KR20220086526A - Development of CAPS marker for discrimination of Lentinula edodes for log cultivation cultivar and use thereof - Google Patents

Development of CAPS marker for discrimination of Lentinula edodes for log cultivation cultivar and use thereof Download PDF

Info

Publication number
KR20220086526A
KR20220086526A KR1020220061925A KR20220061925A KR20220086526A KR 20220086526 A KR20220086526 A KR 20220086526A KR 1020220061925 A KR1020220061925 A KR 1020220061925A KR 20220061925 A KR20220061925 A KR 20220061925A KR 20220086526 A KR20220086526 A KR 20220086526A
Authority
KR
South Korea
Prior art keywords
seq
nos
nucleotide sequences
represented
restriction enzyme
Prior art date
Application number
KR1020220061925A
Other languages
Korean (ko)
Other versions
KR102487647B1 (en
Inventor
한재구
안기홍
조재한
김옥태
Original Assignee
대한민국(농촌진흥청장)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국(농촌진흥청장) filed Critical 대한민국(농촌진흥청장)
Priority to KR1020220061925A priority Critical patent/KR102487647B1/en
Publication of KR20220086526A publication Critical patent/KR20220086526A/en
Application granted granted Critical
Publication of KR102487647B1 publication Critical patent/KR102487647B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2523/00—Reactions characterised by treatment of reaction samples
    • C12Q2523/10—Characterised by chemical treatment
    • C12Q2523/107—Chemical cleaving agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 표고버섯 품종 판별용 CAPS 마커 및 이의 용도에 관한 것으로, 본 발명의 프라이머 세트를 이용하면 표고버섯 품종을 빠르고 간편하게 확인할 수 있으며, 본 발명의 프라이머를 이용하여 PCR로 분리된 CAPS 마커를 이용해 표고 균주를 구분할 수 있다. 우리나라 표고버섯 유전자원을 보호하는 한편 수입품종과의 구별할 수 있어, 해외로 건표고나 생표고로 수출될 때에도 국산품종임을 입증할 수 있는 구별 방법으로 매우 유용하게 활용될 수 있다.The present invention relates to a CAPS marker for identifying shiitake mushroom varieties and their use, and by using the primer set of the present invention, the shiitake mushroom variety can be quickly and easily identified, and the CAPS marker separated by PCR using the primer of the present invention is used. Shiitake strains can be distinguished. Since it can protect the genetic resources of shiitake in Korea and distinguish it from imported varieties, it can be very usefully used as a discrimination method that can prove that it is a domestic variety even when exported as dried or raw shiitake.

Description

원목재배용 표고버섯 품종 판별용 CAPS 마커 및 이의 용도 {Development of CAPS marker for discrimination of Lentinula edodes for log cultivation cultivar and use thereof}CAPS marker for discrimination of shiitake mushroom varieties for log cultivation and use thereof {Development of CAPS marker for discrimination of Lentinula edodes for log cultivation cultivar and use thereof}

본 발명은 원목재배용 표고버섯 (Lentinula edodes) 품종 판별용 CAPS 마커 및 이의 용도에 관한 것이다.The present invention relates to a CAPS marker for cultivar identification of shiitake mushrooms ( Lentinula edodes ) and uses thereof.

세계 버섯생산액은 1990년대 초 약 85억 달러에서 2010년 약 400억 달러로 4.7배 증가하는 등 꾸준히 확대되는 양상을 보이고, 버섯산업은 1990년대 후반 급속하게 증가하였다. 표고버섯은 세계 버섯 생산의 약 17%를 차지하고 있는 표고버섯은 한국, 중국, 일본 등 아시아국가에서 주로 재배되며, 미국, 캐나다, 네덜란드, 폴란드 등의 서구국가에서도 상업적으로 재배되고 있다. 그리고 항암효과를 보이는 렌티난 (lentinan) 등이 있어 식품뿐만 아니라 약학적인 용도로도 사용이 늘어나고 있다. The world mushroom production value has been steadily expanding, increasing 4.7 times from about 8.5 billion dollars in the early 1990s to about 40 billion dollars in 2010, and the mushroom industry increased rapidly in the late 1990s. Shiitake mushrooms, which account for about 17% of the world's mushroom production, are mainly cultivated in Asian countries such as Korea, China, and Japan, and are also commercially grown in Western countries such as the United States, Canada, the Netherlands, and Poland. In addition, there is lentinan, which has anticancer effects, and its use is increasing not only for food but also for pharmaceutical purposes.

표고버섯은 1980년대 까지 일본이 전세계적인 주요 생산국이었으나, 1990년 중국이 주요 생산국이다. 2012년 중국은 전세계 생산의 90%이상인 400만톤 이상을 생산하고 있다. 2013년 국내의 버섯 총 생산액은 전체 농산물 생산액 1.1%차지하고 품목별 생산비율은 느타리 34%, 새송이 24%, 팽이 17%, 표고 16%, 양송이4% 이다. 국내에서 생산되는 버섯 중 농산버섯의 수출액과 수출량은 꾸준히 증가하고 있으나, 임산 버섯인 표고버섯은 수입의 비중이 높아 2015년 표고버섯의 수입량은 수출량에 비하여 약 21배 많았고 수입액은 약 7배 많았다.Until the 1980s, Japan was the world's main producer of shiitake mushrooms, but in 1990, China became the main producer. In 2012, China produced more than 4 million tons, or more than 90% of the world's production. In 2013, the total domestic mushroom production accounted for 1.1% of the total agricultural production, and the production ratio by item was 34% oyster mushroom, 24% oyster mushroom, 17% top, 16% shiitake, and 4% mushroom. Among mushrooms produced in Korea, the export amount and export volume of agricultural mushrooms are steadily increasing, but the proportion of imports of shiitake mushrooms, a forest mushroom, is high.

우리나라는 1997년 종자산업법을 시행하여 국내에서 신품종 육성자를 보호하고 있고, 2002년에 UPOV에 가입하였다. UPOV의 가입으로 우리나라는 외국 품종을 이용할 때 로열티를 지불하고, 국외에 수출되는 국내 품종들도 보호받게 된다. Korea enforced the Seed Industry Act in 1997 to protect new breeders in Korea, and joined the UPOV in 2002. By joining UPOV, Korea pays royalties when using foreign varieties, and domestic varieties exported abroad are also protected.

표고버섯의 주요 생산국이자 소비국인 동북아 3국의 표고버섯 시장이 급속히 변화하고 있다. 현재의 상황에서 품종 구분마커의 개발은 국외 품종에 대한 국산 품종의 구별성을 확보하여 국내에서 개발된 품종들을 보호하는데 도움을 줄 수 있다.The market for shiitake mushrooms in the three Northeast Asian countries, which are major producers and consumers of shiitake, is changing rapidly. In the current situation, the development of a variety marker can help protect domestically developed varieties by securing the differentiation of domestic varieties from foreign varieties.

현재 우리나라의 표고버섯 품종 구별은 산림청에서 제작한 표고버섯 특성조사요령에 의하여 이루어지고 있지만, 분자마커를 이용한다면 더욱 효율적일 수 있다. 현재까지 개발되어 이용되고 있는 분자 마커의 종류로는 RFLPs (Restriction Fragment Length Polymorphisms), SSRs (Simple Sequence Repeats, microsatellite), STS (Sequence Tagged Sites), CAPS (Cleaved Amplification Polymorphic Sequence) 등이 있다. 그 중 CAPS는 유전체 내 하나의 염기서열이 치환된 변이인 SNP나 하나 이상의 염기서열이 삽입 또는 결실된 변이인 Indel의 검출이 가능한 마커로, PCR 산물에 제한효소를 처리하여 DNA 단편의 크기 차이를 확인하는 방법이다. 대부분의 CAPS 마커는 공우성 (co-dominant)이고, 쉽게 결과를 해석할 수 있다는 장점을 가지고 있다.Currently, the classification of shiitake mushroom varieties in Korea is made according to the shiitake mushroom characteristics survey guidelines produced by the Korea Forest Service, but it can be more efficient if molecular markers are used. The types of molecular markers that have been developed and used up to now include Restriction Fragment Length Polymorphisms (RFLPs), Simple Sequence Repeats (SSRs, microsatellite), Sequence Tagged Sites (STS), and Cleared Amplification Polymorphic Sequences (CAPS). Among them, CAPS is a marker that can detect SNP, a mutation in which one nucleotide sequence is substituted, or Indel, a mutation in which one or more nucleotide sequences are inserted or deleted. way to check Most CAPS markers are co-dominant and have the advantage that the results can be easily interpreted.

한편, 현재 한중 FTA의 영향으로 중국산 표고의 수입이 증가하고 있고, 표고의 생산량보다 소비량이 많은 일본에서 중국산 표고보다 한국산을 선호하고 있어, 동북아 3국의 표고버섯 시장이 급속히 변화하고 있다. 이에 따라 직접적인 버섯의 수출입 이외에 품종의 수출도 이루어질 것으로 판단된다. 그리고 2010년 10월 제 10차 생물다양성 협약 당사국 총회를 통해 나고야 의정서가 채택됨에 따라 각국은 현재 보유하고 있는 유전자원에 대한 보호를 강화할 것으로 생각된다. 현재 국내의 국립산림품종관리센터에 품종보호출원 및 등록된 표고버섯 품종은 53개이고 이중 산림조합중앙회 산림버섯연구센터에서 출원한 품종은 총 24개로 약 45%를 차지하고 있다. 따라서 국내에서 보급되고 있는 표고버섯 품종 중 산림버섯연구센터에서 개발한 품종을 CAPS 마커로 구분하는 것은 우리나라 표고버섯 유전자원을 보호하는 한편 수입품종과의 구별에 있어 매우 중요하다. 한편, 해외로 건표고나 생표고로 수출될 때에도 국산품종임을 입증할 수 있는 구별 방법으로 매우 유용하게 활용될 것이다.Meanwhile, under the influence of the Korea-China FTA, imports of Chinese shiitake are increasing, and Japan, which consumes more shiitake than production, prefers Korean shiitake to Chinese shiitake. Accordingly, in addition to the direct import and export of mushrooms, the export of varieties is expected to take place. And as the Nagoya Protocol was adopted at the 10th Convention on Biological Diversity in October 2010, it is thought that each country will strengthen the protection of its genetic resources. Currently, there are 53 shiitake mushroom varieties that have been applied for and registered with the National Forest Varieties Management Center in Korea. Among them, 24 varieties have been applied for by the Forest Mushroom Research Center of the National Forestry Cooperative Federation, accounting for about 45%. Therefore, it is very important to classify the varieties developed by the Forest Mushroom Research Center with CAPS markers among the shiitake varieties that are being distributed in Korea while protecting the genetic resources of shiitake mushrooms in Korea and distinguishing them from imported varieties. On the other hand, even when exported overseas as dried or raw shiitake, it will be very useful as a distinguishing method that can prove that it is a domestic variety.

대한민국 공개특허 제10-2019-0008461호Republic of Korea Patent Publication No. 10-2019-0008461

본 발명의 목적은 표고버섯 품종 참아람, 산조708호, 산조707호, 산조302호, 산조701호, 산조108호, 모리290, 유지로, 향고808 또는 추재2호 판별용 프라이머 세트를 제공하는 데 있다.It is an object of the present invention to provide a primer set for discriminating shiitake mushroom varieties Chamaram, Sanjo 708, Sanjo 707, Sanjo 302, Sanjo 701, Sanjo 108, Mori 290, Yujiro, Hyanggo 808 or Chujae No. 2 there is

또한, 본 발명의 다른 목적은 상기 프라이머 세트를 포함하는 표고버섯 품종 판별용 키트를 제공하는 데 있다.Another object of the present invention is to provide a kit for identifying shiitake mushroom varieties including the primer set.

또한, 본 발명의 다른 목적은 상기 프라이머 세트를 이용하여 표고버섯 품종을 판별하는 방법을 제공하는 데 있다.Another object of the present invention is to provide a method for discriminating shiitake mushroom varieties using the primer set.

상기와 같은 목적을 달성하기 위해, 본 발명은 서열번호 1 및 2의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 또는 서열번호 3 및 4의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍;을 포함하는 표고버섯 품종 참아람 판별용 프라이머 세트를 제공한다.In order to achieve the above object, the present invention provides an oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 1 and 2; Or a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 3 and 4; provides a primer set for discrimination of shiitake mushroom varieties Chamaraam.

또한, 본 발명은 서열번호 5 및 6의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 또는 서열번호 7 및 8의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍;을 포함하는 표고버섯 품종 산조708호 판별용 프라이머 세트를 제공한다.In addition, the present invention provides an oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 5 and 6; Or a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 7 and 8; provides a primer set for discriminating the shiitake mushroom variety Sanjo 708, including.

