KR20120001283A - Composition for prevention or treatment of osteoporosis comprising herbal extract and fermentation product thereof with lactic acid bacteria - Google Patents

Abstract

PURPOSE: A pharmaceutical composition containing fermentation of crude drug extract is provided to prevent osteoclast differentiation and to prevent and/or treat osteoporosis. CONSTITUTION: A fermentation of crude drug extract is prepared by adding water or organic solvent to crude drug mixture, inoculating Lactic acid bacteria to the crude drug extract, and fermenting. The crude drug extract contains 2-8 weight parts of Ephedrae Herba, 0.5-2 weight parts of dry Zingiber officinale Roscoe, 1-6 weight parts of Cinnamomi Cortex, 1-6 weight parts of Paeoniae Radix, and 1-4 weight parts of Glycyrrhizae radix. The organic solvent is alcohol of C1-C4, acetone, or solution thereof. A pharmaceutical composition for preventing or treating osteroporosis contains the crude drug extract or fermentation thereof as an active ingredient.

Description

Composition for Prevention or Treatment of Osteoporosis Comprising Herbal Extract and Fermentation Product Julia with Lactic acid Bacteria}

The present invention relates to a composition for preventing or treating osteoporosis, and more particularly, contains an extract of a herbal mixture including brown root, ephedra, health, control, cinnamon, peony and licorice or a fermented product thereof as an active ingredient, osteoporosis It relates to a composition which can be usefully used for prophylaxis and / or treatment.

Bone tissues of living organisms maintain a dynamic equilibrium in which tissue formation by osteoblasts and absorption of tissue by osteoclasts are constantly repeated. Osteoporosis is a disease caused by the collapse of osteoblasts and osteoclasts, resulting in greater bone resorption than bone formation, resulting in reduced bone mineral density, thinning the bone's densities, and widening the bone marrow cavity. In addition, as the symptoms progress, the bones become weak, so even a small impact is likely to fracture. The causes of osteoporosis are known to be old age, lack of exercise, low weight, smoking, low calcium diet, menopause, ovarian resection, and especially in women, bone loss continues after age 30, and hormone changes in menopause. As a result, bone reduction progresses rapidly. In other words, osteoporosis is an unavoidable symptom in elderly people, especially postmenopausal women, and as the population ages in developed countries, interest in osteoporosis and its therapeutics is gradually increasing. Osteoporosis can be divided into three types: first, idiopathic osteoporosis, second, type I osteoporosis caused by post-menopausal female hormone deficiency, and third, type II osteoporosis found in older men and women.

Currently used osteoporosis therapeutic agents are mostly estrogen-based substances, these have the problem that side effects such as cancer, gallstones, thrombosis when long-term administration. Osteoporosis is a disease that can not be treated by short-term administration of the drug, and long-term administration of the drug is essential. Therefore, there is a need for the development of a new substance that does not have the above side effects even when the drug is administered for a long time and has an excellent efficacy to replace estrogen. . Therefore, many people are trying to develop phytoestrogens such as genistein or daidzein in foods such as soybeans and soybean processed products that can be taken for a long time and have relatively low side effects. Research is ongoing.

Phytoestrogen, a plant hormone, has a relatively low bioavailability, but has a good affinity for estrogen receptor-α (ER-α) and estrogen receptor-β (ER-β) and has fewer side effects such as breast cancer. I am getting it. Substances known as phytoestrogens include isoflanone compounds such as dydzein, genistein, formononetin, biochanin A, and coumestan, such as coumestrol. ) Compounds, lignan compounds such as enterolactone, and phenol compounds such as enterodiol. Of these compounds, sugar compounds are hydrolyzed by the intestinal bacteria β-glucosidase or gastric acid and are eventually absorbed into free isoflavones in the nonglycoside form.

On the other hand, as a technology for obtaining useful substances for humans by adding fermentation by adding microorganisms to herbal medicines, a technology that obtains synergistic effect of formal function by selecting lactic acid bacteria that have good growth and good flavor in Chinese herbal medicine juice solution, mixed culture and fermentation (Korea Registered Patent No. 185619), Technology that preserves the unique properties of each raw material and doubles the effect by fermenting all the raw materials using low-temperature method using meju soybean, which has been selected by fermenting some grains and herbal medicines. 2004-0078030).

Therefore, the present inventors have studied the herbal extracts that can be usefully used to improve osteoporosis, and prepared herbal extracts of the mixture of brown root, ephedra, health, control, cinnamon, peony and licorice, and fermented again using lactic acid bacteria. The fermented product was prepared, and the present invention was completed by revealing that the herbal extract or its lactic acid bacterium fermented product showed an excellent osteoporosis prevention or treatment effect that has not been reported before.

It is an object of the present invention to provide a herbal extract or a lactic acid bacteria fermented product thereof and a composition for preventing or treating osteoporosis containing the same as an active ingredient.

In order to achieve the above object, the present invention provides a lactic acid bacterium fermentation product of the extract of herbal medicines of brown root, ephedra, health, control, cinnamon, peony and licorice mixture.

The present invention also provides a pharmaceutical composition for the prevention or treatment of osteoporosis, containing the herbal extract of the root, ephedra, health, control, cinnamon, peony and licorice mixture or a fermented product thereof.

