KR20220053224A - Cosmetic composition for improving skin elasticity comprising mixed extracts of melaleuca alternifolia leaf, mentha piperita leaf, houttuynia cordata, camellia sinensis leaf, morinda citrifolia and petroselinum sativum as active ingredient - Google Patents

Abstract

The present invention relates to a cosmetic composition containing as an active ingredient a mixed extract of melaleuca alternifolia leaves, mentha piperita leaves, Houttuynia cordata, Camellia sinensis leaves, Morinda citrifolia, and Petroselinum sativum (parsley). More specifically, provided is a cosmetic composition with an excellent skin elasticity improvement effect.

Description

A cosmetic composition for improving skin elasticity, containing a mixed extract of tea tree leaf, peppermint leaf, herbal wheat, green tea, noni and parsley as an active ingredient , CAMELLIA SINENSIS LEAF, MORINDA CITRIFOLIA AND PETROSELINUM SATIVUM AS ACTIVE INGREDIENT}

The present invention relates to a cosmetic composition containing a mixed extract of tea tree leaf, peppermint leaf, yak buckwheat, green tea, noni and parsley as an active ingredient, and more particularly, tea tree leaf, peppermint leaf, yak mulberry, green tea, noni and parsley. It relates to a cosmetic composition for improving skin elasticity having a skin aging improvement effect comprising a mixed extract of

The goal of cosmetics is to maintain beautiful and healthy skin, and to delay the aging of the skin that occurs naturally with aging. In general, aging is caused by oxidative damage to biological materials by free radicals. That is, highly reactive free radicals such as active oxygen such as hydrogen peroxide, hydroxy radicals, and superoxide radicals peroxidize lipids constituting cell membranes to destroy cell membranes, oxidize proteins, and attack hexane to cause oxidative damage, biomaterials destroys the cells and eventually causes the cells to die. The most significant skin characteristics due to aging include wrinkles, loss of elasticity, and dullness of the skin.

In addition, as the human skin ages, various troubles occur. The skin becomes dry, wrinkles are formed, and elasticity is also reduced. Although aging is a natural phenomenon that occurs in people, it can be prevented or delayed through various methods, and cosmetics are focused on preventing this aging phenomenon. At the age of 30, even clear and transparent skin has fine wrinkles and loss of elasticity. Due to these consumer needs, the market for anti-aging products continues to increase, and cosmetics containing collagen, which are closely related to skin elasticity, are being sold steadily. In line with these consumer needs, research groups and industries are conducting research on raw materials and natural ingredients for the purpose of instant wrinkle concealment, long-term wrinkle relief, and elasticity improvement.

On the other hand, flavonoids are widely distributed in plants, and there are about 4,000 types of flavonoids, which are very diverse and have low toxicity. Flavonoids have been called "nature's biological response modifiers" because there is experimental evidence that they can modulate responses to allergens, viruses and carcinogens. According to recent research results, some of flavonoids have excellent antioxidant activity and are reported to promote health in human and animal experiments (Appleton, J.: Evaluating the Bioavailability of Isoquercetin. Nat. Med. J., 2, 1- 6 (2010)), exhibits anti-allergic activity, anti-inflammatory activity, antimicrobial activity and anticancer activity (Singh JP et al., Protective role of Apigenin on the status of lipid peroxidation and antioxidant defense against hepatocarcinogenesis in Wistar albino rats. Phytomedicine 2004 11:309-314).

In addition, according to a recently published paper, flavonoids inhibit the induction of reactive oxygen species (ROS) and affect the inactivation of Interleukin-8 (IL-8), also known as a cytokine, which is known to be involved in the inflammatory response. (Mariusz A. Skiba et al., Central European Journal of Immunology. 2016; 41(3).

Accordingly, the present inventors have studied the application potential of various natural materials, which are not known so far, as a cosmetic product. As a result, tea tree leaves, peppermint leaves, yammilk, green tea, noni and parsley were selected and extracts were prepared therefrom for skin elasticity effect. As a result of measuring , it was found that the efficacy as a cosmetic can be expected because the efficacy is very good. Accordingly, the present inventors studied the applicability of tea tree leaf, peppermint leaf, buckwheat, green tea, noni and parsley as cosmetics among various natural products and conducted various experiments. As a result, the efficacy as a cosmetic for preventing skin aging and improving skin elasticity I found out what to expect.

It is an object of the present invention to provide a cosmetic composition comprising tea tree leaf, peppermint leaf, yakmomil, green tea, noni and parsley, which exhibits an effect of improving skin aging and improving skin elasticity. In addition, it is an object of the present invention to prepare a supercritical, ultrasonic and fermented extract in order to maximize the efficacy of the mixed extract of tea tree leaf, peppermint leaf, yammilk, green tea, noni and parsley, and through a purification process, a cosmetic composition showing efficacy is to provide

The above object is achieved by a cosmetic composition for improving skin elasticity containing a mixed extract of tea tree leaf, peppermint leaf, yakmomil, green tea, noni and parsley.

Also preferably, the mixed extract of tea tree leaf, peppermint leaf, yakmomil, green tea, noni and parsley may be contained in an amount of 0.001 to 30.0% by weight based on the total weight of the cosmetic composition.

Also preferably, the mixed extract of tea tree leaf, peppermint leaf, yam wheat, green tea, noni and parsley (a) purified water, methanol, ethanol, glycerin, ethyl acetate, butylene glycol, propylene glycol, dichloromethane, chloroform, A solvent extraction method of extracting using one or more solvents selected from the group consisting of ethyl ether, butylene glycol, hexane and mixtures thereof, (b) supercritical extraction, and (c) extracted by an extraction method selected from the group consisting of ultrasonic extraction method characterized in that

Also preferably, the mixed extract contains tea tree leaf, peppermint leaf, yam wheat, green tea, noni and parsley in a mixing weight ratio of 1-3:1-3:1-3:1-3:1-3:1-3. can be included as

The cosmetic composition according to the present invention exhibits an excellent skin aging improvement effect and skin elasticity improvement effect. In addition, it can be seen that the skin elasticity improvement effect is excellent when the mixed extract of tea tree leaf, peppermint leaf, yak buckwheat, green tea, noni and parsley according to the present invention is used as a cosmetic. The cosmetic composition comprising the mixed extract of tea tree leaf, peppermint leaf, yakmomil, green tea, noni and parsley according to the present invention has excellent stability in that discoloration, separation and precipitation do not occur with respect to temperature change.

All technical terms used in the present invention, unless otherwise defined, have the following definitions and have the meanings as commonly understood by one of ordinary skill in the art of the present invention. In addition, although preferred methods and samples are described herein, similar or equivalent ones are also included in the scope of the present invention.

The term "about" means 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, means an amount, level, value, number, frequency, percentage, dimension, size, amount, weight or length varying by 4, 3, 2 or 1%.

Throughout this specification, unless the context requires otherwise, the terms "comprises" and "comprising" include, but are not limited to, a given step or element, or group of steps or elements, but any other step or element, or It is to be understood that a step or group of elements is not excluded.

The present invention relates to a cosmetic composition for improving skin elasticity comprising a mixed extract of tea tree leaf, peppermint leaf, yakmomil, green tea, noni and parsley.

Tea tree (TEA TREE, Melaleuca alternifolia) used as an active ingredient in the cosmetic composition of the present invention is native to Australia and is native to New South Wales. It grows to about 6 m in height. It grows in swamps and has strong vitality, so it grows well even if the stem is cut. It is a type of herb that plays a role in refreshing and purifying the air. Tea tree is known to have a strong sterilization and disinfection effect, so it is known that the natives have used tea tree leaves to treat wounds and infections in the past. Recently, it has been widely used in acne-relieving cosmetics. The tea tree leaf of the present invention uses the tea tree leaf.

Peppermint (PEPPERMINT, Mentha piperita) is a cool climate herb. It is a plant that is a little difficult to adapt to in the midsummer of Korea. However, it adapts well to any place with strong vitality and can overwinter in winter without any facilities. Peppermint is rich in various vitamins and antioxidants such as menthol, an essential oil component. These ingredients inhibit the free radicals in the body by inhibiting free radicals in the body with their intense antioxidant action to prevent aging of skin cells, and inhibit the synthesis of leukotriene, an inflammatory mediator, to relieve blemishes, freckles, blemishes, acne, and dermatitis on the skin. Helps health. It also promotes the synthesis of collagen, which is essential for skin hydration, making the skin smooth and elastic. Peppermint leaves of the present invention use peppermint leaves.

HOUTTUYNIA CORDATA is also called Eoseongcho. It grows in shady forests. Underground stems are long, thin, and white. Stems are upright, 20-50cm high, have several vertical lines, and smell. The leaves are alternate phyllotaxis, 3~8cm long, have a sharp tip, have a flat edge, and stipules are attached to the lower part of the petiole. Yakmomil has excellent efficacy as well as strong vitality. A component called quercitrine contained in Yakmomil has antibacterial and anti-inflammatory effects, removing toxins and clearing the skin. It is known to be effective for skin inflammation, various troubles, atopy, and acne. Yakmomil uses the outpost of Yakmomil.

Green tea (CAMELLIA SINENSIS LEAF) refers to unfermented, dried tea leaves or water infused with tea leaves. Green tea contains 5 to 8 times more vitamin C and a large amount of tocopherol than lemon. Vitamin C and tocopherol have a whitening effect that suppresses the formation of spots and freckles, that is, it suppresses the deposition of melanin, so it keeps the skin white and clean. Green tea of the present invention uses green tea leaves.

Noni (MORINDA CITRIFOLIA) is mainly found in the South Pacific region, such as Guam, Hawaii, Fiji, and New Zealand. However, due to its adaptability, it grows well in volcanic terrain, shady forests, and beaches, and is therefore widely cultivated in China, Southeast Asia, Australia, and India. Noni is a tropical plant that grows all year round, and the size of the tree varies from 3 to 12 m when fully grown. It has white, small flowers, and bears lumpy potato-shaped fruits about 10 to 18 cm tall. Phytochemicals, known as special ingredients of noni, are substances that are made to protect themselves from pests as plants grow, and are known to play a role in preventing cell damage and helping cells regenerate in humans. For the noni of the present invention, the fruit of noni is used.

Parsley (PETROSELINUM SATIVUM (PARSLEY)) is a biennial plant belonging to the umbel family, and its origin is southern Italy, North Africa, and the Mediterranean coast. It is a herb that has been cultivated for a very long time with records that it was cultivated in Greece in the 3rd or 4th centuries BC. For skin benefits, it is known to have anti-aging effects as it contains abundant beta-carotene and vitamin C. Vitamin C helps prevent various diseases by removing free radicals, so it helps to prevent aging. It contains not only vitamin C, but also various vitamins such as vitamin A, so it is known that it is effective for various skin problems such as spots and freckles if applied regularly. Parsley of the present invention uses the stem or leaves of parsley.

In addition, the mixed extract of tea tree leaf, peppermint leaf, yakmomil, green tea, noni and parsley may be prepared according to a conventional method known in the art. For example, extraction is performed using (a) solvent extraction, (b) supercritical extraction using reduced pressure and high temperature with carbon dioxide, or (c) ultrasonic extraction.

In the present invention, the mixed extract of tea tree leaf, peppermint leaf, yakmomil, green tea, noni and parsley is prepared using various extraction solvents, for example, water, anhydrous or hydrous lower alcohols having 1-4 carbon atoms (e.g., methanol, ethanol, propanol and butanol), propylene glycol, 1,3-butylene glycol, glycerin, acetone, diethyl ether, ethyl acetate, butyl acetate, dichloromethane, chloroform, nucleic acid and at least one extraction selected from the group consisting of mixtures thereof It can be obtained using a solvent, preferably obtained using ethanol, 70% (v/v) ethanol or water, and most preferably obtained using 70% (v/v) ethanol.

On the other hand, the mixed extract of tea tree leaf, peppermint leaf, yammilk, green tea, noni and parsley of the present invention can be obtained by using not only the above-described extraction solvent but also extracts exhibiting substantially the same effect by using other extraction solvents. It will be apparent to those skilled in the art.

In addition, the mixed extract of tea tree leaf, peppermint leaf, yammilk, green tea, noni and parsley of the present invention includes not only the extract using the above-mentioned extraction solvent, but also an extract that has undergone a conventional purification and fermentation process. For example, decompression by carbon dioxide, extraction by supercritical extraction by high temperature, extraction by extraction using ultrasound, separation using an ultrafiltration membrane having a constant molecular weight cut-off value, various chromatography (size, charge, hydrophobicity or affinity The active fraction obtained through various purification and extraction methods additionally performed, such as separation by a method prepared for separation according to sex) or extracts from fermentation products using natural conditions or various microorganisms, are also included in the extract of the present invention.

In addition, the present invention provides a cosmetic composition, characterized in that the extract is obtained by cooling the extract at room temperature, heating a liquid obtained by filtration, and further concentrating a solvent under reduced pressure or freeze-drying.

The extraction method by the supercritical extraction method by the reduced pressure by carbon dioxide and the high temperature refers to the supercritical fluid extraction method, and in general, the supercritical fluid is a liquid having a gas when it reaches a critical point under high temperature and high pressure conditions, and It has gaseous properties and chemically has a polarity similar to that of a non-polar solvent. Due to these properties, supercritical fluids are used for the extraction of fat-soluble substances (J. Chromatogr. A. 1998;479:200-205).

Carbon dioxide becomes a supercritical fluid with both liquid and gas properties as the pressure and temperature reach the critical point through the operation of the supercritical fluid device, and as a result, the solubility in fat-soluble solutes increases. When the supercritical carbon dioxide passes through an extraction vessel containing a certain amount of the sample, the fat-soluble substance contained in the sample is extracted into the supercritical carbon dioxide.

After extracting the fat-soluble substance, if supercritical carbon dioxide containing a small amount of co-solvent is again flowed through the sample remaining in the extraction container, components that were not extracted with pure supercritical carbon dioxide alone can be extracted.

The supercritical fluid used in the supercritical extraction method of the present invention can effectively extract the active ingredient by using supercritical carbon dioxide or a mixed fluid in which a cosolvent is additionally mixed with carbon dioxide.

As the co-solvent, one or a mixture of two or more selected from the group consisting of chloroform, olive oil, ethanol, methanol, water, ethyl acetate, nucleic acid and diethyl ether may be used. Preferably, one or a mixture of two or more selected from the group consisting of olive oil, ethanol, methanol, and water may be used.

Most of the extracted samples contain carbon dioxide, and since carbon dioxide is volatilized into the air at room temperature, the extract obtained by the above method can be used as a cosmetic composition, and the cosolvent can be removed by a vacuum evaporator.

In addition, the ultrasonic extraction method is an extraction method using energy generated by ultrasonic vibration, and ultrasonic waves can destroy an insoluble solvent contained in a sample in an aqueous solvent. Because the kinetic energy of the particles is increased, sufficient energy for the reaction is obtained, and the high pressure is induced by the impact effect of ultrasonic energy to increase the mixing effect of the material and the solvent contained in the sample, thereby increasing the extraction efficiency.

The extraction solvent that can be used for the ultrasonic extraction method may be one or a mixture of two or more selected from the group consisting of chloroform, ethanol, methanol, water, ethyl acetate, nucleic acid, and diethyl ether. The extracted sample is vacuum filtered to recover the filtrate, then removed by a vacuum evaporator, and an extract can be obtained through a conventional extract preparation method of freeze-drying.

According to the present invention, the mixed extract of tea tree leaf, peppermint leaf, medicinal wheat, green tea, noni and parsley is contained in an amount of 0.001 to 30.0% by weight, preferably 0.01 to 20% by weight, based on the total weight of the cosmetic composition. , more preferably 0.1 to 10% by weight. When the content of the extract is less than 0.001% by weight, the skin aging improvement effect does not appear, and when it exceeds 30.0% by weight, the degree of increase in the skin aging improvement effect for the content increase is insignificant, and there is a problem with safety and stability of the formulation and it is not economical.

The mixed extract according to the present invention contains tea tree leaf, peppermint leaf, buckwheat, green tea, noni and parsley in a mixed weight ratio of 1-3:1-3:1-3:1-3:1-3:1-3 and preferably in a mixing weight ratio of 1:1:1:1:1:1.

In order to use the mixed extract of tea tree leaf, peppermint leaf, yammilk, green tea, noni and parsley prepared in a conventional way in a cosmetic formulation, after removing unnecessary ingredients through a purification process, a cosmetic composition that exhibits an efficacy effect may be included. there is. The purification process can be any conventional purification process, and liquid-liquid extraction using a difference in solubility, precipitation and a filter, and chromatography using the size of polarity and molecular weight, etc. can be used. Also, for example, after dissolving the mixed extract of tea tree leaf, peppermint leaf, yammilk, green tea, noni and parsley in an ethanol aqueous solution (50%, 70% solution, etc.) or other aqueous solution, HP-20, sephadex column filled After separating the water-soluble material and the oil-soluble material using a column using the difference in polarity and molecular weight, the oil-soluble material is concentrated by TLC and freeze-dried to prepare a concentrate.

The ingredients included in the cosmetic composition of the present invention may include ingredients commonly used in cosmetic compositions in addition to the active ingredient as an active ingredient, for example, conventional ingredients such as antioxidants, stabilizers, solubilizers, vitamins, pigments and fragrances. adjuvants, and carriers.

The cosmetic composition of the present invention may be prepared in any formulation conventionally prepared in the art, for example, solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleansing , oil, powder foundation, emulsion foundation, wax foundation, pack, massage cream, spray, etc., but is not limited thereto. More specifically, it may be prepared in the form of a flexible lotion, a nourishing lotion, a nourishing cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray, or a powder.

When the formulation of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as a carrier component. can

When the formulation of the present invention is a solution or emulsion, a solvent, solubilizer or emulsifier is used as a carrier component, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 ,3-butylglycol oil, glycerol fatty ester, polyethylene glycol or fatty acid ester of sorbitan.

When the formulation of the present invention is a suspension, as a carrier component, a liquid diluent such as water, ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystals Adult cellulose, aluminum metahydroxide, bentonite, agar or tracanth may be used.

When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. In particular, in the case of a spray, additional chlorofluorohydrocarbon, propane /may contain propellants such as butane or dimethyl ether.

In the case of cleansing in which the formulation of the present invention contains a surfactant, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid as carrier components Amide ether sulfates, alkylamidobetaines, fatty alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters can be used.

When the cosmetic composition of the present invention is a soap, a surfactant-containing cleansing formulation, or a surfactant-free cleansing formulation, it may be applied to the skin and then wiped off, removed, or washed off with water. As a specific example, the soap is liquid soap, powder soap, solid soap, and oil soap, the surfactant-containing cleansing formulation is a cleansing foam, cleansing water, cleansing towel, and cleansing pack, and the surfactant-free cleansing formulation is a cleansing cream , cleansing lotion, cleansing water, and cleansing gel, but not limited thereto.

Hereinafter, the present invention will be described in more detail through a preparation example. These preparation examples are only for illustrating the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these preparation examples according to the gist of the present invention. .

Preparation Example 1 : Mixed extract of tea tree leaf, peppermint leaf, yak buckwheat, green tea, noni and parsley

Minced and shaded tea tree leaves (leaf), peppermint leaves (leaf), buckwheat (outer plant), green tea (leaf), noni (fruit) and parsley (stem, leaf) were mixed with 60 g each, and then 70% (v) /v) reflux extraction 3 times for 5 hours each with an aqueous ethanol solution, cooled, and filtered with Whatman #4 filter paper. After removing salts from the filtered extract using an ultrafiltration membrane, it was concentrated under reduced pressure at 50° C. or less and freeze-dried to obtain 6.7 g. Then, a mixed extract powder of dried tea tree leaf, peppermint leaf, buckwheat, green tea, noni and parsley was dissolved in 50% 1,3-butylene glycol and used.

Preparation Example 2 : Supercritical fluid mixed extract of tea tree leaf, peppermint leaf, yam wheat, green tea, noni and parsley

Minced and shaded tea tree leaves (leaf), peppermint leaves (leaf), buckwheat wheat (outpost), green tea (leaf), noni (fruit) and parsley (stem, leaf) are mixed with 60 g each, and then mixed with the usual supercritical Extraction was carried out using an extraction method (extraction using olive oil as a cosolvent in a supercritical state under a pressure of about 300 atm at a temperature of about 60°C), and after removing salts using an ultrafiltration membrane, concentrated under reduced pressure and freeze-dried. A mixed extract powder of 31.3 g of dried tea tree leaf, peppermint leaf, chamomile, green tea, noni and parsley was obtained. This was used by dissolving it in 50% 1,3-butylene glycol.

Preparation Example 3 : Preparation of ultrasonically mixed extracts of tea tree leaves, peppermint leaves, yak buckwheat, green tea, noni and parsley

Minced and shade-dried tea tree leaves (leaf), peppermint leaves (leaf), buckwheat wheat (outpost), green tea (leaf), noni (fruit) and parsley (stem, leaf) are mixed with 60 g each, and then ultrasonically (supernonic) Extraction was performed using an ultrasonic device at 25 KHz at 30° C. for about 2 hours), and after removing salts using an ultrafiltration membrane, 7.1 g was obtained through concentration under reduced pressure and freeze-drying. A mixed extract powder of dried tea tree leaf, peppermint leaf, yakmomil, green tea, noni and parsley was used by dissolving it in 50% 1,3-butylene glycol.

Preparation Example 4 : Mixed extract of tea tree leaf, peppermint leaf, yak buckwheat, green tea, noni and parsley

Minced and shaded tea tree leaves (leaf), peppermint leaves (leaf), buckwheat (outpost), green tea (leaf), noni (fruit) and parsley (stem, leaf) 96g, 48g, 48g, 48g, 48g, respectively, After mixing 48 g each, this was extracted under reflux three times for 5 hours with 70% (v/v) aqueous ethanol solution, cooled, and filtered with Whatman #4 filter paper. After removing salts from the filtered extract using an ultrafiltration membrane, it was concentrated under reduced pressure at 50° C. or less and freeze-dried to obtain 6.7 g. Then, a mixed extract powder of dried tea tree leaf, peppermint leaf, buckwheat, green tea, noni and parsley was dissolved in 50% 1,3-butylene glycol and used.

Preparation Example 5 : Mixed extract of tea tree leaf, peppermint leaf, yak buckwheat, green tea, noni and parsley

Minced and shaded tea tree leaf (leaf), peppermint leaf (leaf), buckwheat (outpost), green tea (leaf), noni (fruit) and parsley (stem, leaf) 48g, 96g, 48g, 48g, 48g, respectively, After mixing 48 g each, this was extracted under reflux three times for 5 hours with 70% (v/v) aqueous ethanol solution, cooled, and filtered with Whatman #4 filter paper. After removing salts from the filtered extract using an ultrafiltration membrane, it was concentrated under reduced pressure at 50° C. or less and freeze-dried to obtain 6.9 g. Then, a mixed extract powder of tea tree leaf, peppermint leaf, yakmomil, green tea, noni and parsley was used by dissolving it in 50% 1,3-butylene glycol.

Preparation Example 6 : Mixed extract of tea tree leaf, peppermint leaf, yak buckwheat, green tea, noni and parsley

Minced and shaded tea tree leaf (leaf), peppermint leaf (leaf), buckwheat (outpost), green tea (leaf), noni (fruit) and parsley (stem, leaf) 48g, 48g, 96g, 48g, 48g, respectively, After mixing 48 g each, this was extracted under reflux three times for 5 hours with 70% (v/v) aqueous ethanol solution, cooled, and filtered with Whatman #4 filter paper. After removing salts from the filtered extract using an ultrafiltration membrane, it was concentrated under reduced pressure at 50° C. or less and freeze-dried to obtain 6.6 g. Then, a mixed extract powder of dried tea tree leaf, peppermint leaf, buckwheat, green tea, noni and parsley was dissolved in 50% 1,3-butylene glycol and used.

Preparation Example 7 : Mixed extract of tea tree leaf, peppermint leaf, yak buckwheat, green tea, noni and parsley

Minced and shaded tea tree leaves (leaf), peppermint leaves (leaf), buckwheat (outpost), green tea (leaf), noni (fruit) and parsley (stem, leaf) 48g, 48g, 48g, 96g, 48g, respectively, After mixing 48 g each, this was extracted under reflux three times for 5 hours with 70% (v/v) aqueous ethanol solution, cooled, and filtered with Whatman #4 filter paper. After removing salts from the filtered extract using an ultrafiltration membrane, it was concentrated under reduced pressure at 50° C. or less and freeze-dried to obtain 6.7 g. Then, a mixed extract powder of dried tea tree leaf, peppermint leaf, buckwheat, green tea, noni and parsley was dissolved in 50% 1,3-butylene glycol and used.

Preparation Example 8 : Mixed extract of tea tree leaf, peppermint leaf, yak buckwheat, green tea, noni and parsley

Minced and shaded tea tree leaves (leaf), peppermint leaves (leaf), buckwheat (outpost), green tea (leaf), noni (fruit) and parsley (stem, leaf) 48g, 48g, 48g, 48g, 96g, respectively, After mixing 48 g each, this was extracted under reflux three times for 5 hours with 70% (v/v) aqueous ethanol solution, cooled, and filtered with Whatman #4 filter paper. After removing salts from the filtered extract using an ultrafiltration membrane, it was concentrated under reduced pressure at 50° C. or less and freeze-dried to obtain 6.9 g. Then, a mixed extract powder of tea tree leaf, peppermint leaf, yakmomil, green tea, noni and parsley was used by dissolving it in 50% 1,3-butylene glycol.

Preparation Example 9 : Mixed extract of tea tree leaf, peppermint leaf, yak buckwheat, green tea, noni and parsley

Minced and shaded tea tree leaf (leaf), peppermint leaf (leaf), buckwheat (outpost), green tea (leaf), noni (fruit) and parsley (stem, leaf) 48g, 48g, 48g, 48g, 48g, respectively, After mixing 96 g each, this was extracted under reflux three times for 5 hours with 70% (v/v) aqueous ethanol solution, cooled and filtered with Whatman #4 filter paper. After removing salts from the filtered extract using an ultrafiltration membrane, it was concentrated under reduced pressure at 50° C. or less and freeze-dried to obtain 6.6 g. Then, a mixed extract powder of dried tea tree leaf, peppermint leaf, buckwheat, green tea, noni and parsley was dissolved in 50% 1,3-butylene glycol and used.

Comparative Example 1 : Preparation of green tea leaf solvent extract

In Comparative Example 1, a general organic solvent extract of green tea leaves, which is known to have a high content of flavonoids, was prepared. A sample of 1 kg of green tea leaves was selected, washed sufficiently, and passed through a 300-mesh sieve. Ethanol is added to make a final 70% (V/V) ethanol aqueous solution, and the ethanol aqueous solution is 5 times the weight of the final sample, extracted under reflux 3 times for 5 hours, cooled, and filtered with Whatman #2 filter paper did The filtered extract was concentrated under reduced pressure and then freeze-dried. This powder was dissolved to 2% (v/v) with 50% glycerin and used in the experiment below.

Comparative Example 2 : Preparation of Garlic Solvent Extract

In Comparative Example 2, a general organic solvent extract of garlic known to have a high content of flavonoids was prepared. Garlic samples of 1 kg were selected, thoroughly washed, and then passed through a 300 mesh sieve. Ethanol is added to make a final 70% (V/V) ethanol aqueous solution, and the ethanol aqueous solution is 5 times the weight of the final sample, extracted under reflux 3 times for 5 hours, cooled, and filtered with Whatman #2 filter paper did The filtered extract was concentrated under reduced pressure and then freeze-dried. This powder was dissolved to 2% (v/v) with 50% glycerin and used in the experiment below.

Formulation Example : Preparation of a cosmetic composition containing a mixed extract of tea tree leaf, peppermint leaf, yak buckwheat, green tea, noni and parsley

Cosmetics (Formulation Examples 1 to 9) each comprising a mixed extract of tea tree leaf, peppermint leaf, yakmomil, green tea, noni and parsley of Preparation Examples 1 to 9 were prepared as shown in the composition of Table 1 below. In addition, for comparison of efficacy, a cosmetic composition comprising a green tea extract instead of a mixed extract of tea tree leaf, peppermint leaf, yammilk, green tea, noni and parsley (Comparative Formulation Example 1), a cosmetic composition comprising a garlic extract (Comparative Formulation) Example 2) was prepared according to the composition in Table 1 below.

ingredient
(Unit: wt%) Formulation Example 1 Formulation Example 2 Formulation Example 3 Formulation Example 4 Formulation Example 5 Formulation Example 6 Formulation Example 7 Formulation Example 8 Formulation Example 9 Comparative Formulation Example 1 Comparative Formulation Example 2 Preparation Example 1 5.0 - - - - - - - - - - Preparation 2 - 5.0 - - - - - - - - - Preparation 3 - - 5.0 - - - - - - - - Preparation 4 - - - 5.0 - - - - - - - Preparation 5 - - - - 5.0 - - - - - - Preparation 6 - - - - - 5.0 - - - - - Preparation 7 - - - - - - 5.0 - - - - Preparation 8 - - - - - - - 5.0 - - - Preparation 9 - - - - - - - - 5.0 - - Comparative Example 1 (Green Tea) - - - - - - - - - 5.0 - Comparative Example 2 (garlic) - - - - - - - - - - 5.0 EDTA-2Na 0.02 0.02 0.02 0.02 0.02 0.02 0.02 0.02 0.02 0.02 0.02 cetostearyl alcohol 2.0 2.0 2.0 2.0 2.0 2.0 2.0 2.0 2.0 2.0 2.0 Glyceryl Stearate 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 microcrystallin 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 squalane 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 4.0 liquid paraffin 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 trioctanoin 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 polysorbate 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 Sorbitan Stearate 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 0.5 tocopheryl acetate 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 0.1 cyclomethicone 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 3.0 fragrance, preservative appropriate amount appropriate amount appropriate amount appropriate amount appropriate amount appropriate amount appropriate amount appropriate amount appropriate amount appropriate amount appropriate amount Purified water to 100 to 100 to 100 to 100 to 100 to 100 to 100 to 100 to 100 to 100 to 100

Experimental Example 1 : Measurement of active ingredient content

The extracts prepared in Preparation Examples 1 to 9 and Comparative Examples 1 to 2 were analyzed for flavonoid content by HPLC analysis, and the results are shown in Table 2 below.

division Preparation Example 1 Preparation 2 Preparation 3 Preparation 4 Preparation 5 Preparation 6 flavonoids
(Flavonoid) 3.12 3.10 3.10 2.85 2.99 3.03 division Preparation 7 Preparation 8 Preparation 9 Comparative Example 1 Comparative Example 2 flavonoids
(Flavonoid) 2.78 2.80 2.67 1.87 2.59

As a result of measuring the content of active ingredients in Preparation Examples 1 to 9 and Comparative Examples 1 to 2, it was confirmed that the overall content of flavonoids in Preparation Examples 1 to 9 was higher than in Comparative Examples 1 and 2. When comparing Formulation Examples 1 to 9, since the efficacy of Formulation Example 1 is excellent, it was confirmed that it is most preferable to mix each component at a mixing ratio of 1:1:1:1:1:1.

Experimental Example 2 : Real-time RT-PCR Quantification

The CXCL8 gene expression effect of Preparation Examples 1 to 9 and Comparative Examples 1 to 2 was evaluated. The gene used is gene accession number (Genebank) NM_000584.3 (CXCL8, Homo sapiens C-X-C motif chemokine ligand 8). As a test group, the formulations of Preparation Examples 1 to 9 were used, and as a control group, the extracts of Comparative Examples 1 and 2 were added at a concentration of 2 (v/v), and in Comparative Example 3, only the solvent (50% glycerin), not the extract, was used. The added formulation was used.

The gene expected to be specifically expressed by flavonoids is gene accession number (Genebank) NM_000584.3 (CXCL8, Homo sapiens C-X-C motif chemokine ligand 8), and the extracts of Preparation Examples 1 to 9 and Comparative Examples 1 and 2 Addition of (2% (w / w)), Comparative Example 3 (50% glycerin) to investigate and quantify the degree of expression change according to, My IQ real-time PCR (My IQ Real-time PCR) (Bio-rad, USA) ) was used for quantitative real-time RT-PCR.

Specifically, cDNA was synthesized by performing a reverse transcription reaction using an oligo dT primer and a Superscript kit (Omniscipt™ kit, Qiagen, Co., USA). 0.2 μl of the cDNA, 3.8 μl of water, 0.5 μl of a sense primer, 0.5 μl of an antisense primer, and 5 μl of a cybergreen I staining supermix (Bio-rad, USA) were mixed, put in a PCR tube, Step 1: 95°C, 3 minutes ; Step 2 (repeat 45 times): Step 2-1: 95°C, 10 seconds; Step 2-2: KIF1A - 57 °C, B3GALT4, DHRS9, EMR2, KIAA1199 - 65 °C, 45 seconds; Step 3: 95° C., 1 min; Step 4: 55° C., 1 min; Step 5 (repeat 80 times): The reaction was performed on a My IQ real-time PCR machine designed for 10 seconds at 55°C. To quantify the PCR product, it was stained with SYBR Green I stain (Bio-rad, USA). Cybergreen I staining is a staining method that binds to double-stranded DNA. As double-stranded DNA is generated during the PCR process, the fluorescence intensity increases.

First, primers for the target gene and endogenous control (RPLPO) used in PCR are added to the cyber green master mix to perform PCR, and then the primer optimization process to select an appropriate concentration was performed. The synthesized cDNA sample and each primer listed in Table 3 were mixed, and PCR was performed after adding the cyber green master mix, and analysis was performed using quantitative software.

Registration Number Gene Abbreviations PCR primer sequence (5'->3') NM_000584.3 CXCL8 sense (SEQ ID NO: 1) ATGACTTCCAAGCTGGCCGT Antisense (SEQ ID NO:2) GCACTCCTTGGCAAAACTGC

As a result of measuring the expression level of the CXCL8 gene according to the addition of Preparation Examples 1 to 9 and Comparative Examples 1 to 3, the gene registration number (Genebank) NM_000584.3 (CXCL8, Homo sapiens C-X-C motif chemokine ligand for Preparation Examples 1 to 9) 8) was found to be significantly lower than that of Comparative Examples 1 and 2 (see Table 4, p<0.5).

displayed ≥1.5-fold experimental product CXCL8 (Fold Change) Regulation Preparation Example 1 0.16 down Preparation 2 0.19 down Preparation 3 0.20 down Preparation 4 0.30 down Preparation 5 0.25 down Preparation 6 0.24 down Preparation 7 0.29 down Preparation 8 0.19 down Preparation 9 0.23 down Comparative Example 1 0.41 down Comparative Example 2 0.32 down Comparative Example 3 1.02 -

From the above results, the mixed extract of tea tree leaf, peppermint leaf, buckwheat, green tea, noni and parsley of the present invention was compared with extracts of other plants (Comparative Examples 1 and 2) and Comparative Example 2 (50% glycerin) gene CXCL8 It was confirmed that the expression level was reduced. When comparing Formulation Examples 1 to 9, Formulation Example 1 reduced the expression level of gene CXCL8 the most, so each component was mixed in a 1:1:1:1:1:1 mixing ratio. It was confirmed that mixing was the most preferable.

Experimental Example 3 : Evaluation of skin elasticity improvement effect

The skin elasticity improvement effects of Formulation Examples 1 to 9 and Comparative Formulation Examples 1 to 3 were evaluated as follows. The creams of Formulation Example 1 and Comparative Formulation Examples 1 to 3 were applied to the face of 15 experimenters (females aged 20-35 years) twice a day for 3 consecutive months.

After completion of the experiment, the skin elasticity improvement effect was measured using a skin elasticity meter (cutometer SEM 575, C+K Electronic Co., Germany) before and after using the product for 2 months. Experimental results are described as ΔR8 values of Cutometer SEM 575 in Table 5 below. R8 values indicate the properties of viscoelasticity of the skin.

experimental product Skin elasticity effect (ΔR8, n=15, p<0.05) before use after use Preparation Example 1 0.10 0.41 Preparation 2 0.12 0.37 Preparation 3 0.11 0.36 Preparation 4 0.10 0.31 Preparation 5 0.10 0.32 Preparation 6 0.10 0.34 Preparation 7 0.09 0.33 Preparation 8 0.12 0.29 Preparation 9 0.11 0.30 Comparative Example 1 0.12 0.20 Comparative Example 2 0.09 0.28 Comparative Example 3 0.10 0.14

As can be seen in Table 5, it can be seen that the skin elasticity improvement effect of the experimenter who applied the cream containing the mixed extract of tea tree leaf, peppermint leaf, yammilk, green tea, noni and parsley according to the present invention is the best. . When comparing Formulation Examples 1 to 9, since the efficacy of Formulation Example 1 is excellent, it was confirmed that it is most preferable to mix each component at a mixing ratio of 1:1:1:1:1:1.

As described above in detail a specific part of the present invention, for those of ordinary skill in the art, this specific description is only a preferred embodiment, and it is clear that the scope of the present invention is not limited thereto. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Claims (4)

A cosmetic composition for improving skin elasticity containing a mixed extract of tea tree leaf, peppermint leaf, yak buckwheat, green tea, noni and parsley. The cosmetic composition for improving skin elasticity according to claim 1, wherein the tea tree leaf, peppermint leaf, herbal extract, green tea, noni and parsley mixed extract is contained in an amount of 0.001 to 30.0% by weight based on the total weight of the cosmetic composition. According to claim 1, wherein the tea tree leaf, peppermint leaf, yakmomil, green tea, noni and the mixed extract of parsley (a) water, anhydrous or hydrated lower alcohol having 1-4 carbon atoms, propylene glycol, butylene glycol, glycerin, A solvent extraction method using an extraction solvent selected from the group consisting of acetone, ethyl acetate, chloroform, butyl acetate, diethyl ether, dichloromethane, nucleic acids, and mixtures thereof, (b) supercritical extraction, and (c) ultrasonic extraction. A cosmetic composition for improving skin elasticity, which is extracted by a method selected from According to claim 1, wherein the mixed extract is tea tree leaf, peppermint leaf, buckwheat, green tea, noni and parsley in a mixing weight ratio of 1-3:1-3:1-3:1-3:1-3:1-3 A cosmetic composition for improving skin elasticity, comprising: