WO2006064739A1

WO2006064739A1 - Method of treating biological sample for performing nucleic acid amplification

Info

Publication number: WO2006064739A1
Application number: PCT/JP2005/022676
Authority: WO
Inventors: Takeshi Nagasaka; Nagahide Matsubara; Noriaki Tanaka
Original assignee: National University Corporation Okayama University
Priority date: 2004-12-13
Filing date: 2005-12-09
Publication date: 2006-06-22
Also published as: JP2006166711A

Abstract

It is intended to establish and provide a treatment method for conveniently extracting a nucleic acid in amplifying a target gene-origin nucleic acid likely contained in a biological sample without separating and purifying a nucleic acid such as a DNA from the sample by using complicated procedures as in the existing methods. Namely, a method which comprises: (a) the step of dissolving a biological sample in a buffer solution for dissolving the sample; (b) the step of impregnating a development support with the resultant solution; and (c) the step of bringing the development support into contact with a nucleic acid amplification solution. According to this method, a target gene-origin nucleic acid in a biological sample can be conveniently and efficiently amplified without resorting to complicated procedures for separating and purifying the nucleic acid.

Description

Specification

Biological sample processing method for nucleic acid amplification reaction

Technical field

[0001] The present invention provides a nucleic acid derived from a target gene without separating and purifying the nucleic acid from the sample by a complicated process as in the prior art when amplifying a nucleic acid that may be contained in a biological sample. It is related with the processing method for extracting easily from a sample. Furthermore, the present invention relates to a method for amplifying a nucleic acid using the treatment method.

[0002] This application claims the priority of Japanese Patent Application No. 2004-359468, which is incorporated herein by reference.

Background art

[0003] Intestinal flora and pathogenic bacteria, viruses, or other gene fragments present in mammalian digestive tract mucosal cells, malignant neoplastic cells, neoplastic cells, and secretions It is very useful for understanding the health status of individuals and for early detection of malignant neoplasms. However, the current technology for separating and purifying genes in stool is cumbersome and laborious.

[0004] As a current analysis means, for example, if a pathogenic bacterium has been identified,

It was necessary to dilute the stool (individual stool) with a diluting solution and spread it on various selective media for anaerobic culture. However, the culture requires several days and several weeks, and the operation is complicated, such as counting the number of colonies.

[0005] On the other hand, in recent years, phylogenetic classification using molecular biological methods has attracted attention as a reliable method. Specific probe probes that target various genes enable rapid and specific detection of a wide variety of bacteria, which are becoming key technologies in the detection of microorganisms. In particular, a method using a polymerase 'chain' reaction method (PCR method) can easily and quickly 'accurately detect a target bacterium or the like'.

[0006] In addition, it has been pointed out that the identification of genetic mutations in malignant neoplastic cells present in feces is useful, for example, that screening for colon cancer and the like is possible (Non-Patent Documents). D o

[0007] Nucleic acids isolated from stool force are generally obtained by dissolving stool in an alkaline lysate, centrifuging, and destroying alcohol.

[0008] In addition, nucleic acids from microorganisms are isolated by washing the sample with a phosphate buffer (PBS) or the like, crushing the cells by the salt benzil method, denaturing the protein, and precipitating with alcohol. It was broken. However, it has been pointed out that this method hardly recovers nucleic acid from some bacteria such as Gram-positive cocci.

[0009] In addition, recently, when isolating nucleic acids from a sample, a method of crushing bacterial cells by collecting beads with a diameter of about 0.1 mm and shaking vigorously in the presence of phenol has been widely used. According to this method, nucleic acids can be efficiently isolated from a wide variety of species (Non-patent Document 2).

[0010] However, stool and other specimens contain substances that inhibit the reaction in PCR and other amplification reactions (such as spoilage acid). There are thought to be problems in the removal of inhibitors.

MagExtractor (manufactured by Toyobo) and QIAamp Stool DNA Isolation Kit (manufactured by QIAGEN) are on the market as commercially available nucleic acid isolation kits. The former has a problem that the yield of nucleic acid is poor because the nucleic acid adsorbed on the beads is recovered with magnetic beads after the cells are crushed with beads. On the other hand, the latter is a method in which cell membrane proteins are denatured by heating and nucleic acids are isolated, but this method also has a problem in yield.

[0012] There is also a method for extracting nucleic acids by using beads and gel filtration (Patent Document 1). Force The complexity of the work process and the direct workability cannot be avoided.

[0013] In addition, there is also disclosed a method for extracting fecal force and DNA using a piece of dry filter paper (Patent Document 2). However, the filter paper described in this document contains a stool sample that is not directly related to DNA extraction, and can be easily collected for handling such as transportation and storage by enclosing it in a plastic bag. Is. In order to extract DNA from stool samples contained in filter paper, the following steps (1) to (4) are required.

[0014] (1) Take dry stool together with filter paper in a microtube, use EDT A as an inhibitor of DNA-degrading enzyme, and cationic surfactant for removing ion pairs of anionic polysaccharides; Add a high salt concentration extraction solution containing methylammonium bromide (CTAB) and boil.

(2) Next, clot form is added and mixed, and then centrifuged to remove the anionic polysaccharide-CT AB pair, excess CTAB, fecal residue components and filter paper into the lower form layer of the target DNA. The solution separates into an upper aqueous layer.

(3) Separate the obtained aqueous layer into a new tube, and again repeat the extraction procedure with chloroform, and add 2-propanol to the obtained aqueous layer and centrifuge to obtain DNA precipitate.

(4) After washing the precipitate with 70% ethanol, cover the Tris buffer-EDTA solution to obtain the final DNA solution.

[0015] In the above method, the operation for extracting fecal DNA is complicated.

Non-Patent Literature 1: Sidransky D. et. Al. 1992.Identincation of ras oncogene mutations in the stool of patients with curable colorectal tumors. Science. Apr. 3; 256 (5053): 102

- Five

Non-Patent Document 2: Wilson, K. Η. And R. Β. Blithington. 1996. Human colonic biota studied by ribosomal DNA sequence analysis. Appl. Environ. Micro Diol. 62: 2273-2278 — Publication No. 306175

Patent Document 2: JP 2001-221721 A

Disclosure of the invention

Problems to be solved by the invention

[0016] The problem to be solved by the present invention is to separate and purify nucleic acid such as sample force DNA by a complicated process when amplifying a nucleic acid derived from a target gene that may be contained in a biological sample. It is to establish and provide a treatment method for extracting nucleic acids easily.

Means for solving the problem

[0017] In order to solve the above problems, the present inventors have conducted extensive research, and as a result, dissolved a biological sample in a lysis solution, and contained the lysis solution in a carrier for development, thereby inhibiting the reaction. And the nucleic acid contained in the sample is separated and adsorbed on the development carrier, the development carrier can be directly used for the nucleic acid amplification reaction, and it may be contained in a biological sample. The method of the present invention was completed by successfully amplifying a nucleic acid derived from a target gene simply and efficiently.

That is, the present invention comprises the following.

1. A method of processing a biological sample to amplify nucleic acid derived from a gene that may be contained in the biological sample, including the following steps:

(a) lysing the biological sample with a lysis buffer;

(b) including a sample solution in which a biological sample is dissolved in a developing carrier;

(c) A step of directly contacting the obtained development carrier with a nucleic acid amplification reaction solution containing a target nucleic acid-specific primer.

2. The processing method according to item 1 above, which comprises the step of heating the sample solution obtained in the step (a) at 60 to 95 ° C. for 10 minutes to 10 hours.

3. The treatment method according to item 1 or 2 above, wherein the amplification reaction inhibitor and nucleic acid in the solution in which the biological sample is dissolved are separated by the step (b).

4. A method for amplifying a nucleic acid using the treatment method according to any one of items 1 to 3, wherein the nucleic acid amplification reaction solution obtained in the step (c) is subjected to a nucleic acid amplification treatment.

5. A method for analyzing a gene present in a biological sample, wherein a target gene is identified from the nucleic acid amplification product obtained by the amplification method described in item 4 above.

6. The method for analyzing a gene according to item 5 above, wherein the gene present in the biological sample is a disease-related gene or a microorganism-derived gene.

The invention's effect

[0019] According to the method of the present invention, a nucleic acid derived from a target gene can be easily extracted from a biological sample without being separated and purified by a complicated process as in the past, and a nucleic acid amplification reaction can be performed. It becomes.

Brief Description of Drawings

[0020] FIG. 1 is an explanatory diagram for preparing a stool solution by adding stool to a sample dissolution buffer. (Example 1)

FIG. 2 is a view showing a state where a fecal lysate is centrifuged and separated into a supernatant and a precipitate. (Example 1) FIG. 3 is a view showing a state in which a developing carrier is immersed in a supernatant portion of a stool solution, and the developing carrier including the supernatant portion is dried. (Example 1)

FIG. 4 is a view showing a state in which a nucleic acid is extracted by immersing a development carrier including a supernatant portion in a PCR buffer solution. (Example 1)

FIG. 5 is a diagram showing an example of a sample solution when stool is used as a sample. (Example 1)

FIG. 6 is a diagram showing an example of a sample solution adsorbed and dried using a developing carrier.

(Example 1)

FIG. 7 shows the results of amplification of the KRAS gene. (Example 2)

FIG. 8 shows the results of BRAF gene amplification. (Example 2)

FIG. 9 shows the results of amplification of ThrA gene (derived from E. coli). (Example 2)

FIG. 10 shows the results of simultaneous amplification of KRAS gene and BRAF gene. (Example 2) Explanation of symbols

[0021] a feces

b Sample lysis buffer

c Fecal solution

cl Fecal solution (precipitation)

c2 Fecal solution (supernatant)

d Unfolding carrier (filter paper)

e Buffer for PCR

SM size marker

BEST MODE FOR CARRYING OUT THE INVENTION

[0022] In the present invention, "biological sample" refers to tissues, blood, serum, feces, urine, semen, sputum, saliva, nasal discharge, cerebrospinal fluid, tears, and other body fluids collected from mammals. Particularly preferred is feces. Feces are excrement obtained from mammals. Feces include intestinal mucosa cells, blood cells, intestinal cell flora, pathogenic microorganisms (eg, bacteria and viruses), and intestinal neoplasia (including colon cancer and polyps).

[0023] In the present invention, "genes that may be contained in a biological sample" refers to various disease-related genes and microorganism-related genes that may be contained in a biological sample. Examples include genes causing genetic diseases, genes derived from colon cancer tissue, genes derived from resident bacteria (microbes, viruses, etc.), and the like. In the present invention, a “gene-derived nucleic acid” is almost synonymous with a gene, but a DNA fragment or an RNA fragment containing a desired position necessary for analysis is not necessary, rather than a complete gene sequence. .

[0024] The biological sample processing method of the present invention is based on a method including at least the following steps.

[Step (a)] lysing the biological sample with a lysis buffer;

[Step (b)] A step of including a sample solution in which a biological sample is dissolved in a developing carrier;

[Step (c)] A step of bringing the obtained carrier for development directly into contact with a nucleic acid amplification reaction solution containing a target nucleic acid-specific primer.

[0025] [Step (a)]

In the treatment method of the present invention, in order to dissolve the solid matter contained in the sample, the biological sample is first dissolved. As the sample lysis buffer (hereinafter also simply referred to as “lysis solution”), a known solution can be used. For example, Tris-EDTA buffer or 8.4% (1M) sodium bicarbonate solution can be used as a stool sample solution, and a solution having a pH value of about 9 containing Tris-EDTA buffer is preferable. . The amount of lysate added to the biological sample can be determined in relation to the amount of sample. For example, a solution of about 0.1 to 100, preferably 1 to 30 and more preferably about 3 to 7 liters per lmg of sample can be used. The obtained solution is called a sample solution.

[0026] The sample solution is preferably further heated as desired. The heating is, for example, 60 to 95. C, can be performed for 10 minutes to 10 hours. By vigorous heat treatment, the protein contained in the sample solution can be denatured, and the subsequent steps can be performed more effectively. In addition, the sample solution that has been or has not been subjected to the heat treatment can be centrifuged, and the supernatant can be collected and subjected to the next step. Centrifugation may be appropriately performed at a rotational speed of about 3,000 to 8,000 rpm, preferably 4,000 to 6, OOO rpm, more preferably about 5,000 rpm for 1 to 5 minutes.

[0027] [Step (b)]

Next, the sample solution obtained by the above step (a) or the supernatant of the sample solution obtained by centrifugation is contained in the developing carrier. In the present invention, the “developing carrier” is not particularly limited as long as it can separate a component necessary for analysis and an unnecessary component by contacting a sample solution or a supernatant. The developing carrier having such a function is desirably one having a retention particle diameter of 1 to 7 m. The retained particle size here refers to the value obtained from the leaked particle size when barium sulfate or the like specified in JIS P 3801 [filter paper (for chemical analysis)] is naturally filtered. An example of such a developing carrier is filter paper (retained particle diameter of 1 to 7 m). The filter paper is not limited to paper, and examples thereof include liquid separation filter paper, chromatographic filter paper, glass fiber filter paper, composite fiber filter paper, silica fiber filter paper, polyflon filter, and cylindrical filter paper. Further, a filter paper having anion exchange ability may be used. Examples of commercially available products include ADVANTEC standard filter papers No. 2 and No. 26, and high purity filter paper No. 5B.

The size of the developing carrier depends on the amount of the sample solution. In general, a strip of 10 to 200 mm in length and 1 to 10 mm in width is preferably used. The thickness of the development carrier is generally 0.2 to 0.8 mm fc.

[0028] "Including the sample solution in the developing carrier" means immersing 2 to 10 mm of the tip of the developing carrier in the sample solution or supernatant obtained in the above step (a) for 0.5 to 3 seconds. It means to be immersed in.

[0029] The sample solution or supernatant soaked in the development carrier is naturally developed by the surface tension of the development carrier, and the nucleic acid contained in the sample solution is separated. The nucleic acid can be separated from the amplification reaction inhibitory substance, such as rot acid, present in the sample solution with the use of the carrier for expansion.

In order to enhance the development on the development carrier, a hanging process may be performed under suction conditions using, for example, a vacuum pump. Deployment is sufficient at room temperature, but humidity 40

More preferably, it is carried out at -60% and a temperature of 15-37 ° C.

[0030] The developing carrier containing the sample solution or the supernatant can be dried as necessary. For example, it can be dried under the above suction conditions, or it can be dried by air drying.

[0031] [Process (c)]

The development carrier obtained by the above step (b) is used as a nucleus containing a target nucleic acid-specific primer. Contact the acid amplification reaction solution. For example, immerse the carrier for development containing the supernatant of the sample solution in the nucleic acid amplification reaction solution in step (c)! In the case of a development carrier containing a sample solution, for example, a stool solution, the portion of the development carrier colored by contact with the stool solution is lightly colored. What is necessary is just to immerse in the said nucleic acid amplification reaction solution.

[0032] The "nucleic acid amplification reaction solution" may be a reaction solution used in a desired nucleic acid amplification method. Here, a currently known method can be applied as the nucleic acid amplification method. Specifically, PCR method (Science, 230: 1350-1354, 1985), NASBA method (Nucleic Acid Sequence Based Amplification method, Nature, 350, 91-92, 1991) and LAMP method (Japanese Patent Laid-Open No. 2001-242 169). The PCR method can be preferably applied. Hereinafter, the PCR method will be described as an example.

[0033] After the development carrier including the sample solution or the supernatant is immersed in the nucleic acid amplification reaction solution, the desired nucleic acid can be extracted into the nucleic acid reaction solution. The extracted nucleic acid can be subjected to the nucleic acid amplification treatment by either of the following methods (i) or (ii). You can choose which method to use depending on the situation. A PCR buffer can be used as the nucleic acid amplification reaction solution. As the PCR buffer, for example, Ampdirect crude DNA buffer (Shimadzu Corporation) is preferably used, but not limited to this, widely known PCR buffers can be used.

[0034] (Method of performing nucleic acid amplification treatment by immersing the development carrier obtained in step (b) in the nucleic acid amplification reaction solution for 0 seconds, and then removing the development carrier.

(ii) A method in which a necessary portion of the development carrier obtained in step (b) is cut out and nucleic acid amplification treatment is performed while the cut out development carrier is immersed in a nucleic acid amplification reaction solution.

[0035] Since the nucleic acid amplification reaction solution soaked with the above-described carrier for development contains a target nucleic acid-specific primer, the reaction solution is directly applied to a nucleic acid amplification processing apparatus to cause a nucleic acid amplification reaction. Can do.

[0036] The present invention also includes detecting and identifying the target gene using the nucleic acid amplification product obtained by the above method. For example, by performing hybridization using a DNA chip, a clone library method, denatured radish endogel electrophoresis (DGGE method), temperature dalaziendo gel electrophoresis (TGGE) method, SSCP method, for example, Various genetic diseases and tumors It is possible to detect and identify a disease or a specific microorganism that constitutes a microflora in feces.

For example, when the biological sample is feces, it is possible to provide a method for analyzing various disease-related gene markers such as genes present in the feces, tumor markers in the feces, and microorganism-related genes such as E. coli. .

[0037] The present invention extends to a reagent kit including a biological sample dissolving solution and a nucleic acid separation developing carrier that can be used in the nucleic acid amplification method.

Specific embodiments are shown below.

Example

[0038] (Example 1) Production of development carrier (filter paper) containing fecal solution

As a fecal lysate, a solution of 500 mmol / L Tris-HC1, 16 mmol / L EDTA, lOmmol / L NaCl, pH 9.0 (sample lysis buffer) was prepared. LOOmg of stool was taken in a 1.5 ml tube and 500 L of sample dissolution buffer was added to dissolve the stool. About 20 liters of sample dissolution buffer is desirable for 20 mg of stool to be dissolved. A sample solution obtained by dissolving stool was heat-treated at 95 ° C for 10 minutes. After further centrifugation at 5,000 rpm for 5 minutes, the developing carrier was immersed in the supernatant of the sample solution. In this example, ADVANTEC standard filter paper No. 2 was used as the developing carrier. Next, the development carrier impregnated with the supernatant is dried, and the development carrier part containing the supernatant is directly added to the Ampdirect crude DNA buffer (Shimadzu Corporation), which is a PCR buffer solution. The DNA present in the stool was extracted into the PCR reaction mixture solution by immersing for 2 seconds and rinsing lightly (Figures 1-6).

[Example 2] Amplification of genes in feces

Using the development carrier obtained by the method according to Example 1, the KRAS and BRAF genes present in feces and the thrA gene derived from E. coli were amplified. Rinse the fecal solution supernatant with the spreading carrier part immersed in 50 L of Ampdirect crude DNA buffer (Shimadzu Corporation), which is a buffer solution for each PCR containing the following primers (A) to (D): DNA was extracted.

(A) One primer pair that amplifies across KRAS gene codons 12 and 13

FK-F: 5'-TGACTGAATATAAACTTGTGGTAG (SEQ ID NO: 1) FK-106R: 5'- ATTGTTGGATCATATTCGTC (SEQ ID NO: 2)

(B) One primer pair that amplifies across BRAF gene codon 599

FB-F: 5'- TAGGTGATTTTGGTCTAGCT (SEQ ID NO: 3)

FB-115R: 5 -ATCAGTGGAAAAATAGCCTC (SEQ ID NO: 4)

(C) One primer pair that amplifies ThrA gene specific for E. coli

thrA-F: 5 CCCCGCCAAAATCACCAACCATCT (SEQ ID NO: 5)

thrA-101R: 5'- CGGCAAAAATACGTTCGGCATCG (SEQ ID NO: 6))

(D) One primer pair that amplifies the KRAS gene according to (A) and one primer pair that amplifies the BRAF gene according to (B).

In each of the gene amplification reactions (A), (B), (C), and (D), 40 cycles of PCR reaction were performed at an annealing temperature of 53 ° C. Thereafter, electrophoresis was performed on a 3% agarose gel to confirm that the target gene was amplified (FIGS. 7 to 10).

Industrial applicability

[0040] By using the method of the present invention, it is possible to extract a nucleic acid derived from a target gene very easily and to perform amplification 'detection without purifying or extracting the biological sample force nucleic acid by a complicated method. Become. Therefore, by using the nucleic acid amplification method of the present invention, it is possible to quickly and sensitively perform tests necessary for genetic diagnosis, early cancer diagnosis, infectious disease diagnosis and the like.

[0041] According to the examples of the present invention, when stool is used as a sample, a small amount of DNA derived from colon cancer tissue under conditions where a large amount of normal mucosal tissue-derived DNA and normal mucosal tissue-derived DNA are present. It was possible to detect. Furthermore, it was confirmed that direct detection of bacterial DNA is also possible with the present invention.

Therefore, if the method of the present invention is used, genetic diagnosis of various biological samples, particularly fecal force, can be performed very easily and reliably. The fact that feces with unique information, which is unique to other biological samples, can be used practically and simply as a non-invasive DNA material is an operation that is useful for the diagnosis of various diseases. Enables the processing of large numbers of specimens. Therefore, it can be applied to various types of screening for colorectal cancer and the like in the normal population, and it is also possible to quickly detect causes such as mass-onset infections. The method of the present invention has contributed to preventive medicine, which has become increasingly important in recent years, and has led to mass outbreaks. Application to rapid diagnosis of infectious diseases that occur is expected.

Claims

The scope of the claims

[1] A method for treating a biological sample to amplify nucleic acid derived from a gene that may be contained in the biological sample, including the following steps:

(a) lysing the biological sample with a lysis buffer;

[2] including the step of heating the sample solution obtained in the step (a) at 60 to 95 ° C. for 10 minutes to 10 hours

The processing method according to claim 1.

[3] The processing method according to claim 1 or 2, wherein the amplification reaction inhibitor and the target nucleic acid in the solution in which the biological sample is dissolved are separated by the step (b).

[4] The nucleic acid amplification reaction solution obtained in the step (c) is subjected to nucleic acid amplification treatment.

A method for amplifying a nucleic acid using the treatment method according to any one of items 1 to 3.

[5] A method for analyzing a gene present in a biological sample, wherein a target gene is identified from a nucleic acid amplification product obtained by the amplification method according to claim 4.

[6] The gene analysis method according to claim 5, wherein the gene present in the biological sample is a disease-related gene or a microorganism-derived gene.