JP2006166711A - Simple method for amplifying feces-derived gene - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To establish and provide a method for simply amplifying the objective gene without separating and purifying a nucleic acid from feces as opposed to the conventional methods. <P>SOLUTION: The method for amplifying the gene obtained from the feces comprises (a) a step of dissolving the feces with a dissolving liquid, (b) a step of soaking filter paper with the resultant dissolved liquid and (c) a step of directly bringing the resultant filter paper into contact with a reaction solution for the gene amplification and carrying out the gene amplification. Since the nucleic acid contained in the feces can be separated and adsorbed with the filter paper and the filter paper can directly be used for the gene amplification reaction, the objective gene in the feces can simply and efficiently be amplified without passing through the separation and purification of the nucleic acid as opposed to the conventional methods. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

  The present invention is a method for simply amplifying a target gene by a nucleic acid amplification reaction from nucleic acid stool without nucleic acid purification.

  Using intestinal flora and pathogenic bacteria, viruses, or other digestive tract mucosal cells, malignant neoplastic cells, neoplastic cells, and gene fragments present in the secretions of mammals, It is very useful for investigating the cause of various types of diseases and for diagnosing the disease, for the purpose of grasping the health condition of individuals and early detection of malignant neoplasms. However, the current technology for separating and purifying genes in stool is complicated and time-consuming.

  For example, when it is desired to identify pathogenic bacteria as current analysis means, it is necessary to dilute the target sample (individual stool) with a diluent, spread it on various selective media, and perform anaerobic culture. there were. However, the culture takes several days to several weeks, and operations such as counting the number of colonies are complicated.

  On the other hand, in recent years, phylogenetic classification and identification methods using molecular biological methods have attracted attention as reliable methods. Specific probes and primers targeting various genes enable rapid and specific detection of a wide variety of bacteria, which are becoming key technologies in the detection of microorganisms. In particular, the method using a specific PCR primer can detect / identify a target bacterium simply, rapidly and accurately.

  Further, it has been pointed out that the utility of screening for colon cancer, for example, by identifying genetic mutations in malignant neoplastic cells present in feces (Non-patent Document 1).

  In general, DNA is isolated from stool by dissolving the stool in an alkaline lysate, followed by centrifugation and alcohol precipitation.

  In the past, DNA from microorganisms has been isolated by washing the sample with phosphate buffer (PBS) or the like, crushing the cells using the benzyl chloride method, denaturing the protein, and precipitating with alcohol. It was. However, it has been pointed out that this method hardly recovers DNA from some bacteria such as Gram-positive cocci.

  In addition, recently, when isolating DNA from a sample, a method of crushing bacterial cells by adding beads with a diameter of about 0.1 mm and shaking vigorously in the presence of phenol has been widely used. According to the method, DNA can be efficiently isolated from a wide variety of bacteria (Non-patent Document 2).

  However, it is known that feces contain substances that inhibit the reaction (such as spoilage acid) in amplification reactions such as PCR, and it is considered that these methods have problems in removing these inhibitors. ing.

  As commercial products for DNA isolation, MagExtractor (manufactured by Toyobo) and QIAamp Stool DNA Isolation Kit (manufactured by QIAGEN) are sold. The former involves crushing bacterial cells with beads and then recovering the DNA adsorbed on the beads with magnetic beads, but there is a problem in that the yield of DNA is poor. On the other hand, the latter is to denature cell membrane proteins by heating to isolate DNA, but this method also has a problem in yield.

  There is also a method of extracting nucleic acids by using beads and gel filtration (Patent Document 1), but the complexity of the work process and the deterioration of direct workability cannot be avoided.

  Moreover, the method (patent document 2) which performs nucleic acid extraction from feces using dry filter paper stool requires the following steps (1) to (4).

(1) Take dried stool in a microtube together with filter paper, EDTA as an inhibitor of DNA-degrading enzyme, and a cationic surfactant for removing ion pairs of anionic polymorphs; cetyltrimethylammonium bromide (hereinafter CTAB) ) And a high salt concentration extraction solution is added to perform boiling.
(2) Next, after adding chloroform and mixing, the mixture is centrifuged to remove the anionic polysaccharide-CTAB pair, excess CTAB, fecal residue components and filter paper in the lower chloroform layer, and the target DNA solution in the upper water layer. Separate into layers.
(3) The obtained aqueous layer is collected in a new tube, and 2-propanol is added to the aqueous layer obtained by repeating extraction with chloroform again, followed by centrifugation to obtain a DNA precipitate.
(4) After washing the precipitate with 70% ethanol, a Tris buffer-EDTA solution is added to obtain a final DNA solution.

Thus, separating and purifying DNA from stool itself is complicated and lacks practicality.
Sidransky D. et. Al. 1992. Identification of ras oncogene mutations in the stool of patients with curable colorectal tumors. Science. Apr 3; 256 (5053): 102-5 Wilson, KH and RB Blithington. 1996. Human colonic biota studied by ribosomal DNA sequence analysis. Appl. Environ. Microbiol. 62: 2273-2278 JP 2002-306175 A Japanese Patent Laid-Open No. 2001-221721

  The problem to be solved by the present invention is to establish and provide a method for simply amplifying a target gene without separating and purifying DNA from stool in the conventional manner.

  In order to solve the above problems, the present inventors dissolved feces in a solution, and included the solution in filter paper, and separated the substance that inhibits the reaction and the nucleic acid contained in the feces into the filter paper, By adsorbing and using the filter paper directly in the PCR reaction, the nucleic acid contained in the stool was completed easily and efficiently without a conventional nucleic acid separation and purification step.

That is, this invention consists of the following.
1. A method for amplifying a gene obtained from stool comprising the following steps:
(A) a step of dissolving feces with a solution;
(B) including a solution in which feces are dissolved in filter paper;
(C) A step of performing gene amplification by directly contacting the obtained filter paper with a gene amplification reaction solution.
2. The method according to item 1 above, wherein the solution obtained by dissolving the stool obtained in step (a) is treated to denature the membrane protein of the microorganism.
3. The method according to item 1 above, wherein the amplification reaction inhibitor and the gene in the solution in which stool is dissolved are separated by the step (b).
4). 4. A method for analyzing a gene present in feces, wherein the target gene is identified by performing PCR using a specific primer of the target gene in the step (c) of the amplification method according to items 1 to 3.
5. Using the gene amplification product obtained by the amplification method of 1 to 3 above, hybridization using a DNA chip, clone library method, denaturing gradient gel electrophoresis (DGGE method), temperature gradient gel electrophoresis (TGGE) ) Method or SSCP method to detect and identify disease-related genes.
6). Using the gene amplification product obtained by the amplification method of 1 to 3 above, hybridization using a DNA chip, clone library method, denaturing gradient gel electrophoresis (DGGE method), temperature gradient gel electrophoresis (TGGE) ) Method or SSCP method to specifically detect and identify microorganisms.
7). Reagent kit including at least the following components for performing the amplification method according to items 1 to 3 above:
(1) Solution for stool dissolution;
(2) Filter paper for gene separation.

  According to the method of the present invention, it is possible to easily amplify a target gene from feces by an amplification reaction such as PCR without separating and purifying nucleic acid as in the prior art.

  In the present invention, stool is excrement obtained from mammals. Feces include intestinal mucosal cells, blood cells, intestinal cell flora, pathogenic microorganisms (eg, bacteria and viruses), intestinal neoplasia (including colon cancer and polyps), and the like. In the present invention, genes refer to various disease-related genes and microbial-related genes contained in feces, and examples include causative genes such as genetic diseases, colon cancer tissue-derived genes, or bacteria-derived genes.

[Step (a)]
In the present invention, first, stool is dissolved. This step is performed to dissolve the solid matter contained in the stool. A known stool solution can be used. For example, a Tris-EDTA buffer or 8.4% (1M) sodium hydrogen carbonate solution can be used. Preferably, a solution containing a Tris-EDTA buffer and having a pH value of about 9 can be used. The addition amount of the lysis solution is desirably 0.1 to 100 μL, preferably 1 to 30 μL, more preferably around 3 to 7 μL per 1 mg of stool to be dissolved. When a gene of a microorganism such as an enteric bacterium is aimed, the membrane protein of the microorganism can be denatured. In order to denature the membrane protein, for example, stool is dissolved in a solution, and then heat treatment (for example, 60 to 95 ° C., 10 minutes to 10 hours) may be performed.

[Step (b)]
Next, a solution in which stool is dissolved is included in the filter paper. The filter paper may be directly contacted with the lysate obtained in the step (a) without performing centrifugation, but it is more preferable to contact the filter paper with the supernatant obtained after appropriate centrifugation. . Centrifugation may be suitably performed at a rotational speed of 3000 to 8000 rpm, preferably 4000 to 6000 rpm, more preferably around 5,000 rpm, for 1 minute to 5 minutes.

The filter paper to be used preferably has a retention particle diameter of 1 to 7 μm. The retained particle size referred to here refers to a value obtained from the leaked particle size when barium sulfate or the like specified in JIS P 3801 [filter paper (for chemical analysis)] is naturally filtered. Moreover, you may use the filter paper which attached the anion exchange ability. Examples of commercially available products include ADVANTEC standard filter paper No. 2 and No. 26, and high-purity filter paper No. 5B.
The size of the filter paper depends on the amount of the sample solution, but generally a rectangular shape having a length of 10 to 200 mm and a width of 1 to 10 mm is used. The thickness of the filter paper is generally 0.2 to 0.8 mm.

The contact between the filter paper and the solution is performed by immersing 2 to 10 mm at the tip of the filter paper in the solution for 0.5 to 3 seconds. When the filter paper is immersed in a solution in which stool is dissolved after centrifugation, the filter paper containing the solution may be used for the amplification reaction in step (c) by contacting only the supernatant of the solution. In addition, when filter paper is immersed in a solution in which stool is not centrifuged, the upper part of the filter paper that is colored by contact with the stool solution is used for the amplification reaction in step (c). Is preferred.
The sample absorbed by the filter paper is naturally developed by the surface tension of the filter paper, and the genes are separated. Thus, the filter paper can be used to separate the gene from the amplification reaction inhibitor, such as rot acid, present in the solution.
If desired, a hanging process may be performed under suction conditions (eg, in a vacuum pump) to enhance the development of the filter paper. The expansion is sufficient at room temperature, but it is more preferable to carry out at a humidity of 40 to 60% and a temperature of 15 to 37 ° C.

[Step (c)]
Next, a gene amplification reaction is performed. Currently known methods can be applied to gene amplification. Specifically, polymerase chain reaction method (PCR method, Science, 230: 1350-1354, 1985), NASBA method (Nucleic Acid Sequence Based Amplification method, Nature, 350, 91-92, 1991) and LAMP method ( JP, 2001-242169, A) etc. are mentioned, Preferably PCR method can be applied. Hereinafter, the PCR method will be described as an example.
In step (c), immerse the filter paper obtained in step (b) in a PCR reaction mixture solution containing the primer of the gene of interest to be amplified, and (i) immerse the filter paper in the PCR reaction mixture solution for several seconds. There are two methods: a method of removing the filter paper and performing PCR, and a method of (ii) cutting out the necessary portion of the filter paper obtained in step (b) and performing the PCR while the cut filter paper is kept in the PCR reaction mixture solution. Is possible. Which method is used can be selected according to the situation. As the PCR buffer, it is preferable to use Ampdirect crude DNA buffer (Shimadzu Corporation), but widely known PCR buffers can be used.

  The present invention can detect and identify the gene after amplifying the target gene by performing the gene amplification reaction using the obtained filter paper in the above method and using a specific primer. It is. Therefore, it is possible to provide a method for analyzing genes present in stool, for example, various disease-related gene markers such as tumor markers in stool and microorganism-related genes.

  Furthermore, using the gene amplification product obtained by the method of the present invention, hybridization using a DNA chip, clone library method, denaturing gradient gel electrophoresis (DGGE method), temperature gradient gel electrophoresis (TGGE) ) Method and SSCP method, for example, it is possible to detect various diseases such as genetic diseases and tumors, or to specifically detect and identify microorganisms constituting the microflora in feces.

The present invention extends to a fecal dissolution solution that can be used in the gene amplification method and a reagent kit including a gene separation filter paper.
Specific embodiments are shown below.

(Example 1) Preparation of filter paper containing fecal solution A solution (Lysis buffer) having a composition of 500 mmol / L Tris-HCl, 16 mmol / L EDTA, 10 mmol / L NaCl, pH 9.0 was prepared as a fecal solution. . 100 mg of stool was taken in a 1.5 ml tube and 500 μL of Lysis buffer was added to dissolve the stool. About 20 μL of Lysis buffer is desirable for 20 mg of stool to be dissolved. The solution in which stool was dissolved was subjected to heat treatment at 95 ° C. for 10 minutes. After centrifugation at 5,000 rpm for 5 minutes, filter paper was applied to the supernatant. In this example, ADVANTEC standard filter paper No. 2 was used as the filter paper. Next, dry the filter paper containing the supernatant, immerse the filter paper containing the supernatant directly in the PCR reaction mixture for 2 to 3 seconds, and lightly rinse the DNA present in the stool for PCR reaction mixing. Extracted into the solution (FIGS. 1-6).

(Example 2) Amplification of gene in stool Using the filter paper obtained by the method of Example 1, the KRAS gene and BRAF gene present in stool and the thrA gene of Escherichia coli were amplified. (A) Primer pair (FK-F: 5'-TGACTGAATATAAACTTGTGGTAG, FK-106R: 5'- ATTGTTGGATCATATTCGTC), (B) ) Primer pair (FB-F: 5'-TAGGTGATTTTGGTCTAGCT, FB-115R: 5'-ATCAGTGGAAAAATAGCCTC), (C) Primer pair that amplifies ThrA gene specific for Escherichia coli (thrA-) F: 5'- CCCCGCCAAAATCACCAACCATCT, thrA-101R: 5'- CGGCAAAAATACGTTCGGCATCG), (D) including a primer pair that amplifies the KRAS gene described in (A) and a primer pair that amplifies the BRAF gene described in (B) DNA was extracted by rinsing each in 50 μL of the PCR reaction mixture solution. In each of the gene amplification reactions (A), (B), (C), and (D), 40 cycles of PCR reaction were performed under the condition of an annealing temperature of 53 ° C. Thereafter, electrophoresis was performed on a 3% agarose gel to confirm that the target gene was amplified (FIGS. 5 to 10).

  By using the method of the present invention, amplification and detection of a target gene from stool can be performed very easily without purifying and extracting nucleic acid from a stool sample as in the prior art. Therefore, by using the present invention, genetic diagnosis, early cancer diagnosis, and infectious disease diagnosis can be performed more rapidly and sensitively than before. According to the embodiment of the present invention, it is possible to detect a small amount of DNA derived from normal mucosal tissue and a small amount of colorectal cancer tissue DNA under conditions where a large amount of normal mucosal tissue-derived DNA exists. It was shown that direct detection of bacterial DNA is also possible with the present invention. Therefore, by using the present invention, genetic diagnosis from various stool can be performed extremely easily and reliably. The fact that fecal samples having unique information not found in other biological samples can be used practically and simply as non-invasive DNA materials is not only useful for diagnosis of various diseases, but also has many operations. Enables sample processing. Therefore, it can be applied to various types of examinations such as colorectal cancer targeting a normal population, and it is also possible to quickly detect causes such as mass-onset infections. The method of the present invention can be expected to contribute to preventive medicine, which has become increasingly important in recent years, and to be applied to rapid diagnosis of infectious diseases that cause mass onset.

It is a figure which shows dissolution of feces. Example 1 It is a figure which shows centrifugation of a solution. Example 1 It is a figure which shows adsorption | suction and drying using a filter paper. Example 1 It is a figure which shows gene extraction. Example 1 It is a figure which shows an example of melt | dissolution of feces. Example 1 It is a figure which shows an example of what adsorb | sucked and dried the stool solution using the filter paper. Example 1 It is a figure which shows the amplification result of a KRAS gene. (Example 2) It is a figure which shows the amplification result of a BRAF gene. (Example 2) It is a figure which shows the amplification result of ThrA gene (Escherichia coli origin). (Example 2) It is a figure which shows the result of simultaneous amplification of a KRAS gene and a BRAF gene. (Example 2)

Claims (7)

A method for amplifying a gene obtained from stool comprising the following steps:
(A) a step of dissolving feces with a solution;
(B) including a solution in which feces are dissolved in filter paper;
(C) A step of performing gene amplification by directly contacting the obtained filter paper with a gene amplification reaction solution. The method according to claim 1, wherein the stool-dissolved solution obtained in step (a) is treated to denature microbial membrane proteins. The method according to claim 1, wherein the amplification reaction inhibitor and the gene in the solution in which stool is dissolved are separated by the step (b). The analysis method of the gene which exists in feces which identifies the target gene by performing PCR using the specific primer of a target gene in the process (c) of the amplification method of Claims 1-3. Using the gene amplification product obtained by the amplification method of claims 1 to 3, hybridization using a DNA chip, clone library method, denaturing gradient gel electrophoresis method (DGGE method), temperature gradient gel electrophoresis method ( A method for detecting and identifying a disease-related gene by the (TGGE) method or the SSCP method. Using the gene amplification product obtained by the amplification method of claims 1 to 3, hybridization using a DNA chip, clone library method, denaturing gradient gel electrophoresis method (DGGE method), temperature gradient gel electrophoresis method ( TGGE) method or SSCP method to specifically detect and identify microorganisms. Reagent kit comprising at least the following components for performing the amplification method according to claims 1 to 3:
(1) Solution for stool dissolution;
(2) Filter paper for gene separation.