KR101759399B1 - DNA aptamer specifically binding to surface of living cell of enterotoxigenic Escherichia coli and uses thereof - Google Patents

Abstract

The present invention relates to a DNA aptamer that specifically binds to the surface of Enterotoxigenic Escherichia coli (ETEC) live bacteria, the detection of small intestine E. coli using the same, and the diagnosis of diarrheal diseases caused by small intestine E. coli.

Description

The present invention relates to a DNA aptamer that specifically binds to the surface of a small Escherichia coli bacteria live host,

The present invention relates to enterotoxigenic Escherichia The present invention relates to a DNA aptamer that specifically binds to the surface of a live bacterium, a method for detecting the small intestine E. coli, and a method for diagnosing a diarrheal disease caused by small intestine E. coli.

Escherichia coli ) is one of intestinal bacteria belonging to bacillus. It is a non-pathogenic bacterium in general, and it lives in the field of human and various animals, and is widely distributed in the nature by feces. However, some E. coli are pathogenic and cause diarrhea-like illness in the intestinal tract. Escherichia coli associated with diarrhea diseases Chapter haemorrhagic Escherichia coli (Enterohemorrhage E. coli, EHEC), E. coli enterotoxins small (Enterotoxigenic E. coli, ETEC), Chapter E. coli (Enteropathogenic E. coli, EPEC), invasive E. coli cells (Enteroinvasive E. coli , EIEC) and enteroaggregative E. coli (EAggEC).

In livestock and livestock environments, small intestine E. coli (ETEC) causes diarrheal diseases caused by enterotoxins, and the resulting economic losses are very large. Small intestinal colon E. coli attaches easily to the small intestine mucosa through a colonization factor (pili) and produces an intestinal toxin, thereby inducing excessive secretion of water or electrolytes from the small intestine mucosa to cause diarrhea. Among the small E. coli, four antigens that are problematic in diarrhea are F4, F5, F6, and F41. In particular, small intestine E. coli K88 (F4 antigen) occurs in pigs and small intestine E. coli K99 (F5 antigen) .

Diarrhea caused by small coliform bacteria occurs in all ages, but occurs mainly in the immediate postpartum period and in the postnatal period, especially in newborn pigs, weaned pigs, calves and other non-immunized livestock. In pigs and calves infected with small coliform bacteria, most of the symptoms of dehydration are due to diarrhea. The initial symptoms are mild symptoms of diarrhea. Diarrhea is observed in watery transparent variants such as water, weight loss and dehydration symptoms become clear and the elasticity of the skin disappears. If it gets worse, it will cause symptoms such as livestock fever, depression, weakness, and then sudden death.

Therefore, diarrhea caused by small intestine E. coli causes a great deal of economic loss due to severe diarrhea, atrophy and mortality. As of December 2013, the number of cases of coliform diarrheal disease in cattle was significantly higher than that of other pathogenic strains (22 cases of coliform bacteria, 6 cases of BVD, 5 cases of rotavirus, 2 cases of coronavirus 2 One case of Neospla, one case of coccidium). In addition, since diarrhea caused by small intestinal coliform bacteria continues to occur every year, there is a risk of becoming an infectious disease, and comprehensive and systematic measures are required.

To diagnose diarrheal disease caused by Escherichia coli, diarrhea is collected and sent to the laboratory for various immunological tests. However, the immunological test has a disadvantage in that it is difficult to use in the livestock field because it requires lab-based experimentation and requires expensive equipment and specialized techniques. In addition, since it is difficult to make a definite diagnosis decision only by clinical symptoms in the livestock environment field, the causative bacteria are isolated using the contents of the small intestine, and serologic tests are performed to check the intestinal pathogenicity. Although this method can isolate the causative pathogens correctly, it takes at least 3-5 days and 7 days long to separate culture and enrichment culture.

Therefore, in addition to the diagnosis in the laboratory, there is a need for a quick response method using a quick and simple diagnosis method using the diagnostic kit in the field of actual livestock environment. Accordingly, a strip sensor using a recent antibody has been developed and is in sale. However, in the case of a commercially available strip sensor, since it is an antibody-based detection system, there is a disadvantage in that it is inferior in stability to heat and may be denatured in various environments. In addition, the antibody is difficult to be applied to various applications due to its difficulty in chemical structural modification, and thus there is a limit to the development of a sensor for application to an actual livestock field.

Under these circumstances, the present inventors have completed the present invention by developing a diagnostic method capable of detecting stable E. coli, which is a strain causing diarrheal disease in a livestock environment, and capable of detecting it quickly and easily.

Korean Patent Registration No. 10-0253638

The present invention provides a DNA aptamer specific to small intestine E. coli, and a diagnostic kit and a diagnostic method capable of detecting the small intestine E. coli stably, promptly and easily using the aptamer.

For example, the present invention provides a DNA aptamer that specifically binds to the surface of small intestine E. coli bacteria.

As another example, the present invention provides a method for screening the DNA aptamer.

As another example, the present invention provides a composition for detecting small intestine E. coli comprising the DNA aptamer.

As another example, the present invention provides a kit for detecting small intestine E. coli comprising the DNA aptamer.

As another example, the present invention provides a method for detecting small intestine E. coli comprising the step of reacting the DNA aptamer with a sample.

As another example, the present invention provides a composition for diagnosing livestock diarrhea caused by small intestine E. coli comprising the DNA aptamer.

As another example, the present invention provides a kit for diagnosing livestock diarrhea caused by small intestine E. coli comprising the DNA aptamer.

As another example, the present invention provides a method for diagnosing livestock diarrheal disease caused by small intestine E. coli, comprising the step of reacting a DNA aptamer that specifically binds to the surface of enterobacteriacemic Escherichia coli live bacteria with a sample.

The present inventors have developed a DNA aptamer that specifically binds to the surface of small Escherichia coli bacteria live bacteria in order to develop a more accurate, quick and simple detection method than the conventional method for detecting pathogenic Escherichia coli bacteria. The DNA aptamer provided herein can be used as a diagnostic technique for diarrheal diseases caused by small intestine E. coli, since it binds specifically to the surface of small intestine E. coli bacteria without binding to other strains.

In one aspect, the present invention relates to a DNA aptamer that specifically binds to the surface of small intestine E. coli bacteria.

In the present invention, DNA aptamer refers to single stranded DNA or RNA having high affinity and specificity for a target substance. For the purpose of the present invention, the DNA aptamer is an aptamer that specifically binds to the surface of enterotoxigenic Escherichia coli live cells, and preferably binds specifically to the surface of small intestine E. coli K88 or enteric small E. coli K99 It can be an appater.

Among the small Escherichia coli strains, four antigens that are problematic in diarrhea are F4, F5, F6, and F41. In particular, small intestine E. coli K88 which secretes F4 antigen in pigs is mainly detected. In the calf, Escherichia coli K99 is mainly detected.

Thus, for example, the present invention relates to a DNA apatamer that specifically binds to the surface of small intestine small E. coli K88 and K99 live cells.