또한, 서열번호 9 및 10의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 또는 서열번호 11 및 12의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍;을 포함하는 표고버섯 품종 산조707호 판별용 프라이머 세트를 제공한다.In addition, a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 9 and 10; Or a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 11 and 12; provides a primer set for discriminating the shiitake mushroom variety Sanjo 707, including.

또한, 본 발명은 서열번호 13 및 14의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 서열번호 15 및 16의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 또는 서열번호 17 및 18의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍;을 포함하는 표고버섯 품종 산조302호 판별용 프라이머 세트를 제공한다.In addition, the present invention provides an oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 13 and 14; an oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 15 and 16; Or a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 17 and 18; provides a primer set for discrimination of shiitake mushroom variety Sanjo 302, including.

또한, 본 발명은 서열번호 19 및 20의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 또는 서열번호 21 및 22의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍;을 포함하는 표고버섯 품종 산조701호 판별용 프라이머 세트를 제공한다.In addition, the present invention provides an oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 19 and 20; Or a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 21 and 22; provides a primer set for discrimination of shiitake mushroom variety Sanjo 701, including.

또한, 본 발명은 서열번호 23 및 24; 서열번호 25 및 26; 서열번호 27 및 28; 서열번호 29 및 30; 또는 서열번호 31 및 32의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍;을 포함하는 표고버섯 품종 산조108호 판별용 프라이머 세트를 제공한다.In addition, the present invention provides SEQ ID NOs: 23 and 24; SEQ ID NOs: 25 and 26; SEQ ID NOs: 27 and 28; SEQ ID NOs: 29 and 30; Or a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 31 and 32; provides a primer set for discriminating the shiitake mushroom variety Sanjo No. 108, including.

또한, 본 발명은 서열번호 33 및 34의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍;을 포함하는 표고버섯 품종 모리290 판별용 프라이머 세트를 제공한다.In addition, the present invention provides a primer set for discriminating the shiitake mushroom variety Mori 290, comprising a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 33 and 34.

또한, 본 발명은 서열번호 35 및 36의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍;을 포함하는 표고버섯 품종 유지로 판별용 프라이머 세트를 제공한다.In addition, the present invention provides a primer set for discrimination by maintaining a shiitake mushroom variety;

또한, 본 발명은 서열번호 37 및 38의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍;을 포함하는, 표고버섯 품종 향고808 판별용 프라이머 세트를 제공한다.In addition, the present invention provides a primer set for discriminating the shiitake mushroom variety Hyanggo 808;

또한, 본 발명은 서열번호 39 및 40; 서열번호 41 및 42; 서열번호 43 및 44; 또는 서열번호 45 및 46의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍;을 포함하는, 표고버섯 품종 향고808 판별용 프라이머 세트를 제공한다.In addition, the present invention provides SEQ ID NOs: 39 and 40; SEQ ID NOs: 41 and 42; SEQ ID NOs: 43 and 44; Or a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 45 and 46; provides a primer set for discriminating the shiitake mushroom variety Hyanggo 808, including.

또한, 본 발명은 상기 프라이머 세트를 포함하는 표고버섯 품종 판별을 위한 CAPS (cleaved amplified polymorphic sequences) 마커 증폭용 프라이머 세트를 제공한다.In addition, the present invention provides a primer set for amplifying a cleaved amplified polymorphic sequences (CAPS) marker for identification of shiitake mushroom varieties including the primer set.

또한, 본 발명은 상기 프라이머 세트; 증폭 반응을 수행하기 위한 시약; 및 제한효소를 포함하는 표고버섯 품종 판별용 키트를 제공한다.In addition, the present invention is the primer set; reagents for performing an amplification reaction; And it provides a kit for identifying shiitake mushroom varieties comprising a restriction enzyme.

또한, 본 발명은 표고버섯 시료에서 게놈 DNA를 분리하는 단계; 상기 분리된 게놈 DNA를 주형으로 하고, 제3항의 프라이머 쌍을 시용하여 증폭 반응을 수행하여 표적 서열을 증폭하는 단계; 상기 증폭 단계 산물을 제한효소로 절단하는 단계; 및 상기 제한효소 절단 산물을 전기영동하여 절단 산물의 크기를 분석하는 단계;를 포함하는 표고버섯 품종을 판별하는 방법을 제공한다.In addition, the present invention comprises the steps of isolating genomic DNA from a shiitake mushroom sample; using the isolated genomic DNA as a template and performing an amplification reaction using the primer pair of claim 3 to amplify a target sequence; cleaving the product of the amplification step with a restriction enzyme; and electrophoresing the restriction enzyme cleavage product to analyze the size of the cleavage product.

전술한 바와 같은 본 발명에 따르면, 표고버섯 품종을 빠르고 간편하게 확인할 수 있으며, 본 발명의 프라이머를 이용하여 PCR로 분리된 CAPS 마커를 이용해 표고 균주를 구분할 수 있다. 우리나라 표고버섯 유전자원을 보호하는 한편 수입품종과의 구별할 수 있어, 해외로 건표고나 생표고로 수출될 때에도 국산품종임을 입증할 수 있는 구별 방법으로 매우 유용하게 활용될 수 있다. 또한, CAPS 마커는 PCR로 증폭된 DNA 단편에 제한효소를 처리함으로써 단편의 절단 여부를 확인하기 때문에, SSR 마커의 경우와는 달리 고가의 사이즈 분석 장비가 없이도 아가로즈 겔 상에서 빠르고 쉽게 결과를 확인할 수 있다. 이에 따라 품종을 구분하는 데에 드는 비용과 시간을 줄일 수 있고, 결과 해석에 고도의 지식을 요하지 않기 때문에 보다 효율적인 품종 판별이 가능하다는 장점이 있다.According to the present invention as described above, shiitake mushroom varieties can be quickly and easily identified, and shiitake strains can be distinguished using the CAPS marker separated by PCR using the primers of the present invention. Since it can protect the genetic resources of shiitake in Korea and distinguish it from imported varieties, it can be very usefully used as a discrimination method that can prove that it is a domestic variety even when exported as dried or raw shiitake. In addition, the CAPS marker checks whether the fragment is cut by treating the PCR-amplified DNA fragment with a restriction enzyme, so unlike the SSR marker, you can quickly and easily check the result on an agarose gel without expensive size analysis equipment. have. Accordingly, it is possible to reduce the cost and time required to classify the variety, and since a high level of knowledge is not required to interpret the result, there is an advantage in that it is possible to identify the variety more efficiently.

도 1은 특이 유전변이 발굴을 위한 생물정보분석 파이프라인을 간단히 도식화하여 나타낸 도이다.
도 2는 표고버섯 참아람 품종 특이적 CAPS 마커 적용 결과이다.
도 3은 표고버섯 산조708호 품종 특이적 CAPS 마커 적용 결과이다.
도 4는 표고버섯 산조707호 품종 특이적 CAPS 마커 적용 결과이다.
도 5는 표고버섯 산조302호 품종 특이적 CAPS 마커 적용 결과이다.
도 6은 표고버섯 산조701호 품종 특이적 CAPS 마커 적용 결과이다.
도 7은 표고버섯 산조108호 품종 특이적 CAPS 마커 적용 결과이다.
도 8은 표고버섯 모리290 품종 특이적 CAPS 마커 적용 결과이다.
도 9는 표고버섯 유지로 품종 특이적 CAPS 마커 적용 결과이다.
도 10은 표고버섯 향고808 품종 특이적 CAPS 마커 적용 결과이다.
도 11은 표고버섯 추재2호 품종 특이적 CAPS 마커 적용 결과이다.1 is a diagram showing a simplified schematic diagram of a bioinformation analysis pipeline for discovering specific genetic mutations.
2 is a result of applying the shiitake mushroom cultivar-specific CAPS marker.
3 is a result of applying the shiitake mushroom Sanjo 708 variety-specific CAPS marker.
4 is a result of applying the shiitake mushroom Sanjo 707 variety-specific CAPS marker.
5 is a result of applying the shiitake mushroom Sanjo No. 302 cultivar-specific CAPS marker.
6 is a result of applying the shiitake mushroom Sanjo No. 701 variety-specific CAPS marker.
7 is a result of applying the shiitake mushroom Sanjo No.108 variety-specific CAPS marker.
8 is a result of applying the shiitake mushroom Mori 290 variety-specific CAPS marker.
9 is a result of applying a variety-specific CAPS marker to shiitake mushroom oil.
10 is a result of applying a CAPS marker specific to the 808 cultivar of shiitake mushroom.
11 is a result of applying the shiitake mushroom Chujae No. 2 variety-specific CAPS marker.

이하, 본 발명에 대하여 보다 상세하게 설명하도록 한다.Hereinafter, the present invention will be described in more detail.

본 발명자들은 국내 유통중인 주요 표고 품종의 판별을 위한 분자생물학적 진단법 개발을 위하여 국내에서 유통중인 주요 표고 품종 10종에 대한 비교유전체 분석을 통하여 특이적인 유전변이를 10,904개 발굴하였다. 이어서, 해당 단일염기다형성 (SNP)을 포함하면서 증폭산물의 길이가 300-600bp 정도로서 극단적인 Tm 값을 갖지 않고 (약 40~60C 범위), 증폭산물에 단일 제한효소로 절단되는 부분을 포함한 CAPS 마커 후보군을 설계하였으며, 설계한 마커 후보군의 판별 민감도를 유전자증폭반응과 제한효소 처리에 의하여 재확인 하였고, 최종적으로 정확하고 신속하게 표고버섯 품종 판별에 사용할 수 있는 23개의 CAPS 마커를 선발하여 본 발명을 완성하였다.The present inventors discovered 10,904 specific genetic mutations through comparative genomic analysis of 10 major shiitake varieties distributed in Korea to develop a molecular biological diagnostic method for the identification of major shiitake varieties in circulation. Subsequently, while including the corresponding single nucleotide polymorphism (SNP), the length of the amplification product is about 300-600 bp, and it does not have an extreme Tm value (in the range of about 40 to 60 C), and a CAPS marker including a portion cleaved by a single restriction enzyme in the amplification product A candidate group was designed, and the sensitivity of the designed marker candidate group was reconfirmed by gene amplification reaction and restriction enzyme treatment. Finally, 23 CAPS markers that can be used to accurately and quickly identify shiitake mushroom varieties were selected and completed the present invention. did

본 발명에서 사용되는 용어 “다형성 (polymorphism)”이란 하나의 유전자 좌위 (locus)에 두 가지 이상의 대립 유전자 (allele)가 존재하는 경우를 말하며 다형성 부위 중에서, 사람에 따라 단일 염기만이 다른 것을 단일 염기 다형성 (single nucleotide polymorphism, SNP)이라 한다. 바람직한 다형성 마커는 선택된 집단에서 1% 이상, 더욱 바람직하게는 5% 또는 10% 이상의 발생 빈도를 나타내는 두 가지 이상의 대립 유전자를 가진다. 따라서, 다형성 마커에 대한 유전적 연관 (genetic association)은 특정한 다형성 마커의 하나 이상의 특정한 대립형질에 대해 연관이 있다는 것을 의미한다. 마커는 단일 염기 다형성 (SNP), 마이크로새틀라이트 (microsatellite), 삽입, 결실, 중복 및 전위 (translocation)를 포함한, 게놈에서 발견되는 임의의 변이 형태의 대립형질을 포함할 수 있다.As used herein, the term “polymorphism” refers to a case in which two or more alleles exist at one locus, and among polymorphism sites, only a single base differs from one person to another as a single base It is called single nucleotide polymorphism (SNP). Preferred polymorphic markers have two or more alleles exhibiting an incidence of at least 1%, more preferably at least 5% or 10% in a selected population. Thus, genetic association to a polymorphic marker means that there is an association for one or more specific alleles of a specific polymorphic marker. Markers can include alleles in any variant form found in the genome, including single nucleotide polymorphisms (SNPs), microsatellites, insertions, deletions, duplications and translocations.

본 발명에서 사용되는 용어 “단일염기다형성 (SNP)”은 게놈에서 단일염기 (A, T, C 또는 G)가 종의 멤버들 간 또는 한 개체 (individual)의 쌍 염색체 간에 다른 경우에 발생하는 DNA 서열의 다양성을 의미한다. 단일염기는 폴리뉴클레오티드 서열에 변화 (대체), 제거 (결실) 또는 첨가 (삽입)될 수 있다. SNP는 번역 프레임의 변화를 유발할 수 있다. 단일염기다형성은 유전자의 코딩 서열, 유전자의 비-코딩 부위 또는 유전자 사이의 내부 지역 (intergenic regions)에 포함될 수 있다. 유전자의 코딩 서열 내의 SNP는 유전암호의 중복성 (degeneracy)으로 인해 반드시 타겟 단백질의 아미노산 서열상에 변화를 일으키지는 않는다. 동일한 폴리펩타이드 서열을 형성하는 SNP는 동의적 (synonymous)이라 하고 (침묵 돌연변이라고도 불리움), 다른 폴리펩타이드 서열을 형성하는 SNP의 경우 비-동의적 (non-synonymous)이라고 한다. 비-동의적 SNP는 미스센스 또는 넌센스일 수 있으며, 미스센스 변화는 다른 아미노산을 발생시키는 반면에 넌센스 변화는 비성숙 종결코돈을 형성한다. 단백질-코딩 부위가 아닌 곳에 존재하는 SNP는 유전자 사일런싱, 전사인자 결합 또는 비-코딩 RNA 서열을 유발시킬 수 있다.As used herein, the term “single nucleotide polymorphism (SNP)” refers to DNA that occurs when a single nucleotide (A, T, C, or G) in the genome is different between members of a species or between paired chromosomes of an individual It refers to the diversity of sequences. A single base may be changed (replaced), removed (deleted) or added (inserted) into the polynucleotide sequence. SNPs can cause changes in the translation frame. Single nucleotide polymorphisms may be included in the coding sequence of a gene, in a non-coding region of a gene, or in intergenic regions. SNPs in the coding sequence of genes do not necessarily cause changes in the amino acid sequence of the target protein due to the degeneracy of the genetic code. SNPs that form the same polypeptide sequence are said to be synonymous (also called silent mutations), and SNPs that form different polypeptide sequences are said to be non-synonymous. Non-synonymous SNPs can be missense or nonsense, where a missense change results in another amino acid while a nonsense change forms an immature stop codon. SNPs that are not present in protein-coding sites can cause gene silencing, transcription factor binding, or non-coding RNA sequences.

이어서, 본 발명은 서열번호 1 및 2의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 또는 서열번호 3 및 4의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍;을 포함하는 표고버섯 품종 참아람 판별용 프라이머 세트를 제공한다.Subsequently, the present invention provides an oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 1 and 2; Or a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 3 and 4; provides a primer set for discrimination of shiitake mushroom varieties Chamaraam.

본 발명의 프라이머 쌍은 제한효소에 의한 특이적인 절단이 일어날 수 있는 부위를 증폭하는 것일 수 있다.The primer pair of the present invention may amplify a site where specific cleavage by restriction enzymes can occur.

상기 서열번호 1 및 2의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍에 의한 증폭 산물은 제한효소 AccI (Xmil)에 의해 특이적으로 절단되는 제한효소 자리를 포함하는 것일 수 있다.The amplification product by the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 1 and 2 may include a restriction enzyme site specifically cleaved by the restriction enzyme AccI (Xmil).

상기 서열번호 3 및 4의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍에 의한 증폭 산물은 제한효소 AvaII (Eco48I)에 의해 특이적으로 절단되는 제한효소 자리를 포함하는 것일 수 있다.The amplification product by the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 3 and 4 may include a restriction enzyme site specifically cleaved by the restriction enzyme AvaII (Eco48I).

또한, 본 발명은 서열번호 5 및 6의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 또는 서열번호 7 및 8의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍;을 포함하는 표고버섯 품종 산조708호 판별용 프라이머 세트를 제공한다.In addition, the present invention provides an oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 5 and 6; Or a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 7 and 8; provides a primer set for discriminating the shiitake mushroom variety Sanjo 708, including.

상기 서열번호 5 및 6의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍에 의한 증폭 산물은 제한효소 AfeI에 의해 특이적으로 절단되는 제한효소 자리를 포함하는 것일 수 있다.The amplification product by the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 5 and 6 may include a restriction enzyme site specifically cleaved by the restriction enzyme AfeI.

상기 서열번호 7 및 8의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍에 의한 증폭 산물은 제한효소 NcoI에 의해 특이적으로 절단되는 제한효소 자리를 포함하는 것일 수 있다.The amplification product by the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 7 and 8 may include a restriction enzyme site specifically cleaved by the restriction enzyme NcoI.

또한, 서열번호 9 및 10의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 또는 서열번호 11 및 12의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍;을 포함하는 표고버섯 품종 산조707호 판별용 프라이머 세트를 제공한다.In addition, a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 9 and 10; Or a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 11 and 12; provides a primer set for discriminating the shiitake mushroom variety Sanjo 707, including.

상기 서열번호 9 및 10의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍에 의한 증폭 산물은 제한효소 AvaII (Eco48I)에 의해 특이적으로 절단되는 제한효소 자리를 포함하는 것일 수 있다.The amplification product by the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 9 and 10 may include a restriction enzyme site specifically cleaved by the restriction enzyme AvaII (Eco48I).

상기 서열번호 11 및 12의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍에 의한 증폭 산물은 제한효소 BfaI (FspBI)에 의해 특이적으로 절단되는 제한효소 자리를 포함하는 것일 수 있다.The amplification product by the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 11 and 12 may include a restriction enzyme site specifically cleaved by the restriction enzyme BfaI (FspBI).

또한, 본 발명은 서열번호 13 및 14의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 서열번호 15 및 16의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 또는 서열번호 17 및 18의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍;을 포함하는 표고버섯 품종 산조302호 판별용 프라이머 세트를 제공한다.In addition, the present invention provides an oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 13 and 14; an oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 15 and 16; Or a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 17 and 18; provides a primer set for discrimination of shiitake mushroom variety Sanjo 302, including.

상기 서열번호 13 및 14의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍에 의한 증폭 산물은 제한효소 AccI (Xmil)에 의해 특이적으로 절단되는 제한효소 자리를 포함하는 것일 수 있다.The amplification product by the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 13 and 14 may include a restriction enzyme site specifically cleaved by the restriction enzyme AccI (Xmil).

상기 서열번호 15 및 16의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍에 의한 증폭 산물은 제한효소 AvaII (Eco48I)에 의해 특이적으로 절단되는 제한효소 자리를 포함하는 것일 수 있다.The amplification product by the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 15 and 16 may include a restriction enzyme site specifically cleaved by the restriction enzyme AvaII (Eco48I).

상기 서열번호 17 및 18의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍에 의한 증폭 산물은 BfaI (FspBI)에 의해 특이적으로 절단되는 제한효소 자리를 포함하는 것일 수 있다.The amplification product by the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 17 and 18 may include a restriction enzyme site specifically cleaved by BfaI (FspBI).

또한, 본 발명은 서열번호 19 및 20의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 또는 서열번호 21 및 22의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍;을 포함하는 표고버섯 품종 산조701호 판별용 프라이머 세트를 제공한다.In addition, the present invention provides an oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 19 and 20; Or a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 21 and 22; provides a primer set for discrimination of shiitake mushroom variety Sanjo 701, including.

상기 서열번호 19 및 20의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍에 의한 증폭 산물은 AvaI (Eco88I)에 의해 특이적으로 절단되는 제한효소 자리를 포함하는 것일 수 있다.The amplification product by the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 19 and 20 may include a restriction enzyme site specifically cleaved by AvaI (Eco88I).

상기 서열번호 21 및 22의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍에 의한 증폭 산물은 BfaI (FspBI)에 의해 특이적으로 절단되는 제한효소 자리를 포함하는 것일 수 있다.The amplification product by the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 21 and 22 may include a restriction enzyme site specifically cleaved by BfaI (FspBI).

또한, 본 발명은 서열번호 23 및 24; 서열번호 25 및 26; 서열번호 27 및 28; 서열번호 29 및 30; 또는 서열번호 31 및 32의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍;을 포함하는 표고버섯 품종 산조108호 판별용 프라이머 세트를 제공한다.In addition, the present invention provides SEQ ID NOs: 23 and 24; SEQ ID NOs: 25 and 26; SEQ ID NOs: 27 and 28; SEQ ID NOs: 29 and 30; Or a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 31 and 32; provides a primer set for discriminating the shiitake mushroom variety Sanjo No. 108, including.

상기 서열번호 23 및 24의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍에 의한 증폭 산물은 제한효소 AvaII (Eco48I)에 의해 특이적으로 절단되는 제한효소 자리를 포함하는 것일 수 있다.The amplification product by the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 23 and 24 may include a restriction enzyme site specifically cleaved by the restriction enzyme AvaII (Eco48I).

상기 서열번호 25 및 26의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍에 의한 증폭 산물은 제한효소 AfeI에 의해 특이적으로 절단되는 제한효소 자리를 포함하는 것일 수 있다.The amplification product by the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 25 and 26 may include a restriction enzyme site specifically cleaved by the restriction enzyme AfeI.

상기 서열번호 27 및 28의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍은 제한효소 NcoI에 의해 특이적으로 절단되는 제한효소 자리를 포함하는 것일 수 있다.The oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 27 and 28 may include a restriction enzyme site specifically cleaved by the restriction enzyme NcoI.

상기 서열번호 29 및 30의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍에 의한 증폭 산물은 제한효소 ClaI에 의해 특이적으로 절단되는 제한효소 자리를 포함하는 것일 수 있다.The amplification product by the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 29 and 30 may include a restriction enzyme site specifically cleaved by the restriction enzyme ClaI.

상기 서열번호 31 및 32의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍에 의한 증폭 산물은 제한효소 BfaI (FspBI)에 의해 특이적으로 절단되는 제한효소 자리를 포함하는 것일 수 있다.The amplification product by the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 31 and 32 may include a restriction enzyme site specifically cleaved by the restriction enzyme BfaI (FspBI).

또한, 본 발명은 서열번호 33 및 34의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍;을 포함하는 표고버섯 품종 모리290 판별용 프라이머 세트를 제공한다.In addition, the present invention provides a primer set for discriminating the shiitake mushroom variety Mori 290, comprising a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 33 and 34.

상기 서열번호 33 및 34의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍에 의한 증폭 산물은 제한효소 NcoI에 의해 특이적으로 절단되는 제한효소 자리를 포함하는 것일 수 있다.The amplification product by the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 33 and 34 may include a restriction enzyme site specifically cleaved by the restriction enzyme NcoI.

또한, 본 발명은 서열번호 35 및 36의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍;을 포함하는 표고버섯 품종 유지로 판별용 프라이머 세트를 제공한다.In addition, the present invention provides a primer set for discrimination by maintaining a shiitake mushroom variety;

상기 서열번호 35 및 36의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍에 의한 증폭 산물은 제한효소 AccI (Xmil)에 의해 특이적으로 절단되는 제한효소 자리를 포함하는 것일 수 있다.The amplification product by the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 35 and 36 may include a restriction enzyme site specifically cleaved by the restriction enzyme AccI (Xmil).

또한, 본 발명은 서열번호 37 및 38의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍;을 포함하는, 표고버섯 품종 향고808 판별용 프라이머 세트를 제공한다.In addition, the present invention provides a primer set for discriminating the shiitake mushroom variety Hyanggo 808;

상기 서열번호 37 및 38의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍에 의한 증폭 산물은 제한효소 BfaI (FspBI)에 의해 특이적으로 절단되는 제한효소 자리를 포함하는 것일 수 있다.The amplification product of the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 37 and 38 may include a restriction enzyme site specifically cleaved by the restriction enzyme BfaI (FspBI).

또한, 본 발명은 서열번호 39 및 40; 서열번호 41 및 42; 서열번호 43 및 44; 또는 서열번호 45 및 46의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍;을 포함하는, 표고버섯 품종 추재2호 판별용 프라이머 세트를 제공한다.In addition, the present invention provides SEQ ID NOs: 39 and 40; SEQ ID NOs: 41 and 42; SEQ ID NOs: 43 and 44; Or a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 45 and 46; provides a primer set for discrimination of shiitake mushroom variety Chujae No. 2, including.

상기 서열번호 39 및 40의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍에 의한 증폭 산물은 제한효소 BanII (Eco24I)에 의해 특이적으로 절단되는 제한효소 자리를 포함하는 것일 수 있다.The amplification product by the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 39 and 40 may include a restriction enzyme site specifically cleaved by the restriction enzyme BanII (Eco24I).

상기 서열번호 41 및 42의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍에 의한 증폭 산물은 제한효소 AccI (Xmil)에 의해 특이적으로 절단되는 제한효소 자리를 포함하는 것일 수 있다.The amplification product of the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 41 and 42 may include a restriction enzyme site specifically cleaved by the restriction enzyme AccI (Xmil).

상기 서열번호 43 및 44의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍에 의한 증폭 산물은 제한효소 ClaI (Bsu17I)에 의해 특이적으로 절단되는 제한효소 자리를 포함하는 것일 수 있다.The amplification product by the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 43 and 44 may include a restriction enzyme site that is specifically cleaved by the restriction enzyme ClaI (Bsu17I).

상기 서열번호 45 및 46의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍에 의한 증폭 산물은 제한효소 BfaI (FspBI)에 의해 특이적으로 절단되는 제한효소 자리를 포함하는 것일 수 있다.The amplification product of the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 45 and 46 may include a restriction enzyme site specifically cleaved by restriction enzyme BfaI (FspBI).

본 발명에서 사용되는 용어 "프라이머"란 짧은 자유 수산화기를 가지는 핵산서열로서 카피하려는 핵산 가닥에 상보적인 단일 가닥 올리고뉴클레오티드 서열을 의미하며, 프라이머 연장 산물의 합성을 위한 개시점으로서 작용할 수 있다. 상기 프라이머의 길이 및 서열은 연장 산물의 합성을 시작하도록 허용해야 하며, 프라이머의 구체적인 길이 및 서열은 요구되는 DNA 또는 RNA 표적의 복합도 (complexity)뿐만 아니라, 온도 및 이온 강도와 같은 이용 조건에 의존할 것이다. 구체적 예로, 프라이머의 구체적인 길이 및 서열은 Guanine 및 cytosine의 함량 (GC contents), GC배열, 어닐링 (annealing) 온도 및 이온 강도 등 여러 조건을 고려하여 결정할 수 있다.As used herein, the term “primer” refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied as a nucleic acid sequence having a short free hydroxyl group, and can serve as a starting point for synthesis of a primer extension product. The length and sequence of the primer should allow synthesis of the extension product to begin, and the specific length and sequence of the primer will depend on the complexity of the DNA or RNA target required, as well as the conditions of use such as temperature and ionic strength. something to do. As a specific example, the specific length and sequence of the primer may be determined in consideration of various conditions such as guanine and cytosine contents (GC contents), GC arrangement, annealing temperature, and ionic strength.

또한, 본 발명의 프라이머는 예를 들면, 포스포르아미다이트 고체 지지체 방법과 같은 당 분야에 공지된 방법을 이용하여 화학적으로 합성할 수 있다.In addition, the primer of the present invention can be chemically synthesized using a method known in the art, such as, for example, a phosphoramidite solid support method.

또한, 본 발명에서 프라이머로서 이용된 올리고뉴클레오티드는 또한 뉴클레오티드 유사체 (analogue), 예를 들면, 포스포로티오에이트 (phosphorothioate), 알킬포스포로티오에이트 또는 펩티드 핵산 (peptide nucleic acid)를 포함할 수 있거나 또는 삽입 물질 (intercalating agent)를 포함할 수 있다.In addition, the oligonucleotide used as a primer in the present invention may also contain a nucleotide analogue, for example, a phosphorothioate, an alkylphosphorothioate or a peptide nucleic acid or An intercalating agent may be included.

아울러, 본 발명은 상기 프라이머 세트를 포함하는 표고버섯 품종 판별을 위한 CAPS (cleaved amplified polymorphic sequences) 마커 증폭용 프라이머 세트를 제공한다.In addition, the present invention provides a primer set for amplifying cleaved amplified polymorphic sequences (CAPS) markers for identifying shiitake mushroom varieties including the primer set.

또한, 상기 CAPS 마커는 제한효소에 의해 특이적인 절단이 일어날 수 있는 부위를 프라이머로 증폭하는 것일 수 있다.In addition, the CAPS marker may be to amplify a site where specific cleavage by restriction enzymes can occur with a primer.

하기 실시예에서 확인하는 바와 같이, 본 발명의 프라이머 세트를 이용하면 시료로부터 표고버섯 품종 참아람, 산조708호, 산조707호, 산조302호, 산조701호, 산조108호, 모리290, 유지로, 향고808 및 추재2호를 쉽고 빠르게 판별할 수 있다.As confirmed in the examples below, when the primer set of the present invention is used, the shiitake mushroom varieties Chamaram, Sanjo 708, Sanjo 707, Sanjo 302, Sanjo 701, Sanjo 108, Mori 290, and Yujiro are obtained from the sample. , Hyanggo 808 and Chujae No. 2 can be identified quickly and easily.

나아가, 본 발명은 상기 프라이머 세트; 증폭 반응을 수행하기 위한 시약; 및 제한효소를 포함하는 표고버섯 품종 판별용 키트를 제공한다.Further, the present invention is the primer set; reagents for performing an amplification reaction; And it provides a kit for identifying shiitake mushroom varieties comprising a restriction enzyme.

또한, 본 발명의 특징인 서열번호 1 내지 46의 염기서열로 표시되는 올리고뉴클레오티드로 이루어진 프라이머를 포함하는 CAPS 마커를 이용하여 표고버섯 품종을 판별할 수 있다.In addition, the shiitake mushroom variety can be identified using a CAPS marker including a primer comprising an oligonucleotide represented by the nucleotide sequence of SEQ ID NOs: 1 to 46, which is a characteristic of the present invention.

또한, 프라이머를 이용한 특정 핵산의 검출은 PCR과 같은 증폭 방법을 사용하여 목적 유전자의 서열을 증폭한 다음 당 분야에 공지된 방법으로 유전자의 증폭여부를 확인함으로써 수행될 수 있다.In addition, the detection of a specific nucleic acid using a primer can be performed by amplifying the sequence of the target gene using an amplification method such as PCR, and then confirming whether the gene is amplified by a method known in the art.

또한, 상기 증폭 반응은 예를 들면, 이에 한정되지는 않으나 중합효소 연쇄반응 (PCR), DNA 시퀀싱, RT-PCR, 프라이머 연장법 (Nikiforeov et al., Nucl Acids Res 22, 4167-4175, 1994), 올리고뉴클레오타이드 연장 분석 (Nickerson et al., Pro Nat Acad Sci USA, 87, 8923-8927, 1990), 대립형질 특이적 PCR법 (Rust et al., Nucl Acids Res, 6, 3623-3629, 1993), RNase 불일치절단 (RNase mismatch cleavage, Myers et al., Science, 230, 1242-1246, 1985), 단일가닥 입체 다형화 (single strand conformation lymorphism, Orita et al., Pro Nat Acad Sci USA, 86, 2766-2770, 1989), SSCP 및 헤테로두플렉스 동시 분석법 (Lee et al., Mol Cells, 5:668-672, 1995), 변성 구배 젤 전기영동 (DGGE, Cariello et al., Am J Hum Genet, 42, 726-734, 1988), 변성 고압 액체 크로마토그래피 (Underhill et al., Genome Res, 7, 996-1005, 1997), 혼성화 반응, DNA 칩 등의 방법으로 수행될 수 있다. 상기 혼성화 반응의 예로는 노던 하이브리다이제이션 (Maniatis T. et al., Molecular Cloning, Cold Spring Habor Laboratory, NY, 1982), 인시츄 하이브리다이제이션 (Jacquemier et al., Bull Cancer, 90:31-8, 2003), 마이크로어레이 (Macgregor, Expert, Rev Mol Diagn 3:185-200, 2003) 방법 등이 있다.In addition, the amplification reaction is, for example, but not limited to, polymerase chain reaction (PCR), DNA sequencing, RT-PCR, primer extension method (Nikiforeov et al., Nucl Acids Res 22, 4167-4175, 1994) , oligonucleotide extension analysis (Nickerson et al., Pro Nat Acad Sci USA, 87, 8923-8927, 1990), allele-specific PCR method (Rust et al., Nucl Acids Res, 6, 3623-3629, 1993) , RNase mismatch cleavage (Myers et al., Science, 230, 1242-1246, 1985), single strand conformation lymorphism, Orita et al., Pro Nat Acad Sci USA, 86, 2766 2770, 1989), SSCP and heteroduplex simultaneous assay (Lee et al., Mol Cells, 5:668-672, 1995), denaturing gradient gel electrophoresis (DGGE, Cariello et al., Am J Hum Genet, 42, 726-734, 1988), denaturing high-pressure liquid chromatography (Underhill et al., Genome Res, 7, 996-1005, 1997), hybridization reaction, DNA chip, and the like. Examples of the hybridization reaction include Northern hybridization (Maniatis T. et al., Molecular Cloning, Cold Spring Habor Laboratory, NY, 1982), in situ hybridization (Jacquemier et al., Bull Cancer, 90:31-8). , 2003), and microarray (Macgregor, Expert, Rev Mol Diagn 3:185-200, 2003) methods.

또한, 상기 증폭 반응을 수행하기 위한 시약은 증폭 반응에 일반적으로 사용되는 시약을 모두 포함할 수 있다. 본 발명의 키트가 PCR 증폭 과정에 적용되는 경우에는, 본 발명의 키트는 선택적으로 PCR 증폭에 필요한 시약, 예컨대 버퍼, DNA 중합효소, DNA 중합 효소 조인자 및 dNTPs를 포함할 수 있다. 본 발명의 키트는 상기한 시약 성분을 포함하는 다수의 별도 패키징 또는 컴파트먼트로 제작될 수 있다.In addition, the reagent for performing the amplification reaction may include all reagents generally used in the amplification reaction. When the kit of the present invention is applied to a PCR amplification process, the kit of the present invention may optionally include reagents necessary for PCR amplification, such as a buffer, a DNA polymerase, a DNA polymerase cofactor, and dNTPs. The kit of the present invention may be manufactured in a number of separate packaging or compartments containing the reagent components described above.

또한, 상기 증폭 반응에 의한 증폭 산물은 표고버섯 품종 특이적인 단일염기다형성 (SNP) 및 특정 제한효소에 의해 절단이 일어나는 제한효소 인식 부위가 포함되는 것일 수 있다. In addition, the amplification product by the amplification reaction may include a shiitake mushroom variety-specific single nucleotide polymorphism (SNP) and a restriction enzyme recognition site cleaved by a specific restriction enzyme.

또한, 상기 제한효소는 AccI, AvaII, AfeI, NcoI, BfaI, ClaI 및 BanII 으로 이루어진 군에서 선택된 어느 하나 이상일 수 있으나, 이에 제한되지 않는다.In addition, the restriction enzyme may be any one or more selected from the group consisting of AccI, AvaII, AfeI, NcoI, BfaI, ClaI and BanII, but is not limited thereto.

마지막으로, 본 발명은 표고버섯 시료에서 게놈 DNA를 분리하는 단계; 상기 분리된 게놈 DNA를 주형으로 하고, 제1항 내지 제10항의 프라이머 세트를 이용해 증폭 반응을 수행하여 표적 서열을 증폭하는 단계; 상기 증폭 단계 산물을 제한효소로 절단하는 단계; 및 상기 제한효소 절단 산물을 분석하는 단계;를 포함하는 표고버섯 품종을 판별하는 방법을 제공한다.Finally, the present invention comprises the steps of isolating genomic DNA from a shiitake mushroom sample; using the isolated genomic DNA as a template and amplifying a target sequence by performing an amplification reaction using the primer set of claim 1 ; cleaving the product of the amplification step with a restriction enzyme; and analyzing the restriction enzyme cleavage product; provides a method for discriminating shiitake mushroom varieties comprising

또한, 상기 시료는 표고버섯 배지, 표고버섯 종균 또는 표고버섯일 수 있으나, 이에 제한되지 않는다.In addition, the sample may be a shiitake medium, a shiitake mushroom spawn, or a shiitake mushroom, but is not limited thereto.

또한, 상기 게놈 DNA는 당업계에서 통상적으로 사용되는 페놀/클로로포름 추출법, SDS 추출법 (Tai et al., Plant Mol. Biol. Reporter, 8: 297-303, 1990), CTAB 분리법 (Cetyl Trimethyl Ammonium Bromide; Murray et al., Nuc. Res., 4321-4325, 1980) 또는 상업적으로 판매되는 DNA 추출 키트를 이용하여 추출될 수 있다.In addition, the genomic DNA can be obtained by phenol/chloroform extraction method, SDS extraction method (Tai et al., Plant Mol. Biol. Reporter, 8: 297-303, 1990), CTAB separation method (Cetyl Trimethyl Ammonium Bromide; Murray et al., Nuc. Res., 4321-4325, 1980) or a commercially available DNA extraction kit.

또한, 상기 증폭 반응은 앞서 기술한 방법을 사용하여 수행될 수 있으나, 바람직하게는 중합효소 연쇄반응 (PCR)을 수행하여 이루어지는 것일 수 있다.In addition, the amplification reaction may be carried out using the method described above, but may be preferably made by performing a polymerase chain reaction (PCR).

또한, 상기 제한효소는 AccI, AvaII, AfeI, NcoI, BfaI, ClaI 및 BanII 으로 이루어진 군에서 선택된 어느 하나 이상일 수 있다.In addition, the restriction enzyme may be any one or more selected from the group consisting of AccI, AvaII, AfeI, NcoI, BfaI, ClaI and BanII.

본 발명에서 사용되는 용어 "제한효소"란 DNA의 특정한 염기배열을 식별하고 이중사슬을 절단하는 엔도뉴클레아제로서 특수한 효소를 의미한다. 본 발명의 구체적인 실시예에서는, 선택되어진 프라이머 세트를 기반으로 PCR를 수행하고 PCR 정제 키트로 정제한 후 프라이머와 조합인 제한효소를 이용하여 활성 온도 내에서 처리하였다.The term "restriction enzyme" used in the present invention refers to a specific enzyme as an endonuclease that identifies a specific nucleotide sequence of DNA and cuts double strands. In a specific example of the present invention, PCR was performed based on the selected primer set, and after purification with a PCR purification kit, it was treated within the activation temperature using a restriction enzyme in combination with the primer.

또한, 상기 절단 산물은 당업계에서 널리 공지된 방법에 따라 PCR 산물의 DNA를 크기별로 분리할 수 있다. 바람직하게는 아가로스 겔 (agarose gel) 또는 폴리아크릴아미드 겔 (polyacrylamide gel) 전기영동 또는 형광분석장치 (ABI prism 3100 genetic analyzer-electropherogram)에 의해 확인할 수 있다.In addition, the cleavage product can be separated by size of the DNA of the PCR product according to a method well known in the art. Preferably, it can be confirmed by agarose gel or polyacrylamide gel electrophoresis or fluorescence analysis device (ABI prism 3100 genetic analyzer-electropherogram).

또한, 각각의 제한효소를 처리하였을 시 상기 절단 산물이 두 개 이상의 단편으로 구성된 경우, 사용된 프라이머 및 제한효소에 따라 표고버섯의 품종을 판별하는 것일 수 있다 (하기 표 4 참조).In addition, when the respective restriction enzymes are treated and the cleavage product is composed of two or more fragments, the variety of shiitake mushrooms may be discriminated according to the primers and restriction enzymes used (see Table 4 below).

전술한 바와 같은 본 발명에 따르면, 표고버섯 품종을 빠르고 간편하게 확인할 수 있으며, 본 발명의 프라이머를 이용하여 PCR로 분리된 CAPS 마커를 이용해 표고 균주를 구분할 수 있다. 우리나라 표고버섯 유전자원을 보호하는 한편 수입품종과의 구별할 수 있어, 해외로 건표고나 생표고로 수출될 때에도 국산품종임을 입증할 수 있는 구별 방법으로 매우 유용하게 활용될 수 있다. 또한, CAPS 마커는 PCR로 증폭된 DNA 단편에 제한효소를 처리함으로써 단편의 절단 여부를 확인하기 때문에, SSR 마커의 경우와는 달리 고가의 사이즈 분석 장비가 없이도 아가로즈 겔 상에서 빠르고 쉽게 결과를 확인할 수 있다. 이에 따라 품종을 구분하는 데에 드는 비용과 시간을 줄일 수 있고, 결과 해석에 고도의 지식을 요하지 않기 때문에 보다 효율적인 품종 판별이 가능하다는 장점이 있다.According to the present invention as described above, shiitake mushroom varieties can be quickly and easily identified, and shiitake strains can be distinguished using the CAPS marker separated by PCR using the primers of the present invention. Since it can protect the genetic resources of shiitake in Korea and distinguish it from imported varieties, it can be very usefully used as a discrimination method that can prove that it is a domestic variety even when exported as dried or raw shiitake. In addition, the CAPS marker checks whether the fragment is cut by treating the PCR-amplified DNA fragment with a restriction enzyme, so unlike the SSR marker, you can quickly and easily check the result on an agarose gel without expensive size analysis equipment. have. Accordingly, it is possible to reduce the cost and time required to classify the variety, and since a high level of knowledge is not required to interpret the result, there is an advantage in that it is possible to identify the variety more efficiently.

이하, 본 발명의 실시예를 첨부된 도면을 참고하여 보다 상세하게 설명하도록 한다. 그러나, 하기의 실시예는 본 발명의 내용을 구체화 하기 위한 것일 뿐, 이에 의해 본 발명이 한정되는 것은 아닐 것이다.Hereinafter, embodiments of the present invention will be described in more detail with reference to the accompanying drawings. However, the following examples are only intended to materialize the contents of the present invention, and the present invention will not be limited thereby.

<실시예 1> 표고버섯 국내 유통품종 유전체 데이터 확보<Example 1> Securing genomic data of domestic distribution of shiitake mushrooms

표고버섯 품종 구분을 위한 마커를 개발하기 위해 표고버섯 국내 유통품종 유전체 데이터 확보하고자 하였다. 분석시료로는 표고 톱밥배지 재배용 품종 (참아람, 산조 701호, 산조 708호, 산조 707호), 원목재배용 품종 (산조 108호, 302호, 502호, 모리290), 중국 접종배지 품종 (추제2호, 향고808) 총 10균주를 이용하였다.In order to develop a marker for the classification of shiitake mushroom varieties, it was attempted to secure genomic data of domestic shiitake mushroom varieties. Analysis samples include cultivars for shiitake sawdust cultivation (Chamaram, Sanjo 701, Sanjo 708, Sanjo 707), log cultivation cultivars (Sanjo 108, 302, 502, Mori 290), and Chinese inoculation medium cultivars (extracted). No. 2, Hyanggo 808), a total of 10 strains were used.

분자계통분석을 통해 시료의 종 동정을 확인하고, 시료별 핵산 대량 추출 및 QC를 진행하였으며, 일정 quality 이상의 G-DNA를 대상으로 300bp insert size의 paired end library 구축하고 표고 표준유전체 정보를 기준으로 100-150X depth의 Illumina Hiseq 데이터를 생산하였다. 생산된 read는 Phred score 30 이상, read length 100bp 이상의 조건으로 선별하고, 세균이나 바이러스 데이터베이스에 맵핑 작업을 통해 사후 분석에 불필요한 정보를 제거하는 정제 과정 수행하였다. 표고버섯 공시균주의 NGS데이터 생산 결과는 표 1에 나타내었다.Species identification of the sample was confirmed through molecular phylogenetic analysis, nucleic acid extraction and QC for each sample were performed, and a paired end library of 300bp insert size was constructed targeting G-DNA of a certain quality or higher, and 100 based on the standard genomic information at the elevation. Illumina Hiseq data of -150X depth were produced. Produced reads were selected under the conditions of Phred score of 30 or more and read length of 100 bp or more, and a purification process was performed to remove unnecessary information for post-analysis through mapping to bacterial or viral databases. Table 1 shows the results of NGS data production of the Shiitake mushroom test strain.

Figure pat00001
Figure pat00001

<실시예 2> 표고버섯 품종별 특이 유전변이 탐색<Example 2> Search for specific genetic variation by shiitake mushroom variety

도 1을 참조하여 표고버섯 품종별 특이 유전변이 탐색과 분자 마커를 설계하였다. 핵산 표준유전체로서 L. edodes B17 ver2 (Chen et al. 2016. PLos One 1 (8): e0160336) 정보를 활용하고, 미토콘드리아 표준유전체로서 NC_018365 (https://www.ncbi.nlm.nih.gov/nuccore/ 400201826)를 선발하였다. 이어서, Trimmomatic을 이용하여 어댑터 시퀀스를 가지거나, Phred Score 20 이하이거나, 길이 50bp 이하의 리드를 한 번 더 배제하였다. Burrows-Wheeler transform (BWT) 알고리즘에 의하여 Hiseq 리드를 각각의 레퍼런스 유전체 정보에 정렬하였다. Samtools mpileup을 통하여 가능한 모든 genotype의 likelihood를 계산하고 가장 신뢰도 높은 SNP와 Indel을 선발하였다. Picard 툴을 이용하여 PCR duplicate나 다중 맵핑된 리드들을 제거하였고, GATK HaplotypeCaller를 이용하여 indel 주변의 local realignment를 실시하여 잘못 맵핑된 부분을 수정하였다. 유전변이가 발견된 부위는 SnpEff 툴을 이용하여 어노테이션 (annotation)하였다. 샘플별 시퀀싱 read의 맵핑율과 커버리지는 표 2에 나타내었다.Referring to FIG. 1, specific genetic variation search and molecular markers for each shiitake mushroom variety were designed. L. edodes B17 ver2 (Chen et al. 2016. PLos One 1 (8): e0160336) information was used as a nucleic acid reference genome, and NC_018365 (https://www.ncbi.nlm.nih.gov/) was used as a mitochondrial reference genome. nuccore/ 400201826) was selected. Then, using Trimmomatic, reads having an adapter sequence, Phred Score 20 or less, or a length of 50 bp or less were excluded once more. Hiseq reads were aligned to each reference genome information by the Burrows-Wheeler transform (BWT) algorithm. The likelihood of all possible genotypes was calculated through Samtools mpileup, and the most reliable SNPs and Indels were selected. PCR duplicates or multiple mapped reads were removed using the Picard tool, and local realignment around the indel was performed using GATK HaplotypeCaller to correct the mis-mapped part. The region where the genetic mutation was found was annotated using the SNPEff tool. Table 2 shows the mapping rate and coverage of sequencing reads for each sample.

Figure pat00002
Figure pat00002

<실시예 3> 품종 특이적 CAPS 마커 설계<Example 3> Varieties-specific CAPS marker design

기존에 확보한 NGS 데이터를 기반으로 bwa 맵핑을 시도하고 picard 프로그램에서 소팅하여 샘플별 특이적인 단일염기서열변이 후보군을 선발하였다. 10개의 균주에서 발굴한 SNP 개수는 표 3에 나타내었다.Based on the previously obtained NGS data, bwa mapping was attempted, and a sample-specific single nucleotide sequence mutation candidate group was selected by sorting in the picard program. The number of SNPs discovered in 10 strains is shown in Table 3.

샘플 (품종명)Sample (variety name) SNP#SNP# 샘플 (품종명)Sample (variety name) SNP#SNP# OK229 (참아람)OK229 (Cham Aram) 66개66 pieces OK234 (산조108호)OK234 (Sanjo 108) 2,263개2,263 OK230 (산조708호)OK230 (Sanjo 708) 1,078개1,078 OK255 (모리290)OK255 (Mori 290) 2개2 OK231 (산조707호)OK231 (Sanjo 707) 706개706 OK256 (유지로)OK256 (with maintenance) 699개699 pieces OK232 (산조302호)OK232 (Sanjo 302) 601개601 pieces OK563 (향고808)OK563 (Hyanggo 808) 648개648 pieces OK233 (산조701호)OK233 (Sanjo 701) 151개151 OK564 (추재2호)OK564 (Paperwood No. 2) 4,690개4,690 pieces 총합total 10,904개10,904 pieces

상기 표 3의 SNP를 포함하면서 증폭산물의 길이가 300-600bp 정도로서 극단적인 Tm 값을 갖지 않고 (약 40~60℃ 범위), 증폭산물에 단일 제한효소로 절단되는 부분을 포함한 마커 후보군을 선발하였다. 이어서, Primer3 프로그램을 이용하여 SNP 부위 주변을 증폭할 수 있는 프라이머 쌍을 설계하였다. 본 발명에서 설계된 프라이머 쌍은 표 4에 나타내었다.While including the SNP of Table 3, the length of the amplification product was about 300-600 bp, and it did not have an extreme Tm value (range of about 40 to 60° C.), and a marker candidate group including a portion cut by a single restriction enzyme in the amplification product was selected. . Then, a primer pair capable of amplifying around the SNP site was designed using the Primer3 program. The primer pairs designed in the present invention are shown in Table 4.

