KR101401534B1 - DNA Aptamer Specifically Binding to Surface of Living Cell of Vibrio parahemolyticus and Uses Thereof - Google Patents

Abstract

The present invention relates to a DNA aptamer which specifically binds to the surface of a live bacterium of Vibrio parahaemolyticus, and its use. The DNA aptamer of the present invention has an activity of specifically binding to the surface of a live bacterium of Vibrio parahaemolyticus, so that it can be used as an active ingredient in a sample such as an animal product, a processed food, a dairy product, a drinking water, Live cysts can be detected and information useful for diagnosis of food poisoning can be provided.

Description

[0001] The present invention relates to a DNA aptamer which specifically binds to the surface of a live bacterium of Vibrio parahaemolyticus, and a use thereof. [0002]

The present invention relates to a DNA aptamer which specifically binds to the surface of a live bacterium of Vibrio parahaemolyticus, and its use.

Vibrio (Vibrio) Vibrio pathogens known to cause food poisoning in people from the Para Iti Syracuse to Mora (Vibrio parahemolyticus ) is a tuberculous anaerobic gram-negative bacterium with mobility and one or more flagella. The main pathway of infection can be infected by penetrating the wound or the soft part of the skin, or by ingesting fish or shellfish or seafood, but infection by the wound is relatively low. It is known that the occurrence of food poisoning tends to multiply rapidly due to the high water temperature in the coastal areas from summer to autumn, and the rate of food poisoning increases, and the incubation period is within 24 hours. Symptoms include diarrhea, nausea, vomiting, abdominal pain, or fever, as well as diarrhea, which lasts from 3 to 10 days. In the case of weakened children and elderly people, Severe seizures, as well as dehydration and lethargy with death to the degree of fatal symptoms are accompanied. Most of the causes of foodborne illness of Vibrio parahaemolyticus are toxins called hemolytic toxins and are the main hospital factors. Although this toxin is known to be a toxin that causes hemolysis by making a hole in the cell membrane of red blood cells, it acts on the cell membrane of normal cells. If it acts on the intestine or heart, it can lead to diarrhea or death due to cardiac toxicity .

As described above, Vibrio parahaemolyticus, which causes a fatal disease, is caused by various kinds of pathogenic microorganisms due to increase in domestic average temperature due to imported livestock, imported processed foods, global warming and weather changes. And the rate of transmission to the public environment is rapidly increasing. Therefore, it is required to develop a technology capable of effectively detecting Vibrio parahaemolyticus contained in various foods such as seafood, imported aquatic products, fish and shellfish, and drinking water.

As a method for early detection and identification of Vibrio parahaemolyticus contained in environment such as food, drinking water and the like, conventional culture using a special medium, molecular biology PCR detection, ELISA and immunoassay using antigen antibody, etc. Is used as a diagnostic method. These methods have disadvantages such as DNA extraction in the sample, separation of the target microorganism, and culture step in order to increase the detection efficiency, and it takes 28 hours or more to confirm the detection of the pathogenic microorganism after the sample pretreatment. In order to accurately detect and confirm, there is a disadvantage that it is impossible to process a large amount of samples due to the problem that two or three experiments must be performed concurrently. Therefore, it is urgently required to develop a high-efficiency Vibrio parahaemolyticus detection system capable of rapidly and simply processing large-scale samples. In order to develop a biosensor through the development of such a system, it is necessary to satisfy conditions such as short response time, high selectivity to react only with a specific substance, sensitivity to detect a small amount of substances, chemical stability and low cost. The study was conducted using.

Aptamers are composed of oligomers of short length and form their own various three-dimensional structures. These oligomer structure libraries are capable of structurally binding with various target substances, and among them, screening for aptamers specific to the target substance Respectively. The selected aptamers have the advantage of being able to obtain sequence through sequence analysis, mass production in a short time and low cost by using chemical synthesis technique, and continuous production of aptamer having the same ability once production and production. In addition, it is composed of DNA and can provide more stability through additional chemical substitution process. It is very stable in surrounding pH and temperature, and attaches compounds such as biotin, And it can be used in various fields such as medicine.

Numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated herein by reference in their entirety to better understand the state of the art to which the present invention pertains and the content of the present invention.

The present inventors Vibrio that causes food poisoning para to Mora ET kusu (Vibrio parathermolyticus ) as a live-cell-type DNA aptamer. As a result, the present inventors succeeded in synthesizing and selecting a DNA aptamer that binds to the surface of live cells of Vibrio parahaemolyticus in a live cell state with high specificity, thereby completing the present invention.

Accordingly, an object of the present invention is to provide a DNA aptamer that specifically binds to the surface of a live bacterium of Vibrio parahaemolyticus.

Another object of the present invention is to provide a method for screening the DNA aptamer.

It is another object of the present invention to provide a composition or kit for detecting Vibrio parahaemolyticus containing the DNA aptamer as an active ingredient.

It is still another object of the present invention to provide a method for detecting Vibrio parahaemolyticus live cells.

In order to achieve the above object, in the present invention, Vibrio para to Mora ET kusu (Vibrio parahaemolyticus ) provides a DNA aptamer that specifically binds to the surface of live cells.