The DNA aptamer according to an embodiment of the present invention may have at least one base sequence of the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 56, preferably a nucleotide sequence of SEQ ID NO: 15, SEQ ID NO: 21, SEQ ID NO: Of the base sequence. Also, sequences complementary to the above sequences may be included within the scope of the present invention. In addition, variants of the above sequences may be included within the scope of the present invention. The mutant may be a nucleotide sequence having a functional characteristic that is similar to that of the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 56, although the nucleotide sequence thereof is changed. Specifically, the DNA aptamer gene has a sequence homology of at least 70%, more preferably at least 80%, more preferably at least 90%, and most preferably at least 95% with the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 56 May contain a base sequence.

"% Of sequence homology to polynucleotides" is ascertained by comparing the comparison region with two optimally aligned sequences, and a portion of the polynucleotide sequence in the comparison region is the reference sequence for the optimal alignment of the two sequences (I. E., A gap) relative to the < / RTI >

The DNA aptamer according to one embodiment of the present invention may be single stranded DNA. The single-stranded DNA aptamer forms a tertiary structure and can bind to the surface of small intestine E. coli, preferably small intestine E. coli K88 and K99 live cells.

The DNA aptamer is typically obtained by in vitro selection for binding of the target molecule. Methods for selecting an aptamer that specifically binds to a target molecule are known in the art. For example, organic molecules, nucleotides, amino acids, polypeptides, marker molecules on the cell surface, ions, metals, salts, polysaccharides can be suitable target molecules for separating aptamers that can specifically bind to each ligand . Selection of an aptamer can utilize in vivo or in vitro selection techniques known in the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) method (Ellington et al., Nature 346, 818-22, 1990; and Tuerk et al. , Science 249, 505-10, 1990). As used herein, the term " SELEX method "refers to a method of extracting a DNA binding sequence of a molecule by selectively amplifying a DNA having a high binding capacity to a specific molecule from a set of arbitrarily synthesized DNAs (Louis et al. 355, 564-566).

For example, the present invention provides a method of amplifying a single strand DNA (ssDNA) aptamer by asymmetric PCR from the random dsDNA library, comprising: (a) amplifying a random double strand DNA library through PCR; And (c) a step of reacting the amplified ssDNA aptamer with a live E. coli host microorganism and carrying out a DNA aptamer that specifically binds to the surface of the host E. coli live microorganism through Cell-SELEX (Systematic Evolution of Ligands by Exponential Enrichment) And a method for screening a DNA aptamer.

Step (a) is the first step in the DNA aptamer screening method, in which a random dsDNA library is amplified using PCR.

Step (b) is to perform asymmetric PCR to amplify only ssDNA among dsDNA amplified by PCR. In one embodiment, the asymmetric PCR can be carried out by performing PCR using a forward primer and a reverse primer in a ratio of 10: 2, for example, 10 μl of a forward primer and 2 μl of a reverse primer at the same concentration (25 uM) Can be obtained. A method of selecting ssDNA aptamer is, for example, a method in which biotin is attached to a reverse primer by PCR to amplify dsDNA, and 3 'of the amplification product is treated with streptavidin to form a biotin-streptavidin complex, Can be selectively removed to obtain only the opposite ssDNA aptamer without biotin binding. The ssDNA aptamer obtained can be denatured by heating ssDNA for use in the SELEX method, and then slowly cooled at room temperature to form a three-dimensional structure.

In step (c), the ssDNA aptamer is allowed to react with contacted host E. coli bacteria, and then a DNA aptamer that specifically binds to the surface of the host E. coli bacteria is selected through the Cell-SELEX technique. Small intestines of E. coli can be cultured appropriately to maintain viable conditions. The ssDNA aptamer that does not bind to the surface of small enterococcus live bacteria can be washed out and only the ssDNA that specifically binds can be eluted. It may also include a Negative SELEX step that removes ssDNA that binds to bacteria other than Enterobacteriaceae E. coli at this stage.

One example of the Cell-SELEX technique using small intestinal E. coli K88 and K99 live bacteria is to cultivate small intestine E. coli K88 and K99, to wash the surface of intestinal small E. coli K88 and K99, to prepare small intestinal E. coli K88 and K99 Step of binding DNA aptamers, recovering only small intestinal E. coli K88 and K99 surface-bound DNA aptamers reactive with small intestinal E. coli K88 and K99, and a step of SELEX to obtain optimal specificity and affinity affinity) of the SELEX rounds.

The selection process of the optimal SELEX round is carried out by quantifying through nano-drop and selecting the optimal SELEX round by real-time PCR, and selecting the best candidate small E. coli K88 and K99 surface-bound DNA aptamer candidates in the selected rounds. Cloning the pool to determine the DNA aptamer candidate arm each aptamer sequence.

 In order to select an aptamer exhibiting optimal binding among the candidate enterococci K88 and the K99 surface-bound DNA aptamer candidate group, the step of selecting the concentration of the recovered ssDNA aptamer by nano drop measurement after the re-processing of SELEX is selected, A step of labeling biotin on the 5 'of the candidate E. coli K88 and K99 surface-bound DNA aptamer candidates, a step for identifying the affinity between the labeled small E. coli K88 and the K99 surface-bound DNA aptamer candidates, Treating the streptavidin-coated sensor chip SA with a biotin-labeled aptamer to bind to streptavidin-coated sensor chip SA, attaching a small-sized autologous E. coli to an aptamer immobilized on the sensor chip via streptavidin-biotin binding, Lt; RTI ID = 0.0 > a < / RTI > DNA aptamer. The sensor chip coated with streptavidin may be an SA sensor chip, but is not limited thereto.

According to this method, in the present invention, 27 small-size E. coli K88 live-surface-bound DNA aptamer sequences and 29 small-sized homologous E. coli K99 live-surface-bound DNA aptamer sequences were obtained and are shown in SEQ ID NOS: 1 to 56, respectively . Since the DNA aptamer of the present invention specifically binds to the surface of small intestine E. coli bacteria, it can be useful for diagnosing diarrheal disease by detecting small intestine E. coli in a sample of domestic animals.

Accordingly, in another aspect, the present invention relates to a composition for detecting small intestine E. coli comprising the DNA aptamer.

In another aspect, the present invention relates to a kit for detecting small intestine E. coli comprising the DNA aptamer.

In another aspect, the present invention relates to a method for detecting small intestine E. coli, comprising the step of reacting the DNA aptamer with a sample.

In another aspect, the present invention relates to a composition for diagnosing livestock diarrhea caused by small intestine E. coli comprising the DNA aptamer.

In another aspect, the present invention relates to a kit for diagnosing livestock diarrheal disease caused by small intestine E. coli, comprising the DNA aptamer.

In another aspect, the present invention relates to a method for diagnosing diarrheal diseases of livestock by small enteral coliform bacteria, comprising the step of reacting a DNA aptamer that specifically binds to the surface of small intestinal microflora of Enterobacteriaceae with a sample will be.

Diagnosis " herein is intended to include determining the susceptibility of an individual to a particular disease or disorder, determining whether an individual currently has a particular disease or disorder, the prognosis of a particular disease or disorder determining prognosis, or monitoring the condition of the subject to provide information about the therapeutic efficacy. For purposes of the present invention, the diagnosis may be to identify the presence or characteristic of a diarrheal disease caused by small intestine E. coli.

The diagnostic composition of the present invention may further comprise a buffer or reaction solution that stably maintains the structure or physiological activity of the aptamer. Further, in order to maintain stability, it may be provided in a powder state or dissolved in an appropriate buffer solution.

The sample may be a livestock sample, but may include, but is not limited to, other livestock products, processed foods, dairy products, drinking water, cookware, and water resources.

According to one specific embodiment of the present invention, the kit may be in the form of a DNA aptamer immobilized on a substrate, for example in the form of a microarray. The DNA aptamer can be immobilized on a substrate by using a method known in the art.

Means an array (array) in which a DNA nucleic acid material is attached at a high density to a specific region of a microarray substrate. The substrate of the microarray refers to a support having a suitable rigid or semi-rigid and may be, for example, a glass, membrane, slide, filter, chip, wafer, fiber, magnetic bead or non-magnetic bead, gel, tubing, But are not limited to, plates, polymers, microparticles, and capillaries. The DNA aptamer of the present invention can be arranged and immobilized on the substrate. Such immobilization can be carried out by a chemical bonding method or a covalent bonding method such as UV. For example, the DNA aptamer can be bound to a glass surface modified to include an epoxy compound or an aldehyde group, and can also be bound by UV on a polylysine coating surface. In addition, the DNA aptamer can be bound to the substrate via linkers (e.g., ethylene glycol oligomers and diamines). The DNA aptamers of the present invention can be biotinylated, for example, and can be successfully coupled onto a substrate coated with streptavidin.

In one embodiment, the present invention provides a method for detecting a DNA aptamer comprising the steps of binding biotin to the 5 'position of a DNA aptamer, binding the biotin to a sensor chip immobilized with streptavidin, A method for producing a sensor chip to which a small intestine small-size E. coli surface-bound DNA aptamer is immobilized and a small intestine small-size E. coli detection method, comprising the step of adhering a small intestine E. coli to the surface of the chip.

Detection of small intestine E. coli can be achieved by detecting complexes of DNA aptamer and small intestine E. coli. To facilitate detection of the complex, DNA aptamers are used as fluorescent substances, such as fulorescein, Cy3 or Cy5 , A radioactive material, or a chemical (e.g., biotin).

Since the DNA aptamer of the present invention has a property of specifically binding to the surface of small intestine E. coli, preferably small intestine small E. coli K88 and K99 live organism, it is possible to detect small intestine small E. coli, and furthermore, It is useful for diagnosing diarrheal diseases caused.

BEST MODE FOR CARRYING OUT THE INVENTION The optimum E. coli surface-linked DNA aptamer according to the present invention can be utilized in a variety of environmental fields and animal environment fields, and specifically, it can be widely used for detection of diarrheal diseases applied to an actual livestock field.

FIG. 1 is a schematic diagram of a Cell-SELEX experiment for screening DNA aptamers that specifically bind to the surface of small intestine E. coli bacteria.
FIG. 2 shows the result of selective amplification of ssDNA using streptavidin beads after amplification of random DNA aptamer using PCR and asymmetric PCR technique.
Lane M: 100 bp DNA marker
Lane 1: Amplification of random DNA aptamers by PCR and asymmetric PCR technique for the treatment of small Escherichia coli K88 SELEX, followed by selective recovery of ssDNA using streptavidin beads
Lane 2: Amplification of the random DNA aptamer by the PCR and asymmetric PCR technique for the progression of small Escherichia coli K99 SELEX and selective recovery of ssDNA using streptavidin beads
FIG. 3A shows the quantitative measurement of the concentration of the small-sized E. coli K88 surface-bound DNA aptamer recovered in each round in the SELEX process for the preparation of the surface-bound DNA aptamer of small intestinal E. coli K88 using nano-drops.
FIG. 3B shows the quantitative measurement of the concentration of the small-sized E. coli K99 surface-bound DNA aptamer recovered in each round in the SELEX process for the preparation of surface-bound DNA aptamers of small intestine E. coli K99 using nano-drops.
FIG. 4A shows the results of quantitative determination of the affinity test of the aptamer candidate group secured for selecting DNA aptamers that optimally bind to the surface of small intestinal E. coli K88 using nano drop.
FIG. 4B is a graph showing the results of quantitative determination of the affinity test of the aptamer candidate group secured for selecting DNA aptamers that bind optimally to the surface of small intestine E. coli K99 using nano drop.
Fig. 5A shows the secondary structure of two kinds of DNA aptamers showing specific binding force to the surface of small intestine E. coli K88.
FIG. 5B shows the secondary structure of two kinds of DNA aptamers showing specific binding force to the surface of small intestine E. coli K99.
FIG. 6 is a schematic diagram showing a process of immobilizing enterobacterial small E. coli K88 and K99 surface-bound DNA aptamers on the surface of streptavidin-coated SA chip, and binding small enterococci K88 and K99 live bacteria thereto.
FIG. 7A is a graph showing the results obtained by fixing the surface binding DNA aptamer (clone name: E88-16) of small intestine E. coli K88 on the surface of a streptavidin-coated SA chip and quantifying the binding force by testing the binding force with other strains other than the target strain Respectively.
FIG. 7B is a graph showing the results obtained by fixing the surface binding DNA aptamer (clone name E88-23) of small intestine E. coli K88 on the surface of streptavidin-coated SA chip and quantifying the binding force by testing the binding force with other strains other than the target strain Respectively.
FIG. 7C is a graph showing the results of binding affinity of a surface-binding DNA aptamer (clone name E99-3) of small intestine E. coli K99 to the surface of a streptavidin-coated SA chip and quantifying the binding force by testing the binding force with other strains Respectively.
FIG. 7D is a graph showing the results of binding affinity of a surface-binding DNA aptamer (clone name E99-8) of a small intestine E. coli K99 to the surface of a streptavidin coated SA chip and quantifying the binding force by testing the binding force with other strains other than the target strain Respectively.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Example 1. Preparation of DNA aptamer pool

1-1. DNA random library amplification using PCR technique

Enterotoxigenic Escherichia 100 bp template DNA containing 40 random sequences in a ratio of dA: dG: dC: dT = 1.5: 1.15: 1.25: 1 to produce a single stranded DNA aptamer specifically binding to E. coli , ETEC (5'-GGTAATACGACTCACTATAGGGAGATACCACCTTATTCAATT-N40-AGATTGCACTTACTATCT-3 '; SEQ ID NO: 57) and a pair of primers capable of amplifying it by 100 bp were custom-made in Bioneer (Korea) [5'-GGTAATACGACTCACTATAGGGAGATA CCAGCTTATTCAATT- (SEQ ID NO: 58), 5'-biotin-AGATAGTAAGTGCAATCT-3 '(SEQ ID NO: 59) as a biotinylated reverse primer. An arbitrary DNA library was amplified using PCR (Bioneer, Korea). The reaction composition for amplification of the 100 bp DNA library by PCR was 1 μl of template DNA, 5 μl of 10 × PCR buffer, 4 μl of each 2.5 mM dNTP mixture, 2 μl of 25 μM forward primer, 25 μM biotinylated reverse primer 2 , 0.25 μl (1 unit / μl) of Ex Taq polymerase (TaKaRa, Japan) and 35.75 μl of distilled water. The PCR reaction conditions were first denaturation at 94 ° C for 5 minutes, 25 cycles of reaction at 94 ° C for 30 seconds, 52 ° C for 30 seconds, and 72 ° C for 30 seconds, followed by extension at 72 ° C for 5 minutes Respectively. After the PCR reaction, 4 占 퐇 was taken and the amplified product was confirmed by 2% agarose gel electrophoresis. The DNA library obtained by PCR was purified using a PCR purification kit (Qiagen, USA) and recovered using 45 μl of distilled water.