서열번호SEQ ID NO: 마커marker 제한효소restriction enzyme 품종kind 프라이머 염기서열primer sequence SizeSize 1One AccI_229_02_LAccI_229_02_L AccI (Xmil)AccI (Xmil) 참아람patience leftleft CCAGTATGTCTTCAGCTCATCACCAGTATGTCTTCAGCTCATCA 582582 22 AccI_229_02_RAccI_229_02_R rightright TAGAGAACAGCTAACCCACCATTAGAGAACAGCTAACCCACCAT 33 AvaII_229_03_LAvaII_229_03_L AvaII (Eco48I)AvaII (Eco48I) 참아람patience leftleft GGAAGAAACATAGCATTGAAGCGGAAGAAACATAGCATTGAAGC 648648 44 AvaII_229_03_RAvaII_229_03_R rightright CATGATTATCGAGAGCTTGTGACATGATTATCGAGAGCTTGTGA 55 AfeI_230_01_LAfeI_230_01_L AfeIAfeI 산조
708호sanjo
708 leftleft CAATAATAAGCGCAAATTCCTCCAATAATAAGCGCAAATTCCTC 591591 66 AfeI_230_01_RAfeI_230_01_R rightright TATGTCCAACCAGGGTTTAGTCTATGTCCAACCAGGGTTTAGTC 77 NcoI_230_04_LNcoI_230_04_L NcoINcoI 산조
708호sanjo
708 leftleft GAGCATCCTATTCTATGCGAACGAGCATCCTATTCTATGCGAAC 372372 88 NcoI_230_04_RNcoI_230_04_R rightright CATCATATGTAATGATGCGGACCATCATATGTAATGATGCGGAC 99 AvaII_231_LAvaII_231_L AvaII (Eco48I)AvaII (Eco48I) 산조
707호sanjo
707 leftleft ACCTGTTCCATTAGTTCCTGTGACCTGTTCCATTAGTTCCTGTG 306306 1010 AvaII_231_RAvaII_231_R rightright TTCAGAAAGCTAAGCACAAACATTCAGAAAGCTAAGCACAAACA 1111 BfaI_231_02_LBfaI_231_02_L BfaI (FspBI)BfaI (FspBI) 산조
707호sanjo
707 leftleft TTGAGTACTGATTTGAACGTCGTTGAGTACTGATTTGAACGTCG 579579 1212 BfaI_231_02_RBfaI_231_02_R rightright CGCCTACATATATTGGGTCACTCGCCTACATATATTGGGTCACT 1313 AccI_232_LAccI_232_L AccI (Xmil)AccI (Xmil) 산조
302호sanjo
302 leftleft CAATGTCATCATATCACTTGCCCAATGTCATCATATCACTTGCC 472472 1414 AccI_232_RAccI_232_R rightright AACAGCAGAACTCCAACAATCTAACAGCAGAACTCCAACAATCT 1515 AvaII_232_LAvaII_232_L AvaII (Eco48I)AvaII (Eco48I) 산조
302호sanjo
302 leftleft AACCAAACAGCAAGTATGATCCAACCAAACAGCAAGTATGATCC 616616 1616 AvaII_232_RAvaII_232_R rightright ACGCTGCATTGAAGGTACTATTACGCTGCATTGAAGGTACTATT 1717 BfaI_232_01_LBfaI_232_01_L BfaI (FspBI)BfaI (FspBI) 산조
302호sanjo
302 leftleft ATAGTACGCGCCAGTCATATTTATAGTACGCGCCAGTCATATTT 654654 1818 BfaI_232_01_RBfaI_232_01_R rightright AATTTATCGACAAAGCCAGAAAAATTTATCGACAAAGCCAGAAA 1919 AvaI_233_01_LAvaI_233_01_L AvaI (Eco88I)AvaI (Eco88I) 산조
701호sanjo
701 leftleft CCACTCCCTATCTATTCCTTCCCCACTCCCTATTCTATTCCTTCC 581581 2020 AvaI_233_01_RAvaI_233_01_R rightright TGGAAGGCTCCTAGATCAATAATGGAAGGCTCCTAGATCAATAA 2121 BfaI_233_02_LBfaI_233_02_L BfaI (FspBI)BfaI (FspBI) 산조
701호sanjo
701 leftleft TATCCAACAACAACAAGAGCAGTATCCAACAACAACAAGAGCAG 458458 2222 BfaI_233_02_RBfaI_233_02_R rightright GATCAAAGTCGGATCATCGTATGATCAAAGTCGGATCATCGTAT 2323 AvaII_234_LAvaII_234_L AvaII (Eco48I)AvaII (Eco48I) 산조
108호sanjo
108 leftleft AAGATGAGCAATTGAGACTGGTAAGATGAGCAATTGAGACTGGT 506506 2424 AvaII_234_RAvaII_234_R rightright CATACTATCCATTACAGCCGGTCATACTATCCATTACAGCCGGT 2525 AfeI_234_04_LAfeI_234_04_L AfeIAfeI 산조
108호sanjo
108 leftleft TTTGAAGAACATCCCTTTCAGTTTTGAAGAACATCCCTTTCAGT 517517 2626 AfeI_234_04_RAfeI_234_04_R rightright CCTTCCTTCAGCGTAACTACAGCCTTCCTTCAGCGTAACTACAG 2727 NcoI_234_04_LNcoI_234_04_L NcoINcoI 산조
108호sanjo
108 leftleft TGCTCTACTTCGGGTTGTAAGTTGCTCTACTTCGGGTTGTAAGT 594594 2828 NcoI_234_04_RNcoI_234_04_R rightright GAGTTCATTGACGAGACAGACAGAGTTCATTGACGAGACAGACA 2929 ClaI_234_01_LClaI_234_01_L ClaIClaI 산조
108호sanjo
108 leftleft TCGAGAATGGCTTCTATGAGTTTCGAGAATGGCTTCTATGAGTT 642642 3030 ClaI_234_01_RClaI_234_01_R rightright TGTATATGTAGTGGCACACGGTTGTATATGTAGTGGCACACGGT 3131 BfaI_234_07_LBfaI_234_07_L BfaI (FspBI)BfaI (FspBI) 산조
108호sanjo
108 leftleft TGTCATTGACGGACTTATTGAATGTCATTGACGGACTTATTGAA 331331 3232 BfaI_234_07_RBfaI_234_07_R rightright AACATGCGCATAACAGTGTAAGAACATGCGCATAACAGTGTAAG 3333 NcoI_255_LNcoI_255_L NcoINcoI 모리
290Mori
290 leftleft GATCATTAGTCCCAATCCAAGAGATCATTAGTCCCAATCCAAGA 343343 3434 NcoI_255_RNcoI_255_R rightright GTTACATTCCGTGGTCGATAGTGTTACATTCCGTGGTCGATAGT 3535 AccI_256_LAccI_256_L AccI (Xmil)AccI (Xmil) 유지로with maintenance leftleft CAGTGACATATGACGGTGTAGGCAGTGACATATGACGTGTGTAGG 453453 3636 AccI_256_RAccI_256_R rightright CTCTCAACTCGTTTCAACATGACTCTCAACTCGTTTCAACATGA 3737 BfaI_563_01_LBfaI_563_01_L BfaI (FspBI)BfaI (FspBI) 향고
808incense
808 leftleft CATCGTCCTTGTTGTACTTGAACATCGTCCTTGTTGTACTTGAA 308308 3838 BfaI_563_01_RBfaI_563_01_R rightright TGGTATGCATTATCTCCCTTTCTGGTATGCATTATCTCCCTTTC 3939 BanII_564_12_LBanII_564_12_L BanII (Eco24I)BanII (Eco24I) 추재
2호autumn wood
No. 2 leftleft TGCTCAGTTCTTCAACATTGTCTGCTCAGTTCTTCAACATTGTC 427427 4040 BanII_564_12_RBanII_564_12_R rightright AGTCAGGAGAGAGGATGTACGAAGTCAGGAGAGAGGATGTACGA 4141 AccI_564_06_LAccI_564_06_L AccI (Xmil)AccI (Xmil) 추재
2호autumn wood
No. 2 leftleft TATTTCCCAGGCTGTTGATAGTTATTTCCCAGGCTGTTGATAGT 546546 4242 AccI_564_06_RAccI_564_06_R rightright GGCATAACAATCAAGTCCATTTGGCATAACAATCAAGTCCATTT 4343 ClaI_564_08_LClaI_564_08_L ClaI (Bsu17I)ClaI (Bsu17I) 추재
2호autumn wood
No. 2 leftleft TTTCTCCCTGACTTTGAAGTGTTTTCTCCCTGACTTTGAAGTGT 540540 4444 ClaI_564_08_RClaI_564_08_R rightright GAGATGTCGGTCATAGGATGTTGAGATGTCGGTCATAGGATGTT 4545 BfaI_564_04_LBfaI_564_04_L BfaI (FspBI)BfaI (FspBI) 추재
2호autumn wood
No. 2 leftleft CGAAGAAATGGGTCTAAAGTTGCGAAGAAATGGGTCTAAAGTTG 377377 4646 BfaI_564_04_RBfaI_564_04_R rightright GCCTATAGATTGTTTGAATCGCGCCTATAGATTGTTTGAATCGC

<실시예 4> 표고버섯 품종별 CAPS 마커 적용 결과<Example 4> CAPS marker application result for each shiitake mushroom variety

각 품종별로 상기 표 4의 프라이머 및 제한효소를 이용하여 유전자증폭반응 (PCR)을 실시하였으며, 증폭산물에 대한 제한효소 반응은 제공사의 매뉴얼에 따라 수행하였다. 증폭 및 절단 반응의 확인을 위하여 아가로스겔 전기영동을 실시하였으며 그 결과는 도 2 내지 도 11에 나타내었다.For each variety, a gene amplification reaction (PCR) was performed using the primers and restriction enzymes in Table 4, and the restriction enzyme reaction for the amplification product was performed according to the manufacturer's manual. Agarose gel electrophoresis was performed to confirm amplification and cleavage reactions, and the results are shown in FIGS. 2 to 11 .

도 2 내지 도 11에 나타낸 바와 같이, 참아람 품종 특이적 프라이머 쌍을 이용하여 증폭 반응을 수행하고, 전기영동으로 증폭 산물의 크기를 분석한 결과, 참아람 품종 (229) 특이적인 마커 (서열번호 1 및 2, 서열번호 3 및 4)의 경우, 참아람 품종 이외 품종은 아가로스 겔 상에서 한 가지 크기의 band만 관찰된 반면에 참아람 품종은 제한효소에 의해 절단되어 두 가지 크기의 band가 관찰되었다. 참아람 품종은 제한효소 AccI에 의해 절단되는 경우 582 bp, 제한효소 AvaII에 의해 절단되는 경우 648 bp 크기의 특이적인 band가 관찰되었다. 마찬가지로, 산조708호, 산조707호, 산조302호, 산조701호, 산조108호, 모리290, 유지로, 향고808 또는 추재2호 품종 특이적인 마커를 사용하여 증폭 산물의 크기를 분석 한 결과, 각 품종의 특이적인 마커는 타겟 품종만 특이적으로 절단하여 해당 품종에서만 두 가지 크기의 band가 관찰되었으며, 이외 다른 품종은 한 가지 크기의 band만이 관찰되었다.As shown in FIGS. 2 to 11, an amplification reaction was performed using a pair of primers specific to the Chamaram variety, and the size of the amplification product was analyzed by electrophoresis. As a result, the Chamaram variety (229) specific marker (SEQ ID NO: In the case of 1 and 2, SEQ ID NOs: 3 and 4), only one size band was observed on the agarose gel in varieties other than Chamaram varieties, whereas in the Chamaram varieties, bands of two sizes were observed after being cut by a restriction enzyme. became In the Chamaram variety, a specific band with a size of 582 bp when cut by the restriction enzyme AccI and 648 bp in size when cut by the restriction enzyme AvaII was observed. Similarly, as a result of analyzing the size of amplification products using specific markers for Sanjo 708, Sanjo 707, Sanjo 302, Sanjo 701, Sanjo 108, Mori 290, Yujiro, Hyanggo 808, or Chujae 2 varieties, As for the specific marker of each breed, only the target breed was specifically cut, and bands of two sizes were observed only in the corresponding breed, and bands of one size were observed in other breeds.

이러한 결과는 본 발명에서 설계된 CAPS 마커는 표고버섯 품종별로 다른 품종과 구별할 수 있으며, 상기 각 품종별 CAPS 마커를 종합하여 사용할 경우 표고버섯의 품종을 신속하고 정확하게 판별할 수 있다는 것을 의미한다.These results mean that the CAPS markers designed in the present invention can be distinguished from other varieties for each shiitake mushroom variety, and when the CAPS markers for each variety are used collectively, the shiitake mushroom varieties can be quickly and accurately determined.

이상에서 살펴본 바와 같이, 본 발명의 구체적인 실시예를 상세하게 설명되었으나, 본 발명의 사상을 이해하는 당업자는 동일한 사상의 범위 내에서 다른 구성요소를 추가, 변경, 삭제 등을 통하여, 퇴보적인 다른 발명이나 본 발명 사상의 범위 내에 포함되는 다른 실시예를 용이하게 제안할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다. 본 발명의 범위는 상술한 상세한 설명보다는 후술하는 특허청구의 범위에 의하여 나타내어지며, 특허청구의 범위의 의미 및 범위 그리고 그 균등 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.As described above, although specific embodiments of the present invention have been described in detail, those skilled in the art who understand the spirit of the present invention may add, change, delete, etc. other components within the scope of the same spirit, and other degenerate inventions However, other embodiments included within the scope of the present invention may be easily proposed. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention is indicated by the claims described later rather than the above detailed description, and all changes or modifications derived from the meaning and scope of the claims and their equivalents are included in the scope of the present invention. should be interpreted as

<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Development of CAPS marker for discrimination of Lentinula edodes culivar and use thereof <130> 2022-0154-10-C <160> 46 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AccI_229_02_L <400> 1 ccagtatgtc ttcagctcat ca 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AccI_229_02_R <400> 2 tagagaacag ctaacccacc at 22 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AvaII_229_03_L <400> 3 ggaagaaaca tagcattgaa gc 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AvaII_229_03_R <400> 4 catgattatc gagagcttgt ga 22 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AfeI_230_01_L <400> 5 caataataag cgcaaattcc tc 22 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AfeI_230_01_R <400> 6 tatgtccaac cagggtttag tc 22 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NcoI_230_04_L <400> 7 gagcatccta ttctatgcga ac 22 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NcoI_230_04_R <400> 8 catcatatgt aatgatgcgg ac 22 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AvaII_231_L <400> 9 acctgttcca ttagttcctg tg 22 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AvaII_231_R <400> 10 ttcagaaagc taagcacaaa ca 22 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BfaI_231_02_L <400> 11 ttgagtactg atttgaacgt cg 22 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BfaI_231_02_R <400> 12 cgcctacata tattgggtca ct 22 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AccI_232_L <400> 13 caatgtcatc atatcacttg cc 22 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AccI_232_R <400> 14 aacagcagaa ctccaacaat ct 22 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AvaII_232_L <400> 15 aaccaaacag caagtatgat cc 22 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AvaII_232_R <400> 16 acgctgcatt gaaggtacta tt 22 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BfaI_232_01_L <400> 17 atagtacgcg ccagtcatat tt 22 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BfaI_232_01_R <400> 18 aatttatcga caaagccaga aa 22 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AvaI_233_01_L <400> 19 ccactcccta tctattcctt cc 22 <210> 20 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AvaI_233_01_R <400> 20 tggaaggctc ctagatcaat aa 22 <210> 21 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BfaI_233_02_L <400> 21 tatccaacaa caacaagagc ag 22 <210> 22 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BfaI_233_02_R <400> 22 gatcaaagtc ggatcatcgt at 22 <210> 23 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AvaII_234_L <400> 23 aagatgagca attgagactg gt 22 <210> 24 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AvaII_234_R <400> 24 catactatcc attacagccg gt 22 <210> 25 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AfeI_234_04_L <400> 25 tttgaagaac atccctttca gt 22 <210> 26 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AfeI_234_04_R <400> 26 ccttccttca gcgtaactac ag 22 <210> 27 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NcoI_234_04_L <400> 27 tgctctactt cgggttgtaa gt 22 <210> 28 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NcoI_234_04_R <400> 28 gagttcattg acgagacaga ca 22 <210> 29 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ClaI_234_01_L <400> 29 tcgagaatgg cttctatgag tt 22 <210> 30 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ClaI_234_01_R <400> 30 tgtatatgta gtggcacacg gt 22 <210> 31 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BfaI_234_07_L <400> 31 tgtcattgac ggacttattg aa 22 <210> 32 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BfaI_234_07_R <400> 32 aacatgcgca taacagtgta ag 22 <210> 33 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NcoI_255_L <400> 33 gatcattagt cccaatccaa ga 22 <210> 34 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NcoI_255_R <400> 34 gttacattcc gtggtcgata gt 22 <210> 35 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AccI_256_L <400> 35 cagtgacata tgacggtgta gg 22 <210> 36 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AccI_256_R <400> 36 ctctcaactc gtttcaacat ga 22 <210> 37 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BfaI_563_01_L <400> 37 catcgtcctt gttgtacttg aa 22 <210> 38 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BfaI_563_01_R <400> 38 tggtatgcat tatctccctt tc 22 <210> 39 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BanII_564_12_L <400> 39 tgctcagttc ttcaacattg tc 22 <210> 40 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BanII_564_12_R <400> 40 agtcaggaga gaggatgtac ga 22 <210> 41 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AccI_564_06_L <400> 41 tatttcccag gctgttgata gt 22 <210> 42 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AccI_564_06_R <400> 42 ggcataacaa tcaagtccat tt 22 <210> 43 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ClaI_564_08_L <400> 43 tttctccctg actttgaagt gt 22 <210> 44 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ClaI_564_08_R <400> 44 gagatgtcgg tcataggatg tt 22 <210> 45 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BfaI_564_04_L <400> 45 cgaagaaatg ggtctaaagt tg 22 <210> 46 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BfaI_564_04_R <400> 46 gcctatagat tgtttgaatc gc 22 <110> REPUBLIC OF KOREA (MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Development of CAPS marker for discrimination of Lentinula edodes culiva and use thereof <130> 2022-0154-10-C <160> 46 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AccI_229_02_L <400> 1 ccagtatgtc ttcagctcat ca 22 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AccI_229_02_R <400> 2 tagagaacag ctaacccacc at 22 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AvaII_229_03_L <400> 3 ggaagaaaca tagcattgaa gc 22 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AvaII_229_03_R <400> 4 catgattatc gagagcttgt ga 22 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AfeI_230_01_L <400> 5 caataataag cgcaaattcc tc 22 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AfeI_230_01_R <400> 6 tatgtccaac cagggtttag tc 22 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NcoI_230_04_L <400> 7 gagcatccta ttctatgcga ac 22 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NcoI_230_04_R <400> 8 catcatatgt aatgatgcgg ac 22 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AvaII_231_L <400> 9 acctgttcca ttagttcctg tg 22 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AvaII_231_R <400> 10 ttcagaaagc taagcacaaa ca 22 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BfaI_231_02_L <400> 11 ttgagtactg atttgaacgt cg 22 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BfaI_231_02_R <400> 12 cgcctacata tattgggtca ct 22 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AccI_232_L <400> 13 caatgtcatc atatcacttg cc 22 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AccI_232_R <400> 14 aacagcagaa ctccaacaat ct 22 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AvaII_232_L <400> 15 aaccaaacag caagtatgat cc 22 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AvaII_232_R <400> 16 acgctgcatt gaaggtacta tt 22 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BfaI_232_01_L <400> 17 atagtacgcg ccagtcatat tt 22 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BfaI_232_01_R <400> 18 aatttatcga caaagccaga aa 22 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AvaI_233_01_L <400> 19 ccactcccta tctattcctt cc 22 <210> 20 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AvaI_233_01_R <400> 20 tggaaggctc ctagatcaat aa 22 <210> 21 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BfaI_233_02_L <400> 21 tatccaacaa caacaagagc ag 22 <210> 22 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BfaI_233_02_R <400> 22 gatcaaagtc ggatcatcgt at 22 <210> 23 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AvaII_234_L <400> 23 aagatgagca attgagactg gt 22 <210> 24 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AvaII_234_R <400> 24 catactatcc attacagccg gt 22 <210> 25 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AfeI_234_04_L <400> 25 tttgaagaac atccctttca gt 22 <210> 26 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AfeI_234_04_R <400> 26 ccttccttca gcgtaactac ag 22 <210> 27 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NcoI_234_04_L <400> 27 tgctctactt cgggttgtaa gt 22 <210> 28 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NcoI_234_04_R <400> 28 gagttcattg acgagacaga ca 22 <210> 29 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ClaI_234_01_L <400> 29 tcgagaatgg cttctatgag tt 22 <210> 30 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ClaI_234_01_R <400> 30 tgtatatgta gtggcacacg gt 22 <210> 31 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BfaI_234_07_L <400> 31 tgtcattgac ggacttattg aa 22 <210> 32 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BfaI_234_07_R <400> 32 aacatgcgca taacagtgta ag 22 <210> 33 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NcoI_255_L <400> 33 gatcattagt cccaatccaa ga 22 <210> 34 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> NcoI_255_R <400> 34 gttacattcc gtggtcgata gt 22 <210> 35 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AccI_256_L <400> 35 cagtgacata tgacggtgta gg 22 <210> 36 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AccI_256_R <400> 36 ctctcaactc gtttcaacat ga 22 <210> 37 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BfaI_563_01_L <400> 37 catcgtcctt gttgtacttg aa 22 <210> 38 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BfaI_563_01_R <400> 38 tggtatgcat tatctccctt tc 22 <210> 39 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BanII_564_12_L <400> 39 tgctcagttc ttcaacattg tc 22 <210> 40 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BanII_564_12_R <400> 40 agtcaggaga gaggatgtac ga 22 <210> 41 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AccI_564_06_L <400> 41 tatttcccag gctgttgata gt 22 <210> 42 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> AccI_564_06_R <400> 42 ggcataacaa tcaagtccat tt 22 <210> 43 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ClaI_564_08_L <400> 43 tttctccctg actttgaagt gt 22 <210> 44 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> ClaI_564_08_R <400> 44 gagatgtcgg tcataggatg tt 22 <210> 45 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BfaI_564_04_L <400> 45 cgaagaaatg ggtctaaagt tg 22 <210> 46 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BfaI_564_04_R <400> 46 gcctatagat tgtttgaatc gc 22

Claims (6)

서열번호 13 및 14의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 서열번호 15 및 16의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 서열번호 17 및 18의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 서열번호 23 및 24의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 서열번호 25 및 26의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 서열번호 27 및 28의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 서열번호 29 및 30의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 서열번호 31 및 32의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 서열번호 33 및 34의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 및 서열번호 35 및 36의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍;으로 이루어진 프라이머 세트, 제한효소 및 증폭 반응을 수행하기 위한 시약을 포함하는, 원목재배용 표고버섯 품종 판별용 키트에서,
상기 원목재배용 표고버섯 품종은, 산조302호, 산조108호, 모리290, 유지로이고,
상기 제한효소는, AccI, AvaII, AfeI, BfaI, ClaI, NcoI 중 선택되는 어느 하나 이상인 것인, 키트.
an oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 13 and 14; an oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 15 and 16; a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 17 and 18; a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 23 and 24; a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 25 and 26; a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 27 and 28; a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 29 and 30; a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 31 and 32; a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 33 and 34; And oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 35 and 36; in a kit for identifying shiitake mushroom varieties for log cultivation, comprising a primer set consisting of, a restriction enzyme and a reagent for performing an amplification reaction,
The shiitake mushroom varieties for log cultivation are Sanjo 302, Sanjo 108, Mori 290, Yujiro,
The restriction enzyme, AccI, AvaII, AfeI, BfaI, ClaI, will any one or more selected from NcoI, the kit.
 제1항에 있어서,
상기 증폭 반응을 수행하기 위한 시약은, dNTPs (deoxynulceotide triphosphate), DNA 중합효소 (polymerase) 및 버퍼를 포함하는 것인, 키트.
According to claim 1,
The reagent for performing the amplification reaction, dNTPs (deoxynulceotide triphosphate), the kit comprising a DNA polymerase (polymerase) and a buffer.
 서열번호 13 및 14의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 서열번호 15 및 16의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 서열번호 17 및 18의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 서열번호 23 및 24의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 서열번호 25 및 26의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 서열번호 27 및 28의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 서열번호 29 및 30의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 서열번호 31 및 32의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 서열번호 33 및 34의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍; 및 서열번호 35 및 36의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍;으로 이루어진 프라이머 세트를 포함하는, 원목재배용 표고버섯 품종 판별을 위한 CAPS (cleaved amplified polymorphic sequences) 마커 증폭용 프라이머 세트에서,
상기 원목재배용 표고버섯 품종은, 산조302호, 산조108호, 모리290, 유지로인 것인, 프라이머 세트.
an oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 13 and 14; an oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 15 and 16; a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 17 and 18; a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 23 and 24; a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 25 and 26; a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 27 and 28; a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 29 and 30; a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 31 and 32; a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 33 and 34; And in the primer set for cleaved amplified polymorphic sequences (CAPS) marker amplification for identifying shiitake mushroom varieties for log cultivation, comprising a primer set consisting of a pair of oligonucleotide primers represented by the nucleotide sequences of SEQ ID NOs: 35 and 36,
The shiitake mushroom varieties for log cultivation are Sanjo No. 302, Sanjo No. 108, Mori 290, Yujiro, a primer set.
 제3항에 있어서,
상기 CAPS 마커는 제한효소에 의해 특이적인 절단이 일어날 수 있는 부위를 프라이머로 증폭하는 것을 특징으로 하는, CAPS (cleaved amplified polymorphic sequences) 마커 증폭용 프라이머 세트.
4. The method of claim 3,
The CAPS marker is a primer set for amplifying a CAPS (cleaved amplified polymorphic sequences) marker, characterized in that the primer amplifies a site where specific cleavage can occur by a restriction enzyme.
 표고버섯 시료에서 게놈 DNA를 분리하는 1단계;
상기 분리된 게놈 DNA를 주형으로 하고, 제3항의 프라이머 세트를 이용해 증폭 반응을 수행하여 표적 서열을 증폭하는 2단계;
상기 증폭 단계의 산물을 제한효소로 절단하는 3단계;
상기 절단 산물을 전기영동하여 밴드(band)의 크기를 분석하는 4단계; 및
두 가지 크기의 밴드가 관찰되면 해당 품종의 표고버섯으로 판별하는 5단계;를 포함하는, 원목재배용 표고버섯 품종 판별 방법에서,
상기 원목재배용 표고버섯 품종은, 산조302호, 산조108호, 모리290, 유지로이고,
상기 제한효소는, AccI, AvaII, AfeI, BfaI, ClaI, NcoI 중 선택되는 어느 하나 이상인 것인, 방법.
Step 1 of isolating genomic DNA from the shiitake mushroom sample;
a second step of amplifying the target sequence by using the isolated genomic DNA as a template and performing an amplification reaction using the primer set of claim 3;
Step 3 of cutting the product of the amplification step with a restriction enzyme;
Step 4 of analyzing the size of the band by electrophoresis of the cleavage product; and
In the method for identifying shiitake mushroom varieties for log cultivation, including; step 5 of determining that the shiitake mushroom is of the corresponding variety when two sizes of bands are observed,
The shiitake mushroom varieties for log cultivation are Sanjo 302, Sanjo 108, Mori 290, Yujiro,
The method of claim 1, wherein the restriction enzyme is at least one selected from among AccI, AvaII, AfeI, BfaI, ClaI, and NcoI.
 제5항에 있어서,
상기 방법은,
(1) 서열번호 13 및 14의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍을 사용하여 표적 서열을 증폭시키고, AccI 제한효소를 사용하여 밴드가 절단되는 경우 산조302호로 판별하고,
(2) 서열번호 15 및 16의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍을 사용하여 표적 서열을 증폭시키고, AvaII 제한효소를 사용하여 밴드가 절단되는 경우 산조302호로 판별하고,
(3) 서열번호 17 및 18의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍을 사용하여 표적 서열을 증폭시키고, BfaI 제한효소를 사용하여 밴드가 절단되는 경우 산조302호로 판별하고,
(4) 서열번호 23 및 24의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍을 사용하여 표적 서열을 증폭시키고, AvaII 제한효소를 사용하여 밴드가 절단되는 경우 산조108호로 판별하고,
(5) 서열번호 25 및 26의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍을 사용하여 표적 서열을 증폭시키고, AfeI 제한효소를 사용하여 밴드가 절단되는 경우 산조108호로 판별하고,
(6) 서열번호 27 및 28의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍을 사용하여 표적 서열을 증폭시키고, NcoI 제한효소를 사용하여 밴드가 절단되는 경우 산조108호로 판별하고,
(7) 서열번호 29 및 30의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍을 사용하여 표적 서열을 증폭시키고, ClaI 제한효소를 사용하여 밴드가 절단되는 경우 산조108호로 판별하고,
(8) 서열번호 31 및 32의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍을 사용하여 표적 서열을 증폭시키고, BfaI 제한효소를 사용하여 밴드가 절단되는 경우 산조108호로 판별하고,
(9) 서열번호 33 및 34의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍을 사용하여 표적 서열을 증폭시키고, NcoI 제한효소를 사용하여 밴드가 절단되는 경우 모리290로 판별하고,
(10) 서열번호 35 및 36의 염기서열로 표시되는 올리고뉴클레오티드 프라이머 쌍을 사용하여 표적 서열을 증폭시키고, AccI 제한효소를 사용하여 밴드가 절단되는 경우 유지로 품종으로 판별하는 것인, 방법.6. The method of claim 5,
The method is
(1) Amplify the target sequence using an oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 13 and 14, and when the band is cut using an AccI restriction enzyme, it is determined as Sanjo No. 302,
(2) Amplify the target sequence using the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 15 and 16, and when the band is cut using AvaII restriction enzyme, it is determined as Sanjo No. 302,
(3) Amplify the target sequence using the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 17 and 18, and when the band is cut using a BfaI restriction enzyme, it is determined as Sanjo No. 302,
(4) Amplify the target sequence using the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 23 and 24, and when the band is cut using AvaII restriction enzyme, it is determined as Sanjo No. 108,
(5) Amplify the target sequence using the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 25 and 26, and when the band is cut using AfeI restriction enzyme, it is determined as Sanjo No. 108,
(6) Amplify the target sequence using the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 27 and 28, and when the band is cut using NcoI restriction enzyme, it is determined as Sanjo No. 108,
(7) Amplify the target sequence using the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 29 and 30, and when the band is cut using ClaI restriction enzyme, it is determined as Sanjo No. 108,
(8) Amplify the target sequence using the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 31 and 32, and when the band is cut using a BfaI restriction enzyme, it is determined as Sanjo No. 108,
(9) Amplify the target sequence using the oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 33 and 34, and when the band is cut using NcoI restriction enzyme, it is determined as Mori 290,
(10) Amplifying the target sequence using an oligonucleotide primer pair represented by the nucleotide sequences of SEQ ID NOs: 35 and 36, and discriminating as a variety by oil when the band is cut using an AccI restriction enzyme.
KR1020220061925A 2020-12-16 2022-05-20 Development of CAPS marker for discrimination of Lentinula edodes for log cultivation cultivar and use thereof KR102487647B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020220061925A KR102487647B1 (en) 2020-12-16 2022-05-20 Development of CAPS marker for discrimination of Lentinula edodes for log cultivation cultivar and use thereof

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020200176054A KR102496779B1 (en) 2020-12-16 2020-12-16 Development of CAPS marker for discrimination of Lentinula edodes for cultivation on sawdust medium cultivar and use thereof
KR1020220061925A KR102487647B1 (en) 2020-12-16 2022-05-20 Development of CAPS marker for discrimination of Lentinula edodes for log cultivation cultivar and use thereof

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
KR1020200176054A Division KR102496779B1 (en) 2020-12-16 2020-12-16 Development of CAPS marker for discrimination of Lentinula edodes for cultivation on sawdust medium cultivar and use thereof

Publications (2)

Publication Number Publication Date
KR20220086526A true KR20220086526A (en) 2022-06-23
KR102487647B1 KR102487647B1 (en) 2023-01-12

Family

ID=82222012

Family Applications (3)

Application Number Title Priority Date Filing Date
KR1020200176054A KR102496779B1 (en) 2020-12-16 2020-12-16 Development of CAPS marker for discrimination of Lentinula edodes for cultivation on sawdust medium cultivar and use thereof
KR1020220061926A KR102487648B1 (en) 2020-12-16 2022-05-20 Development of CAPS marker for discrimination of Lentinula edodes for cultivation on chinese medium cultivar and use thereof
KR1020220061925A KR102487647B1 (en) 2020-12-16 2022-05-20 Development of CAPS marker for discrimination of Lentinula edodes for log cultivation cultivar and use thereof

Family Applications Before (2)

Application Number Title Priority Date Filing Date
KR1020200176054A KR102496779B1 (en) 2020-12-16 2020-12-16 Development of CAPS marker for discrimination of Lentinula edodes for cultivation on sawdust medium cultivar and use thereof
KR1020220061926A KR102487648B1 (en) 2020-12-16 2022-05-20 Development of CAPS marker for discrimination of Lentinula edodes for cultivation on chinese medium cultivar and use thereof

Country Status (1)

Country Link
KR (3) KR102496779B1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120103010A (en) * 2011-03-09 2012-09-19 대한민국(관리부서 : 산림청 국립산림과학원장) The distinguishing method of the strain of shiitake using laccase single neclotide ploymorphism marker
KR101834565B1 (en) * 2017-02-23 2018-03-06 충북대학교 산학협력단 CAPS Marker for Differentiation of Shiitake Mushroom Cultivar Sanmaru-1 and use thereof
KR20190008461A (en) 2017-07-13 2019-01-24 산림조합중앙회 SSR Markers for Cultivar Discrimination of Oak mushroom and use thereof
KR101997679B1 (en) * 2018-03-20 2019-07-08 충북대학교 산학협력단 CAPS Marker for Identification of Lentinula edodes Cultivar Sanmaru 2ho and use thereof

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101905980B1 (en) * 2016-09-29 2018-10-08 충북대학교 산학협력단 Primer Sets for Discrimination of Shiitake Mushroom Cultivar Comprising Hyanggo-808, Sanmaru-1 and Sanjo-705 and Use Thereof
KR102299594B1 (en) * 2020-06-02 2021-09-09 충북대학교 산학협력단 Development of CAPS marker for discrimination of shiitake mushroom culivar Sanbaekhyang and use thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120103010A (en) * 2011-03-09 2012-09-19 대한민국(관리부서 : 산림청 국립산림과학원장) The distinguishing method of the strain of shiitake using laccase single neclotide ploymorphism marker
KR101834565B1 (en) * 2017-02-23 2018-03-06 충북대학교 산학협력단 CAPS Marker for Differentiation of Shiitake Mushroom Cultivar Sanmaru-1 and use thereof
KR20190008461A (en) 2017-07-13 2019-01-24 산림조합중앙회 SSR Markers for Cultivar Discrimination of Oak mushroom and use thereof
KR101997679B1 (en) * 2018-03-20 2019-07-08 충북대학교 산학협력단 CAPS Marker for Identification of Lentinula edodes Cultivar Sanmaru 2ho and use thereof

Also Published As

Publication number Publication date
KR102487648B1 (en) 2023-01-12
KR20220085994A (en) 2022-06-23
KR102496779B1 (en) 2023-02-07
KR102487647B1 (en) 2023-01-12
KR20220086527A (en) 2022-06-23

Similar Documents

Publication Publication Date Title
FI112093B (en) Method and test kit for demonstrating genetic identity
KR102032502B1 (en) SNP markers for discriminating color of Flammulina velutipes and use thereof
CN110551844A (en) Sugarcane cultivar genome SSR molecular marker development method and application
KR100898721B1 (en) Method of identification between Hanwoo and foreign beef meats
KR102298723B1 (en) Marker for discrimination of resistance to tomato yellow leaf curl virus and discrimination method using the same marker
KR101382406B1 (en) Primer sets for discrimination of grape cultivars and use thereof
KR102172478B1 (en) DNA marker for discriminating genotype of Chinese cabbage, radish and their intergeneric hybrid and uses thereof
KR102487647B1 (en) Development of CAPS marker for discrimination of Lentinula edodes for log cultivation cultivar and use thereof
JP2013000066A (en) Method for identifying tree species of interspecific hybrid of eucalyptus
KR102377677B1 (en) InDel Markers for Discrimination of Cynanchum wilfordii and Cynanchum auriculatum and Method for Use thereof
KR102524050B1 (en) Molecular marker for discriminating sex of Actinidia arguta and uses thereof
KR102276917B1 (en) EST-SSR primer set for identifying Perilla frutescens cultivar, kit for identifying Perilla frutescens cultivar comprising the same, and method for identifying Perilla frutescens cultivar using the same
KR101677048B1 (en) Apis mellifera specific microsatellite molecular makers and method for determining apis mellifera species using the same
CN112695098A (en) Identification method of Fujian Qing Maojiao chicken species
KR102449286B1 (en) CAPS marker for discriminating new Pyogo mushroom Sulbaekhyang, and use thereof
KR102412793B1 (en) SNP genetic markers and primer sets for discriminating domestic wheat cultivar and uses thereof
KR101972081B1 (en) Markers for classification of fagopyrum tataricum cultivars
CN112111579B (en) Identification method of Tan sheep derived components
KR102275692B1 (en) Marker composition for discriminating aging retarded Chinese cabbage and uses thereof
KR101728893B1 (en) Detecting method for discrimination of solanum commersonii and solanum tuberosum using chloroplast sequence-specific indel marker
WO2023129057A2 (en) Multiplex pcr method for identifying the resistance gene tsw of tomato spotted wilt virus (tswv), and resistance 5 gene l4 of pepper mild mottle virus (pmmov) in pepper (capsicum annuum)
KR101561654B1 (en) Single nucleotide polymorphism marker and detection kit for origin identification of Lycium
KR20240142641A (en) Ssr primers for discriminating waxy corn cultivar saengmyeongchal and uses thereof
KR20240105713A (en) SNP/InDel genetic markers and primer sets for discriminating domestic barley cultivar and uses thereof
KR20220141541A (en) Development of SNP markers and use thereof for discrimination of Pyogo mushroom cultivar Sanjo-701 or Chamaram

Legal Events

Date Code Title Description
A107 Divisional application of patent
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant