extract, ginseng extract, Icaricide B2, creoside IV, or curaridinol as an active ingredient. will be.

Another object of the present invention is to provide a quasi-drug composition for preventing or treating muscle disease, or for improving muscle function, which includes an extract of bay leaf extract, ginseng extract, ginseng extract, Icariside B2, creoside IV, or curaridinol as an active ingredient. .

Another object of the present invention is to provide a food composition for preventing or treating muscle disease, or for improving muscle function, comprising a panacea extract, ginseng extract, ginseng extract, Icaricide B2, creoside IV, or curaridinol as an active ingredient. .

Another object of the present invention is to provide a health functional food for preventing or treating muscle disease, or for improving muscle function, comprising a panacea extract, ginseng extract, ginseng extract, Icaricide B2, creoside IV, or curaridinol as an active ingredient. will be.

Another object of the present invention is to provide a feed composition for preventing or treating muscle disease, or for improving muscle function, comprising a panacea extract, ginseng extract, ginseng extract, Icaricide B2, creoside IV, or curaridinol as an active ingredient. .

Another object of the present invention is to obtain an extract from Manbyeongcho; obtaining a sugar ginseng extract from sugar ginseng; Or to provide a method for preparing a composition for preventing or treating or improving muscle function, comprising the step of obtaining a ginseng extract from ginseng.

Another object of the present invention comprises the steps of separating Icariside B2 from the Manbyeongcho extract; separating creoside IV from the ginseng extract; Or to provide a method for preparing a composition for preventing or treating muscle disease, or for improving muscle function, comprising the step of isolating claridinol from ginseng extract.

This will be described in detail as follows. Meanwhile, each description and embodiment disclosed in the present application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. In addition, it cannot be seen that the scope of the present application is limited by the detailed description described below.

As an aspect for achieving the above object, the present invention provides for preventing or treating muscle disease or improving muscle function, comprising a bay leaf extract, ginseng extract, ginseng extract, Icaricide B2, creoside IV, or claridinol as an active ingredient. A pharmaceutical composition for use is provided.

In the present invention, the term "extract" refers to a liquid component obtained by immersing a target substance, such as the ginseng, ginseng, or ginseng in various solvents, and then extracting it for a certain period of time at room temperature or in a warm state, by removing the solvent from the liquid component. It means a result such as the obtained solid content. In addition, it can be comprehensively interpreted as including all of the dilutions of the above results, their concentrates, their preparations, and their purified products.

In addition, the present invention is not limited to the parts of panacea, perilla ginseng, and dried ginseng, and may be, for example, an extract obtained from leaves, roots, stems, etc. can

The extract may be obtained by extraction with water or various organic solvents, and the like, but is not particularly limited thereto, and preferably may be extracted with water, an alcohol having 1 to 4 carbon atoms, or a mixed solvent thereof. In addition, the method for obtaining the extract is also not particularly limited thereto, but preferably a cold extraction method in which a dried or processed product thereof is immersed in the solvent and extracted at room temperature of 10 to 25 ° C., by heating to 40 to 100 ° C. Methods such as a heating extraction method for extraction, an ultrasonic extraction method for extraction by adding ultrasonic waves, and a reflux extraction method using a reflux condenser can be used.

The extraction solvent is preferably added by 1 to 20 times the weight of the extraction solvent, and more preferably 10 times by weight. The extraction temperature is preferably 10 ~ 45 ℃, but is not limited thereto. In addition, the extraction time is preferably 1 to 5 days, most preferably 3 days, but is not limited thereto. Drying is preferably reduced pressure drying, vacuum drying, boiling drying, spray drying or freeze drying, more preferably freeze drying, but not limited thereto.

In the present invention, the term "fraction" refers to a result obtained by a fractionation method for separating a specific component or a specific group from a mixture containing various components. In the present invention, the fraction can be interpreted as a fraction obtained by applying the extracts of Manbyeongcho, Dangsaeng ginseng, or Goginseng to various fractionation methods. The fractionation method is not particularly limited thereto, but may be a solvent fractionation method performed by treating various solvents, an ultrafiltration fractionation method performed by passing through an ultrafiltration membrane having a constant molecular weight cut-off value, or a chromatographic fractionation method. In addition, as the solvent used in the solvent fractionation method, a polar solvent or a non-polar solvent may be used without particular limitation.

'Icaricide ratio 2' in the present invention may be represented by the following formula (1).

[Formula 1]

The icaricide ratio 2 is an organic compound having a chemical formula of C ₁₉ H ₃₀ O ₈ .

Icariside B2 according to the present invention may be isolated from a site including leaves, stems, roots, etc. of Arachnid, and in one embodiment, it may be isolated from Arachnid leaf extract. In addition, as long as the substances of Icaricide B2 according to the present invention are identical, they are included in the scope of the present invention, without limitation to chemical synthesis known in the art, or obtaining from other sources or manufacturing processes. In addition, the icaricide ratio 2 may be obtained by extracting the Albania extract alone or with a mixed solvent, and any known solvent may be used.

The extract according to the present invention may be an extract including Icaricide B2.

In the present invention, 'creoside IV' may be represented by the following formula (2).

[Formula 2]

The creoside IV is an organic compound having a chemical formula of C ₁₇ H ₃₂ O ₁₀ .

Creoside IV according to the present invention may be isolated from the extract after obtaining the extract without limitation on the site of the sugar ginseng, for example, it may be isolated from the extract of sugar ginseng root.

In addition, as long as the substances of creoside IV according to the present invention are identical, they are included in the scope of the present invention, without limitation on the preparation, chemical synthesis, or obtained from other sources known in the art.

In addition, the creoside IV may be obtained by extracting the ginseng root extract alone or with a mixed solvent, and any known solvent may be used.

The ginseng extract according to the present invention may be an extract containing creoside IV.

In the present invention, 'curaridinol' may be represented by the following formula (3).

[Formula 3]

In the present invention, claridinol is an organic compound having the formula C ₂₆ H ₃₂ O ₇ .

The curaridinol according to the present invention may be isolated from the extract after obtaining the extract without limitation on the site of the old ginseng, but in one embodiment, the curaridinol may be isolated from the old ginseng root extract.

In addition, as long as the substances of claridinol according to the present invention are identical, they are included in the scope of the present invention, without limitation on the preparation process or chemical synthesis known in the art, or obtained from other sources.

In addition, the claridinol may be obtained by extraction with a single or mixed solvent of ginseng root extract, and any known solvent may be used.

The Korean ginseng extract according to the present invention may be an extract containing claridinol.

In the present invention, 'muscle' refers to tendons, muscles, and tendons inclusively. 'Muscle strength' refers to the ability to exert force by contraction of the muscle, and the strength is proportional to the muscle mass. 'Improvement of muscle strength' refers to the differentiation of myocytes into muscle cells to increase muscle mass, improve physical performance, improve maximum endurance, strengthen muscle recovery, reduce muscle fatigue, and improve energy balance. In addition, this strength is related to the 'mobility' or 'exercise performance' of the body. 'Exercise performance ability' refers to the ability to quickly, strongly, for a long time, and skillfully perform physical movements performed in daily life or sports. do. In addition, 'muscle weakness' refers to a state in which the strength of one or more muscles is reduced. The muscle weakness may be limited to any one muscle, one side of the body, upper or lower extremities, or the like, or may appear throughout the body. In addition, subjective muscle weakness symptoms, including muscle fatigue and muscle pain, can be quantified objectively through physical examination.

In addition, as used herein, the term 'muscle disease' refers to a disease or condition reported in the art as a muscle disease caused by a decrease in muscle function, muscle wasting, or muscle degeneration. The muscle wasting or degeneration occurs due to genetic factors, acquired factors, aging, etc., and muscle wasting is characterized by a gradual loss of muscle mass, weakness and degeneration of muscles, particularly skeletal or voluntary muscles and cardiac muscles. Examples of related diseases include muscle loss, muscle loss, atony, muscular atrophy, muscular dystrophy, muscle degeneration, myasthenia gravis, cachexia, cardiotrophy and sarcopenia ( sarcopenia) and the like. The composition of the present invention has the effect of increasing muscle mass, and the type of muscle is not limited.

The composition of the present invention has, for example, prevention, improvement, and therapeutic efficacy of the above-mentioned diseases or conditions, such as sarcopenia, muscular atrophy, by promoting differentiation of myoblasts.

The composition of the present invention is not limited thereto, but can be implemented in the form of various compositions for external use, such as pharmaceutical compositions, food (including food additives) compositions, quasi-drugs compositions, feed (feed additive) compositions, cosmetic compositions, etc. have.

The pharmaceutical composition of the present invention may further include a pharmaceutically acceptable carrier. A pharmaceutically acceptable carrier may further include, for example, a carrier for oral administration or a carrier for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like.

Carriers for parenteral administration may also include water, suitable oils, saline, aqueous glucose and glycols, and the like. In addition, it may further include a stabilizer and a preservative. Suitable stabilizers include antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol.

The pharmaceutical composition of the present invention may be administered to mammals including humans by any method. For example, it can be administered orally or parenterally, and parenteral administration methods include, but are not limited to, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal. , intranasal, enteral, topical, sublingual or rectal administration.

The pharmaceutical composition of the present invention may be formulated as a formulation for oral administration or parenteral administration according to the administration route as described above. When formulated, one or more buffers (e.g., saline or phosphate buffered saline (PBS)), antioxidants, bacteriostatic agents, chelating agents (e.g., EDTA or glutathione), fillers, bulking agents, binders, adjuvants (e.g., aluminum hydroxide), suspending agents, thickening agents, wetting agents, disintegrating agents or surfactants, diluents or excipients.

Solid preparations for oral administration include tablets, pills, powders, granules, liquids, gels, syrups, slurries, suspensions or capsules, and such solid preparations include the pharmaceutical composition of the present invention and at least one excipient, such as For example, starch (including corn starch, wheat starch, rice starch, potato starch, etc.), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol maltitol , cellulose, methyl cellulose, sodium carboxymethyl cellulose, and hydroxypropylmethyl-cellulose or gelatin may be mixed and prepared. For example, tablets or dragees can be obtained by blending the active ingredient with a solid excipient, grinding it, adding suitable adjuvants, and processing it into a granular mixture.

In addition to simple excipients, lubricants such as magnesium stearate talc are also used. Liquid formulations for oral use include suspensions, solutions, emulsions, or syrups. In addition to water or liquid paraffin, which are commonly used simple diluents, various excipients, for example, wetting agents, sweeteners, fragrances or preservatives may be included. have. In addition, in some cases, cross-linked polyvinylpyrrolidone, agar, alginic acid or sodium alginate may be added as a disintegrant, and an anti-aggregating agent, a lubricant, a wetting agent, a flavoring agent, an emulsifier and a preservative may be further included. .

For parenteral administration, the pharmaceutical composition of the present invention may be formulated according to methods known in the art in the form of injections, transdermal administrations and nasal inhalants together with suitable parenteral carriers. In the case of the injection, it must be sterilized and protected from contamination of microorganisms such as bacteria and fungi. For injection, examples of suitable carriers include, but are not limited to, water, ethanol, polyols (eg, glycerol, propylene glycol and liquid polyethylene glycol, etc.), mixtures thereof and/or a solvent or dispersion medium containing vegetable oil. can More preferably, suitable carriers include Hanks' solution, Ringer's solution, PBS containing triethanolamine or sterile water for injection, isotonic solutions such as 10% ethanol, 40% propylene glycol and 5% dextrose. . In order to protect the injection from microbial contamination, it may further include various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In addition, in most cases, the injection may further contain an isotonic agent such as sugar or sodium chloride.

In the case of transdermal administration, forms such as ointment, cream, lotion, gel, external solution, pasta, liniment, and air are included. Here, 'transdermal administration' means that an effective amount of the active ingredient contained in the pharmaceutical composition is delivered into the skin by topically administering the pharmaceutical composition to the skin.

For administration by inhalation, the compositions used according to the invention may be formulated in pressurized packs or with the use of a suitable propellant, for example, dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. It can be conveniently delivered in the form of an aerosol spray from the nebulizer. In the case of a pressurized aerosol, the dosage unit may be determined by providing a valve to deliver a metered amount. For example, gelatin capsules and cartridges for use in inhalers or insufflators may be formulated to contain a powder mixture of the compound and a suitable powder base such as lactose or starch. Formulations for parenteral administration are described in Remington's Pharmaceutical Science, 15th Edition, 1975 Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour, a recipe generally known to all pharmaceutical chemistry.

The pharmaceutical composition of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, or biological response modifiers.

As another aspect for achieving the above object, the present invention provides for the prevention or treatment of muscle disease or muscle function comprising a bay leaf extract, ginseng extract, ginseng extract, Icaricide B2, creoside IV, or claridinol as an active ingredient. A quasi-drug composition for improvement is provided.

The term "quasi-drug" as used in the present invention refers to articles that are not instruments, machines, or devices used for the purpose of diagnosing, treating, alleviating, treating or preventing diseases of humans or animals, and pharmacologically affecting the structure and function of humans or animals. It refers to articles other than instruments, machines, or devices among articles used for the purpose of influencing, and may include, but is not limited to, preparations for internal use in one embodiment, formulation methods, doses, and methods of use of quasi-drugs , components and the like may be appropriately selected from conventional techniques known in the art.

The quasi-drug composition of the present invention may further include a pharmaceutically acceptable carrier, excipient or diluent if necessary in addition to the above components. The pharmaceutically acceptable carrier, excipient or diluent is not limited as long as it does not impair the effects of the present invention, for example, a filler, an extender, a binder, a wetting agent, a disintegrant, a surfactant, a lubricant, a sweetener, a fragrance, a preservative, etc. may include

As another aspect for achieving the above object, the present invention provides for the prevention or treatment of muscle disease or muscle function comprising a bay leaf extract, ginseng extract, ginseng extract, Icaricide B2, creoside IV, or claridinol as an active ingredient. A food composition for improvement is provided.

The food composition of the present invention includes all forms such as functional food, nutritional supplement, health food, food additives, and feed, and includes animals including humans or livestock. is the target of eating. Food compositions of this type can be prepared in various forms according to conventional methods known in the art.

Food compositions of this type can be prepared in various forms according to conventional methods known in the art. General foods include, but are not limited to, beverages (including alcoholic beverages), fruits and their processed foods (canned fruit, bottled, jam, marmalade, etc.), fish, meat and their processed foods (ham, sausage corned beef, etc.) , Breads and noodles (udon, soba, ramen, spagate, macaroni, etc.), fruit juice, various drinks, cookies, syrup, dairy products (butter, cheese, etc.), edible vegetable oils and fats, margarine, vegetable protein, retort food, frozen food , various seasonings (soybean paste, soy sauce, sauce, etc.) can be prepared by adding the active ingredient.

In addition, as a nutritional supplement, it can be prepared by adding the above active ingredients to capsules, tablets, pills, and the like. In addition, the health functional food is not limited thereto, but it can be ingested by liquefying, granulating, encapsulating, and powdering it so that it can be prepared in the form of tea, juice, and drink and consumed as a health drink, for example. In addition, in order to use the Manbyeongcho, ginseng or sugar ginseng in the form of a food additive, it may be prepared and used in the form of a powder or a concentrate. In addition, it can be prepared in the form of a composition by mixing with a known active ingredient known to be effective in improving muscle strength.

In addition to the above, the health food of the present invention includes various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, pectic acid salts, alginic acid, alginic acid salts, organic acids, protective colloidal thickeners, pH regulators, stabilizers, preservatives, It may contain glycerin, alcohol or a carbonation agent and the like.

As another aspect for achieving the above object, the present invention provides for the prevention or treatment of muscle disease or muscle function comprising a bay leaf extract, ginseng extract, ginseng extract, Icaricide B2, creoside IV, or claridinol as an active ingredient. A feed composition for improvement is provided.

In the present invention, the feed composition may be formulated in a conventional feed form, and may include known feed ingredients together. In addition, it can be used as a feed additive, which is added in the form of an additive to the feed used. The feed additive of the present invention corresponds to an auxiliary feed under the Feed Management Act, and is a mineral preparation such as sodium bicarbonate (bicarbonate), bentonite, magnesium oxide, complex minerals, and trace minerals such as zinc, copper, cobalt, and selenium. Preparations, kerotene, vitamin E, vitamins A, D, E, nicotinic acid, vitamins such as vitamin B complex, protective amino acids such as methionine and lyic acid, protective fatty acids such as fatty acid calcium salts, probiotics (lactic acid bacteria), yeast culture Water, live bacteria such as mold fermented products, yeast agents, and the like may be further included.

The feed or feed additive of the present invention can be applied to a number of animal diets including mammals, poultry and fish.

As another aspect for achieving the above object, the present invention comprises the steps of obtaining an extract of Manbyeongcho; obtaining a sugar ginseng extract from sugar ginseng; Or it provides a method for preparing a composition for preventing or treating muscle disease or improving muscle function, comprising the step of obtaining a ginseng extract from ginseng.

In the present invention, the Manbyeongcho extract contains Icaricide B2 as an active ingredient.

In the present invention, the ginseng extract contains creoside IV as an active ingredient.

In the present invention, the ginseng extract contains claridinol as an active ingredient.

As another aspect for achieving the above object, the present invention comprises the steps of isolating Icaricide B2 from the extract of Manbyeongcho; separating creoside IV from the ginseng extract; Or it provides a method for preparing a composition for preventing muscle disease or improving muscle function, comprising the step of isolating claridinol from ginseng extract.

Manbyeongcho, ginseng, or ginseng extract of the present invention or a material separated therefrom has an effect for preventing or treating muscle disease or improving muscle function, and thus can be used as a material for pharmaceuticals, food, and the like.

1 shows the structure (FIG. 1A) and a schematic separation diagram (FIG. 1B) of icariside B2.
2 shows the structure (FIG. 2A) and the separation schematic diagram (FIG. 2B) of creoside IV.
3 shows the structure (FIG. 3A) and a schematic separation diagram (FIG. 3B) of kuraridinol.
4 shows the results of nuclear magnetic resonance (NMR) measurement for confirming the structure of Icaricide ratio 2 (FIG. 4A: ¹ H NMR, FIG. 4B: ¹³ C NMR).
5 shows the results of nuclear magnetic resonance (NMR) measurement for the confirmation of the creoside IV structure (FIG. 5A: ¹ H NMR, FIG. 5B: ¹³ C NMR).
6 shows the results of nuclear magnetic resonance (NMR) measurement for confirming the structure of claridinol (FIG. 6A: ¹ H NMR, FIG. 6B: ¹³ C NMR).
7 shows an EGFP fluorescence image (FIG. 7A) and quantitative analysis results (FIG. 7B) confirming the effect on mitochondrial damage caused by muscle atrophy according to Icaricide B2 treatment in a zebrafish model of anticancer drug-induced muscle atrophy. .
8 is an EGFP fluorescence image (FIG. 8A) and quantitative analysis results (FIG. 8B) confirming the effect on mitochondrial damage caused by muscle atrophy according to Creoside IV treatment in a zebrafish model of anticancer drug-induced muscle atrophy.
9 is an EGFP fluorescence image (FIG. 9A) and quantitative analysis results (FIG. 9B) confirming the effect on mitochondrial damage caused by muscle atrophy according to curaridinol treatment in a zebrafish model of anticancer drug-induced muscle atrophy.
10 shows the results of RT-qPCR measurement of gene expression of MyoD (FIG. 10A) and myogenin (FIG. 10B) according to Icaricide B2 treatment.
11 is a result of measuring the gene expression of MyoD (FIG. 11A) and myogenin (FIG. 11B) according to Creoside IV treatment by RT-qPCR.
12 is a result of RT-qPCR measurement of gene expression of MyoD ( FIG. 12A ) and myogenin ( FIG. 12B ) according to claridinol treatment.
13 shows the results of RT-qPCR measurement of gene expression of Myh1 (FIG. 13A), Myh2 (FIG. 13B), Myh4 (FIG. 13C), and Myh7 (FIG. 13D) according to Icaricide B2 treatment.
14 is a result of RT-qPCR measurement of gene expression of Myh1 (FIG. 14A), Myh2 (FIG. 14B), Myh4 (FIG. 14C), and Myh7 (FIG. 14D) according to Creoside IV treatment.
15 is a result of RT-qPCR measurement of gene expression of Myh1 (FIG. 15A), Myh2 (FIG. 15B), Myh4 (FIG. 15C), and Myh7 (FIG. 15D) according to claridinol treatment.
FIG. 16 shows the results of confirming the MHC-positive myotube cell image ( FIG. 16A ) and the ratio of multinucleated MHC-positive myotube cells ( FIG. 16B ) according to Icaricide B2 treatment by immunofluorescence staining.
17 is a result of confirming the MHC-positive myotube cell image ( FIG. 17A ) and the multinuclear MHC-positive myotube cell distribution ( FIG. 17B ) by immunofluorescence staining according to Creoside IV treatment.
18 is a result of confirming the MHC-positive myotube cell image ( FIG. 18A ) and the distribution and ratio of multinucleated MHC-positive myotube cells ( FIG. 18B ) by immunofluorescence staining according to claridinol treatment.
19 shows the results of RT-qPCR measurement of gene expression of COX2 (FIG. 19A), ATPase6 (FIG. 19B) and SIRT3 (FIG. 19C) according to Icaricide B2 treatment.
20 is a result of RT-qPCR measurement of gene expression of SDHA (FIG. 20A) and DRP1 (FIG. 20B) according to Creoside IV treatment.

Hereinafter, the present invention will be described in more detail through the following examples. However, these Examples are for illustrative purposes of the present invention, and the scope of the present invention is not limited only to these Examples.

Example 1: Preparation of Albania extract and Icariside B2 (Icariside B2)

25 kg of horseradish extract was immersed and extracted with 95% methanol twice at room temperature 25° C. for one week. 3 L of distilled water was added to the concentrated methanol extract and suspended. Solvent fractionation was performed using the same amount of n-hexane, chloroform, ethyl acetate, and n-butanol using a separatory funnel. Column chromatography was performed on 320 g of the n-butanol fraction. 320 g of the n-butanol fraction was adsorbed on silica gel 70-230 mesh to be solidified and then loaded onto a column, and the developing solvent was chloroform and methanol at a rate of increasing polarity to obtain a total of 6 small fractions. obtained (hereinafter referred to as 'B1 to B6').

With respect to the obtained B2 22 g, RP-C18 filler was performed by MPLC, and 29 small fractions were obtained using acetone, methanol, and water as a developing solvent (hereinafter referred to as 'B2-1 to B2-29'). Silica gel 230-400 mesh filler was performed by MPLC with respect to 2 g of B2-27 in the small fraction, and white crystalline material was obtained at 300 mg of B2-27-3. As a result, the icaricide ratio 2 was obtained ( FIGS. 1 and 4 ).

white amorphous powder; electron ionization mass spectrometer (EI-MS) m/z 386.19 [M]+; Molecular formula C ₁₉ H ₃₀ O ₈ ; ¹ H-NMR (500 MHz, pyridine- d ₅ ) δ 7.18 (1H, d, J = 15.7 Hz, H-7), 6.52 (1H, d, J = 15.7 Hz, H-8), 4.96 (1H, d, J = 7.7 Hz, H-1'), 4.41 (1H, dd, J = 11.2, 4.2 Hz, H-3), 4.54-3.95 (6H, m, H-2'-H-6'), 2.60 (1H, dd, J = 14.6, 4.8 Hz, H-4a), 2.28 (3H, s, H-10), 1.97 (2H, d, J = 14.6 Hz, H-2a, H-4b), 1.53 (1H, dd, J = 12.3, 10.7 Hz, H-2b), 1.12 (6H, s, H-12, H-13), 0.96 (3H, s, H-11); ¹³ C-NMR (250 MHz, pyridine- d ₅ ) δ 197.4 (C-9), 143.3 (C-7), 133.6 (C-8), 103.4 (C-1'), 79.0 (C-5') , 78.8 (C-3'), 75.6 (C-2'), 71.9 (C-4'), 71.7 (C-3), 70.1 (C-6), 67.4 (C-5), 63.0 (C- 6'), 45.0 (C-2), 38.3 (C-4), 35.4 (C-1), 29.3 (C-11), 28.0 (C-10), 25.6 (C-12), 20.2 (C- 13).

Example 2: Preparation of ginseng extract and creoside Ⅳ (Creoside Ⅳ)

7 kg of ginseng root was reflux-cooled with 80% methanol and extracted three times for 3 hours. MCI gel was suspended in water in the methanol extract concentrated using a vacuum rotary vacuum concentrator under reduced pressure, and solvent fractionation was performed by column chromatography using methanol. 100 g of the methanol fraction was adsorbed onto silica gel 230-400 mesh to be solidified and then loaded onto a column, and the developing solvent was methyl chloride: methanol = 30: 1 to 0: 100 using a ratio of increasing polarity. Proceeded to obtain a total of five small fractions (hereinafter referred to as 'M1 ~ M5').

Column chromatography was performed on 15 g of the obtained M3 with a RP-C18 filler, and the developing solvent was methanol: water = 40: 60 to 0: 100 to obtain 10 small fractions (hereinafter 'M3-1 to M3') -10'). In this small fraction, 100 mg of M3-5 was recrystallized with methanol to obtain a white crystalline material, and as a result, the creoside IV was obtained ( FIGS. 2 and 5 ).

white amorphous powder; electron ionization mass spectrometer (EI-MS) m/z 396 [M]+; Molecular formula C ₁₇ H ₃₂ O ₁₀ ; ¹ H-NMR (500 MHz, CD ₃ OD) δ 0.87 (3H, t, J = 6.9, H-6), 1.28 (6H, m, H-3 to H-5), 1.57 (2H, m, H -2), 3.15 to 3.86 (m), 4.07 (1H, dd, J = 11.4, 1.7), 4.23 (1H, d, J = 7.8), 4.29 (1H, d, J = 6.5); ¹³ C-NMR (250 MHz, CD ₃ OD) δ 105.1 (C-1"), 104.3 (C-1'), 77.8 (C-3'), 76.7 (C-5'), 74.9 (C-2 ´), 74.1 (C-3"), 72.3 (C-2"), 71.5 (C-4´), 70.9 (C-1), 69.4 (C-6´ and C-4"), 66.7 (C -5"), 32.8 (C-4), 30.7 (C-2), 26.7 (C-3), 23.6 (C-5), 14.4 (C-6).

Example 3: Preparation of Ginseng Extract and Kuraridinol

10 kg of ginseng root was reflux-cooled with 99.9% methanol and extracted three times for 3 hours. 3 L of distilled water was added to the concentrated methanol extract using a vacuum rotary vacuum concentrator and suspended. Solvent fractionation was performed using the same amount of methylene chloride, ethyl acetate and n-butanol using a separatory funnel. Column chromatography was performed on 250 g of the ethyl acetate fraction. 320 g of the n-butanol fraction was adsorbed on silica gel 70-230 mesh to be solidified and then loaded onto a column, and the developing solvent was methylene chloride: methanol = 20: 1 to 0: 100 using a ratio of increasing polarity to obtain a total of 35 small fractions (hereinafter referred to as 'E1 to E35').

Silica gel 230-400 mesh filler was used for the obtained E15 32 g, and the developing solvent was methylene chloride: methanol = 20: 1 to 1:1 to obtain 6 small fractions (hereinafter 'E15- 1 to E15-6'). Silica gel 230-400 mesh filler was used for 2.77 g of E15-3 in the small fraction, and the developing solvent was hexane: ethyl acetate = 1:1 to 0: 100 at 1.08 g of E15-3-3. A yellow crystalline material was obtained, and as a result, the claridinol was obtained ( FIGS. 3 and 6 ).

yellow amorphous powder; electron ionization mass spectrometer (EI-MS) m/z 456 [M]+; Molecular formula C ₂₆ H ₃₂ O ₇ ; ¹ H-NMR (500 MHz, DMSO- d ₆ ) δ 14.86 (1H, s, OH-9), 10.17 (1H. s, OH-7), 7.94 (1H, d, J = 15.6 Hz, H-2 ), 7.86 (1H, d, J = 15.6 Hz, H-3), 7.43 (1H, d, J = 8.6 Hz, H-6'), 6.38 (1H, d, J = 2.2 Hz, H-3') ), 6.32 (1H, dd, J = 2.2, 8.6 Hz, H-5'), 6.04 (1H, s, H-6), 4.57 (1H, br s, H-9"a), 4.47 (1H, d, J = 2.2 Hz, H-9"b), 3.83 (3H, s, OCH3), 2.55 (2H, m, H-1"), 2.35 (1H, m,H-2"), 1.64 (3H) , s ,H-10"), 1.35 (2H, m, H-3"), 1.19 (2H, m, H-4"), 1.02 (3H, s, H-6"), 1.01 (3H, s) , H-7"); ¹³ C-NMR (250 MHz, DMSO- d ₆ ) δ 191.96 (C-4), 165.28 (C-9), 162.75 (C-7), 161.14 (C-4'), 160.27 (C-5), 159.02 (C-2'), 148.00 (C-8"), 138.63 (C-2), 130.31 (C-6'), 122.79 (C-3), 113.74 (C-1) '), 110.92 (C-9"), 108.05 (C-5'), 106.73 (C-8), 104.41 (C-10), 102.58 (C-3'), 90.66 (C-6), 68.64 ( C-5"), 55.49 (OCH3), 46.41 (C-2"), 41.57 (C-4"), 29.55 (C-6"), 29.00 (C-7"), 27.10 (C-1") , 26.65 (C-3"), 17.85 (C-10").

Experimental Example 1: Confirmation of mitochondrial damage mitigation effect due to muscle atrophy in the zebrafish model of anticancer drug-induced muscle atrophy of Icaricide B2

Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish produced in this laboratory are managed in a 3.5L acrylic tank at 28.5±1℃ temperature and 14/10 hour light/dark cycle conditions under the approval of the Animal Experimental Ethics Committee of Sookmyung Women’s University, 2 days a day. Live Brine shrimp (artemia) and Tetramin, 16106, Germany) were bred through feeding, and the embryos used in the experiment were obtained through crossing of Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish.

In order to confirm the mitochondrial damage mitigation effect of Icariside B2 due to muscle atrophy through the zebrafish model of muscle atrophy, embryos 1 day after fertilization were treated with anticancer drugs (FOLFIRI; 5-Fluorouracil, Leucovorin, Irinotecan) for muscle atrophy. To make a zebrafish model, 1, 10, and 100 ng/ml of Icaricide ratio 2 isolated from Manbyeongchoi extract in Example 1 were treated. Confocal mitochondrial images in muscle cells using Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish embryos showing the physiological activity of mitochondria through real-time morphological observation of EGFP (MLS-EGFP) expressed in mitochondria after 48 hours of extract treatment. It was observed through a microscope (Carl Zeiss, Germany).

As a result, it was confirmed that the brightness of EGFP expressed in mitochondria was significantly reduced by mitochondrial damage in the muscle cells of FOLFIRI-treated zebrafish embryos compared to the control group, and Icaricide ratio 2 of 1, 10, and 100 ng/ml It was confirmed that the expression level gradually increased with treatment with the concentration, and in particular, the degree of mitochondrial damage caused by FOLFIRI was significantly alleviated at a concentration of 100 ng/ml (FIG. 7). Therefore, through the above results, it was confirmed that Icaricide B2 could inhibit the occurrence of muscle atrophy by restoring mitochondrial damage in muscle cells caused by anticancer drug (FOLFIRI) treatment.

Experimental Example 2: Confirmation of mitochondrial damage mitigation effect due to muscle atrophy in zebrafish model of anticancer drug-induced muscle atrophy of creoside IV

Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish produced in this laboratory are managed in a 3.5L acrylic tank at 28.5±1℃ temperature and 14/10 hour light/dark cycle conditions under the approval of the Animal Experimental Ethics Committee of Sookmyung Women’s University, 2 days a day. Live Brine shrimp (artemia) and Tetramin, 16106, Germany) were bred through feeding, and the embryos used in the experiment were obtained through crossing of Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish.

In order to confirm the mitochondrial damage mitigation effect of Creoside IV due to muscle atrophy through the muscle atrophy zebrafish model, the embryos 1 day after fertilization were treated with anticancer drugs (FOLFIRI; 5-Fluorouracil, Leucovorin, Irinotecan) and muscle atrophy zebrafish. A fish model was made, and 1, 10, and 100 ng/ml of creoside IV isolated from the ginseng root extract in Example 2 were treated. Confocal mitochondrial images in muscle cells using Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish embryos showing the physiological activity of mitochondria through real-time morphological observation of EGFP (MLS-EGFP) expressed in mitochondria after 48 hours of extract treatment. It was observed through a microscope (Carl Zeiss, Germany).

As a result, it was confirmed that the brightness of EGFP expressed in mitochondria was significantly decreased compared to the control group due to mitochondrial damage in muscle cells of FOLFIRI-treated zebrafish embryos, and creoside IV at concentrations of 1, 10, and 100 ng/ml. It was confirmed that the expression level gradually increased with treatment with FOLFIRI, and the degree of mitochondrial damage caused by FOLFIRI was significantly alleviated, especially at concentrations of 10 and 100 ng/ml (FIG. 8). Therefore, it was confirmed through the above results that creoside IV can inhibit the occurrence of muscle atrophy by restoring mitochondrial damage in muscle cells caused by anticancer drug (FOLFIRI) treatment.

Experimental Example 3: Confirmation of mitochondrial damage mitigation effect due to muscle atrophy in zebrafish model of anticancer drug-induced muscle atrophy of claridinol

Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish produced in this laboratory are managed in a 3.5L acrylic tank at 28.5±1℃ temperature and 14/10 hour light/dark cycle conditions under the approval of the Animal Experimental Ethics Committee of Sookmyung Women’s University, 2 days a day. Live Brine shrimp (artemia) and Tetramin, 16106, Germany) were bred through feeding, and the embryos used in the experiment were obtained through crossing of Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish.

In order to confirm the mitochondrial damage mitigation effect of claridinol due to muscle atrophy through the muscle atrophy zebrafish model, the embryos 1 day after fertilization were treated with anticancer drugs (FOLFIRI; 5-Fluorouracil, Leucovorin, Irinotecan) and muscle atrophy zebrafish. A fish model was made, and 0.01, 0.1, and 1 ng/ml of claridinol isolated from the root extract of Korean ginseng in Example 3 were treated. Confocal mitochondrial images in muscle cells using Tg ( Xla.Eef1a1:mlsEGFP ) zebrafish embryos showing the physiological activity of mitochondria through real-time morphological observation of EGFP (MLS-EGFP) expressed in mitochondria after 48 hours of extract treatment. It was observed through a microscope (Carl Zeiss, Germany).

As a result, it was confirmed that the brightness of EGFP expressed in mitochondria was decreased compared to the control group due to mitochondrial damage in muscle cells of FOLFIRI-treated zebrafish embryos, and claridinol was 0.01, 0.1. As the concentration of 1 ng/ml was treated, the expression level gradually increased, confirming that the degree of mitochondrial damage caused by FOLFIRI was significantly alleviated at all concentrations (FIG. 9). Therefore, from the above results, it was confirmed that claridinol can inhibit the occurrence of muscle atrophy by restoring mitochondrial damage in muscle cells caused by anticancer drug (FOLFIRI) treatment.

Experimental Example 4: Confirmation of the effect of Icaricide B2 inducing myoblast differentiation and promoting myotube cell formation

Based on the results of Experimental Example 1, the following cell experiments were performed using C2C12 myoblasts to confirm the effect of Icaricide B2 on myoblast differentiation and myotube formation. . C2C12 myoblasts were purchased from the American Type Culture Collection (Manassas, VA, USA) and treated with Dulbecco's modified Eagle's Media (GenDEPOT, Barker, TX, USA) containing 15% fetal bovine serum (Gibco, Grand Island, NY, USA). The 6-well plate was seeded at a concentration of 2 x 10 ⁵ cells/ml. After culturing for 24 hours, when the cell confluency reached about 90%, it was replaced with a differentiation medium (DM) containing 2% horse serum (HyClone, Logan, UT, USA) to induce differentiation for about 72 hours. The experimental group was treated with Icaricide ratio 2 in DM at concentrations of 0.1, 1, 10, and 100 ng/ml, and the control group was treated with DMSO as a vehicle and cultured under the same conditions.

4-1: Icaricide B2 myoblast differentiation promoting effect

To confirm the effect of Icaricide B2 on myoblast differentiation, The mRNA expression of MyoD, myogenin and MHC (myosin heavy chain) isoforms, which are indicators related to the induction of differentiation of C2C12 myoblasts into myotubes, were measured by RT-qPCR. To this end, C2C12 was treated with Icaricide B2 in the same manner as described above, and differentiation was induced by culturing, and then, Trizol solution was added to lyse the cells and centrifuged. Chloroform and isopropanol were added to the supernatant, respectively, and centrifuged to remove the supernatant. After removing the remaining solution, the RNA pellet was dissolved using nuclease free water. After measuring the concentration of the extracted RNA and confirming the purity, cDNA was synthesized using the qPCRBIO cDNA Synthesis Kit (PCR Biosystems Ltd., London, UK). Quantitative PCR was performed on the synthesized cDNA using qPCRBIO SyGreen Mix (PCR Biosystem Ltd.). The primer sequences used are shown in Table 1.

Gene description Primers Sequences (5' →3') SEQ ID NO: ATPase6 F ACACACCAAAAGGACGAACA One R GAAGGAAGTGGGCAAGTGAG 2 COX2 F ATGGCCTACCCATTCCAACT 3 R CGGGGTTGTTGATTTCGTC 4 GAPDH F CGTGCCGCCTGGAGAAAC 5 R TGGGAGTTGCTGTTGAAGTCG 6 Myh1 F GAGGGACAGTTCATCGATAGCAA 7 R GGGCCAACTTGTCATCTCTCAT 8 Myh2 F CCGCAATGCAGAAGAGAAA 9 R TTCACGGTCTGCTCCATGT 10 Myh4 F CAGGACTTGGTGGACAAACTACA 11 R TTTAGTGTGAACCTCTCGGCTC 12 Myh7 F CTCAAGCTGCTCAGCAATCTATTT 13 R GGAGCGCAAGTTTGTCATAAGT 14 MyoD F AAACCCCAATGCGATTTATCAGG 15 R TAAGCTTCATCTTTTGGGCGTGA 16 Myogenin F ACAGCATCACGGTGGAGGATATGT 17 R CCCTGCTACAGAAGTGATGGCTTT 18 SIRT3 F CGTTGTGAAACCCGACATTG 19 R TCCCCTAGCTGGACCACATC 20

As a result, the expression levels of MyoD, an early stage indicator of myoblast differentiation, and myogenin, an early stage indicator, were significantly increased in all groups treated with Icaricide ratio 2 at concentrations of 0.1, 1, 10, and 100 ng/ml compared to the control group ( Fig. 10). As a result of measuring the expression levels of MHC isoforms, which are markers at the end of myoblast differentiation and are related to the speed and function of muscle contraction, the gene expression levels of all MHC isoforms (Myh1, Myh2, Myh4, Myh7) were found in the group treated with Icaricide B2. It increased in a concentration-dependent manner. In particular, it was confirmed that Myh1, Myh2 gene expression was significantly increased compared to the control group at all concentrations, and Myh4, Myh7 expression levels were significantly increased in the groups treated with 1, 10, and 100 ng/ml (FIG. 13). The above results show that Icaricide B2 has a differentiation-promoting effect of C2C12 myoblasts.

4-2: Icaricide ratio 2 promotes myotube cell formation

The degree of MHC-positive myotube cell formation by Icaricide B2 was to be confirmed through immunofluorescence staining. To this end, DM was removed from the cells differentiated under the same conditions described above, washed with phosphate buffered saline (PBS), and fixed with 4% paraformaldehyde for 30 minutes. It was washed again with PBS, permeated with 0.1% Triton X-100 for 30 minutes, and then washed with PBS. After blocking in 5% horse serum solution, it was stained with anti-MHC (Developmental Studies Hybridoma Bank, Iowa, IA, USA). After washing with PBS, they were treated with Alexa Fluor 568-conjugated secondary antibody and DAPI (D9542, Sigma, St. Louis, MO, USA). Images were taken with a fluorescence microscope (Logos Biosystem, Anyang, South Korea). Multinucleated MHC-expressing myotubes were calculated at randomly selected sites in the captured image (Scale bar = 100 μm). After analyzing the number of MHC-positive and multinucleated myotubes, the total number of cells was applied to express the number of multinucleated-MHC-positive myotubes (MHC-positive myotubes) as a percentage.

As a result, images of MHC-positive myotube cells expressed in red fluorescence and the ratio of multinucleated MHC-positive myotubes observed through DAPI staining are shown in FIGS. 16A and 16B, respectively. It was confirmed that the formation of MHC-positive myotubes was promoted compared to the control by Icaricide B2 treatment ( FIG. 16A ). In addition, the formation of multinuclear MHC-positive myotube cells having three or more nuclei increased in a concentration-dependent manner by Icaricide B2 treatment. was significantly increased (FIG. 16B). The above results show that Icaricide Bi-2 has the effect of inducing differentiation of C2C12 myoblast cells and promoting myotubular cell formation.

4-3: Confirmation of regulation of gene expression related to mitochondrial function of Icariside B2

In order to determine whether the effect of Icaricide B2 to promote C2C12 myoblast differentiation and myotube cell formation is related to mitochondrial function, the gene expression levels of the electron transport system complex and mitochondrial function-related markers present in the inner mitochondrial membrane of myoblasts were RT- It was measured by qPCR. The primer sequences used are shown in Table 1. As a result, the expression level of COX2 constituting the mitochondrial inner membrane electron transport system complex IV was significantly increased in the 0.1, 10, and 100 ng/ml treatment groups than in the control group (FIG. 19A). In addition, the expression of ATPase 6, an electron transport complex V marker involved in the last step of the oxidative phosphorylation process for mitochondrial ATP generation, was significantly increased in all groups treated with Icariside B2 compared to the control group ( FIG. 19B ). SIRT3, which plays an important role in maintaining the homeostasis of mitochondrial energy metabolism, also significantly increased its expression in a concentration-dependent manner compared to the control group in all groups treated with Icaricide B2 ( FIG. 19C ). These results show that the myoblast differentiation and myotube cell formation promoting effect of Icaricide B2 is related to the improvement of mitochondrial function through activation of mitochondrial energy metabolism and maintenance of homeostasis.

Experimental Example 5: Confirmation of the effect of creoside IV to induce myoblast differentiation and promote myotube cell formation

Based on the results of Experimental Example 2, the following cell experiments were performed using C2C12 myoblasts to determine the effect of creoside IV on myoblast differentiation and myotube formation. C2C12 myoblasts were purchased from the American Type Culture Collection (Manassas, VA, USA) and treated with Dulbecco's modified Eagle's Media (GenDEPOT, Barker, TX, USA) containing 15% fetal bovine serum (Gibco, Grand Island, NY, USA). The 6-well plate was seeded at a concentration of 2 x 10 ⁵ cells/ml. After culturing for 24 hours, when the cell confluency reached about 90%, it was replaced with a differentiation medium (DM) containing 2% horse serum (HyClone, Logan, UT, USA) to induce differentiation for about 72 hours. The experimental group was treated with creoside IV in DM at a concentration of 1, 10, and 100 ng/ml, and the control group was treated with DMSO as a vehicle and cultured under the same conditions.

5-1: Creoside IV myoblast differentiation promoting effect

To confirm the effect of creoside IV on myoblast differentiation, The mRNA expression of MyoD, myogenin and MHC (myosin heavy chain) isoforms, which are indicators related to the induction of differentiation of C2C12 myoblasts into myotubes, were measured by RT-qPCR. To this end, C2C12 was treated with creoside IV in the same manner as described above, and differentiation was induced by culturing, and then cells were lysed by adding Trizol solution and centrifuged. Chloroform and isopropanol were added to the supernatant, respectively, and centrifuged to remove the supernatant. After removing the remaining solution, the RNA pellet was dissolved using nuclease free water. After measuring the concentration of the extracted RNA and confirming the purity, cDNA was synthesized using the qPCRBIO cDNA Synthesis Kit (PCR Biosystems Ltd., London, UK). Quantitative PCR was performed on the synthesized cDNA using qPCRBIO SyGreen Mix (PCR Biosystem Ltd.). The primer sequences used are shown in Table 2.

Gene description Primers Sequences (5' →3') SEQ ID NO: Drp1 F TCTGCAGCTAGTCCACGTTTC 21 R ACCCCATTCTTCTTGCTTCAA 22 GAPDH F CGTGCCGCCTGGAGAAAC 23 R TGGGAGTTGCTGTTGAAGTCG 24 Myh1 F GAGGGACAGTTCATCGATAGCAA 25 R GGGCCAACTTGTCATCTCTCAT 26 Myh2 F CCGCAATGCAGAAGAGAAA 27 R TTCACGGTCTGCTCCATGT 28 Myh4 F CAGGACTTGGTGGACAAACTACA 29 R TTTAGTGTGAACCTCTCGGCTC 30 Myh7 F CTCAAGCTGCTCAGCAATCTATTT 31 R GGAGCGCAAGTTTGTCATAAGT 32 MyoD F AAACCCCAATGCGATTTATCAGG 33 R TAAGCTTCATCTTTTGGGCGTGA 34 Myogenin F ACAGCATCACGGTGGAGGATATGT 35 R CCCTGCTACAGAAGTGATGGCTTT 36 SDHA F CAGAAGTCGATGCAGAACCA 37 R CGACCCGCACTTTGTAATCT 38

As a result, the expression levels of myoD, an early stage indicator of myoblast differentiation, and myogenin, an early stage indicator, were significantly increased in the groups treated with creoside IV at concentrations of 1, 10, and 100 ng/ml compared to the control group (FIG. 11) . As a result of measuring the expression levels of MHC isoforms, which are markers at the end of myoblast differentiation and are related to the speed and function of muscle contraction, the gene expression levels of Myh1, Myh2, Myh4, and Myh7 were 1, 10, 100 ng/ml of creoside IV compared to the control group. It was significantly increased in all groups treated with the concentration of (Fig. 14). The above results show that creoside IV has a differentiation-promoting effect of C2C12 myoblasts.

5-2: Creoside IV promotes myotube cell formation

The degree of MHC-positive myotube cell formation by creoside IV was to be confirmed through immunofluorescence staining. To this end, DM was removed from the cells differentiated under the same conditions described above, washed with phosphate buffered saline (PBS), and fixed with 4% paraformaldehyde for 30 minutes. It was washed again with PBS, permeated with 0.1% Triton X-100 for 30 minutes, and then washed with PBS. After blocking in 5% horse serum solution, it was stained with anti-MHC (Developmental Studies Hybridoma Bank, Iowa, IA, USA). After washing with PBS, they were treated with Alexa Fluor 568-conjugated secondary antibody and DAPI (D9542, Sigma, St. Louis, MO, USA). Images were taken with a fluorescence microscope (Logos Biosystem, Anyang, South Korea). Multinucleated MHC-expressing myotubes were calculated at randomly selected sites in the captured images (Scale bar = 100 μm). After analyzing the number of MHC-positive and multinucleated myotubes, the total number of cells was applied to express the number of multinucleated-MHC-positive myotubes (MHC-positive myotubes) as a percentage.

As a result, images of MHC-positive myotube cells expressed by red fluorescence and the distribution of multinucleated MHC-positive myotubes observed through DAPI staining are shown in FIGS. 17A and 17B, respectively. It was confirmed that the formation of MHC-positive myotubes was promoted by Creoside IV treatment compared to the control ( FIG. 17A ). In the experimental group treated with Creoside IV at 1, 10, and 100 ng/ml, the formation of multinucleated MHC-positive myotubes increased, and the number of MHC-positive myotubes with 2~4 nuclei was particularly significant at the concentration of 100 ng/ml. It was confirmed that the number of MHC-positive myotube cells having 5 or more nuclei significantly increased in the group treated with creoside IV at concentrations of 1 and 10 ng/ml compared to the control group (FIG. 17B). . The above results show that creoside IV has the effect of inducing differentiation of C2C12 myoblasts and promoting myotube cell formation.

5-3: Confirmation of gene expression regulation related to mitochondrial function of creoside IV

In order to confirm whether the effect of creoside IV to promote C2C12 myoblast differentiation and myotube formation is related to mitochondrial function, SDHA and mitochondrial fission, which are present in the inner mitochondrial membrane of myoblasts, and The gene expression level of regulating DRP1 was measured by RT-qPCR. The primer sequences used are shown in Table 2. As a result, especially in the 10 and 100 ng/ml treatment groups, the expression level of SDHA was significantly increased compared to the control group, and the expression of the DRP1 gene involved in mitochondrial division was significantly decreased ( FIG. 20 ). These results show that the effect of creoside IV to promote differentiation of C2C12 myoblast cells and myotubes is related to the improvement of mitochondrial function through mitochondrial energy metabolism activation and mitochondrial damage alleviation.

Experimental Example 6: Confirmation of myoblast differentiation induction and myotube cell formation promoting effect of claridinol

Based on the results of Experimental Example 3, the following cell experiments were performed using C2C12 myoblasts to confirm the effect of claridinol on myoblast differentiation and myotube formation. C2C12 myoblasts were purchased from the American Type Culture Collection (Manassas, VA, USA) and treated with Dulbecco's modified Eagle's Media (GenDEPOT, Barker, TX, USA) containing 15% fetal bovine serum (Gibco, Grand Island, NY, USA). The 6-well plate was seeded at a concentration of 2 x 10 ⁵ cells/ml. After culturing for 24 hours, when the cell confluency reached about 90%, it was replaced with a differentiation medium (DM) containing 2% horse serum (HyClone, Logan, UT, USA) to induce differentiation for about 72 hours. The experimental group was treated with ginseng root extract and claridinol separated therefrom at concentrations of 0.01, 0.1, and 1 ng/ml in DM, and the control group was treated with DMSO as a vehicle and cultured under the same conditions.

6-1: Myoblast differentiation promoting effect of claridinol

To confirm the effect of claridinol on myoblast differentiation, The mRNA expression of MyoD, myogenin and MHC (myosin heavy chain) isoforms, which are indicators related to the induction of differentiation of C2C12 myoblasts into myotubes, were measured by RT-qPCR. To this end, C2C12 was treated with claridinol in the same manner as described above and culturing to induce differentiation, followed by lysis and centrifugation by adding Trizol solution. Chloroform and isopropanol were added to the supernatant, respectively, and centrifuged to remove the supernatant. After removing the remaining solution, the RNA pellet was dissolved using nuclease free water. After measuring the concentration of the extracted RNA and confirming the purity, cDNA was synthesized using the qPCRBIO cDNA Synthesis Kit (PCR Biosystems Ltd., London, UK). Quantitative PCR was performed on the synthesized cDNA using qPCRBIO SyGreen Mix (PCR Biosystem Ltd.). The primer sequences used are shown in Table 3.

Gene description Primers Sequences (5' →3') SEQ ID NO: GAPDH F CGTGCCGCCTGGAGAAAC 39 R TGGGAGTTGCTGTTGAAGTCG 40 Myh1 F GAGGGACAGTTCATCGATAGCAA 41 R GGGCCAACTTGTCATCTCTCAT 42 Myh2 F CCGCAATGCAGAAGAGAAA 43 R TTCACGGTCTGCTCCATGT 44 Myh4 F CAGGACTTGGTGGACAAACTACA 45 R TTTAGTGTGAACCTCTCGGCTC 46 Myh7 F CTCAAGCTGCTCAGCAATCTATTT 47 R GGAGCGCAAGTTTGTCATAAGT 48 MyoD F AAACCCCAATGCGATTTATCAGG 49 R TAAGCTTCATCTTTTGGGCGTGA 50 Myogenin F ACAGCATCACGGTGGAGGATATGT 51 R CCCTGCTACAGAAGTGATGGCTTT 52

As a result, the expression levels of myoD, an early stage indicator of myoblast differentiation, and myogenin, an early stage indicator, were significantly increased in the group treated with claridinol at concentrations of 0.01, 0.1, and 1 ng/ml compared to the control group, especially 1 ng The expression level was significantly higher in the /ml treatment group than in other concentrations (Fig. 12).

In addition, as a result of measuring the expression levels of MHC isoforms, which are markers at the end of myoblast differentiation and related to the speed and function of muscle contraction, the mRNA expression levels of Myh1, Myh2, and Myh4 were also found in the claridinol-treated group (0.01, 0.1, 1 ng/ml), and Myh7, a slow muscle fiber-related gene, also increased significantly at all concentrations compared to the control group (FIG. 15). The above results show that claridinol has a differentiation-promoting effect of C2C12 myoblasts.

6-2: Curaridinol promotes myotube cell formation

The degree of MHC-positive myotube cell formation by curaridinol was confirmed through immunofluorescence staining. To this end, DM was removed from the cells differentiated under the same conditions described above, washed with phosphate buffered saline (PBS), and fixed with 4% paraformaldehyde for 30 minutes. It was washed again with PBS, permeated with 0.1% Triton X-100 for 30 minutes, and then washed with PBS. After blocking in 5% horse serum solution, it was stained with anti-MHC (Developmental Studies Hybridoma Bank, Iowa, IA, USA). After washing with PBS, they were treated with Alexa Fluor 568-conjugated secondary antibody and DAPI (D9542, Sigma, St. Louis, MO, USA). Images were taken with a fluorescence microscope (Logos Biosystem, Anyang, South Korea). Multinucleated MHC-expressing myotubes were calculated at randomly selected sites in the captured image (Scale bar = 100 μm). After analyzing the number of MHC-positive and multinucleated myotubes, the total number of cells was applied to express the number of multinucleated-MHC-positive myotubes (MHC-positive myotubes) as a percentage.

As a result, images of MHC-positive myotube cells expressed by red fluorescence and the distribution of multinucleated MHC-positive myotubes observed through DAPI staining are shown in FIGS. 18A and 18B, respectively. It was confirmed that MHC-positive myotube cell formation was promoted compared to the control group by treatment with curaridinol (FIG. 18A). In addition, in the experimental group treated with claridinol 0.01, 0.1, and 1 ng/ml, mononuclear MHC-positive myotubes decreased significantly compared to the control group, whereas the formation of multinuclear MHC-positive myotubes increased. In particular, the ratio of MHC-positive myotube cells having 6 or more nuclei was significantly increased in a concentration-dependent manner compared to the control at all concentrations treated with claridinol (FIG. 18B). The above results show that claridinol has the effect of inducing differentiation of C2C12 myoblasts and promoting the formation of myotubes.

The experimental examples described in this specification and the accompanying drawings show the effects of the active substances of Icariside B2, Creoside IV or Curaridinol, and the extract obtained by separating the active substances also produces the effect is the technology to which the present invention belongs It is obvious to those of ordinary skill in the field.

From the above description, those skilled in the art to which the present invention pertains will be able to understand that the present invention may be embodied in other specific forms without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention, rather than the above detailed description, all changes or modifications derived from the meaning and scope of the claims described below and their equivalents.

<110> Sookmyung Women's university industry-academic cooperation foundation National Institute for Korean Medicine Development <120> Composition for preventing or treating of muscle disease or improvement of muscular functions comprising Rhododendron brachycarpum extract, Codonopsis Pilosulae Radix extract, or Sophora flavescens extract, or active component separated therefrom as an active ingredient <130> KPA2022-005 <150> KR 10-2021-0013316 <151> 2021-01-29 <160> 52 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 1 acacaccaaa aggacgaaca 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 2 gaaggaagtg ggcaagtgag 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 3 atggcctacc cattccaact 20 <210> 4 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 4 cggggttgtt gatttcgtc 19 <210> 5 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 5 cgtgccgcct ggagaaac 18 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 6 tgggagttgc tgttgaagtc g 21 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 7 gagggacagt tcatcgatag caa 23 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 8 gggccaactt gtcatctctc at 22 <210> 9 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 9 ccgcaatgca gaagagaaa 19 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 10 ttcacggtct gctccatgt 19 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 11 caggacttgg tggacaaact aca 23 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 12 tttagtgtga acctctcggc tc 22 <210> 13 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 13 ctcaagctgc tcagcaatct attt 24 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 14 ggagcgcaag tttgtcataa gt 22 <210> 15 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 15 aaaccccaat gcgatttatc agg 23 <210> 16 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 16 taagcttcat cttttgggcg tga 23 <210> 17 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 17 acagcatcac ggtggaggat atgt 24 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 18 ccctgctaca gaagtgatgg cttt 24 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 19 cgttgtgaaa cccgacattg 20 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 20 tcccctagct ggaccacatc 20 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 21 tctgcagcta gtccacgttt c 21 <210> 22 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 22 accccattct tctgcttcaa 20 <210> 23 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 23 cgtgccgcct ggagaaac 18 <210> 24 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 24 tgggagttgc tgttgaagtc g 21 <210> 25 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 25 gagggacagt tcatcgatag caa 23 <210> 26 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 26 gggccaactt gtcatctctc at 22 <210> 27 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 27 ccgcaatgca gaagagaaa 19 <210> 28 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 28 ttcacggtct gctccatgt 19 <210> 29 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 29 caggacttgg tggacaaact aca 23 <210> 30 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 30 tttagtgtga acctctcggc tc 22 <210> 31 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 31 ctcaagctgc tcagcaatct attt 24 <210> 32 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 32 ggagcgcaag tttgtcataa gt 22 <210> 33 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 33 aaaccccaat gcgatttatc agg 23 <210> 34 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 34 taagcttcat cttttgggcg tga 23 <210> 35 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 35 acagcatcac ggtggaggat atgt 24 <210> 36 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 36 ccctgctaca gaagtgatgg cttt 24 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 37 cagaagtcga tgcagaacca 20 <210> 38 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 38 cgacccgcac tttgtaatct 20 <210> 39 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 39 cgtgccgcct ggagaaac 18 <210> 40 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 40 tgggagttgc tgttgaagtc g 21 <210> 41 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 41 gagggacagt tcatcgatag caa 23 <210> 42 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 42 gggccaactt gtcatctctc at 22 <210> 43 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 43 ccgcaatgca gaagagaaa 19 <210> 44 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 44 ttcacggtct gctccatgt 19 <210> 45 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 45 caggacttgg tggacaaact aca 23 <210> 46 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 46 tttagtgtga acctctcggc tc 22 <210> 47 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 47 ctcaagctgc tcagcaatct attt 24 <210> 48 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 48 ggagcgcaag tttgtcataa gt 22 <210> 49 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 49 aaaccccaat gcgatttatc agg 23 <210> 50 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 50 taagcttcat cttttgggcg tga 23 <210> 51 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 51 acagcatcac ggtggaggat atgt 24 <210> 52 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> artificial sequence <400> 52 ccctgctaca gaagtgatgg cttt 24

Claims (15)

A pharmaceutical composition for preventing or treating muscle disease, or for improving muscle function, comprising a bay leaf extract, ginseng extract, ginseng extract, Icaricide B2, creoside IV, or curaridinol as an active ingredient. A quasi-drug composition for preventing or treating muscle disease or for improving muscle function, comprising a bay leaf extract, ginseng extract, ginseng extract, Icariside B2, creoside IV, or curaridinol as an active ingredient. A food composition for preventing or treating muscle disease, or for improving muscle function, comprising a bay leaf extract, ginseng extract, ginseng extract, Icariside B2, creoside IV, or curaridinol as an active ingredient. A feed composition for preventing or treating muscle disease, or for improving muscle function, comprising a panacea extract, ginseng extract, ginseng extract, Icaricide B2, creoside IV, or curaridinol as an active ingredient. 5. The method according to any one of claims 1 to 4,
The Manbyeongcho extract, ginseng extract, or ginseng extract is extracted with water, an organic solvent having 1 to 4 carbon atoms, or a mixed solvent thereof, the composition. 6. The method of claim 5,
The composition, wherein the Manbyeongcho extract, ginseng extract, or wild ginseng extract is extracted by at least one method selected from the group consisting of cold-chilling, heating, ultrasonication and reflux extraction. 5. The method according to any one of claims 1 to 4,
The muscle disease is a muscle disease induced due to decreased muscle function, muscle wasting or muscle degeneration, the composition. 5. The method according to any one of claims 1 to 4,
The muscle disease is muscle loss, muscle loss, dystonia (atony), muscular atrophy (muscular atrophy), muscular dystrophy (muscular dystrophy), muscle degeneration, myasthenia gravis, cachexia (cachexia), cardiac atrophy (cardiotrophy) and sarcopenia (sarcopenia) At least one selected from the group consisting of, the composition. 5. The method according to any one of claims 1 to 4,
The panacea extract, ginseng extract, ginseng extract, Icariside B2, creoside IV, or curaridinol has mitochondrial damage alleviation, myoblast differentiation induction or myotube cell formation promoting activity, the composition. 5. The method according to any one of claims 1 to 4,
The Arachnid plant extract or Icaricide ratio 2 is MyoD, myogenin, Myh1, Myh2, Myh4, Myh7, COX2, ATPase6 and SIRT3 to increase the expression of one or more selected from the group consisting of, the composition. 5. The method according to any one of claims 1 to 4,
The composition, wherein the ginseng extract or creoside IV increases the expression of at least one selected from the group consisting of MyoD, myogenin, Myh1, Myh2, Myh4, Myh7, SDHA and DRP1. 5. The method according to any one of claims 1 to 4,
The high ginseng extract or curaridinol is to increase the expression of one or more selected from the group consisting of MyoD, myogenin, Myh1, Myh2, Myh4 and Myh7, the composition. 13. A health functional food for preventing or treating muscle disease or improving muscle function, comprising the food composition according to any one of claims 3, 5 to 12. Obtaining an extract from Albania flower; obtaining a sugar ginseng extract from sugar ginseng; Or a method for preparing a composition for preventing or treating muscle disease, or for improving muscle function, comprising the step of obtaining a ginseng extract from ginseng. Separating Icaricide B2 from the extract of Albania; separating creoside IV from the ginseng extract; Or a method for preparing a composition for preventing or treating muscle disease or for improving muscle function, comprising the step of isolating claridinol from the ginseng extract.

Images