KR101199961B1 - Composition for Prevention or Treatment of Osteoporosis Comprising Bangpungtongseungsan and Fermentation Product Thereof with Lactic Acid Bacteria - Google Patents

Abstract

The present invention relates to a composition for the prevention or treatment of osteoporosis, more specifically, lactic acid bacteria fermentation and wind-breaking acid or lactic acid bacteria fermentation of wind-breaking acid, characterized in that it is prepared by inoculating and fermenting lactic acid bacteria in wind-breaking acid. It relates to a pharmaceutical composition and health food for preventing or treating osteoporosis containing as an active ingredient. The composition comprising the wind-breaking acid or the wind-breaking acid fermentation product of the present invention is excellent in inhibiting osteoclast differentiation and related gene expression, and thus can be usefully used for the prevention and / or treatment of osteoporosis.

Description

Composition for Prevention or Treatment of Osteoporosis Comprising Bangpungtongseungsan and Fermentation Product Thereof with Lactic Acid Bacteria}

The present invention relates to a composition for preventing or treating osteoporosis, and more particularly, to a composition containing wind-breaking acid or a lactic acid bacterium fermentation product thereof as an active ingredient, and which can be usefully used for preventing and / or treating osteoporosis.

Bone tissues of living organisms maintain a dynamic equilibrium in which tissue formation by osteoblasts and absorption of tissue by osteoclasts are constantly repeated. Osteoporosis is a disease caused by the collapse of osteoblasts and osteoclasts, resulting in greater bone resorption than bone formation, resulting in reduced bone mineral density, thinning the bone's densities, and widening the bone marrow cavity. In addition, as the symptoms progress, the bones become weak, so even a small impact is likely to fracture. The causes of osteoporosis are known to be old age, lack of exercise, low weight, smoking, low calcium diet, menopause, ovarian resection, and especially in women, bone loss continues after age 30, and hormone changes in menopause. As a result, bone reduction progresses rapidly. In other words, osteoporosis is an unavoidable symptom in elderly people, especially postmenopausal women, and as the population ages in developed countries, interest in osteoporosis and its therapeutics is gradually increasing. Osteoporosis can be divided into three types: first, idiopathic osteoporosis, second, type I osteoporosis caused by post-menopausal female hormone deficiency, and third, type II osteoporosis found in older men and women.

Currently used osteoporosis therapeutic agents are mostly estrogen-based substances, these have the problem that side effects such as cancer, gallstones, thrombosis when long-term administration. Osteoporosis is a disease that can not be treated by short-term administration of the drug, and long-term administration of the drug is essential. Therefore, there is a need for the development of a new substance that does not have the above side effects even when the drug is administered for a long time and has an excellent efficacy to replace estrogen. . Therefore, many people are trying to develop phytoestrogens such as genistein or daidzein in foods such as soybeans and soybean processed products that can be taken for a long time and have relatively low side effects. Research is ongoing.

Phytoestrogen, a plant hormone, has a relatively low bioavailability, but has a good affinity for estrogen receptor-α (ER-α) and estrogen receptor-β (ER-β) and has fewer side effects such as breast cancer. I am getting it. Substances known as phytoestrogens include isoflanone compounds such as dydzein, genistein, formononetin, biochanin A, and coumestan, such as coumestrol. ) Compounds, lignan compounds such as enterolactone, and phenol compounds such as enterodiol. Of these compounds, sugar compounds are hydrolyzed by the intestinal bacteria β-glucosidase or gastric acid and are eventually absorbed into free isoflavones in the nonglycoside form.

On the other hand, Windproof Tongseong Mountain is windproof, Angelica, Peony, Peony, Cheongung, Gardenia, Yeongyo, Peppermint, Ginger, Hyungae, Ephedra. Herbal medicine, Rhubarb, Rhubarb, Manganese, Gil-Gyeong, Gil-Gyeong, Baekchul, Licorice, Golden, Huang, Gypsum and Talc. It is recorded for the first time in Ryu Hagan's Theory of Vibration. Wind-breaking tonic acid is hypertension and atherosclerosis in obese type palsy, but the vein is strong, but it is fat poison and intestinal self-toxic food poisoning and renal self-toxic water poison. Used when there is. In addition, according to the research and prescription of published articles related to the treatment of obesity since 2000, Sasang prescription, bodily sensation Iin-tang, and Wind-break Tongsan were found to be frequently prescribed. The same result suggests that wind-breaking acid is widely used for the treatment of obesity (Hwang Mi-ja, et al., Korean Journal of Oriental Obesity, 7 (1); 39-54, 2007).

Experimental studies have been conducted several times to directly or indirectly confirm the efficacy of windbreakable acid for obesity and complications related to obesity. 9 (1); 69-82, 1993), Effects of wind-breaking acids such as sulfur on obesity genes and related factors in obese mice induced by a high-fat diet (Sang Joon et al., 27 (1): 11-) 22, 2006), and the effects of wind-breaking acid such as Shin on obesity and mast cells in white paper (Shin Byung-cheol et al., Journal of Oriental Rehabilitation Medicine, 7 (1); 101-118, 1997). However, no prior literature has yet been reported showing that it can be used for the alleviation or treatment of percutaneous acid osteoporosis.

Thus, the present inventors prepared a fermentation product after the production of wind-break through acid, and fermented again using the lactic acid bacteria, and the fact that the wind-break through acid and its lactic acid bacteria fermentation shows excellent osteoporosis prevention or treatment effect has not been reported before. The present invention has been completed by revealing.

It is an object of the present invention to provide a composition for preventing or treating osteoporosis containing wind-permeable acid or lactic acid bacterium fermentation thereof as an active ingredient.

In order to achieve the above object, the present invention provides a lactic acid bacteria fermented product of perforated acid.

