KR20210041355A - A nucleic acid aptamer specifically binding to Enterobacter sakazakii and the use thereof - Google Patents

Abstract

The present invention relates to a nucleic acid aptamer that specifically binds to Enterobacter sakazaki, a composition for detecting Enterobacter sakazaki including the aptamer, a kit for detection, a method for detecting Enterobacter sakazaki in a sample using the aptamer, a method for removing Enterobacter sakazaki from a sample, and a method for preparing a nucleic acid aptamer specific for Enterobacter sakazaki.

Description

A nucleic acid aptamer specifically binding to Enterobacter sakazakii and the use thereof

It relates to a nucleic acid aptamer that specifically binds to Enterobacter sacazaki and uses thereof.

Enterobacter sakazakii is highly resistant to osmotic pressure and dry environments, so it is easy to detect in unsterilized formula. Infants and infants infected with Enterobacter Sakazaki cause sepsis, meningitis, encephalitis, and necrotizing enteritis, and the mortality rate is known to be 20-50%. Various methods for detecting Enterobacter sakazaki in formula, for example, colony counting after culture (culture & colony counting), immunobased assay, polymerase chain reaction, etc. Although it is suggested, there is a problem in that it is difficult to quickly cope with contamination because it is difficult to quickly diagnose technically because it takes a long time to calculate a result.

An aptamer refers to a single-stranded nucleic acid having high specificity and affinity for various target substances such as heavy metals, organic compounds, proteins, bacteria, and cancer cells. Aptamer is the SELEX method (Systematic evolution of ligands by exponential enrichment), a process that maximizes the specificity and affinity for a target substance by repeatedly adsorbing and desorbing a specific nucleotide sequence that binds to a target substance under in vitro conditions. ) To obtain the nucleotide sequence for the target material. When the nucleotide sequence is secured, chemical synthesis is easy, so high purity and low cost mass production is possible. However, since repetitive adsorption, desorption, and amplification processes of nucleotides using the SELEX method are required to secure nucleotide sequence, the overall time required for securing aptamers is lengthened, so to quickly detect acute pollutants or cells causing acute infection. There is a disadvantage that it is difficult to quickly cope with the required receptor development.

In order to compensate for these shortcomings, MonoLEX, FACS-SELEX, MARAS, etc. have been proposed as studies on the discovery process of aptamers to quickly secure aptamers that selectively bind to the bacterial surface. However, since the method introduced for the rapid excavation process requires skilled technology, an excessive washing step using centrifugation in the process of adsorption and desorption of bacteria from the random ssDNA library to compensate for the shortcomings of the existing method. ) To remove the ssDNA that is not attached to the target material and the ssDNA that is weak in binding power, and discover the ssDNA with strong affinity and specificity in a small amount, a centrifugation based-partitioning method was proposed.

Under this background, the present inventors have introduced a centrifugation-based splitting method to rapidly secure a single-stranded nucleic acid aptamer that specifically binds to Enterobacter saczakaki, and use this to provide a method for detecting Enterobacter saccazaki.

One aspect is to provide a nucleic acid aptamer that specifically binds to Enterobacter sakazaki.

Another aspect is to provide a composition for detecting Enterobacter Sakazaki comprising the aptamer.

Another aspect is to provide a kit for detecting Enterobacter Sakazaki comprising the aptamer.

Another aspect is to provide a method of detecting Enterobacter Sakazaki in a sample using the aptamer.

Another aspect is to provide a method for removing Enterobacter Sakazaki from a sample using the aptamer.

Another aspect is to provide a method of preparing a nucleic acid aptamer that specifically binds to Enterobacter sacazaki.

One aspect provides a nucleic acid aptamer that specifically binds to Enterobacter sakazaki.

The term, "Enterobacter sakajaki (Enterobacter sakazakii, KCTC 2949) herein is a non-spore forming, Gram-negative facultative anaerobic bacteria. Sakajaki bacteria are found in bacteria belonging to the Enterobacteriaceae group of human and animal internal environment. Saccharide is kigyun Although the incidence of silver is low, it is a high-risk bacteria that can induce enteritis or meningitis, and it is known to cause meningitis or enteritis in infants and infants, especially in infants and infants with weak immunity than in healthy adults.

In the present specification, the term "nucleic acid" is a polymer of nucleotides, and may be used in the same sense as an oligonucleotide or polynucleotide. The nucleic acid may include a deoxyribonucleotide (DNA), a ribonucleotide (RNA), a nucleotide analogue, and/or a peptide nucleic acid (PNA) molecule.

As used herein, the term "aptamer" refers to a nucleic acid molecule that forms a stable tertiary structure by itself and is capable of binding to a target molecule with high affinity and specificity. The aptamer may exist as a single-stranded nucleic acid. The aptamer forms a tertiary structure and can specifically bind to Enterobacter saczakaki.

In the present specification, the term "specifically binding" means that the aptamer does not substantially bind to other microorganisms other than Enterobacter sakazaki, or shows a large difference in affinity, enabling the distinction between Enterobacter sacchaki and other microorganisms. Means to do. The other microorganisms may include Escherichia coli , shigella sonnei , Enterobacter aerogenes , Staphylococcus xylosus , Bacillus cereus , and the like.

The aptamer may include a nucleotide sequence having 90% or more, 95% or more, 97% or more, or 98% or more identity with any one nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 31. The aptamer may be one in which some nucleotides in any one nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 31 are substituted, inserted, and/or deleted. For example, the aptamer may be one in which a nucleotide that is not essential for specific binding to Enterobacter sakazaki among any one nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 31 is substituted with another nucleotide. The term "nucleotides not essential for specific binding to Enterobacter sakazaki" may be nucleotides corresponding to PCR primer regions at both ends of the aptamer.

The aptamer may consist of the nucleotide sequence of SEQ ID NO: 1. The aptamer may include the nucleotide sequence of SEQ ID NO: 1. The aptamer is 90% or more, 95% or more, 97% or more, or 98% or more, with the nucleotide sequence of SEQ ID NO: 1 and the nucleotide sequence of SEQ ID NO: 35 (GCAATGGTACGGTACTTCC AGGGGTGGGCGGGTGCGGTGGTTCGGCGACATTCGGTTTATGGT CAAAAGTGCACGCTACTTTGCTAA) including PCR primer regions at both ends of the aptamer. It may include a nucleotide sequence having. In the nucleotide sequence of SEQ ID NO: 35, nucleotides corresponding to the PCR primer regions at both ends of the aptamer may be nucleotides indicated by non-bold parts.

The aptamer may further include a detectable labeling substance. The labeling material is a material that generates a detectable signal, and the detectable signal may be an optical signal, an electrochemical signal, a radioactive isotope signal, an enzyme signal, or a combination thereof. For example, the labeling material may be a fluorescent material, a color developing enzyme, a quantum dot, a radioactive isotope, a gold nanoparticle, an electrochemical functional group, and a combination thereof.

The material generating the optical signal may be a fluorescent material or a phosphorescent material. The fluorescent substance is, for example, fluorescein, 6-FAM, rhodamine, Texas Red, tetramethylrhodamine, carboxyrhodamine, carboxyrotamine 6G, carboxyrodol, carboxyrhodamine 110 , Cascade Blue, Cascade Yellow, Komarin, Cy2 (cyanine 2), Cy3, Cy3.5, Cy5, Cy5.5, Cy-chrome, phycoerythrin, PerCP (peridine chlorophyll) -a protein), PerCP-Cy5.5, JOE (6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein), NED, ROX (5- (and -6)- Carboxy-X-rhodamine), HEX, Lucifer Yellow, Marina Blue, Oregon Green 488, Oregon Green 500, Oregon Green 514, Alexa Floor, 7-amino-4-methyl Komarin-3-acetic acid, BODIPY FL, Bodipy FL-Br 2, Bodipy 530/550, and the like may be included. In addition, the optical signal may be generated by a fluorescence resonance energy transfer (FRET) pair. As the FRET pair, a material known in the art may be used. The material generating the electrochemical signal may be methylene blue. The radioactive isotope may be C ¹⁴ , I ¹²⁵ , P ³² , or S ³⁵ . The enzyme may be alkaline phosphatase, beta-galactosidase, horseradish peroxidase, luciferase, cytochrome P450, or glucose oxidase.

The labeling material may be bonded to the 3'end or 5'end of the aptamer. The labeling material may be bound to a specific site of the aptamer. The specific region may be, for example, a part of a hairpin-loop structure.

Another aspect provides a composition for detecting Enterobacter sakazaki, comprising a nucleic acid aptamer that specifically binds to Enterobacter saczaki.

Another aspect provides a kit for detecting Enterobacter saczaki, comprising a nucleic acid aptamer that specifically binds to Enterobacter sacazaki.

The description of the Enterobacter sakazaki, nucleic acid, aptamer, and the like are as described above.

The composition or kit may be used to quickly screen for the presence or absence of Enterobacter sakazaki in a sample prior to detection using an apparatus such as HPLC, LC/MS, or GC/MS or detection using an antibody. The composition or kit may further include a reaction buffer. The kit may further include a description describing a method of detecting Enterobacter sakazaki in a sample.

In the kit, the aptamer may be immobilized on a substrate. The term "substrate" refers to a solid support on which the aptamer can be immobilized. The substrate may be a bead, a membrane, a microtiter plate, or a chip. The aptamer may be, for example, immobilized on a magnetic bead. In this case, the aptamer specifically bound to Enterobacter Sakazaki can be separated using a magnet. The aptamer may be covalently bonded to the substrate directly or by a linker. The aptamer may further include a functional group capable of covalently binding. The functional group may be a carboxyl group, a hydroxy group, or an amine group. The aptamer may be, for example, biotinylated. The biotinylated aptamer can be immobilized by streptavidin coated on the substrate.

Another aspect provides a method of detecting Enterobacter sakazaki in a sample. The method comprises the steps of contacting a sample with a nucleic acid aptamer that specifically binds to Enterobacter sakazaki; And confirming whether Enterobacter Sakazaki is bound to the aptamer.

Another aspect provides a method of removing Enterobacter sakazaki from a sample. The method comprises the steps of contacting a sample containing Enterobacter sakazaki with a nucleic acid aptamer that specifically binds to Enterobacter sakazaki to form an aptamer complex with Enterobacter sakazaki; And removing the complex.

The description of the Enterobacter sakazaki, nucleic acid, aptamer, and the like are as described above.

As used herein, the term "sample" refers to a substance containing or presumed to contain Enterobacter sakazaki. The sample may be taken from one or more of food, drinking water, factory wastewater, livestock wastewater, household wastewater, waste, soil, air, precipitation, seawater, food, tissues or cells of animals and plants, or liquids from animals and plants. In one embodiment, the sample may be a formula.

Contact between the sample and the aptamer may occur under appropriate reaction conditions, for example, a composition and a pH of a salt such that the binding with Enterobacter saczaki can occur efficiently. A person skilled in the art can easily set such reaction conditions. A suitable pH can be, for example, 5 to 8.5, 6 to 8, or 7 to 8. The reaction temperature may be, for example, 15 to 50°C, 15 to 40°C, 15 to 30°C, 15 to 25°C, 20 to 30°C, or 20 to 25°C. The reaction time may be 20 to 60 minutes, 30 to 50 minutes or 40 to 50 minutes. The aptamer may be provided in the form of the above-described composition or kit. The aptamer may be fixed to the substrate. The substrate may be a bead, a film, a microtiter plate, or a chip.

Whether Enterobacter Sakazaki and the aptamer are combined may be confirmed through a sensor to which the aptamer is connected. For this, a sensor known in the art may be used. Whether or not the combination can be confirmed by measuring a signal generated by the combination. The signal may be an optical signal, an electrochemical signal, an enzyme signal, or a combination thereof. Whether or not the binding may be confirmed by detecting a change in an optical signal or a change in an electrochemical signal caused by a change in the structure of the aptamer bound to Enterobacter sakazaki, for example. Alternatively, it is possible to determine whether the aptamer is bound by measuring the difference in cohesion or repulsion between the support to which the aptamer is fixed and Enterobacter sakazaki. A sample in which the presence of Enterobacter sakazaki is confirmed by the above method may be further analyzed through an analysis method known in the art.

The removal of the complex may be performed by a magnetic separation method, filtration, a method using a carrier adsorption method, a centrifugation method, or a combination thereof.

Another aspect provides a method of preparing a nucleic acid aptamer that specifically binds to Enterobacter sakazaki. The method comprises the steps of culturing Enterobacter Sakazaki; Inducing the binding of ssDNA and Enterobacter sakazaki by mixing a single-stranded DNA (ssDNA) library consisting of the nucleotide sequence of SEQ ID NO: 32 and the cultured Enterobacter saczaki; Washing to remove ssDNA that is not bound to Enterobacter saczaki or bound with low avidity; Separating and amplifying the ssDNA bound to Enterobacter sakazaki may be included.

The description of the Enterobacter sakazaki, nucleic acid, aptamer, and the like are as described above.

The ssDNA library may include a nucleotide sequence having 90% or more, 95% or more, 97% or more, or 98% or more identity with the nucleotide sequence of SEQ ID NO: 32. The nucleotide sequence of SEQ ID NO: 32 has a fixed sequence region for PCR at both ends, and has 45 random nucleotide sequences in the center between the fixed sequence regions, and the random nucleotide sequence is any A, G, T, It generally means consisting of C bases, but the number of bases is not necessarily limited to 45. Any number of bases from 45 may be added or omitted by repetitive PCR and cloning processes, and the total length of the ssDNA library may be changed accordingly.

In general, to discover an aptamer specifically attached to a target, SELEX (Systematic evolution of ligand by exponential enrichment) is performed. The SELEX method is a nucleic acid that has binding power to a specific target from a randomly synthesized random nucleic acid library. After selecting and amplifying, the nucleotide sequence is analyzed by finally concentrating the nucleic acid having high avidity through repeated experiments. In contrast, the present inventors perform centrifugation based-partitioning, excluding the enrichment process used in the SELEX method, and a process in which randomly synthesized random nucleic acid libraries bind and desorb to a specific target. This is a method of obtaining a nucleic acid having high avidity to a specific target through an excessive washing step. That is, in order to separate a nucleic acid that binds to a target and a nucleic acid that does not bind to a target, it is a method of performing a centrifugation method using a weight difference between the target and the nucleic acid-target complex.

The nucleic acid aptamer that specifically binds to Enterobacter sakazaki according to an aspect can quickly identify and isolate the presence and/or concentration of Enterobacter saczakaki in a sample.

Figure 1 is a schematic diagram comparing the centrifugation-based partitioning method (Centrifugation based-partitioning) and the SELEX method for the production and selection of DNA aptamer that specifically binds to Enterobacter Sakazaki.
FIG. 2 is a diagram showing the secondary structure of one type of ssDNA (SC25) that is predicted to have the highest avidity among the 31 DNA aptamers prepared in Example 1 using the MFold program and the sequence alignment program.
Figure 3 is a view showing the result of analyzing the binding force of the selected ssDNA (SC25) to Enterobacter Sakazaki.
4 is a diagram showing the results of analyzing the selectivity of the selected ssDNA (SC25) with respect to Enterobacter saczakaki compared with the other five bacteria.
5 is a diagram showing the results of analyzing the binding power and selectivity of the selected ssDNA (SC25) to Enterobacter Sakazaki when the medium is a formula.

It will be described in more detail through the following examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example 1. Preparation of DNA aptamer specifically binding to Enterobacter sakazaki

1.1 Centrifugation based-partitioning

As shown in Fig. 1, the process of reattaching and enriching the target material in the existing SELEX method is eliminated, the attachment and desorption process of the random DNA library and the target material, and an excessive washing step. ) To produce a DNA aptamer that specifically binds Enterobacter Sakazaki through a centrifugation-based splitting method that can produce an aptamer with high affinity and selectivity for a target substance only by centrifugation within a short time. I did.

1.2 Synthesis of ssDNA library

In order to screen for an aptamer specific for Enterobacter saczaki, an ssDNA library consisting of the following single-stranded DNA oligonucleotides was synthesized. The synthesized ssDNA library is a random ssDNA library with a total length of 88-mer, and has a fixed nucleotide sequence region (underlined part) to which primer pairs are annealed at both ends and a nucleotide sequence region (N ₄₅ ) randomly arranged in the center.

5'- GCAATGGTACGGTACTTCC -N ₄₅ - CAAAAGTGCACGCTACTTTGCTAA -3' (SEQ ID NO: 32)

Here, N ₄₅ generally means consisting of 45 arbitrary A, G, T, C bases, but the number of bases is not necessarily limited to 45. Any number of bases from 45 may be added or omitted by repetitive PCR and cloning processes, and the total length of the ssDNA library may be changed accordingly.

1.3 Mixing with Enterobacter Sakazaki Culture and Isolation of ssDNA

Enterobacter Sakazaki (KCTC2949), which is a target material for mixing with the random ssDNA library, was inoculated in a nutrient broth and then incubated at 37°C ^{until the concentration reached 10 8} CFU/mL. Next, in order to remove the culture medium from the Enterobacter sakazaki solution, it was washed three times using a PBS buffer and then suspended in a binding buffer (1X PBS, 0.45g glucose, 1% BSA, 0.01g tRNA). Thereafter, the random ssDNA library was dissolved in a binding buffer, heated at 95° C. for 5 minutes, immediately lowered to 4° C. using ice, and mixed with Enterobacter Sakazaki suspension (10 ⁷ CFU) suspended in a binding buffer, and mixed at room temperature for 1 hour. Mixed during. Thereafter, ssDNAs that did not bind Enterobacter Sakazaki were removed using a centrifuge for 3 minutes at 13000 rpm, and ssDNA having weak binding strength was removed through an excessive washing process using PBS buffer. Next, the Enterobacter Sakazaki-ssDNA mixture was subjected to heat treatment to separate the ssDNAs attached to the Enterobacter Sakazaki surface from Enterobacter Sakazaki.

1.4 Reverse screening process

The isolated ssDNAs bind to sites such as proteins or glycolipids on the surface of Enterobacter sakazaki, and these cell surface substances have the potential to exist in bacteria other than Enterobacter sakazaki. In a total of two times, negative selection using different bacteria was performed. Bacteria used for reverse screening were Escherichia coli , shigella sonnei , Enterobacter aerogenes , Staphylococcus xylosus , Bacillus cereus , and ssDNAs that bind to these bacteria. After removal, only ssDNA that does not bind to these bacteria was isolated. Specifically, in the first reverse screening process, a reverse screening process was performed using a mixture of five selected bacteria, and in the second reverse screening process, each of the five selected bacteria was individually reverse screened. After passing through, finally, in order to increase the selectivity for Enterobacter Sakazaki, the ssDNA screening process attached to Enterobacter Sakazaki was performed once more. Then, after suspending Enterobacter Sakazaki-ssDNA using an elution buffer (1X PBS, 0.45g glucose, 1% BSA, 0.01g), in order to drop and recover the ssDNA bound to the surface of Enterobacter Sakazaki, Enterobacter Sakazaki The -ssDNA complex was heat-treated at 95° C. for 10 minutes and then recovered using a centrifuge.

1.5 PCR amplification and purification

The amount of ssDNAs recovered through the above process was amplified through PCR. The sequence of the primers used at this time is shown in Table 1 below.

Sequence (5'→3') Sequence number Forward GCAATGGTACGGTACTTCC 33 Reverse TTAGCAAAGTAGCGTGCACTTTTG 34

Specifically, PCR was performed twice in total to amplify the recovered ssDNAs. The first PCR mixture composition is a total of 50 uL by mixing 20 uL of a recovery solution containing ssDNA attached and detached from Enterobacter Sakazaki, 2.5 uL (10 uM) of each primer, and 25 uL of the PCR master mix. The temperature conditions were repeated 10 times at 95° C. for 30 seconds, 56.3° C. for 30 seconds, and 72° C. for 30 seconds. To confirm that PCR was properly performed, PCR products were analyzed by electrophoresis using 3% agarose gel. The PCR product was finally purified using a PCR purification kit (MinElute PCR Purification Kit, QIAGEN), and then a second PCR was performed. The second PCR mixture consisted of 15 uL of amplified dsDNA, 2.5 uL (10 uM) of each primer, 25 uL of PCR master mix, and 5 uL of distilled water were mixed to perform PCR in a total amount of 50 uL, and the temperature condition was the first PCR. It was the same as the method, but it was repeated 8 times. The final PCR product was analyzed by electrophoresis and purified using a PCR purification kit. The finally obtained ssDNAs were cloned using a cloning kit (TOPO TA cloning kit), and plasmids cloned from each colony were extracted using a plasmid extraction kit to perform nucleotide sequencing. As shown in Table 2 below, ssDNA having a total of 31 different nucleotide sequences was obtained.

Sample name Base sequence Sequence number SC1 CTTGACAAACTTGACGATAGGGCTACACAGTATACTTACCCGGTT 2 SC2 GAGTCAGTACTCAGTATTGACATCTCCAGACGCGCATGATAGTT 3 SC3 GGCGACTTGATCTGTCGGGGGCGTCCCTGCTGACCATGGTTGCAT 4 SC5 GCATTTAACTTATCCTGTGGCCACTTTTACTGACTTCTGTGGAGC 5 SC7 AATATTTTATCAAGTCCCAATGCTCGTATTCCGACTTTAGCTTAT 6 SC11 TGCGGTAGTGATTTGCGGGGTCATAGTAGCGGTTTTTGGGGGGTT 7 SC12 CGCTGTGCAGTATGGTTGGGTTGGTGTGAGGGTCTTTTTCATTGT 8 SC15 ACCCATCATAACCACGTGACATCTTGCCAGGGCCATCTGGCTGGT 9 SC16 TCATGTTGTTGATGACAAATAGGGCGTCGGTTATTCACCCTAGG 10 SC17 TCCGAGCGCACTCTCGCTGCGCAGGATCGATTTTCTAGCTTTGG 11 SC19 CTACAGGGGAATAATTATTTTAGCGGGGCTTTGGAAGTCCGTCT 12 SC20 GTTGAGGAACCTGTTGGTATTGCCAGGTGGGAGGGAGGCCCTTTA 13 SC22 CCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCG 14 SC23 CAACGCATCCCAATCAAACCCGCGGGCCTATCGCTTTAATCTGA 15 SC24 CGACAGTACTCAATATATCGAATTGTAATTGGCACTCACGTTAGG 16 SC25 AGGGGTGGGCGGGTGCGGTGGTTCGGCGACATTCGGTTTATGGT One SC28 CCATGAGTGTTGGTGAAATGTTGGGACACTAGGTGGCATAGAGCCG 17 SC30 AAATCTTACGGTGGTACATGGCCCGTGGCGGCCAGGGTCCAAAGT 18 SC31 TACGGAGGATGTATAGGACCCTTTGTCTCTGTTTGAAGTAATATC 19 SC33 TCCACCCCGGTGGTAGTGTGGTTTTGAAAATCCTACTAGGGTGTG 20 SC34 AATGAGTGTTGTGAATGTTGGGACACTAGGTGGCATAGAGCCG 21 SC36 TTGGCTACGGCGGTGACCTTAGTTAGGGTGTGTTTAATTCGCCGT 22 SC39 TACAAAACCCCTCTTGTGATCGGGCGGACAGTTAACCTGCTCCTA 23 SC40 CGGGAAGTCGTAGTTAGTGTTACTTCTACTCTGCGCTGTTCACGG 24 SC41 CCTTATGAACTTTGAACTGTTCTGGGTTACTGCTTCCGAGATTCG 25 SC42 AGGGGTGGGCGGGTGCGGTGGTTCGGCGACATTCGGTTTATGGT 26 SC43 AGTCCATTGACTGTGGAATCTGCAGTGTGTTTGGCTGCCTTTGCT 27 SC45 GCAGGGCTGGCACTTAGTGTGGTGGGTCTGGTGTATTGGACTTAA 28 SC47 ATTAGCCTGGCTCGTTAATGACCTATACTCCATGGTTTGTAAGGT 29 SC48 TGGGTTGGAATCGACGGAAGCTATCTTCTAGTGCAATGGTTCTGC 30 SC49 GTCTTCGTTGTTCATTTTATCCGTGTGGGGGCGTTCTGTCTTT 31

Example 2. Analysis of the avidity and selectivity of the selected DNA aptamer to Enterobacter sakazaki

2.1 Analysis of Avidity for Enterobacter Sakazaki

Through homology analysis using a sequence alignment program, among the 31 ssDNAs prepared in Example 1, ssDNA (SC25), which is predicted to have the highest avidity, was analyzed for binding power and selectivity to Enterobacter sakazaki. The secondary structure of the selected ssDNA (SC25) was analyzed using a web server-based Mfold program, and it is shown in FIG. 2.

For the affinity analysis of the selected ssDNA (SC25) sequence, Enterobacter Sakazaki (KCTC 2949) was inoculated into a culture solution and then cultured at ^{37° C. until the concentration reached 10 8 CFU/mL.} Next, in order to remove the culture solution from the Enterobacter sakazaki solution, it was washed three times using a PBS buffer and then suspended in the PBS buffer. Enterobacter Sakazaki 100 uL (10 ⁷ CFU) was mixed with 100 uL of fluorescently labeled ssDNA (0, 10, 25, 50, 100, 250, 500 nM) at various concentrations, and then reacted at room temperature for 30 minutes. After the reaction, in order to remove ssDNAs that did not bind to the surface of Enterobacter Sakazaki, they were washed three times using a PBS buffer, and then the fluorescence intensity of the Enterobacter Sakazaki-ssDNA complex was measured using a fluorescence analyzer. The intensity of fluorescence in each ssDNA concentration condition was plotted using the SigmaPlot program using a nonlinear regression method and a single site saturation ligand binding method, and F=B _max* C/(K _d + C ) Was used, where F is the fluorescence intensity, B _max is the maximum binding intensity, K _d is the dissociation constant, and C is the concentration of ssDNA.

As a result of analyzing the binding ability to Enterobacter saczaki, as shown in FIG. 3, the avidity (K _d , dissociation constant) of the selected ssDNA (SC25) was measured to be 66 nM, and the selected ssDNA (SC25) was Entero It was confirmed that it exhibits a high level of binding strength to Bacter Sakazaki.

2.2 Analysis of Selectivity for Enterobacter Sakazaki

In order to confirm the selectivity of the selected ssDNA to Enterobacter saczakaki, Escherichia coli , Shigella sonnei , Enterobacter aerogenes , Staphylococcus xylosus , Bacillus cereus Selectivity analysis was performed using five different bacteria, including. The experiment was performed by reacting 100uL (10 ⁷ CFU) of each bacteria and 100uL of 100nM ssDNA at room temperature for 20 minutes, washing with PBS buffer, and measuring and comparing the fluorescence intensity of the bacteria-ssDNA complex.

As a result of comparing the ratio of the fluorescence intensity of the target Enterobacter Sakazaki (KCTC 2949)-ssDNA complex and the fluorescence intensity of five other bacteria-ssDNA complexes, as shown in FIG. 4, the selected ssDNA (SC25) is a target Compared to in Enterobacter Sakazaki, when mixed with Escherichia coli, Shigella, Enterobacter, Staphylococcus, and Bacillus, the fluorescence intensity is very low, less than 10%, so that the selected ssDNA (SC25) is It was confirmed that it has significant selectivity.

From the above results, it can be confirmed that DNA aptamer (SC25) containing the nucleotide sequence of SEQ ID NO: 1 among the Enterobacter saccharin-specific DNA aptamers prepared in Example 1 exhibits a remarkably high level of Enterobacter saccharin binding and selectivity. have.

Example 3. Confirmation of the detection ability of Enterobacter Sakazaki in powdered milk prepared with SC25 aptamer

In Example 2, it was predicted that the binding power to Enterobacter Sakazaki would be high, and the binding power and selectivity of the selected ssDNA aptamer (SC25) was confirmed by using PBS as a medium. In consideration of the point, the functionality of the selected ssDNA aptamer was further confirmed in an environment where the medium is a formula.

Specifically, in order to confirm the functionality of the selected ssDNA aptamer (SC25) in an environment where the medium is a formula, Enterobacter Sakazaki (KCTC 2949) was inoculated into the culture ^{solution and the concentration was 10 8} CFU/mL at 37°C. Incubated until reached. Next, in order to remove the culture solution from the Enterobacter sakazaki solution, it was washed three times using a PBS buffer and then suspended in the PBS buffer. Formulated milk was dissolved in 100 ml of distilled water, dissolved in 100 ml of distilled water, and diluted 100 times after dissolving it at 37°C, referring to the description of the formula. 100uL (10 ⁷ CFU) of Enterobacter Sakazaki was mixed with 100uL of a dilution of formula, and then 200uL of fluorescently labeled ssDNA (100nM) was mixed and reacted at room temperature for 20 minutes. After the reaction, in order to remove ssDNAs and impurities that did not bind to the surface of Enterobacter Sakazaki, it was washed three times using a PBS buffer, and then the fluorescence intensity of the Enterobacter Sakazaki-ssDNA complex was measured using a fluorescence analyzer.

As a result of comparing the fluorescence intensity of Enterobacter Sakazaki-ssDNA complex in medium PBS and Enterobacter Sakazaki-ssDNA complex in medium formula, as shown in FIG. 6, the selected ssDNA aptamer (SC25 ) Showed a specific high level of binding power to Enterobacter Sakazaki even in general formula, where the medium is not PBS.

From the above results, it can be confirmed that the avidity and selectivity of the ssDNA aptamer are normally activated in the formula, not in PBS, but in the formula mainly derived from Enterobacter sakazaki.

From the above results, it was confirmed that the DNA aptamer comprising the nucleotide sequence of SEQ ID NO: 1 of the present invention can specifically bind to Enterobacter sakazaki with high avidity and selectivity, and thus can be utilized for the detection of Enterobacter sakazaki.

<110> KOREA INSTITUTE OF SCIENCE AND TECHNOLOGY <120> A nucleic acid aptamer specifically binding to Enterobacter sakazakii and the use thereof <130> PN129200 <160> 35 <170> KoPatentIn 3.0 <210> 1 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> SC25 ssDNA <400> 1 aggggtgggc gggtgcggtg gttcggcgac attcggttta tggt 44 <210> 2 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> SC1 ssDNA <400> 2 cttgacaaac ttgacgatag ggctacacag tatacttacc cggtt 45 <210> 3 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> SC2 ssDNA <400> 3 gagtcagtac tcagtattga catctccaga cgcgcatgat agtt 44 <210> 4 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> SC3 ssDNA <400> 4 ggcgacttga tctgtcgggg gcgtccctgc tgaccatggt tgcat 45 <210> 5 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> SC5 ssDNA <400> 5 gcatttaact tatcctgtgg ccacttttac tgacttctgt ggagc 45 <210> 6 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> SC7 ssDNA <400> 6 aatattttat caagtcccaa tgctcgtatt ccgactttag cttat 45 <210> 7 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> SC11 ssDNA <400> 7 tgcggtagtg atttgcgggg tcatagtagc ggtttttggg gggtt 45 <210> 8 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> SC12 ssDNA <400> 8 cgctgtgcag tatggttggg ttggtgtgag ggtctttttc attgt 45 <210> 9 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> SC15 ssDNA <400> 9 acccatcata accacgtgac atcttgccag ggccatctgg ctggt 45 <210> 10 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> SC16 ssDNA <400> 10 tcatgttgtt gatgacaaat agggcgtcgg ttattcaccc tagg 44 <210> 11 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> SC17 ssDNA <400> 11 tccgagcgca ctctcgctgc gcaggatcga ttttctagct ttgg 44 <210> 12 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> SC19 ssDNA <400> 12 ctacagggga ataattattt tagcggggct ttggaagtcc gtct 44 <210> 13 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> SC20 ssDNA <400> 13 gttgaggaac ctgttggtat tgccaggtgg gagggaggcc cttta 45 <210> 14 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> SC22 ssDNA <400> 14 ccatgagtgt tgtgaaatgt tgggacacta ggtggcatag agccg 45 <210> 15 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> SC23 ssDNA <400> 15 caacgcatcc caatcaaacc cgcgggccta tcgctttaat ctga 44 <210> 16 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> SC24 ssDNA <400> 16 cgacagtact caatatatcg aattgtaatt ggcactcacg ttagg 45 <210> 17 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> SC28 ssDNA <400> 17 ccatgagtgt tggtgaaatg ttgggacact aggtggcata gagccg 46 <210> 18 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> SC30 ssDNA <400> 18 aaatcttacg gtggtacatg gcccgtggcg gccagggtcc aaagt 45 <210> 19 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> SC31 ssDNA <400> 19 tacggaggat gtataggacc ctttgtctct gtttgaagta atatc 45 <210> 20 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> SC33 ssDNA <400> 20 tccaccccgg tggtagtgtg gttttgaaaa tcctactagg gtgtg 45 <210> 21 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> SC34 ssDNA <400> 21 aatgagtgtt gtgaatgttg ggacactagg tggcatagag ccg 43 <210> 22 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> SC36 ssDNA <400> 22 ttggctacgg cggtgacctt agttagggtg tgtttaattc gccgt 45 <210> 23 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> SC39 ssDNA <400> 23 tacaaaaccc ctcttgtgat cgggcggaca gttaacctgc tccta 45 <210> 24 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> SC40 ssDNA <400> 24 cgggaagtcg tagttagtgt tacttctact ctgcgctgtt cacgg 45 <210> 25 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> SC41 ssDNA <400> 25 ccttatgaac tttgaactgt tctgggttac tgcttccgag attcg 45 <210> 26 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> SC42 ssDNA <400> 26 aggggtgggc gggtgcggtg gttcggcgac attcggttta tggt 44 <210> 27 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> SC43 ssDNA <400> 27 agtccattga ctgtggaatc tgcagtgtgt ttggctgcct ttgct 45 <210> 28 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> SC45 ssDNA <400> 28 gcagggctgg cacttagtgt ggtgggtctg gtgtattgga cttaa 45 <210> 29 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> SC47 ssDNA <400> 29 attagcctgg ctcgttaatg acctatactc catggtttgt aaggt 45 <210> 30 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> SC48 ssDNA <400> 30 tgggttggaa tcgacggaag ctatcttcta gtgcaatggt tctgc 45 <210> 31 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> SC49 ssDNA <400> 31 gtcttcgttg ttcattttat ccgtgtgggg gcgttctgtc ttt 43 <210> 32 <211> 88 <212> DNA <213> Artificial Sequence <220> <223> ssDNA library <400> 32 gcaatggtac ggtacttccn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnncaaaag tgcacgctac tttgctaa 88 <210> 33 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer_forward <400> 33 gcaatggtac ggtacttcc 19 <210> 34 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> primer_reverse <400> 34 ttagcaaagt agcgtgcact tttg 24 <210> 35 <211> 87 <212> DNA <213> Artificial Sequence <220> <223> nucleic acid aptamer specifically binding to Enterobacter sakazakii <400> 35 gcaatggtac ggtacttcca ggggtgggcg ggtgcggtgg ttcggcgaca ttcggtttat 60 ggtcaaaagt gcacgctact ttgctaa 87

Claims (12)

Nucleic acid aptamer that specifically binds Enterobacter sakazaki. The nucleic acid aptamer according to claim 1, wherein, as an aptamer consisting of the nucleotide sequence of SEQ ID NO: 1, when the nucleic acid aptamer is RNA, T in the nucleotide sequence is U. The nucleic acid aptamer according to claim 1, wherein, as an aptamer consisting of the nucleotide sequence of SEQ ID NO: 35, when the nucleic acid aptamer is RNA, T in the nucleotide sequence is U. The aptamer of claim 1, further comprising a detectable labeling substance. A composition for detecting Enterobacter Sakazaki comprising the aptamer of any one of claims 1 to 4. Enterobacter Sakazaki detection kit comprising the aptamer of any one of claims 1 to 4. The kit of claim 6, wherein the aptamer is immobilized on a substrate. The kit of claim 7, wherein the substrate is a bead, a membrane, a microtiter plate, or a chip. Contacting the aptamer of any one of claims 1 to 4 with a sample; And
A method of detecting Enterobacter sacazaki in a sample comprising the step of determining whether Enterobacter saczaki is bound to the aptamer. Forming a complex of Enterobacter sakazaki and aptamer by contacting the aptamer of any one of claims 1 to 4 with a sample; And
A method for removing Enterobacter sakazaki from a sample comprising the step of removing the complex. Culturing Enterobacter Sakazaki;
Mixing a single-stranded DNA (ssDNA) library with the cultured Enterobacter Sakazaki to induce binding of ssDNA to Enterobacter Sakazaki;
Washing to remove ssDNA that is not bound to Enterobacter saczaki or bound with low avidity;
A method of producing a nucleic acid aptamer specifically binding to Enterobacter saczaki, comprising the step of isolating and amplifying ssDNA bound to Enterobacter saczaki. The method of claim 11, wherein the ssDNA library consists of the nucleotide sequence of SEQ ID NO: 32.

Images