1-2. Amplification of ssDNA using asymmetric PCR technique

Asymmetric PCR was performed to amplify only ssDNA among dsDNA amplified by PCR technique. Asymmetric PCR reaction composition was as follows: 10 μl of template DNA obtained in Example 1-1, 10 μl of 10 × PCR buffer, 8 μl of 2.5 mM dNTP mixture, 10 μl of 25 uM forward primer, 2 μl of 25 μM biotinylated reverse primer , 0.5 μl (1 unit / μl) of Ex Taq polymerase (Takara, Japan) and 59.5 μl of distilled water. Asymmetric PCR conditions were as follows: denaturation at 94 ° C for 5 minutes, 15 cycles of reaction at 94 ° C for 30 seconds, 52 ° C for 30 seconds, and 72 ° C for 30 seconds, followed by extension at 72 ° C for 5 minutes Respectively. After the PCR reaction, 4 μl was taken and 2% agarose gel was used to confirm whether an exact size band appeared. The remaining DNA was subjected to PCI extraction and ethanol precipitation, which were conventionally used to recover a pure DNA aptamer pool .

The reaction solution was treated with the same volume of PCI (Phenol: Chloroform: Isoamylalcohol = 25: 24: 1) solution, stirred vigorously and centrifuged at 13,000 rpm for 15 minutes at 4 ° C to recover only supernatant. To the supernatant, 1/100 volume of tRNA (Sigma Aldrich, USA) and 3 volumes of 100% ethanol were added and reacted at -70 ° C for 1 hour or more. After the reaction, the DNA was recovered by centrifugation at 4 ° C for 20 minutes at 13,000 rpm. The recovered DNA was dried at 65 ° C and dissolved in 50 μl of distilled water. 4 μl of the recovered DNA was subjected to 2% agarose gel electrophoresis to confirm whether an exact size band appeared.

1-3. Fabrication and recovery of ssDNA using heating-cooling technique

50 μl of distilled water was added to 50 μl of the DNA obtained in Example 1-2 in order to remove dsDNA and ssDNA attached with biotin from the PCR products amplified using asymmetric PCR and to ensure pure ssDNA only in pure positive direction, The dsDNA was denaturated with ssDNA using a heating-cooling technique. The dsDNA was reacted at 85 캜 for 5 minutes to denature it with ssDNA, and immediately after completion of the reaction, the reaction solution was cooled to 4 캜 to prepare ssDNA.

After that, 50 μl of streptavidin (Pierce, USA) was added and reacted at room temperature for 1 hour. After the reaction was completed, the reaction mixture was centrifuged at 4 ° C for 10 minutes using a centrifuge at 13,000 rpm, and only the supernatant was recovered to obtain ssDNA. In order to obtain pure ssDNA from the reaction solution, PCI extraction and ethanol precipitation method were used. The reaction solution was treated with the same volume of PCI (Phenol: Chloroform: Isoamylalcohol = 25: 24: 1) solution, stirred vigorously and centrifuged at 13,000 rpm for 15 minutes at 4 ° C to recover only supernatant. To the supernatant, 1/100 volume of tRNA (Sigma Aldrich, USA) and 3 volumes of 100% ethanol were added and reacted at -70 ° C for 1 hour or more. After the reaction, only the ssDNA was recovered by centrifugation at 13,000 rpm for 20 minutes at 4 ° C. The recovered ssDNA was dried at 65 ° C and dissolved in 50 μl of distilled water. 10 [mu] l of the recovered ssDNA was taken and 10% acrylamide gel electrophoresis was performed to confirm whether an exact size band appeared (see Fig. 2).

Example  2 : Cell - SELEX  Utilizing techniques Small portable  Escherichia coli K88 and K99 Lt; RTI ID = 0.0 > Small portable  E. coli surface binding ssDNA Of app tamer  Selection

2-1. Cell - SELEX The composition of each solution used in

Small intestine E. coli K88 and K99 culture medium: Tryptic Soy broth (Difco, USA)

Washing solution (for washing small enterococci, for removal of non-binding ssDNA with small Escherichia coli): 137 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4, pH 7.4

2X DNA aptamer Sorted solution: 2X Tryptic Soy broth

DNA aptamer elution solution: 10 mM Tris-HCl, 1 mM EDTA, pH 7.6

2-2. Cell - SELEX To be used for ssDNA of Aptamer  Structure Production

60 μl of distilled water was added to 40 μl of ssDNA prepared in advance in order to screen the small intestine E. coli K88 and K99 surface-bound DNA aptamer that specifically bind to small intestinal E. coli K88 and K99, and 2 × DNA aptamer selection solution 100 And the mixture was boiled at 85 ° C for 5 minutes to denaturation. The mixture was gradually cooled at room temperature to form a stable three-dimensional structure of ssDNA aptamer.

2-3. Small portable  Escherichia coli K88 and Of K99  Culture and preparation

For the screening of the small E. coli K88 and K99 surface - bound DNA aptamers, small intestine colonies K88 and K99 were obtained through culture. First, small intestine E. coli K88 and K99 were inoculated in 5 ml of culture medium, Tryptic Soy broth (Difco, USA), and cultured in a 37 ° C agitator for 15 hours to obtain small intestinal E. coli K88 and K99. The culture broth was completely removed after centrifugation (4 ° C, 13,000 rpm, 10 min) to precipitate small intestinal E. coli K88 and K99. The culture medium (137 mM NaCl, 2.7 mM KCl, 8 mM Na2HPO4, And the surface of small intestine E. coli K88 and K99 was washed through a resuspension, and the supernatant was removed by centrifugation. The above procedure was repeated twice to eliminate residues on the surfaces of small intestinal E. coli K88 and K99 live cells.

2-4. Cell - SELEX  Utilizing techniques Small portable  Escherichia coli K88 and K99 Lt; RTI ID = 0.0 > Small portable  E. coli surface binding ssDNA Of app tamer  Selection

In order to select a DNA aptamer that specifically binds to the surfaces of enterobacterial small Escherichia coli K88 and K99 live cells, 100 μl of the ssDNA aptamer forming the structure in Example 2-2 was diluted with the small intestine Escherichia coli K88 and K99, and reacted for 1 hour at 4 ° C in a Thermo mixer (Eppendorf, USA). After completion of the reaction, the supernatant containing the aptamer pools not bound to the small intestine E. coli K88 and K99 was removed through centrifugation (4 ° C, 13,000 rpm, 10 minutes) and then washed three times with the washing solution, All of the small Escherichia coli K88 and the ssDNA aptamer non-specifically bound to the K99 surface were removed. The ssDNA aptamer specifically bound to the small intestinal E. coli K88 and K99 surfaces was prepared by adding 50 μl of the DNA aptamer elution solution, denaturing the reaction at 85 ° C for 5 minutes, centrifuging (4 ° C, 13,000 rpm, 10 minutes) Respectively. PCI extraction and ethanol precipitation were performed to recover pure DNA aptamer pool from the recovered small E. coli K88 and K99 specific binding DNA aptamer elution solution, and then recovered in 50 μl of distilled water.

2-5. Negative SELEX Cultivation and preparation of other strains for

Negative SELEX was performed in the middle of the SELEX process in order to remove the ssDNA binding to the other strains of the host Escherichia coli K88 and K99, and to specifically bind to only the small Escherichia coli K88 and K99. The other strains used in the experiment and their culture media were described in the table below (Table 1). Other strains were inoculated in 5 ml of each culture medium and cultured in a 37 ° C agitation incubator for 15 hours to obtain other strains. After the strain was settled by centrifugation (4 ° C, 13,000 rpm, 10 minutes), the culture medium was completely removed and 500 μl of washing solution (137 mM NaCl, 2.7 mM KCl, 8 mM Na 2 HPO 4, pH 7.4) The surface of the strain was washed through a cup and centrifuged to remove the supernatant. By repeating the above procedure twice, there was no residue on the surface of the other strains.

Strain name Culture medium Listeria monocytogenes (ATCC 19115) Brain Heart Infusion Salmonella typhimurium (ATCC19585) Brain Heart Infusion Shigella sonnei (ATCC 25931) Nutrient broth Enterobacter cloacae (KCCM 12178) Nutrient broth Escherichia coli (ATCC 25922) Tryptic Soy broth

2-6. Negative SELEX Non-specific through ssDNA  remove

Negative SELEX was performed in the middle of the SELEX process in order to remove the ssDNA binding to the other strains of the host Escherichia coli K88 and K99, and to specifically bind to only the small Escherichia coli K88 and K99. The other strains obtained in Example 2-5 were re-suspended in the small intestine E. coli K88 recovered in Example 2-4 and the aptamer bound to K99, and then re-suspended in a Thermo mixer (Eppendorf, USA) at 4 ° C for 1 hour Lt; / RTI > After the reaction was completed, the supernatant containing the aptamer pool not bound to the other strains was recovered by centrifugation (4 ° C., 13,000 rpm, 10 minutes), and then PCI extraction and ethanol After performing the precipitation method, it was recovered in 50 占 퐇 of distilled water.

Example  3. Small portable  Escherichia coli K88 and K99 Lt; RTI ID = 0.0 > Cell - SELEX  Affinity test for round selection

3-1. Nano-drop  Used Small portable  Escherichia coli K88 and K99  Combination DNA Aptamer  Selection of SELEX rounds for production

After completion of the SELEX for 10 rounds, the concentration of ssDNA bound to the surface of the small intestine E. coli K88 and K99 recovered in each round was quantified by Nano (Nano) method to quantitatively confirm the progress of SELEX and the affinity of eluted ssDNA aptamer in each round -drop). As a result of measuring the ssDNA aptamer concentration eluted from each round by using nano-drop, the concentration of 10 rounds was the highest at 750.1 ng / μl in the case of small E. coli K88, and the concentration of 11 rounds 677.7 ng / mu l, the concentration was lower than the result of 10 rounds. As a result, it was confirmed that the optimal aptamer pool most specifically binding to enterobacteriaceous E. coli K88 was 10 round pools (see Fig. 3a). In addition, in the case of small enterococcus K99, the concentration of 10 rounds was 754.2 ng / μl, and the concentration of 11 rounds was 584.2 ng / μl, indicating that the concentration was lower than that of 10 rounds. It was confirmed that the specially bonded optimum aptamer pool was a 10 round pool (see Fig. 3b).

3-2. Real - time PCR through SELEX  Selection of rounds

Real-time PCR was performed to confirm the progress of SELEX progression and the affinity of eluted DNA aptamer quantitatively after completing up to 11 times of cell-SELEX of small intestinal E. coli K88 and K99. First, the ssDNA aptamers eluted in the 9th round, 10th round, and 11th rounds after the initial DNA library and the final negative SELEX were amplified by PCR, and asymmetric PCR was performed to obtain ssDNA. The ssDNA aptamers obtained at 0, 8, 9, and 10 rounds were prepared at the same concentration, and the SELEX round was again conducted. As a result, only DNA aptamers specifically binding to enterobacterial small E. coli K88 and K99 were recovered. Then, each of the obtained ssDNAs was diluted to 10 ^-1 , 10 ^-2 and 10 ^-3 , respectively, and used as a template DNA for real-time PCR. The fluorescent dye used in the real-time PCR was iQ SYBR Green Supermix (Bio-Rad, USA). The reaction conditions were as follows: denaturation at 94 ° C for 5 min, 20 sec at 94 ° C, The reaction was carried out at 72 ° C for 20 seconds, followed by 40 cycles, followed by extension at 72 ° C for 5 minutes. Real-time PCR results were obtained from experiments using 10 ^-3 diluted samples as template DNA. As the number of C (t) values is lower, it can be easily amplified in a short cycle and the efficiency of aptamer is high. According to the experimental results, in case of K88 real- (t), and the K99 small E. coli strain also showed the lowest C (t) value in 10 rounds, indicating that it is more efficient than the other rounds (see Table 2). It is confirmed that this is a result consistent with the result obtained in Example 3-1.

9R (1 x 10 ^-3 ) 10R (1 x 10 ^-3 ) 11R (1 x 10 ^-3 ) K88 SELEX  Round C (t) Value 17.12 13.39 14.25 K99 SELEX  Round C (t) Value 15.65 13.64 14.06

Example  4. Small portable  Specific binding to the surface of Escherichia coli DNA Aptamer  Candidate's Cloning

The primer 5'-GGTAATACGACTCACTATAGGGAGATACCAGCTTATTCAATT-3 '(SEQ ID NO: 58) was inserted into 10 rounds of ssDNA aptamer, which was judged to have the highest binding efficiency with the small intestine E. coli K88 and K99 through nano-drop and real- ) And reverse primer 5'-AGATAGTAAGTGCAATCT-3 '(SEQ ID NO: 59) to obtain dsDNA. The dsDNA thus obtained was cloned using Solgent's T-blunt cloning kit. For cloning, 1 μl of T-vector (10 ng / μl), 4 μl of PCR product (20 ng / μl) and 1 μl of 6 × T-blunt buffer were mixed and reacted at 25 ° C for 5 minutes. 6 μl of the T-blunt cloning reaction mixture was mixed with 100 μl of DH5α, transformed by heat shock at 42 ° C. for 30 seconds, and reacted on ice for 2 minutes. Then, 900 μl of SOC medium (2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl 2, 10 mM MgSO 4 and 20 mM glucose) was added thereto and incubated at 37 ° C. for 40 minutes do. After the incubation, 200 μl of the solution was taken and contained ampicillin (50 μg / ml), kanamycin (50 μg / ml), X-gal (50 μg / ml) and IPTG (LB plate) and incubated at 37 ° C for 15 hours. Then, only white colonies were selected, and the nucleotide sequence of aptamer was determined by Solgent, Korea. Through sequencing, 27 non - overlapping small E. coli K88 surface - bound DNA aptamer sequences and 27 small size E. coli K99 surface - bound DNA aptamer sequences were obtained. Tables 3 and 4 below show DNA aptamer sequences of small intestinal E. coli K88 and K99.

Clone name SEQ ID NO: order Sequence size ( bp ) E88-1 SEQ ID NO: 1 TTCCAGGTCCAGCTATGATTAAAGGTGGTAGAGCGTAATC 40 E88-2 SEQ ID NO: 2 GTTATAGCTTTTTTAAATTCGCGGAGGAAAAGACATCCC 39 E88-3 SEQ ID NO: 3 CGCTCGCGTACCGGCGTAACACCTGAGTGAGTAAACTAAT 40 E88-4 SEQ ID NO: 4 CGCTGCATGCGTGGCAATACATTGGGGAGCATAAGCTTGG 40 E88-5 SEQ ID NO: 5 CCAGTGGTATTTTTCGTGTTTTTAAAATGGCAGCTTGTAC 40 E88-6 SEQ ID NO: 6 CGCGTGAATTCGTACTAGGCCAATCGGATCCCTTACCGCG 40 E88-7 SEQ ID NO: 7 GATTCCTCCCTAGTAAATTTATCTCTTCAGCCCGGACGCG 40 E88-8 SEQ ID NO: 8 GTTCATCGCTGCGCATTTGGGCCTGCGTCTTACTATACCC 40 E88-9 SEQ ID NO: 9 CGACGACCTGTCCCTCTTGTTGATGGTCGAGCCGAAACCC 40 E88-10 SEQ ID NO: 10 CCGCGAACATGGGCGCGGCCAACACACCCAACGCTGCAGC 40 E88-11 SEQ ID NO: 11 TTCCATCCCGATTGTAGTTCAAGCCCCCATTACGGATTTAG 41 E88-12 SEQ ID NO: 12 TAGCGCTCCCTTTATAGATGGTACTCCTAAGCTCGAGAAT 40 E88-13 SEQ ID NO: 13 GGAACTCTTTCAACACAGGGGCGTGAAACATACTACTACC 40 E88-15 SEQ ID NO: 14 GGCAACCTCTCCCGCACGTCGGCCTTGCGTCCTCCCACT 39 E88-16 SEQ ID NO: 15 GTAGCCTGCAGTGTCCTGTGTGTATGGCTTAGTCTCGTGG 40 E88-17 SEQ ID NO: 16 CGCTAGTAACGTAAATGCCAGTGAACAGGCGAGCTACACC 40 E88-18 SEQ ID NO: 17 CCCTCGGCGTTTTTACTTTCGCAGAGTATGCATGGTGGGG 40 E88-19 SEQ ID NO: 18 GTTGCATTTCGCGCAGTCCTCTGGTATCCGGGAAGGTGTG 40 E88-20 SEQ ID NO: 19 CCGGTAGAGCGTATCCCTGGTCGGAACGTGTTCTCGTGAG 40 E88-22 SEQ ID NO: 20 GCAAGTCGAAATTCCGATCGTCCCCTGCACATCTCGCGTG 40 E88-23 SEQ ID NO: 21 GGCCATTCGTGGTACGGTACCACGCAATTCTACGTTTCG 39 E88-24 SEQ ID NO: 22 GTTTTGCCGGCAAAGACGCGAGGTACCCTTTTACCCCTTG 40 E88-25 SEQ ID NO: 23 GCGAGTGAGCGGGTCGTATTGCGCAAAGCTCCTCAAGTTG 40 E88-27 SEQ ID NO: 24 GCTTAATCCGAACTACAGTTGTTTGTGCTAATACTGCATG 40 E88-28 SEQ ID NO: 25 CCGATGAACCGGAAACCGCCGTATGTATCCAATGGCTACT 40 E88-29 SEQ ID NO: 26 GTAGTGCGCTGCACCGTGCGTCTTTACCTTTGGTTTCATG 40 E88-30 SEQ ID NO: 27 GGCCCCGTGAGGGTTGCAGCCACGACGGGATGCGTTGTCG 40

Clone name SEQ ID NO: order Sequence size ( bp ) E99-1 SEQ ID NO: 28 GTCGTTTTGACAAGAGAAAGTAATCCCGATCAAGGTGGTC 40 E99-2 SEQ ID NO: 29 TTCTTGTCCGTGTCGCGCTAGTTTGACGTTTTGGATCTGC 40 E99-3 SEQ ID NO: 30 TGCTGTGCAACATGTTCCCTCGTCTCATGCCTCCATGCCCG 41 E99-4 SEQ ID NO: 31 CGGCACTCGTCGTTAGGTCGTAGGTTTCGTTGGGTTGGGG 40 E99-6 SEQ ID NO: 32 CGCACATCCACCGTGAATGTGGTCATAACTCCCTGTGACG 40 E99-7 SEQ ID NO: 33 CATCAGGAGACGCTGGGCCTGATGATACCGTAACGTGGCG 40 E99-8 SEQ ID NO: 34 TCCGTCATGTGTTGCCGTTGTTATTTATCGGTTTTGGTGG 40 E99-10 SEQ ID NO: 35 TGACACCTGCTTTCACTGACGTAGTATTTGGGTTATGGGG 40 E99-11 SEQ ID NO: 36 TTGCGCTGTCGAAAGTTAGAGGGGGTCTGGGGGTATATAG 40 E99-12 SEQ ID NO: 37 CCTGTTTGTGTGGAATGGTGGCACAGTACTCCATGCAGAT 40 E99-13 SEQ ID NO: 38 CTTACTCCATTGTGGGTGCAACAGTGTCTTTACGTGTCTG 40 E99-14 SEQ ID NO: 39 AACCTCGCTCAGAGCCCATCATGTGTCCGAAATTCTGGAT 40 E99-15 SEQ ID NO: 40 AAATGCGGGTTACTCAATATCCTGAGCGCGTGGTCTTCCG 40 E99-16 SEQ ID NO: 41 TGATGCAATCGCCAGGTCGTACATTCCGGAGTGTGTTCCCG 41 E99-17 SEQ ID NO: 42 TGGAGCAGTGTTTTACAATTGCTAGAGAGTGCTTAAAGTG 40 E99-18 SEQ ID NO: 43 GGCGCAGAGCGTACGAATCCCTTTCCTTCCCTTAAGTCTGC 41 E99-19 SEQ ID NO: 44 GGTCTGTATCGACGTCACGCTGCAACCCAGTTAAATGATA 40 E99-20 SEQ ID NO: 45 TTGGACTAATCTGGAGCAAGATCACGGCCATATGCATATC 40 E99-21 SEQ ID NO: 46 CGGTGCTTTCTCTTTTCGTTTTCCCTTTCCAATGCTCGCG 40 E99-22 SEQ ID NO: 47 GCACGGGGGGGTTACCTTTTACACGTGTTTCCGTTTTGTG 40 E99-23 SEQ ID NO: 48 GGCCATTCGTGGTACGGTACCACGCAATTCTACGTTTCG 39 E99-24 SEQ ID NO: 49 CACGCCTAGCGCTGAGCACGCCAAGTGCTGGGATCCCATT 40 E99-25 SEQ ID NO: 50 CAAATAGATGTCTCTGATGGTATTGTCCAATAGGCAACGG 40 E99-26 SEQ ID NO: 51 TGGGCCATAGAGTCCGTTTTAGCGTGGCGGGTTGACCTGG 40 E99-27 SEQ ID NO: 52 GATGAGTGGAAATATACCCTTGGTGGCAGACTCTTTAACG 40 E99-29 SEQ ID NO: 53 CGGCAGCGCTTTCAACATCGCTAAGCAACTAGTCACATCA 40 E99-30 SEQ ID NO: 54 AACTCGGAAGAGAATGTGGAACATGCATCCCATTTACCG 39 E99-31 SEQ ID NO: 55 CAAGTCGTTTTTCAAAGGTCGGGGCATTTCCGCGAATGGA 40 E99-32 SEQ ID NO: 56 GGCCTCGTCGCAGTCCAACTCTTTGTCTCTGAACCAATAC 40

Example  5. Nano Drop  Used Small portable  Specific binding to the surface of Escherichia coli DNA Aptamer  Candidate's affinity testing

SsDNA aptamer was prepared using a clone having an aptamer sequence obtained in Example 4 to select a DNA aptamer that optimally binds to the surface of small intestine E. coli K88 and K99 live cells. The aptamers having the respective sequences were prepared at the same concentration, and cell-SELEX was performed again, and the concentration of the recovered aptamer was measured using nano drop (see FIG. 4).

Example  6. Small portable  Escherichia coli DNA Of app tamer  Structure determination

The structures of candidate E. coli K88 and K99 surface-bound DNA aptamer candidates could be imaged using the DNA mfold program provided by the Rensselear polytechnic institute (see FIG. 5).

Example  7. SPR through Small portable  Escherichia coli DNA Of app tamer Detectability  Test

7-1. Small portable  Escherichia coli K88 and K99  Live bacteria binding DNA Of app tamer Detectability  To verify Aptamer Fixed chip  making

In Example 5, the small intestine E. coli K88 live bacteria-bound aptamers E88-16 and E88-23 and the intestinal small-sized E. coli K99 live bacteria-bound aptamers E99-3 and E99- 8, the present inventors conducted a surface plasmon resonance (SPR) experiment using BIAcore 3000 (BIACORE), which is an SPR detection system device, in order to confirm the small E. coli K88 and K99 detection ability. For the SPR experiments, a sensor chip SA (GE Healthcare) whose surface was coated with streptavidin was used. First, ssDNA was prepared by labeling 5 'of E88-16, E88-23, E99-3, E99-8 aptamer with biotin to fix aptamer to a sensor chip to which streptavidin was immobilized. The surface of the sensor chip SA was treated with 10 μL / min of HBS-EP buffer (GE Healthcare) to activate the surface, and then the biotin-labeled aptamer prepared in this way was added to the sensor chip SA channel 2 coated with streptavidin And 3 times for 6 minutes at ㎕ / min to fix the aptamer to the sensor chip SA through streptavidin-biotin binding. A schematic diagram of a sensor chip SA coated with a streptavidin fixed on an aptamer is shown in Fig.

7-2. optimal Small portable  Escherichia coli K88 and K99  Live bacteria binding DNA Of app tamer  Evaluation of affinity with target strains

In order to evaluate the affinity between small intestine E. coli K88 and K99 and intestinal small E. coli K88 surface-binding appamers E88-16, E88-23 and enteric small E. coli K99 surface binders E99-3 and E99-8, small intestine E. coli K88 K99 was resuspended in the culture medium Tryptic Soy broth. The small coliform bacteria K88 and K99 were incubated with a sensor chip (channel 1) that did not bind anything, 5 μl / min of a small intestine culture solution to a sensor chip (channel 2) immobilized with small intestinal E. coli K88 and K99 surface- For 10 minutes to quantify the affinity between small intestinal E. coli K88 and K99 and small intestinal E. coli K88 and K99 surface-bound DNA aptamer candidates. The dissociation constants ( K _d , dissociation) of the candidate small-molecule E. coli K88 and K99 surface-bound DNA aptamer candidates binding to the respective small-sized E. coli K88 and K99 are shown in Table 5 below.

Target strain Clone name K _d value  (M) Escherichia coli K88
E88-16 1.12 × 10 ^-13 E88-23 1.18 × 10 ^-14 Escherichia coli K99
E99-3 7.15 × 10 ^-12 E99-8 4.84 × 10 ^-11

7-3. optimal Small portable  Escherichia coli K88 and K99  Live bacteria binding DNA Of app tamer  Evaluation of binding force with other strains

Enzymatic Small Escherichia coli K88 Surface binding aptamers E88-16, E88-23 and enterococcal small Escherichia coli K99 surface binders E99-3 and E99-8 were used for negative SELEX for the evaluation of the affinity for non-target strains of other strains. The strain was resuspended in each culture medium (see Table 1). The culture broth of the prepared strains K88 and K99 was transferred to a sensor chip (channel 2) to which a sensor chip (channel 1), which did not bind anything, a small-sized coliform K88 and a K99 surface-coupled DNA aptamer, For 10 minutes to quantify the affinity between a non-target strain and a candidate host micro-E. coli K88 and a K99 surface-bound DNA aptamer candidate group (see FIG. 7). The dissociation constants ( K _d , dissociation) of candidate enterococci K88 and K99 surface-bound DNA aptamer candidates were found to be low in the target strain but higher in the other strains than in the target strain.

The present invention has been described with reference to the preferred embodiments. It will be understood by those skilled in the art that the present invention may be embodied in various other forms without departing from the spirit or essential characteristics thereof. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> DNA aptamer specifically binds to the surface of living cell          enterotoxigenic Escherichia coli and uses thereof <160> 59 <170> Kopatentin 1.71 <210> 1 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-1 <400> 1 ttccaggtcc agctatgatt aaaggtggta gagcgtaatc 40 <210> 2 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-2 <400> 2 gttatagctt ttttaaattc gcggaggaaa agacatccc 39 <210> 3 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-3 <400> 3 cgctcgcgta ccggcgtaac acctgagtga gtaaactaat 40 <210> 4 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-4 <400> 4 cgctgcatgc gtggcaatac attggggagc ataagcttgg 40 <210> 5 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-5 <400> 5 ccagtggtat ttttcgtgtt tttaaaatgg cagcttgtac 40 <210> 6 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-6 <400> 6 cgcgtgaatt cgtactaggc caatcggatc ccttaccgcg 40 <210> 7 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-7 <400> 7 gattcctccc tagtaaattt atctcttcag cccggacgcg 40 <210> 8 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-8 <400> 8 gttcatcgct gcgcatttgg gcctgcgtct tactataccc 40 <210> 9 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-9 <400> 9 cgacgacctg tccctcttgt tgatggtcga gccgaaaccc 40 <210> 10 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-10 <400> 10 ccgcgaacat gggcgcggcc aacacaccca acgctgcagc 40 <210> 11 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-11 <400> 11 ttccatcccg attgtagttc aagcccccat tacggattta g 41 <210> 12 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-12 <400> 12 tagcgctccc tttatagatg gtactcctaa gctcgagaat 40 <210> 13 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-13 <400> 13 ggaactcttt caacacaggg gcgtgaaaca tactactacc 40 <210> 14 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-15 <400> 14 ggcaacctct cccgcacgtc ggccttgcgt cctcccact 39 <210> 15 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-16 <400> 15 gtagcctgca gtgtcctgtg tgtatggctt agtctcgtgg 40 <210> 16 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-17 <400> 16 cgctagtaac gtaaatgcca gtgaacaggc gagctacacc 40 <210> 17 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-18 <400> 17 ccctcggcgt ttttactttc gcagagtatg catggtgggg 40 <210> 18 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-19 <400> 18 gttgcatttc gcgcagtcct ctggtatccg ggaaggtgtg 40 <210> 19 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-20 <400> 19 ccggtagagc gtatccctgg tcggaacgtg ttctcgtgag 40 <210> 20 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-22 <400> 20 gcaagtcgaa attccgatcg tcccctgcac atctcgcgtg 40 <210> 21 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-23 <400> 21 ggccattcgt ggtacggtac cacgcaattc tacgtttcg 39 <210> 22 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-24 <400> 22 gtttggccgg caaagacgcg aggtaccctt ttaccccttg 40 <210> 23 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-25 <400> 23 gcgagtgagc gggtcgtatt gcgcaaagct cctcaagttg 40 <210> 24 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-27 <400> 24 gcttaatccg aactacagtt gtttgtgcta atactgcatg 40 <210> 25 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-28 <400> 25 ccgatgaacc ggaaaccgcc gtatgtatcc aatggctact 40 <210> 26 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-29 <400> 26 gtagtgcgct gcaccgtgcg tctttacctt tggtttcatg 40 <210> 27 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E88-30 <400> 27 ggccccgtga gggttgcagc cacgacggga tgcgttgtcg 40 <210> 28 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-1 <400> 28 gtcgttttga caagagaaag taatcccgat caaggtggtc 40 <210> 29 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-2 <400> 29 ttcttgtccg tgtcgcgcta gtttgacgtt ttggatctgc 40 <210> 30 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-3 <400> 30 tgctgtgcaa catgttccct cgtctcatgc ctccatgccc g 41 <210> 31 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-4 <400> 31 cggcactcgt cgttaggtcg taggtttcgt tgggttgggg 40 <210> 32 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-6 <400> 32 cgcacatcca ccgtgaatgt ggtcataact ccctgtgacg 40 <210> 33 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-7 <400> 33 catcaggaga cgctgggcct gatgataccg taacgtggcg 40 <210> 34 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-8 <400> 34 tccgtcatgt gttgccgttg ttatttatcg gttttggtgg 40 <210> 35 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-10 <400> 35 tgacacctgc tttcactgac gtagtatttg ggttatgggg 40 <210> 36 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-11 <400> 36 ttgcgctgtc gaaagttaga gggggtctgg gggtatatag 40 <210> 37 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-12 <400> 37 cctgtttgtg tggaatggtg gcacagtact ccatgcagat 40 <210> 38 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-13 <400> 38 cttactccat tgtgggtgca acagtgtctt tacgtgtctg 40 <210> 39 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-14 <400> 39 aacctcgctc agagcccatc atgtgtccga aattctggat 40 <210> 40 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-15 <400> 40 aaatgcgggt tactcaatat cctgagcgcg tggtcttccg 40 <210> 41 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-16 <400> 41 tgatgcaatc gccaggtcgt acattccgga gtgtgttccc g 41 <210> 42 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-17 <400> 42 tggagcagtg ttttacaatt gctagagagt gcttaaagtg 40 <210> 43 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-18 <400> 43 ggcgcagagc gtacgaatcc ctttccttcc cttaagtctg c 41 <210> 44 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-19 <400> 44 ggtctgtatc gacgtcacgc tgcaacccag ttaaatgata 40 <210> 45 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-20 <400> 45 ttggactaat ctggagcaag atcacggcca tatgcatatc 40 <210> 46 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-21 <400> 46 cggtgctttc tcttttcgtt ttccctttcc aatgctcgcg 40 <210> 47 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-22 <400> 47 gcacgggggg gttacctttt acacgtgttt ccgttttgtg 40 <210> 48 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-23 <400> 48 ggccattcgt ggtacggtac cacgcaattc tacgtttcg 39 <210> 49 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-24 <400> 49 cacgcctagc gctgagcacg ccaagtgctg ggatcccatt 40 <210> 50 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-25 <400> 50 caaatagatg tctctgatgg tattgtccaa taggcaacgg 40 <210> 51 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-26 <400> 51 tgggccatag agtccgtttt agcgtggcgg gttgacctgg 40 <210> 52 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-27 <400> 52 gatgagtgga aatataccct tggtggcaga ctctttaacg 40 <210> 53 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-29 <400> 53 cggcagcgct ttcaacatcg ctaagcaact agtcacatca 40 <210> 54 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-30 <400> 54 aactcggaag agaatgtgga acatgcatcc catttaccg 39 <210> 55 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-31 <400> 55 caagtcgttt ttcaaaggtc ggggcatttc cgcgaatgga 40 <210> 56 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> DNA aptamer E99-32 <400> 56 ggcctcgtcg cagtccaact ctttgtctct gaaccaatac 40 <210> 57 <211> 100 <212> DNA <213> Artificial Sequence <220> <223> template DNA, where n is any one selected from consiting of A,          G, C and T <400> 57 ggtaatacga ctcactatag ggagatacca gcttattcaa ttnnnnnnnn nnnnnnnnnn 60 nnnnnnnnnn nnnnnnnnnn nnagattgca cttactatct 100 <210> 58 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> PCR forward primer <400> 58 ggtaatacga ctcactatag ggagatacca gcttattcaa tt 42 <210> 59 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> PCR reverse primer <400> 59 agatagtaag tgcaatct 18

Claims (10)

Enterotoxigenic Escherichia coli A DNA aptamer consisting of the nucleotide sequence of SEQ ID NO: 34, which specifically binds to the surface of K99 live cells. delete delete A composition for detecting small intestine E. coli, comprising the DNA aptamer of claim 1. A kit for detecting small enteral coliform bacteria, comprising the DNA aptamer of claim 1. 6. The method of claim 5,
Wherein the kit is in the form of a microarray in which DNA aptamers are immobilized on a substrate. A method for detecting small intestine E. coli comprising the step of reacting the DNA aptamer of claim 1 with a sample. A composition for diagnosing livestock diarrhea caused by small intestine E. coli, comprising the DNA aptamer of claim 1. A kit for diagnosing diarrheal disease in livestock by small enteral coliform bacteria, comprising the DNA aptamer of claim 1. A method for diagnosing diarrheal disease of livestock by small intestine E. coli, comprising the step of reacting the DNA aptamer of claim 1 with a sample.

Images