In another aspect, the present invention provides a health food for preventing or treating osteoporosis, which contains a herbal extract of a root, ephedra, health, control, cinnamon, peony and licorice mixture or a fermented product thereof.

The present invention provides lactic acid bacterium fermentation of herbal extracts of brown root, ephedra, health, control, cinnamon, peony and licorice mixture.

The herbal extracts are 2 to 8 parts by weight of ephedra, 0.5 to 2 parts by weight, 2 to 8 parts by weight, 2 to 8 parts by weight, 1 to 6 parts by weight of cinnamon, 1 to 6 parts by weight of peony and 1 to 4 parts by weight of licorice. It is preferable to prepare and extract the herbal mixture in a negative proportion. Although water is generally used as the extraction solvent, other organic solvents may be used in addition to water as necessary. Organic solvents that can be used include, but are not limited to, C ₁ to C ₄ lower alcohols, acetone, or aqueous solutions thereof. In the present invention, the "herbal extract" is used as a meaning including not only the extraction of the medicinal mixture using water but also extracted using an organic solvent other than water.

According to a preferred embodiment of the present invention, in order to prepare a lactic acid bacteria fermented product of the herbal extract (hereinafter, also abbreviated as "herbal fermented product" or "fermented product of the herbal extract"), the first to 2 to the herbal mixture as described above After adding 15 times the amount of water to prepare a water extract extracted from hot water at 70 to 100 ℃. After cooling the extract, the lactic acid bacteria were inoculated at 0.5 to 5% by weight, preferably 1% by weight of the sample weight, and fermented at 20 to 40 ° C, preferably at 37 ° C for 24 to 52 hours, preferably 48 hours. A fermentation product of the herbal extract of the present invention is prepared. When preparing a fermented product of a herbal extract with a herbal extract prepared using an organic solvent other than water as the extraction solvent, it is preferable to first dry the extract, and then dilute it in water, and then inoculate it with lactic acid bacteria to ferment it. Do.

In the above, as the lactic acid bacteria, various strains or commercially available lactic acid bacteria can be used without limitation. Specifically, microorganisms of the genus Lactobacillus, Bifidobacterium, Streptococcus, Leukonostock, Pediococcus and Lactococcus can be used without limitation, and among them, it is preferable to use microorganisms of the genus Lactobacillus. In a preferred embodiment of the present invention Bifidobacterium breve ( Bifidobacterium) breve ), Lactobacillus casei ), L. acidophilus , L. acidophilus , L. plantarum , L. bulgaricus and L. delbruekii subsp. Lactobacillus delbruekii subsp. Various kinds of lactic acid bacteria such as lactis ) were used to prepare the herbal fermented product of the present invention (see Example 1). However, the lactic acid bacteria that can be used are not limited to the lactic acid bacteria exemplified above, and the lactic acid bacteria culture medium may also be selected from MRS (Man-Rogosa-Sharpe), lactose, M17 and APT medium (Asparagine Enrichment Broth) according to the respective lactic acid bacteria. But it is not limited thereto.

The present invention also provides a pharmaceutical composition for the prevention or treatment of osteoporosis, containing the herbal extract of the root, ephedra, health, control, cinnamon, peony and licorice mixture or a fermented product thereof.

The herbal extract or herbal fermentation product according to the present invention can be administered orally or parenterally during clinical administration and can be used in the form of a general pharmaceutical preparation. That is, the herbal extract of the present invention or the fermented product thereof may be administered in various oral and parenteral dosage forms in actual clinical administration, and when formulated, the commonly used fillers, extenders, binders, wetting agents, disintegrants, surfactants It is prepared using diluents or excipients. Solid preparations for oral administration include tablets, pills, powders, granules, capsules and the like, which solid preparations contain at least one excipient such as starch, calcium carbonate, sucrose or lactose in the herbal extract or herbal fermentation product. Mixed with gelatin. In addition to simple excipients, lubricants such as magnesium styrate talc are also used. Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin. have. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories. As the non-aqueous solvent and the suspension solvent, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, and the like can be used. As the base of the suppository, uthepsol, macrogol, tween 61, cacao butter, laurin butter, glycerol, gelatin and the like can be used. In addition, calcium or vitamin D ₃ may be additionally added to prevent or improve the efficacy of osteoporosis.

Dosage units may, for example, contain 1, 2, 3 or 4 times the individual dose, or 1/2, 1/3 or 1/4 times. Individual dosages contain amounts in which the effective drug is administered at one time, which usually corresponds to all, 1/2, 1/3 or 1/4 times the daily dose.

The human dose of the herbal extract or herbal fermentation product of the present invention is appropriately selected according to the absorbency, inactivation rate and excretion rate of the active ingredient in the body, the age, sex, condition, degree of disease, etc. Mg / kg, preferably 20-100 mg / kg, and may be administered in divided portions 1 to 6 times a day.

Toxicity experiments during oral and intraperitoneal administration of the compositions of the present invention were carried out. As a result, 50% lethal dose (LD ₅₀ ) by oral toxicity test was found to be a safe substance of at least 5 g / kg or more.

According to one embodiment of the present invention, treatment of the herbal extracts and fermented extracts of the herbal extracts not only significantly reduces TRAP activity, an osteoclast differentiation-related marker, and the formation of multinuclear osteoclasts (see FIG. 1). The expression of osteoclast differentiation related genes is also significantly reduced (see Table 2). In addition, according to the embodiment using a variety of lactic acid bacteria fermentation, the fermented product of the herbal extract of the present invention generally decreases TRAP activity, a marker related to osteoclast differentiation, and the effect is remarkable, especially at high concentrations, and multinuclear osteoclasts. The formation of cells is also significantly reduced (see FIGS. 2A and 2B).

In addition, according to another embodiment of the present invention, no abnormal symptoms or dead animals due to administration of the fermented product of the herbal extracts are observed. The administration of the herbal extracts and fermented products of the herbal extracts reduced the weight gain due to ovarian extraction (see FIG. 3), and does not show the weight change of other organs (see Table 4). In addition, as a result of analyzing the serum of each group of animals using a biochemical analyzer, the herbal extract administration group significantly reduced the total cholesterol, LDL-cholesterol, HDL-cholesterol and triglyceride concentrations due to ovarian extraction, and the herbal extract In the fermentation group of the LDL-cholesterol and triglyceride concentration is significantly reduced (see Table 5).

The present invention also provides herbal extracts of brown root, ephedra, health, control, cinnamon, peony and licorice mixture or fermented products thereof and healthy foods for preventing or alleviating osteoporosis containing the same as an active ingredient.

The herbal extract of the present invention or the lactic acid bacterium fermented product of the herbal extract may be added to a health food for the purpose of improving osteoporosis, and when the herbal extract or the herbal fermented product is used as a food additive, it is added as it is or with other food or food ingredients. It can be used together and can be suitably used according to a conventional method. The mixed amount of the active ingredient may be suitably determined depending on the purpose of use (prevention, health or therapeutic treatment). Generally, in the preparation of food or beverage, the herbal extract or the herbal fermented product is added in an amount of 30 wt% or less, preferably 10 wt% or less with respect to the raw material. However, in the case of long-term intake for health and hygiene or health control, the amount may be below the above range, and the active ingredient may be used in an amount above the above range because there is no problem in terms of safety. .

There is no particular limitation on the kind of food. Examples of the food to which the above substances can be added include dairy products including meat, sausage, bread, chocolate, candy, snack, confectionery, pizza, ramen, other noodles, gums, ice cream, various soups, drinks, tea, Alcoholic beverages, and vitamin complexes, all of which include healthy foods in a conventional sense.

In addition, the herbal extract or the herbal fermented product of the present invention is a variety of herbal medicine prescriptions, for example, gagamsokmyeongtang (加減 續 命 湯), brown root (葛根), galgun gulpipitang (葛根 橘皮 湯), galgeum munmundong (葛根 麥 門冬 散, Galgunjukyeotang (탕 根 竹茹 湯), Galgunhaegi-tang (갈 根 解肌 湯), Galchultang (葛 朮 湯), Galhwanghwan (葛 黃 丸), Crustal Assets (枳殼 煮 散) ), Danggui Baekchultang (맥 白 朮 湯), Macmundongumja (자 子), Baluntang (방), Bangpungtang (防風 湯), Baekchulsan (白 朮 散), Samhaehaegitang (四 物 解肌) 사), Sawi-tang, Sanjong Gwagtang-tang, Samduhaejeong-tang, Samyang-tang, Fresh Brown Root Juice, Sopung Sungi-tang ,, Horseback Ritual Bath, Horse Riding Budang Bath, Horse Riding Uefeng-Tang (승 風 湯), Seungyangbo Wei-Tang (, 陽 補 胃 湯), Shiho Seungmatang (柴胡) Shiho Landscape Garden Bath, Sindaltang, Sinseon Buddhist Temple, Sinseongsan, Sinhyomyeong Moktang效 明目 湯, Seopsintang, Yeoktongtonggi-tang, Yeongyo Horse Horse Tang, Yeongseonjetong, Yintang, Jade Sugar 폐, Onheungtang, Ikgi Chongmyeongtang, Ikjihwajungtang, Ginseng Cheonggisan (人蔘 淸 肌 散), Injinsawangtang ), Ilbo Ilbeol (一 補 一發 丹), Consonant Cheongwihwan (전), Jeon Life Blood Bath, Jeon Life Mountain, Jojungtang, Jigaltang (,), Jiyusan, Jingyo Seungmatang, Cheongyangtang, Cheongyeolhaegitang, Chunghwasungitang ,), Taste Ordinance, Governing White Water German Room, Pyeongwijiyutang, Pyeongmoum Yin, Habaek Water German Room (解 百物 毒 一方, Hae Soju German Room, Hae poisoning poisoning, Hae Haehwa Doksan, Hae Cha Soe German Room, Haepado Dokbang 설 (通 解 通)散) it may be used or the like.

The health beverage composition of the present invention may contain various flavors or natural carbohydrates as an additional ingredient such as ordinary beverages. Natural carbohydrates described above include glucose, monosaccharides such as fructose, disaccharides such as maltose and sucrose, and polysaccharides such as dextrin and cyclodextrin, sugar alcohols such as xylitol, sorbitol, and erythritol. Examples of sweeteners include natural sweeteners such as tau martin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like. The ratio of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 ml of herbal extract or herbal fermentation.

In addition to the above, herbal extracts or fermented extracts of herbal extracts include various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH regulators, stabilizers, preservatives, glycerin , Alcohols, carbonating agents used in carbonated drinks, and the like. In addition, the herbal extract or herbal fermented product may contain flesh for the production of natural fruit juice, fruit juice beverage and vegetable beverage. These components can be used independently or in combination. The ratio of such additives is not critical but is generally selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of the herbal extract or fermented product of the herbal extract.

As described above, since the herbal extract or herbal fermented product has an excellent inhibitory effect on osteoclast differentiation and related gene expression, it may be usefully used for the prevention and / or treatment of osteoporosis.

Figure 1 shows the herbal extract and Bifidobacterium brene of the present invention on the formation of TRAP activity (A) and TRAP-positive multinucleated osteoclasts induced by RANKL (Receptor Activator for Nuclear Factor κB Ligand) in RAW264.7 cells, respectively. Graph and photograph showing the effect (B) of the fermentation of the herbal extracts fermented by EB (ATCC 15700).
2A and 2B show the effect of fermented herbal extracts fermented by various lactic acid bacteria on the formation of RANKL-induced TRAP activity (A) and TRAP-positive multinucleated osteoclasts (B) in RAW264.7 cells. It is a graph. G: hydrothermal extract sample of the herbal mixture, G con: sterile sample before fermentation of the herbal extract, G127: Lactobacillus cassei (KCTC 2180) fermentation, G128: Lactobacillus ashdophyllus (KCTC 2182) fermentation, G129: lactose Bacillus casei (ATCC 393) fermentation, G144: Lactobacillus plantarum (ATCC 8014) fermentation, G-150: Lactobacillus ashdophyllus (ATCC 4356) fermentation, G-344: Lactobacillus vulgaris (KFRI) # 344) Fermentation, G-402: Lactobacillus plantarum (ATCC 8014) Fermentation, G-442: Lactobacillus delbrueki subspecies Lactis (ATCC 7830) fermentation, G-692: Lactobacillus casei (KFRI # 692) Fermentation, G-744: Bifidobacterium breve (ATCC 15700) fermentation, RANLK: osteoclast differentiation-inducing cytokine.
Figure 3 is a graph showing the weight change of ovarian extract rats during the administration of the herbal extract and the herbal extract. C; Control, NC; Negative control, GGT; Herbal extract administration group, GFT; Herbal extract administration group fermented by Bifidobacterium breve.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are only for illustrating the present invention, and the scope of the present invention is not limited by the following examples.

Example 1 Preparation of Lactic Acid Bacteria Fermented Herbal Extract

The herbal extract was used as an herbal preparation prepared by extracting brown root, ephedra, health, control, cinnamon, peony, and licorice on the basis of 50 tablets and used in the experiment. The herbal mixture was prepared after extracting the herbal mixture in the ratio of 8 g of root roots, 4 g of ephedra, 1 g of health, 4 g of control, 3 g of cinnamon, 3 g of peony, and 2 g of licorice. The total content of 50 medicinal herbs is 1,250 g and extracted by boiling water for 150 minutes in 12.5 ℓ of distilled water (10 times its amount) (Korea, Gyeongseo extractor cosmos-600), followed by standard testing sieve (Aperture 500 ㎛ and 150 ㎛). The medicinal herb extract was prepared by filtration of the medicinal herb. In addition, lactic acid bacteria (1-5 × 10 ⁸ CFU / ml) of 1% volume (v / v) was added to the filtered bath, fermented at 37 ° C. for 48 hours, and then filtered through the standard test sieve to ferment the lactic acid bacteria of the herbal extract. Water was prepared. Fermented herbal medicines were stored at 4 ℃ until freeze-dried before use. The lactic acid bacteria used to prepare the lactic acid bacteria fermentation products were as follows: Bifidobacterium breve (ATCC 15700), Lactobacillus casei (KCTC 2180, ATCC 393, KFRI # 692), Lactobacillus ashdophyllus (KCTC 2182, ATCC) 4356), Lactobacillus plantarum (ATCC 8014), Lactobacillus vulgaris (KFRI # 344) and Lactobacillus delbrueki subspecies lactis (ATCC 7830).

Example 2. Effect of Herbal Medicine Extract and Fermented Herbal Medicine Extract on Osteoclast Differentiation

RAW264.7 cells differentiate with osteoclasts, showing an increase in TRAP activity, a marker of osteoclast differentiation upon RANKL treatment (Minkin C. Calcif Tissue Int. 1982 34 (3): 285-90; Hsu H, et al., 1999, Proc. Nat. Acad. Sci. USA, 96, 35403545). In order to confirm the effect of the herbal extract (GGT) and lactic acid bacteria fermentation (GFT) of the herbal extract prepared in Example 1 on osteoclast differentiation, RAW264.7 cells were 96-dense at a density of 1 × 10 ³ cells / well. Aliquots were dispensed into well plates and treated with herbal extracts and fermentation of herbal extracts at 25-200 μg / ml concentrations for 3 days. At this time, a-MEM medium (10% FBS) containing RANKL (100 ng / ml), which is a differentiation inducing factor, was used as the culture medium.

TRAP activity was measured on day 4 of treatment of the test substance, and after performing TRAP staining to confirm TRAP-positive multinucleated osteoclast formation, multinucleated osteoclasts were identified under a microscope. To this end, the osteoclasts were fixed in 10% formalin for 10 minutes and with ethanol / acetone (1: 1, v / v) mixed solvent for 1 minute, followed by staining kit (Leukocyte Acid Phosphatase Kit 387-A, Sigma, MO). And stained. Differentiated multinucleated osteoclasts were observed under a microscope equipped with a DP controller (Olympus Optical Co. Ltd., Tokyo, Japan). For the measurement of TRAP activity, citrate buffer (50 mM, pH 4.6) containing 10 mM sodium tartarate, 5 mM p-nitrophenylsulfonate (Sigma, MO) in a 96-well plate containing the osteoclasts fixed above. After the addition was incubated at 37 ℃ for 1 hour. After mixing this enzyme reaction solution with the same amount of 0.1 N NaOH, the absorbance was measured at 410 nm. TRAP activity was expressed in% compared to the control.

As a result, the herbal extracts significantly reduced TRAP activity from 50 μg / ml concentration, and the fermented product of the herbal extracts fermented by Bifidobacterium breve significantly reduced TRAP activity at 100 μg / ml concentration ( A, p <0.05 in FIG. 1). In addition, it was confirmed by TRAP staining that the formation of multinucleated osteoclasts was reduced during the fermentation treatment of the herbal extracts and the herbal extracts fermented by Bifidobacterium breve (FIG. 1B). In addition, as a result of experiments using fermented products of the herbal extracts fermented by various lactic acid bacteria, the fermented products of the herbal extracts of the present invention reduced the overall TRAP activity, especially at 100 ㎍ / ㎖ concentration (Fig. 2a and A, p <0.01 of FIG. 2b). In addition, it was confirmed by TRAP staining that the formation of multinucleated osteoclasts was reduced upon treatment of fermented herbal extracts fermented by Lactobacillus casei, Lactobacillus vulgaris and Lactobacillus plantarum (FIGS. 2A and 2B). ).

Example  3. Expression of Osteoclast Differentiation Related Genes by Herbal Extracts

TRAP, c-Src and Cathepsin K genes are essential for osteoclast differentiation and bone resorption and are known to increase expression during osteoclast differentiation (Hsu H, et al., 1999, Proc. Nat. Acad. Sci USA, 96, 35403545). Therefore, real time quantitative PCR (real time quantitative PCR) was performed to confirm the effect of the herbal extracts that inhibit TRAP staining and activity on the expression of the three genes. For this, total RNA was isolated using TRIzol (Invitrogen, Inc. NY, USA) three days after RANKL treatment. Primers specific for osteoclast differentiation related genes were designed using an online primer design program (Rozen and Skaletsky, 2000), and the primers for each gene were the forward and reverse primer pairs shown in Table 1 below. Was used. cDNA was synthesized using 2 μg total RNA, 1 μM oligo-dT ₁₈ primer and 10 units of RNase inhibitor RNasin (Promega, WI, USA) and Omniscript Reverse Transcriptase (Qiagen, CA). SYBR green-based quantitative PCR amplification was performed using a Stratagene Mx3000P Real-Time PCR system after mixing 50-fold diluted cDNA and 20 mmol of primers with Brilliant SYBR Green Master Mix (Stratagene, Calif.). The PCR program is as follows. After holding for 10 minutes at 95 ° C. for polymerase activity, 40 times at 94 ° C. (denature), 40 seconds at 60 ° C. (annealing) and 1 minute at 72 ° C. (extension) were performed 40 times. Subsequently, temperature dissociation curves (also referred to as 'melting curves') of the PCR products generated by holding at 95 ° C for 1 minute, 55 ° C for 30 seconds, and 95 ° C for 30 seconds were prepared. All experiments were repeated three times, and PCR data were analyzed according to the 2 ^{-ΔΔ CT} method (Livak and Schmittgen, 2001). At this time, GAPDH was used as a control of PCR, and after analyzing GAPDH-normalized 2 ^{-ΔΔ CT} data by Student's t-test, p <0.05 was determined as a significant difference.

As a result, the expression of all three genes increased rapidly during RANKL treatment, but the expression of c-Src and Cathepsin K genes were significantly decreased in the herbal extract treatment group (200 μg / ml) ( p <0.05). , Table 2).

gene Forward primer (5 '-> 3') order
number Back primer (5 '-> 3') order
number TRAP ACACAGTGATGCTGTGTGGCAACTC One CCAGAGGCTTCCACATATATGATGG 2 c-Src CCAGGCTGAGGAGTGGTACT 3 CAGCTTGCGGATCTTGTAGT 4 Cathepsin k GGCCAACTCAAGAAGAAAAC 5 GTGCTTGCTTCCCTTCTGG 6 GAPDH AACTTTGGCATTGTGGAAGG 7 ACACATTGGGGGTAGGAACA 8

Effect of Herbal Extracts on the mRNA Expression of RANKL-induced Osteoclast-Specific Genes in RAW264.7 Cells TRAP c-Src Cathepsin k RANKL untreated 1.09 ± 0.61 1.01 ± 0.08 1.10 ± 0.66 RANKL treatment 1.97 ± 0.01 3.14 ± 0.15 ^* 19150.28 ± 281.57 ^* RANKL + GGT (100 μg / ml) 0.43 ± 0.11 ^# 0.74 ± 0.27 ^# 6299.63 ± 1677.93 ^#

^* p <0.05, significantly different from RANKL untreated group.

^# p <0.05, significantly different from RANKL treatment group.

Example  4. Ovarian Extraction Rat  Of Herbal Extracts and Herbal Extracts on Organs and Blood Biochemical Indicators Fermented products  Impact

In order to verify the osteoporosis inhibitory effect of the herbal extracts and herbal extracts that inhibit the formation of osteoclasts, oral fermented products of the herbal extracts fermented by Bifidobacterium breve fermented with ovarian isolated rat model for 12 weeks. Administered. Specifically, experiments were performed using 9-week-old female rats (Orient, Seoul, Korea). After visual inspection of the animals, they were purified in an animal room for 7 days and ovarian extraction was performed. Seven days after ovarian extraction, the groups were separated and 36 of the healthy animals were selected and used in the experiment. Each experimental group was classified as shown in Table 3 below. Healthy animals were weighed during the acclimatization period, and then divided into 5 g intervals to select animals close to their average weights. The animals thus selected were randomly distributed to have an even weight based on the weighted ranking of the nine animals. Animal identification was performed by pigmentation of the coat and labeling of the individual identification cards. Each test substance was administered based on the daily clinical dose (15 ㎖ / ㎏, 2 times / day), using the dorsal skin fixation method to fix the experimental animals and using oral administration disposable Fujide (Fujigami, Japan) and injection tube Forced oral administration in the stomach. The dosage of the fermented product of the herbal extract was lower than that of the herbal extract due to the yield change due to fermentation. The control group (C group) and the negative control group (NC group) was administered the same dose of distilled water.

As a result, no abnormal symptoms or dead animals were observed due to the administration of the herbal extracts and the herbal extracts during the administration period. Body weights of the administration group and NC group were significantly increased compared to group C ( p <0.01). However, in the GGT or GFT-administered group, body weight was significantly reduced compared to the NC group from 6 weeks after the administration ( p <0.01) (FIG. 3).

For 12 weeks, no gross abnormalities were observed in the uterus, brain, thyroid, heart, lung, liver, spleen, kidney and adrenal gland extracted from each animal after administration of the herbal extract and the fermented product of the herbal extract. In addition, compared to group C, the uterine weight of the NC group showed a significant decrease of about 84% ( p <0.01). In addition, there was no difference in the weight of different organs between groups (Table 4).

Serum of each group of animals was analyzed using a biochemistry analyzer, and the triglyceride concentration was significantly increased in the NC group compared to the C group ( p <0.05). Compared with the NC group, the total cholesterol, LDL-cholesterol, HDL-cholesterol, and triglyceride concentrations increased significantly due to ovarian extraction in the GGT-administered group ( p <0.05), and LDL-cholesterol and triglyceride in the GFT-administered group. The concentration was significantly reduced ( p <0.05). There were no differences in other blood biochemical markers in the GGT- or GFT-treated groups compared to the NC group (Table 5).

Classification name Experimental group Number of animals process
(Ml / kg) Dose
(Mg / kg / day) C Control group 9 15 - NC Ovarian Extracted Rat 9 15 - GGT Ovarian isolated rats treated with herbal extracts 9 15 756 GFT Ovarian isolated rats treated with herbal extracts fermented by Bifidobacterium breve 9 15 738

C; Control, NC; Negative control, GGT; Herbal extract administration group, GFT; Herbal extract administration group fermented by Bifidobacterium breve

Weight of organ (n = 9, unit: g) 12 weeks after administration of herbal extract and fermented product of herbal extract  long time C NC GGT GFT Womb 0.69 ± 0.21 0.11 ^** ± 0.02 0.12 ± 0.02 0.12 ± 0.03 brain 1.98 ± 0.10 2.00 ± 0.10 1.91 ± 0.15 1.98 ± 0.09 pituitary 0.0164 ± 0.0031 0.0134 ± 0.0016 0.0137 ± 0.0012 0.0142 ± 0.0015 lungs 1.50 ± 0.15 1.14 ± 0.14 1.52 ± 0.17 1.51 ± 0.21 Heart 1.14 ± 0.11 1.10 ± 0.10 0.11 ± 0.13 0.11 ± 0.17 liver 8.71 ± 0.72 8.17 ± 1.11 7.93 ± 0.70 8.55 ± 0.85 spleen 0.66 ± 0.14 0.63 ± 0.07 0.65 ± 0.09 0.70 ± 0.07 Height (left) 1.07 ± 0.11 0.96 ± 0.10 0.98 ± 0.10 1.00 ± 0.07 Height (right) 1.07 ± 0.12 0.95 ± 0.11 1.02 ± 0.10 1.02 ± 0.09 Adrenal gland (left) 0.04 ± 0.01 0.03 ± 0.01 0.02 ± 0.01 0.02 ± 0.01 Adrenal gland (right) 0.03 ± 0.01 0.02 ± 0.01 0.03 ± 0.01 0.03 ± 0.01

Values are expressed as mean ± S.D.

^** p <0.01, significantly different from C.

Biochemical Indices of Ovariectomized Rat Serum 12 Weeks After Administration of Herb Extracts and Fermented Herb Extracts (n = 9)  Biochemical indicators C NC GGT GFT AST (U / L) 43.09 ± 13.79 42.86 ± 9.39 34.71 ± 7.20 36.70 ± 8.75 ALT (U / L) 120.88 ± 31.08 120.94 ± 29.77 111.19 ± 22.91 110.44 ± 19.42 ALP (U / L) 171.11 ± 73.20 176.68 ± 56.37 203.96 ± 55.45 217.98 ± 44.99 Total cholesterol
(Mg / dl) 107.78 ± 27.81 118.56 ± 10.42 87.33 ^b ± 23.78 98.67 ± 30.07 HDL-cholesterol
(Mg / dl) 34.81 ± 6.61 37.20 ± 1.99 30.23 ^b ± 4.95 32.66 ± 6.77 LDL-cholesterol
(Mg / dl) 6.98 ± 2.09 7.79 ± 0.98 5.31 ^b ± 1.01 5.74 ^b ± 1.69 Triglycerides
(Mg / dl) 58.00 ± 21.33 81.80 ^a ± 19.74 57.29 ^b ± 16.32 57.43 ^b ± 11.93 Phosphate (mg / dl) 8.79 ± 0.87 8.66 ± 1.04 9.55 ± 1.12 9.40 ± 1.73 Calcium (mg / ㎗) 11.98 ± 0.81 11.59 ± 0.43 11.36 ± 0.55 11.54 ± 0.35

Values are expressed as mean ± S.D.

^a p <0.05, significantly different from C.

^b p <0.05, significantly different from NC.

Manufacturing example  1: of herbal extract or herbal extract Fermented products  Preparation of a pharmaceutical composition comprising

<1-1> Preparation of Syrup

Syrup containing the herbal extract or fermented product of the herbal extract as an active ingredient 2% (weight / volume) was prepared by the following method. First, fermented powder, saccharin, and sugar of the herbal extract or herbal extract prepared in Example 1 were dissolved in 80 g of warm water. After the solution was cooled, a solution consisting of glycerin, saccharin, spices, ethanol, sorbic acid and distilled water was prepared and mixed thereto. Water was added to this mixture to 100 ml.

The components of the syrup are as follows.

Herbal medicine extract or fermented product of herbal medicine extract ... 2 g

Saccharin 0.8 g

25.4 g of sugar

Glycerin 8.0 g

Spices ... 4.04 g

Ethanol 4.0 g

0.4 g of sorbic acid

Distilled water ···················

<1-2> Preparation of Tablet

A tablet containing 15 mg of active ingredient was prepared by the following method.

250 g of the herbal extract or fermented product of the herbal extract was mixed with 175.9 g of lactose, 180 g of potato starch and 32 g of colloidal silicic acid. 10% gelatin solution was added to the mixture, which was then ground and passed through a 14 mesh sieve. It was dried and the mixture obtained by adding 160 g of potato starch, 50 g of talc and 5 g of magnesium stearate was made into a tablet.

250 g of herbal extracts or fermented products of herbal extracts

Lactose ... 175.9 g

Potato starch ... 180 g

Colloidal silicic acid 32 g

10% gelatin solution

Potato starch ... 160 g

Talc ・ ・ ・ ・ ・ ・ ・ 50 g

Magnesium stearate ... 5 g

Manufacturing example  2: of herbal extract or herbal extract Fermented products  Production of health food containing

<2-1> Preparation of food

Foods containing herbal extracts or fermented products of herbal extracts were prepared as follows.

1. Preparation of Cooking Seasonings

A health promotion cooking seasoning was prepared from 20 to 95% by weight of the herbal extract or fermented product of the herbal extract.

2. Preparation of Tomato Ketchup and Sauce

Health promotion tomato ketchup or sauce was prepared by adding 0.2-1.0 wt% of the herbal extract or fermented product of the herbal extract to tomato ketchup or sauce.

3. Manufacturing of Flour Foods

0.5 to 5.0% by weight of the herbal extracts or fermented products of the herbal extracts were added to the flour, and bread, cake, cookies, crackers and noodles were prepared using the mixture to prepare foods for health promotion.

4. Preparation of soups and gravy

0.1-5.0% by weight of the herbal extracts or fermented products of the herbal extracts were added to the soups and broths to prepare meat products for health promotion, soups and noodles of noodles.

5. Preparation of Ground Beef

10% by weight of the herbal extract or fermented product of the herbal extract was added to the ground beef to prepare a ground beef for health promotion.

6. Manufacture of Dairy Products

5-10% by weight of the herbal extract or fermented product of the herbal extract was added to the milk, and the milk was used to prepare various dairy products such as butter and ice cream.

7. Manufacture of wire

Brown rice, barley, glutinous rice, and yulmu were alphad by a known method, and then dried and roasted to prepare a powder having a particle size of 60 mesh using a grinder. Black beans, black sesame seeds, and perilla were also steamed and dried by a known method, and then ground to a powder having a particle size of 60 mesh. The herbal extract or the fermented product of the herbal extract was reduced and concentrated in a vacuum concentrator, and the dried product obtained by drying with a spray and a hot air dryer was pulverized with a particle size of 60 mesh to obtain a dry powder. It was prepared by combining the dry powder of the grains, seeds and herbal extracts or fermented products of the herbal extracts prepared in the following ratio.

Cereals (30% by weight brown rice, 15% by weight barley, 20% by weight barley),

Seeds (7% by weight perilla, 8% by weight black beans, 7% by weight black sesame),

Dry powder (3% by weight) of the herbal extract or fermented product of the herbal extract,

Ganoderma lucidum (0.5% by weight),

Sulfur (0.5 wt%)

<2-2> Preparation of Drink

1. Preparation of Carbonated Drinks

5-10% of sugar, 0.05-0.3% citric acid, 0.005-0.02% caramel, 0.1-1% of vitamin C are mixed, and 79-94% purified water is mixed to make syrup, and the syrup is 85-98. After sterilization at 20 ° C. for 180 seconds, the mixture was mixed with cooling water at a ratio of 1: 4, and 0.5 to 0.82% of carbon dioxide was injected to prepare a carbonated beverage containing a herbal extract or a fermented product of the herbal extract.

2. Manufacture of health drinks

Instant sterilization by homogeneously mixing subsidiary ingredients such as liquid fructose (0.5%), oligosaccharide (2%), sugar (2%), salt (0.5%), water (75%) and fermented products of herbal or herbal extracts Then, it was packaged in small packaging containers such as glass bottles and PET bottles to prepare healthy drinks.

3. Preparation of Vegetable Juice

Health supplement vegetable juice was prepared by adding 5 g of the herbal extract or fermented product of the herbal extract to 1,000 ml of tomato or carrot juice.

4. Preparation of Fruit Juice

Health supplement fruit juice was prepared by adding 1 g of the herbal extract or fermented product of the herbal extract to 1,000 ml of apple or wine.

<110> Korea Institute of Oriental Medicine <120> Composition for Prevention or Treatment of Osteoporosis          Comprising Herbal Extract and Fermentation Product Thereof with          Lactic Acid Bacteria <130> 2010-dpa-0062 <160> 8 <170> KopatentIn 1.71 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> forward primer for TRAP <400> 1 acacagtgat gctgtgtggc aactc 25 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for TRAP <400> 2 ccagaggctt ccacatatat gatgg 25 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer for c-Src <400> 3 ccaggctgag gagtggtact 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for c-Src <400> 4 cagcttgcgg atcttgtagt 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer for Cathepsin K <400> 5 ggccaactca agaagaaaac 20 <210> 6 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for Cathepsin K <400> 6 gtgcttgctt cccttctgg 19 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer for GAPDH <400> 7 aactttggca ttgtggaagg 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for GAPDH <400> 8 acacattggg ggtaggaaca 20

Claims (9)

Extracted by adding water or an organic solvent to the herbal mixture including brown root, ephedra, health, control, cinnamon, peony and licorice to extract the crude drug extract, characterized in that it is prepared by inoculating the herbal extract to fermentation by inoculating lactic acid bacteria Lactobacillus fermentation of herbal extracts. The method according to claim 1,
The herbal extracts are 2 to 8 parts by weight of ephedra, 0.5 to 2 parts by weight, 2 to 8 parts by weight, 2 to 8 parts by weight, 1 to 6 parts by weight of cinnamon, 1 to 6 parts by weight of peony and 1 to 4 parts by weight of licorice. Fermented product prepared by adding hot water to the herbal mixture comprising a portion after extraction. The method according to claim 1,
The organic solvent is a fermentation, characterized in that selected from the group consisting of C ₁ to C ₄ alcohol, acetone and an aqueous solution thereof. The method according to claim 1,
The lactic acid bacterium is a fermentation product, characterized in that selected from the group consisting of Lactobacillus, Bifidobacterium, Streptococcus, Leukonostock, Pediococcus and Lactococcus. The method of claim 4,
The lactic acid bacteria are microorganisms selected from the group consisting of Bifidobacterium breve, Lactobacillus casei, Lactobacillus ashidophyllus, Lactobacillus plantarum, Lactobacillus vulgaris, and Lactobacillus delbruecki subspecies lactis. Fermented product. The method according to any one of claims 1, 4 and 5,
The lactic acid bacteria fermentation, characterized in that inoculated in the amount of 0.5 to 5% by weight of the sample weight. The method according to any one of claims 1, 4 and 5,
The lactic acid bacteria fermentation, characterized in that the fermentation for 24 to 52 hours at a temperature of 20 to 40 ℃. A pharmaceutical composition for preventing or treating osteoporosis, comprising the herbal extract of claim 1 or a lactic acid bacterium fermentation product of the herbal extract as an active ingredient. Health food for osteoporosis prevention or improvement containing the herbal extract or herbal lactobacillus fermentation of the herbal extract disclosed in claim 1 as an active ingredient.

Images