In addition, the present invention provides a pharmaceutical composition for preventing or treating osteoporosis, which contains a wind-breaking acid or lactic acid bacteria fermented product thereof as an active ingredient.

In another aspect, the present invention provides a health food for preventing or treating osteoporosis containing a wind-breaking acid or lactic acid bacteria fermentation thereof as an active ingredient.

The present invention provides a lactic acid bacterium fermentation product of windbreakable acid.

The windproof Tongseong acid is a herbal preparation prepared by extracting windproof, Angelica, Peony, Cheongung, Gardenia, Yeongyo, Peppermint, Ginger, Hungae, Ephedra, Rhubarb, Manganese, Giltyeong, Baekchul, Licorice, Golden, Gypsum and Talc, 5 to 15 parts by weight, 5 to 15 parts by weight, 5 to 15 parts by weight, 5 to 15 parts by weight, Gardenia 4 to 12 parts, 5 to 15 parts by weight, 5 to 15 parts by weight, 5 to 15 parts by weight of mint, 13 to 30 parts by weight of ginger. Part, mold opening 4 to 12 parts by weight, ephedra 5 to 15 parts by weight, rhubarb 5 to 15 parts by weight, 5 to 15 parts by weight of forget-me-not, 8 to 23 parts by weight, 4 to 12 parts by weight, licorice 13 to 30 parts by weight , 8 to 23 parts by weight of gold, 8 to 23 parts by weight of gypsum and 20 to 40 parts by weight of talc is preferably prepared after extraction of the herbal mixture. Although water is generally used as the extraction solvent, other organic solvents may be used in addition to water as necessary. Organic solvents that can be used include, but are not limited to, C ₁ to C ₄ lower alcohols, acetone, or aqueous solutions thereof. In the present invention, the "windproof acid" is used to mean not only the extraction of the medicinal mixture using water, but also all of the extraction using an organic solvent other than water. Among the medicines used as the raw material of windproof Tongseong, peppermint, golden, talc, and gilkyung have anti-inflammatory effects, and ducts, golden, and baekchul have anti-allergic effects, and ducts, windproof, hyunggae, talc and rhubarb have antibacterial effects. Relieves inflammation of the machine and skin, and improves inflammatory diseases and hypertension by reducing the viscosity of the blood, golden, gardenia, rhubarb and hyunghyeong, sanchija, cheongung, and nerve stabilizing function, Angelica, cheongung, peony Enhances blood circulation and promotes blood circulation. Forget-me-not and rhubarb quickly discharge the intestinal contents to improve the high viscosity of blood due to stagnation of intestinal contents, ephedra, peony, and ginger excrete stagnant impurities in interstitial cells with sweat. Do it.

According to a preferred embodiment of the present invention, in order to prepare lactic acid bacteria fermentation product (hereinafter also referred to as "windproof compound fermentation") of wind-breaking acid, first, after adding 2-15 times the amount of water to the herbal mixture as described above To prepare a water extract extracted from hot water at 70 to 100 ℃. After cooling the extract, the lactic acid bacteria were inoculated at 0.5 to 5% by weight, preferably 1% by weight of the sample weight, and fermented at 30 to 40 ° C, preferably at 37 ° C for 24 to 52 hours, preferably 48 hours. A windproof acid fermentation product of the present invention is prepared. When preparing the wind-breaking acid fermented product with the wind-breaking acid extract prepared by using an organic solvent other than water as an extracting solvent, first, the extract is dried, diluted in water, and then inoculated with lactic acid bacteria to ferment. desirable.

In the above, as the lactic acid bacteria, various strains or commercially available lactic acid bacteria can be used without limitation. Specifically, microorganisms of the genus Lactobacillus, Bifidobacterium, Streptococcus, Leukonostock, Pediococcus and Lactococcus can be used without limitation, and among them, it is preferable to use microorganisms of the genus Lactobacillus. In a preferred embodiment of the present invention Lactobacillus plantarum ( Lactobacillus) plantarum ), L. curvatus , L. bulgaricus , Lactobacillus delbruequia subspecies L. delbruekii subsp. lactis ), Lactobacillus casei ( L. casei ), Lactobacillus ashdophylus ( L. acidophilus ), Bifidobacterium breve ( Bifidobacterium) brep ) and Bifidobacterium thermophilum ( B. thermophilum ) using a variety of lactic acid bacteria to prepare the wind-proof acid fermentation of the present invention (see Example 1).

In addition, the present invention provides a pharmaceutical composition for preventing or treating osteoporosis, which contains a wind-breaking acid or lactic acid bacteria fermented product of wind-breaking acid as an active ingredient.

Windproof painful acid or windproof acid fermented product according to the present invention can be administered orally or parenterally during clinical administration and can be used in the form of a general pharmaceutical preparation. That is, the windproof acid or the fermented product of the present invention may be administered in various oral and parenteral dosage forms in actual clinical administration, and when formulated, fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, which are commonly used It is prepared using diluents or excipients. Solid preparations for oral administration include tablets, pills, powders, granules, capsules and the like, which solid preparations contain at least one excipient such as starch, calcium carbonate, sucrose or lactose in windproof acid or its fermentation products. Mixed with gelatin. In addition to simple excipients, lubricants such as magnesium styrate talc are also used. Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups, and may include various excipients, such as wetting agents, sweeteners, fragrances, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin. have. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories. As the non-aqueous solvent and the suspension solvent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used. As the base of the suppository, uthepsol, macrogol, tween 61, cacao butter, laurin butter, glycerol, gelatin and the like can be used. In addition, calcium or vitamin D ₃ may be additionally added to prevent or improve the efficacy of osteoporosis.

Dosage units may, for example, contain 1, 2, 3 or 4 times the individual dose, or 1/2, 1/3 or 1/4 times. Individual dosages contain amounts in which the effective drug is administered at one time, which usually corresponds to all, 1/2, 1/3 or 1/4 times the daily dose.

The human dose of the wind-breaking acid or wind-breaking acid fermentation product of the present invention is appropriately selected according to the absorbance, inactivation rate and excretion rate of the active ingredient in the body, the age, sex, condition, degree of disease, etc. 300 mg / kg, preferably 20-100 mg / kg, and may be administered in 1 to 6 divided doses per day.

Toxicity experiments during oral and intraperitoneal administration of the compositions of the present invention were carried out. As a result, 50% lethal dose (LD ₅₀ ) by oral toxicity test was found to be a safe substance of at least 5 g / kg or more.

According to one embodiment of the present invention, treatment of percutaneous acid and percutaneous acid fermentation not only significantly reduces TRAP activity, which is a marker for osteoclast differentiation, and the formation of multinuclear osteoclasts (see FIG. 1). Expression of genes related to cell differentiation is also significantly reduced (see Table 2). In addition, according to the embodiment using a variety of lactic acid bacteria fermentation, wind-permeable acid fermentation of the present invention reduces the activity of TRAP, a marker associated with osteoclast differentiation overall, the effect is particularly noticeable at high concentrations (see Fig. 2). ).

In addition, according to another embodiment of the present invention, no abnormal symptoms or dead animals due to the administration of windproof acid fermentation are observed, and the administration of windproof acid and windproof acid fermentation does not change the weight gain due to ovarian extraction (FIG. 3 does not show weight changes of other organs (see Table 4). In addition, as a result of analyzing the serum of the animals of each group using a biochemical analyzer, there is a significant effect that the increased triglyceride concentration due to ovary extraction significantly decreased in the group administered the wind perforated acid and fermented wind perforated acid (see Table 5).

In another aspect, the present invention provides a health food for preventing or alleviating osteoporosis, containing lactic acid bacteria fermented product of wind-breaking acid or wind-breaking acid.

The wind-proof or acid-proof fermented product of the present invention can be added to health foods for the purpose of improving osteoporosis, and when the wind-proof or acid-proof fermented product of the present invention is used as a food additive, wind-proof or acid-proof fermented product is used as it is. It may be added or used with other food or food ingredients, and may be appropriately used according to conventional methods. The amount of the active ingredient to be mixed can be suitably determined according to the intended use (prevention, health or therapeutic treatment). Generally, in preparing foods or beverages, windproof acid or windproof acid fermentation is added in an amount of 30% by weight or less, preferably 10% by weight or less relative to the raw material. However, in the case of long-term consumption intended for health and hygiene purposes or for health control purposes, the amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount exceeding the above range .

There is no particular limitation on the kind of the food. Examples of the food to which the above substances can be added include dairy products including meat, sausage, bread, chocolate, candy, snack, confectionery, pizza, ramen, other noodles, gums, ice cream, various soups, drinks, tea, Alcoholic beverages, and vitamin complexes, all of which include healthy foods in a conventional sense.

In addition, the windproof Tongtong acid or the Windproof Tung acid fermentation product of the present invention is a variety of herbal medicine prescription, for example, gagamsokmyeongtang (加減 續 命 湯), brown root (갈 根), galgun gulpipitang (葛根 橘皮 湯), galgeum vegetation (갈 根 麥 門冬 散), Gal Geunjukyeotang (갈 根 竹茹 湯), Gal Geun-tang (葛根 湯), Gal Geunhaegi-tang (葛根 解肌 湯), Galchultang (황), Gal Hwang Hwan (葛 黃 丸), Perceptual assets, Danggui Baekchul-tang, Macmun-dong-eumja, Baluntang, Bangpung-tang, Baekchulsan, and objects Haegi-tang, Sawi-tang, Sanjong Gwagtang-tang, Samduhaejeong-tang, Samyang-tang, Fresh Brown Root Juice, Excursion Soongi-tang, Horse Riding Geun-tang, Horse Riding Budang-tang, Horse Riding Uefeng-tang, and Yangyang Bo-wi-tang , Shiho Seungmatang (시 胡 升麻 湯), Shiho Jogyeongtang (柴胡 불), Sindaltang (腎 疸 湯), Sinseon Bulgukdan (神仙 不 醉 丹), Sinseongsan (聖 散, Shin Hyo Myeong Moktang, Deokssintang, Yeokgyeongtonggitang, Yeongyo Seungmatang, Yeongseonjetong (옥), ox-sugar (온 雪 湯), On-beoptang (,), Ikgi Chongmyeong-tang (탕 明 湯), Ikjihwajung-tang (, 智 和 中 湯), Ginseng Cheonggisan (人蔘 淸 肌 散), Injin Sahwangtang, Ilboil Independence, Jaumcheongwiwihwan, Jeon Life Blood Tang, Jeongsansan, Jojungtang (갈 中 탕), Jigaltang, Jiyusan, Jingyo Riding Horse Tang, Cheongyangtang, Cheongyeolhaegitang ), Chunghwa Soongi-tang (취 和 보), Taste Preservation (醉 鄕 寶 屑), Governing White House German Room, Pyeongwijiyutang, Pyeongmoum-eum (平) ,), Haebaekmul germanium, haesoju germanium, toxic poisoning, haejuhwadoksan, haechaesoengbang (解 菜蔬) 파 一方) ), And red snow can be used in Zhongshan (紅雪 通 中 散).

The health beverage composition of the present invention may contain various flavors or natural carbohydrates as an additional ingredient such as ordinary beverages. Natural carbohydrates described above include glucose, monosaccharides such as fructose, disaccharides such as maltose and sucrose, and polysaccharides such as dextrin and cyclodextrin, sugar alcohols such as xylitol, sorbitol, and erythritol. Examples of sweeteners include natural sweeteners such as tau martin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like. The ratio of the natural carbohydrate is generally about 0.01 to 0.04 g, preferably about 0.02 to 0.03 g per 100 ml of the wind-breaking acid or wind-breaking acid fermentation product of the present invention.

In addition to the above, the windproof acid or the windproof acid fermented product is various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH regulators, stabilizers, preservatives, glycerin, Alcohols, carbonating agents used in carbonated drinks, and the like. In addition, the wind-breaking acid or wind-breaking acid fermentation may contain flesh for preparing natural fruit juice, fruit juice drink and vegetable drink. These components may be used independently or in combination. The proportion of such additives is not critical, but is usually selected in the range of 0.01 to 0.1 parts by weight per 100 parts by weight of percutaneous acid or percutaneous acid.

As described above, the wind-breaking acid or the wind-breaking acid fermented product has an excellent inhibitory effect on osteoclast differentiation and related gene expression, and thus may be usefully used for the prevention and / or treatment of osteoporosis.

1 is fermented by wind-permeable acid and Lactobacillus plantarum on the formation of TRAP activity (A) and TRAP-positive multinucleated osteoclasts induced by RANKL (Receptor Activator for Nuclear Factor κB Ligand) in RAW264.7 cells, respectively. Graph and photograph showing the effect (B) of the wind-breaking acid fermentation.
Figure 2 is a graph showing the effect of wind-perforated fermented by various lactic acid bacteria on TRNK activity induced by RANKL in RAW264.7 cells. B: hot water extract sample of windproof acid, B-con: sterilized sample before fermentation of windproof acid, B166: Lactobacillus curbatus (NRRL (Norther Regional Research Laboratory, ARS Culture Collection, US Department of Agriculture, Peoria, Ill, USA) ) B-4562) Fermented product, B344: Lactobacillus vulgaris (KFRI # 344) fermented product, B402: Lactobacillus plantarum (ATCC 8014) fermented product, B442: Lactobacillus delbrueki subspecies lactis (ATCC 7830) Fermentation product, B744: Bifidobacterium breve (ATCC 15700) fermentation product, B748: Bifidobacterium thermofilum (ATCC 25525) fermentation product, B-127: Lactobacillus casei (KCTC 2180) fermentation product, B128: Lactobacillus ashdophyllus (KCTC 2182) fermentation, B-129: Lactobacillus casei (ATCC 393) fermentation.
3 is a graph showing the change in body weight of ovarian harvested rats during administration of windproof acid and windproof acid fermentation. C; Control, NC; Negative control, BBT; Windproof acid-administered group, BFT; Windproof tonic acid administration group fermented by Lactobacillus plantarum.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are only for illustrating the present invention, and the scope of the present invention is not limited by the following examples.

Example 1 Preparation of Lactic Acid Bacteria Fermentation

The windproof Tongseong acid is a herbal preparation prepared by extracting the windproof, Angelica, Peony, Cheongung, Gardenia, Yeongyo, Peppermint, Ginger, Hungae, Ephedra, Rhubarb, Forget-me-not, Gilgyeong, Baekchul, Licorice, Gold, Gypsum and Talc. 50 laps were prepared and used for the experiment. It is windproof 1.69 g, donkey 1.69 g, peony 1.69 g, horoscope 1.69 g, gardenia 1.31 g, kyokyo 1.69 g, mint leaf 1.69 g, ginger 4.50 g, mold opening 1.31 g, ephedra 1.69 g, rhubarb The herbal mixture is prepared and extracted at the ratio of 1.69 g, Gil length 2.62 g, white liquor 1.31 g, licorice 4.5 g, gold 2.62 g, gypsum 2.62 g and talc 6.37 g. The total amount of 50 medicinal herbs is 2,118.5 g, which is extracted by boiling water for 10 minutes in 21.18 ℓ of distilled water (10 times, cosmos-600 in Korea, Gyeongseo extractor), and then using a standard testing sieve (Aperture 500 μm and 150 μm). Pungtangseong acid was prepared by filtration of the medicament. In addition, lactic acid bacteria (1-5 × 10 ⁸ CFU / mL) of 1% (v / v) of the total amount was added to the filtered bath, fermented at 37 ° C. for 48 hours, and filtered through the standard test sieve to obtain the Lactic acid bacteria fermented product was prepared. Fermentation strains were incubated at 37 ° C. for 24 hours in Difco ™ lactobacillus MRS broth (Becton Dickinson and Company, HuntValley, MD, USA) medium before inoculation. Fermented herbal medicines were stored at 4 ℃ until freeze-dried before use. The lactic acid bacteria used to prepare the lactic acid bacteria fermentation products were as follows: Lactobacillus plantarum (ATCC 8014), Lactobacillus curbatus (NRRL B-4562), Lactobacillus vulgaris (KFRI # 344), Lactobacillus delbruecki Subspecies Lactis (ATCC 7830), Lactobacillus Casei (KCTC 2180, ATCC 393), Lactobacillus Ashdophyllus (KCTC 2182), Bifidobacterium breve (ATCC 15700), Bifidobacterium thermofilum (ATCC 25525).

Example 2 Effects on Osteoclast Differentiation of Wind-breaking Acid and Wind-breaking Acid Fermentation

RAW264.7 cells differentiate with osteoclasts, showing an increase in TRAP activity, a marker of osteoclast differentiation upon RANKL treatment (Minkin C. Calcif Tissue Int. 1982 34 (3): 285-90; Hsu H, et al., 1999, Proc. Nat. Acad. Sci. USA, 96, 35403545). To determine the effect of wind-breaking acid (BBT) and wind-breaking acid lactic acid fermentation (BFT) prepared in Example 1 on osteoclast differentiation, RAW264.7 cells were 96-well at a density of 1 × 10 ³ cells / well. Plates were aliquoted and treated with windproof acid and windproof fermentation at a concentration of 25-200 μg / ml for 3 days. At this time, a-MEM medium (10% FBS) containing RANKL (100 ng / ml), which is a differentiation inducing factor, was used as the culture medium.

TRAP activity was measured on day 4 of treatment of the test substance, and after performing TRAP staining to confirm TRAP-positive multinucleated osteoclast formation, multinucleated osteoclasts were identified under a microscope. To this end, the osteoclasts were fixed in 10% formalin for 10 minutes and with ethanol / acetone (1: 1, v / v) mixed solvent for 1 minute, followed by staining kit (Leukocyte Acid Phosphatase Kit 387-A, Sigma, MO). And stained. Differentiated multinucleated osteoclasts were observed under a microscope equipped with a DP controller (Olympus Optical Co. Ltd., Tokyo, Japan). For the measurement of TRAP activity, after adding the citrate buffer (50 mM, pH 4.6) containing 10 mM sodium tartrate, 5 mM p-nitrophenyl phosphate (Sigma, MO) to the plate containing the osteoclasts fixed above Incubated at 37 ° C. for 1 hour. After mixing this enzyme reaction solution with the same amount of 0.1 N NaOH, the absorbance was measured at 410 nm. TRAP activity was expressed in% compared to the control.

As a result, windproof acid reduced TRAP activity at low concentrations and windproof acid fermentation fermented by Lactobacillus plantarum significantly reduced TRAP activity at a concentration of 100 μg / ml (FIG. 1A, p <0.05). In addition, it was confirmed by TRAP staining that the formation of multinucleated osteoclasts decreased during treatment of wind-breaking acid and fermentation of wind-breaking acid (FIG. 1B). In addition, as a result of experiments using a variety of lactic acid bacteria fermentation, the wind-permeable acid fermentation of the present invention reduced the overall TRAP activity, especially the effect was significant at a concentration of 100 ㎍ / ㎖ (Fig. 2, p <0.01).

Example 3 Expression of Osteoclast Differentiation Related Genes

TRAP, c-Src and cathepsin K genes are essential for osteoclast differentiation and bone resorption and are known to increase expression during osteoclast differentiation (Hsu H, et al., 1999, Proc. Nat. Acad. Sci USA, 96, 35403545). Therefore, real time quantitative PCR (real time quantitative PCR) was performed to confirm the effect of wind-proof acid that inhibits TRAP staining and activity on the expression of these three genes. For this purpose, total RNA was isolated 24 hours after RANKL treatment using TRIzol (Invitrogen Inc., NY, USA). Primers specific for osteoclast differentiation related genes were designed using an online primer design program (Rozen and Skaletsky, 2000), and the primers for each gene were the forward and reverse primer pairs shown in Table 1 below. Was used. cDNA was synthesized using 2 μg total RNA, 1 μM oligo-dT ₁₈ primer and 10 units of RNase inhibitor RNasin (Promega, WI, USA) and Omniscript Reverse Transcriptase (Qiagen, CA). SYBR green-based quantitative PCR amplification was performed using a Stratagene Mx3000P Real-Time PCR system after mixing 50-fold diluted cDNA and 20 mmol of primers with Brilliant SYBR Green Master Mix (Stratagene, Calif.). The PCR program is as follows. After holding for 10 minutes at 95 ° C. for polymerase activity, 40 times at 94 ° C. (denature), 40 seconds at 60 ° C. (annealing) and 1 minute at 72 ° C. (extension) were performed 40 times. Subsequently, temperature dissociation curves (also referred to as 'melting curves') of the PCR products generated by holding at 95 ° C for 1 minute, 55 ° C for 30 seconds, and 95 ° C for 30 seconds were prepared. All experiments were repeated three times, and PCR data were analyzed according to the 2 ^{-ΔΔ CT} method (Livak and Schmittgen, 2001). At this time, GAPDH was used as a control of PCR, and after analyzing GAPDH-normalized 2 ^{-Δ △ CT} data by Student's t-test, p <0.05 was determined as a significant difference.

As a result, the expression of all three genes increased rapidly during RANKL treatment, but the expression of c-Src and cathepsin K genes was significantly decreased in the wind-perforated acid treatment group (100 ㎍ / ml) (Table 2). .

gene Forward primer (5 '-> 3') order
number Back primer (5 '-> 3') order
number TRAP ACACAGTGATGCTGTGTGGCAACTC One CCAGAGGCTTCCACATATATGATGG 2 c-Src CCAGGCTGAGGAGTGGTACT 3 CAGCTTGCGGATCTTGTAGT 4 Cathepsin k GGCCAACTCAAGAAGAAAAC 5 GTGCTTGCTTCCCTTCTGG 6 GAPDH AACTTTGGCATTGTGGAAGG 7 ACACATTGGGGGTAGGAACA 8

Effect of Wind-proof Acid on mRNA Expression of RANKL-induced Osteoclast-specific Genes in RAW264.7 Cells TRAP c-Src Cathepsin k RANKL untreated 1.09 ± 0.61 1.01 ± 0.08 1.10 ± 0.66 RANKL treatment 1.97 ± 0.01 3.14 ± 0.15 ^* 19150.28 ± 281.57 ^* RANKL + BBT (100 μg / ml) 1.60 ± 0.09 1.12 ± 0.23 ^# 9443.32 ± 138.85 ^{* #}

^* p <0.05, significantly different from RANKL untreated group.

^# p <0.05, significantly different from RANKL treatment group.

Example  4. Ovarian Extraction Rat  On organs and blood biochemical indicators Windbreak Tongseong Mountain  And Windbreak Tongseong Mountain Fermented products  Impact

In order to verify the osteoporosis inhibitory effect of the wind-breaking acid and the wind-breaking acid fermentation inhibiting the formation of osteoclasts, wind-breaking acid fermented by wind-breaking acid and Lactobacillus plantarum was orally administered to the ovarian isolated rat model for 12 weeks. Specifically, experiments were performed using 9-week-old female rats (Orient, Seoul, Korea). After visual inspection of the animals, they were purified in an animal room for 7 days and ovarian extraction was performed. Seven days after ovarian extraction, the groups were separated and 36 of the healthy animals were selected and used in the experiment. Each experimental group was classified as shown in Table 3 below. Healthy animals were weighed during the acclimatization period, and then divided into 5 g intervals to select animals close to their average weights. The animals thus selected were randomly distributed to have an even weight based on the weighted ranking of the nine animals. Animal identification was performed by pigmentation of the coat and labeling of the individual identification cards. Each test substance was administered based on the daily clinical dose (15 ㎖ / ㎏, 2 times / day), using the dorsal skin fixation method to fix the experimental animals and using oral administration disposable Fujide (Fujigami, Japan) and injection tube Forced oral administration in the stomach. The dosage of wind-breakable acid fermentation was lower than that of wind-breakable acid due to the yield change due to fermentation. The control group (C group) and the negative control group (NC group) was administered the same dose of distilled water.

As a result, no abnormal symptoms or dead animals were observed due to the administration of the wind-breaking acid and the wind-breaking acid fermentation during the administration period. Was significantly increased compared to group C (p <0.01). However, no body weight change was observed in the BBT and BFT-administered groups compared to the NC group (FIG. 3).

No gross abnormalities were observed in the uterus, brain, thyroid, heart, lung, liver, spleen, kidney and adrenal gland extracted from each animal after administration of wind-breaking acid and fermentation of wind-breaking acid for 12 weeks. In addition, compared with group C, the uterine weight of the NC group showed a significant decrease of about 84% ( p <0.01), but there was no difference in uterine weight by the administration of wind-proof and acid-proof fermented products. In addition, there was no difference in the weight of different organs between groups (Table 4).

Serum of each group of animals was analyzed using a biochemistry analyzer, and the triglyceride concentration was significantly increased in the NC group compared to the C group ( p <0.05). Compared with the NC group, the triglyceride concentrations increased significantly due to ovarian extraction in the BBT- and BFT-administered groups ( p <0.05) (Table 5).

Classification name Experimental group Number of animals process
(Ml / kg) Dose
(Mg / kg / day) C Control group 9 15 - NC Ovarian Extracted Rat 9 15 - BBT Ovary extraction rack administered windproof tonic acid 9 15 431 BFT Ovariectomized rats treated with wind-breaking acid fermented by Lactobacillus plantarum 9 15 367

C; Control, NC; Negative control, BBT; Windproof acid treatment group, BFT; Wind-breaking acid-administered group fermented by Lactobacillus plantarum

Weight of organs after 12 weeks of windproof acid and fermented windproof acid (n = 9, unit: g) C NC BBT BFT Womb 0.69 ± 0.21 0.11 ^a ± 0.02 0.12 ^a ± 0.01 0.11 ^a ± 0.01 brain 1.98 ± 0.10 2.00 ± 0.10 1.99 ± 0.07 1.96 ± 0.06 pituitary 0.0164 ± 0.0031 0.0134 ± 0.0016 0.0150 ± 0.0024 0.0134 ± 0.0018 lungs 1.50 ± 0.15 1.14 ± 0.14 1.51 ± 0.15 1.47 ± 0.14 Heart 1.14 ± 0.11 1.10 ± 0.10 1.18 ± 0.07 1.11 ± 0.07 liver 8.71 ± 0.72 8.17 ± 1.11 8.80 ± 0.77 8.76 ± 0.95 spleen 0.66 ± 0.14 0.63 ± 0.07 0.68 ± 0.10 0.65 ± 0.11 Height (left) 1.07 ± 0.11 0.96 ± 0.10 1.03 ± 0.08 1.01 ± 0.10 Height (right) 1.07 ± 0.12 0.95 ± 0.11 1.05 ± 0.11 1.01 ± 0.09 Adrenal gland (left) 0.04 0.01 0.03 ± 0.01 0.02 ± 0.01 0.03 ± 0.01 Adrenal gland (right) 0.03 ± 0.01 0.02 ± 0.01 0.03 ± 0.01 0.02 ± 0.01

Values are expressed as mean ± S.D.

^a p <0.01, significantly different from C.

Biochemical Indices of Ovariectomized Rat Serum 12 Weeks After Windbreaking Acid and Fermentation of Windbreaking Acid (n = 9) C NC BBT BFT AST (U / L) 43.09 ± 13.79 42.86 ± 9.39 36.28 ± 6.75 41.91 ± 15.40 ALT (U / L) 120.88 ± 31.08 120.94 ± 29.77 114.87 ± 21.07 114.71 ± 16.94 ALP (U / L) 171.11 ± 73.20 176.68 ± 56.37 211.18 ± 52.73 199.87 ± 77.70 Total cholesterol
(Mg / dl) 107.78 ± 27.81 118.56 ± 10.42 116.89 ± 22.27 127.67 ± 20.43 HDL-cholesterol
(Mg / dl) 34.81 ± 6.61 37.20 ± 1.99 36.06 ± 3.85 38.70 ± 4.92 LDL-cholesterol
(Mg / dl) 6.98 ± 2.09 7.79 ± 0.98 7.89 ± 1.69 7.50 ± 1.73 Triglyceride
(Mg / dl) 58.00 ± 21.33 81.80 ^a ± 19.74 51.29 ^b ± 16.92 49.29 ^b ± 16.83 Phosphate (mg / dl) 8.79 ± 0.87 8.66 ± 1.04 8.86 ± 0.85 8.08 ± 0.73 Calcium (mg / ㎗) 11.98 ± 0.81 11.59 ± 0.43 11.50 ± 0.30 11.47 ± 0.39

Values are expressed as mean ± S.D.

^a p <0.05, significantly different from C.

^b p <0.05, significantly different from NC.

Manufacturing example  One: Windbreak Tongseong Mountain  or Windbreak Tongseong Mountain The fermented product  Preparation of a pharmaceutical composition comprising

<1-1> Preparation of Syrup

Syrup containing wind-breakable acid or wind-breakable acid fermented product as an active ingredient 2% (weight / volume) was prepared by the following method. First, the wind-breaking acid or wind-breaking acid fermented product powder, saccharin and sugar prepared in Example 1 were dissolved in 80 g of warm water. After the solution was cooled, a solution consisting of glycerin, saccharin, spices, ethanol, sorbic acid and distilled water was prepared and mixed thereto. Water was added to the mixture to make 100 ml.

The components of the syrup are as follows.

Windproof Tongshan or Windproof Tung Acid Fermentation ?????????????? 2 g

Saccharin ?????????????????????????? 0.8 g

Party???????????????????????????? 25.4 g

Glycerin ????????????????????????? 8.0 g

Spices ?????????????????????????? 0.04 g

ethanol ?????????????????????????? 4.0 g

Sorbic acid ????????????????????????? 0.4 g

Distilled water??????????????????????????? dose

<1-2> Preparation of tablets

A tablet containing 15 mg of active ingredient was prepared by the following method.

250 g windproof acid or 250 g windproof acid fermentation were mixed with 175.9 g lactose, 180 g potato starch and 32 g colloidal silicic acid. 10% gelatin solution was added to the mixture, which was then ground and passed through a 14 mesh sieve. It was dried and the mixture obtained by adding 160 g of potato starch, 50 g of talc and 5 g of magnesium stearate was made into a tablet.

Perforated Acid or Perforated Acid Windproof ?????????????? 250 g

Lactose ???????????????????????? 175.9 g

Potato starch ????????????????????????? 180 g

Colloidal silicate ?????????????????????? 32 g

10% gelatin solution

Potato starch ????????????????????????? 160 g

talc???????????????????????????? 50 g

Magnesium Stearate ????????????????????? 5 g

Manufacturing example  2: Windbreak Tongseong Mountain  or Windbreak Tongseong Mountain The fermented product  Production of health food containing

<2-1> Manufacturing of food

Foods containing wind-breakable acid or wind-breakable acid fermentation were prepared as follows.

1. Preparation of cooking seasoning

Wind-breaking acid or 20-95 wt% of wind-breaking acid fermented product prepared for health promotion cooking seasoning.

2. Manufacture of tomato ketchup and sauce

Health-promoting tomato ketchup or sauce was prepared by adding 0.2-1.0 wt% of wind-breakable acid or fermented product of wind-breakable acid to tomato ketchup or sauce.

3. Manufacture of flour food

Wind-breaking acid or 0.5-5.0 wt% of wind-breaking acid fermented product was added to the flour, and bread, cake, cookies, crackers and noodles were prepared using the mixture to prepare foods for health promotion.

4. Manufacture of soups and gravies

Wind-breaking acid or 0.1-5.0 wt% of wind-breaking acid fermented product was added to soups and broths to prepare meat products for health promotion, soups of noodles and soups.

5. Manufacture of ground beef

Health-proof ground beef was prepared by adding 10% by weight of wind-breakable acid or fermented wind-breakable acid to the ground beef.

6. Manufacture of dairy products

Windproof tonic acid or 5 to 10% by weight of the windproof tonic acid fermented product was added to milk, and the milk was used to prepare various dairy products such as butter and ice cream.

7. Manufacturing of wires

Brown rice, barley, glutinous rice, and yulmu were alphad by a known method, and then dried and roasted to prepare a powder having a particle size of 60 mesh using a grinder. Black beans, black sesame seeds, and perilla were also steamed and dried by a known method, and then ground to a powder having a particle size of 60 mesh. The wind-breaking acid or wind-breaking acid fermented product was concentrated under reduced pressure in a vacuum concentrator, and the dried product obtained by spraying and drying with a hot air dryer was pulverized with a particle size of 60 mesh to obtain a dry powder. The grains, seeds and the dry powder of wind-breakable acid or wind-breakable acid fermentation prepared above were blended in the following ratio.

Cereals (30% by weight of brown rice, 15% by weight of yulmu, 20% by weight of barley)

Seeds (7% by weight perilla, 8% by weight black bean, 7% by weight black sesame)

Dry powder (3% by weight) of wind-breaking acid or fermentation of wind-breaking acid,

(0.5% by weight),

(0.5% by weight)

<2-2> Production of beverage

1. Manufacture of carbonated beverages

5 to 10% of sugar, 0.05 to 0.3% of citric acid, 0.005 to 0.02% of caramel, 0.1 to 1% of vitamin C are mixed, and 79 to 94% of purified water is mixed to make a syrup, and the syrup is 85 to 98 Sterilizing at 20 ℃ for 180 seconds, mixed with cooling water at a ratio of 1: 4, and then injected with 0.5 ~ 0.82% of carbon dioxide gas to prepare a carbonated beverage containing perforated acid or percutaneous acid.

2. Manufacture of health drinks

Instant sterilization by homogeneous mixing of ingredients such as liquid fructose (0.5%), oligosaccharide (2%), sugar (2%), salt (0.5%), water (75%) and windproof or acid-proof fermented products After that, it was packaged in small packaging containers such as glass bottles and PET bottles to prepare healthy drinks.

3. Manufacture of vegetable juice

5 g of wind-breaking acid or fermented wind-breaking acid was added to 1,000 ml of tomato or carrot juice to prepare vegetable juice for health promotion.

4. Manufacture of fruit juice

1 g of perforated acid or fermented perforated acid was added to 1,000 ml of apple or wine to prepare fruit juice for health promotion.

Attach an electronic file to a sequence list

Claims (15)

Prepared by adding water or organic solvent to the herbal mixtures including windproof, peony, cheonggung, gardenia, duct bridge, peppermint, ginger, hedgehog, ephedra, rhubarb, forget-me-not, Gilgyeong, baekrye, licorice, gold, gypsum and talc. A pharmaceutical composition for preventing or treating osteoporosis containing lactic acid bacteria fermented product of wind-proof tonic acid prepared by inoculating fermented lactic acid bacteria in the wind-breakable acid or the wind-breaking acid as an active ingredient. The method according to claim 1,
The wind-breaking acid is 5 to 15 parts by weight, 5 to 15 parts by weight, 5 to 15 parts by weight, 5 to 15 parts by weight, Gardenia 4 to 12 parts by weight, 5 to 15 parts by weight, 5 to 15 parts by weight of peppermint per 10 parts by weight of wind. , 13 to 30 parts by weight, 4 to 12 parts by weight of mold, 5 to 15 parts by weight of ephedra, 5 to 15 parts by weight of rhubarb, 5 to 15 parts by weight of forage, 8 to 23 parts by weight, 4 to 12 parts by weight of white rice, A pharmaceutical composition for osteoporosis prevention or treatment prepared by hot water extraction after adding water to a herbal mixture comprising 13 to 30 parts by weight of licorice, 8 to 23 parts by weight of gold, 8 to 23 parts by weight of gypsum and 20 to 40 parts by weight of talc. The method according to claim 1,
The organic solvent is a C ₁ to C ₄ alcohol, acetone and a pharmaceutical composition for preventing or treating osteoporosis, characterized in that selected from the group consisting of an aqueous solution thereof. The method according to claim 1,
The lactic acid bacteria Lactobacillus, Bifidobacterium, Streptococcus, Leukonostock, Pediococcus and Lactococcus is a pharmaceutical composition for preventing or treating osteoporosis, characterized in that selected from the group consisting of. The method of claim 4,
The lactobacillus is Lactobacillus plantarum, Lactobacillus curvatus, Lactobacillus vulgaris, Lactobacillus delbrueki subspecies lactis, Lactobacillus cassace, Lactobacillus ashdophyllus, Bifidobacterium breve and Bifidobactera A pharmaceutical composition for preventing or treating osteoporosis, characterized in that the microorganism selected from the group consisting of Leeum thermofilum. The method according to any one of claims 1, 4 and 5,
The lactic acid bacteria is a pharmaceutical composition for preventing or treating osteoporosis, characterized in that inoculated in the amount of 0.5 to 5% by weight of the sample weight. The method according to any one of claims 1, 4 and 5,
The lactic acid bacteria is a pharmaceutical composition for preventing or treating osteoporosis, characterized in that the fermentation for 24 to 52 hours at a temperature of 30 to 40 ℃. delete Prepared by adding water or organic solvent to the herbal mixtures including windproof, peony, cheonggung, gardenia, duct bridge, peppermint, ginger, hedgehog, ephedra, rhubarb, forget-me-not, Gilgyeong, baekrye, licorice, gold, gypsum and talc. Health food for the prevention or improvement of osteoporosis containing lactic acid bacteria fermented product of Bangpungtong acid prepared by inoculating fermentation by lactic acid bacteria in the windproof tongseong or acid. The method according to claim 9,
The wind-breaking acid is 5 to 15 parts by weight, 5 to 15 parts by weight, 5 to 15 parts by weight, 5 to 15 parts by weight, Gardenia 4 to 12 parts by weight, 5 to 15 parts by weight, 5 to 15 parts by weight of peppermint per 10 parts by weight of wind. , 13 to 30 parts by weight, 4 to 12 parts by weight of mold, 5 to 15 parts by weight of ephedra, 5 to 15 parts by weight of rhubarb, 5 to 15 parts by weight of forage, 8 to 23 parts by weight, 4 to 12 parts by weight of white rice, A health food for preventing or improving osteoporosis prepared by adding hot water to a herbal mixture including 13 to 30 parts by weight of licorice, 8 to 23 parts by weight of gold, 8 to 23 parts by weight of gypsum, and 20 to 40 parts by weight of talc. The method according to claim 9,
The organic solvent is C ₁ to C ₄ alcohol, acetone and health foods for preventing or improving osteoporosis, characterized in that selected from the group consisting of an aqueous solution thereof. The method according to claim 9,
The lactic acid bacteria Lactobacillus, Bifidobacterium, Streptococcus, leukonostock, pediococcus and lactococcus health food for preventing or improving osteoporosis, characterized in that selected from the group consisting of. The method of claim 12,
The lactobacillus is Lactobacillus plantarum, Lactobacillus curvatus, Lactobacillus vulgaris, Lactobacillus delbrueki subspecies lactis, Lactobacillus cassace, Lactobacillus ashdophyllus, Bifidobacterium breve and Bifidobactera Health food for preventing or improving osteoporosis, characterized in that the microorganism selected from the group consisting of Leeum thermofilum. The method according to any one of claims 9, 12 and 13,
The lactic acid bacteria is osteoporosis prevention or improvement health foods, characterized in that inoculated in an amount of 0.5 to 5% by weight of the sample weight. The method according to any one of claims 9, 12 and 13,
The lactic acid bacteria is osteoporosis prevention or improvement health food, characterized in that fermentation for 24 to 52 hours at a temperature of 30 to 40 ℃.

Images