According to a preferred embodiment of the present invention, the DNA aptamer is an oligonucleotide having a nucleotide sequence as set forth in any one of SEQ ID NOS: 1 to 28 or a homologous oligonucleotide thereof.

In another aspect of the present invention, there is provided a method for selecting a DNA aptamer comprising the steps of: (i) amplifying a DNA aptamer using a PCR technique to prepare a ssDNA aptamer; (Ii) culturing and washing Vibrio parahaemolyticus; (Iii) Vibrio parahaemolyticus A step of screening DNA aptamers that specifically bind to the surface of live bacteria of Violeta parahaemolyticus through a Live Cell SELEX technique using live bacteria of Moraiticus.

According to another aspect of the present invention, there is provided a composition for detecting Vibrio parahaemolyticus containing the DNA aptamer as an active ingredient.

According to another aspect of the present invention, there is provided a kit for detecting Vibrio parahaemolyticus live cells containing the DNA aptamer as an active ingredient.

According to a preferred embodiment of the present invention, the kit is in the form of a chip in which DNA aptamers are immobilized on a chip.

According to another aspect of the present invention, there is provided a method for detecting Vibrio parahaemolyticus live cells, which comprises the steps of:

(a) Vibrio para to Mora ET kusu (Vibrio parahaemolyticus ) live bacteria and the DNA aptamer; And (b) to the Vibrio para coupled to the DNA aptamer Mora ET kusu (Vibrio parahaemolyticus ) to identify live bacteria.

The present invention is based on the finding that Vibrio parahaemolyticus ) which specifically binds to the viable surface of live bacteria.

As used herein, the term " DNA aptamer " refers to a DNA nucleic acid molecule capable of binding with high affinity and specificity to a specific target substance.

In the present specification, "DNA aptamer" is used in combination with "DNA oligonucleotide".

The term " oligonucleotide " as used herein generally refers to a nucleotide polymer having only about 200 nucleotides in length, including DNA and RNA, preferably DNA nucleotide molecules. Nucleotides include deoxyribonucleotides, ribonucleotides, modified nucleotides or bases and / or their analogs, or any substrate that can be introduced into a polymer by DNA or RNA polymerase or by synthetic reaction. If a modification to the nucleotide structure is present, such modification may be added before or after the synthesis of the oligonucleotide polymer. The nucleotide sequence may be terminated by a non-nucleotide component. The oligonucleotides can be further modified after synthesis, for example by binding with a label.

The term "homologous oligonucleotide" refers to a sequence homologous to a nucleotide sequence of SEQ ID NO: 1 to 28, preferably 80% or more, more preferably 90% or more, still more preferably 95% or more, and most preferably 99% Refers to an oligonucleotide having substantially the same function as the DNA aptamer gene of the present invention. Sequence homology can be analyzed by methods known in the art.

The DNA aptamers of the present invention are typically obtained by in vitro selection for binding of the target material. Methods for selecting an aptamer that specifically binds to a target substance are well known in the art. For example, organic molecules, nucleotides, amino acids, polypeptides, marker molecules on the surface of live cells, ions, metals, salts, polysaccharides can be suitable target substances for separating aptamers capable of specifically binding to each ligand . Selection of the aptamer can utilize in vivo or in vitro selection techniques known by the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) method (Ellington et al., Nature 346, 818-22, 1990; and Tuerk et al. , Science 249, 505-10, 1990). As used herein, the term " SELEX method " refers to a method of identifying the DNA binding sequence of a substance by selectively amplifying a DNA having a high binding affinity for a specific substance from a set of arbitrarily synthesized DNAs (Louis et al. Nature 355, 564-566).

According to a specific embodiment of the present invention, the DNA aptamer of the present invention is selected through the following steps:

(I) amplifying a DNA aptamer using a PCR technique and preparing a ssDNA aptamer;

(Ii) culturing and washing Vibrio parahaemolyticus; And

(Iii) Vibrio parahaemolyticus A step of screening DNA aptamers that specifically bind to the surface of live bacteria of Violeta parahaemolyticus through a Live Cell SELEX technique using live bacteria of Moraiticus.

Hereinafter, the screening method of the DNA aptamer of the present invention will be described in more detail.

(I)

PCR is used to amplify the random dsDNA library. Asymmetric PCR is performed to amplify only ssDNA in the amplified random dsDNA library. Asymmetric PCR is a method of obtaining single stranded DNA by performing PCR using a forward primer and a reverse primer at a ratio of 10: 1, for example, 10 μl of a forward primer and 1 μl of a reverse primer at the same concentration (25 μM) . For example, when performing PCR, ssDNA aptamer is selected by, for example, attaching biotin to a reverse primer to amplify dsDNA and treating the amplified product with streptavidin to form a biotin-streptavidin complex, And selectively removing only the ssDNA aptamer. The ssDNA aptamers prepared are denatured by heating ssDNA for use in the SELEX method, and then slowly cooled at room temperature to form a three-dimensional structure.

(Ii)

Vibrio parahaemolyticus is cultivated in order to screen DNA aptamers binding to the live cell surface of V. parahaemolyticus. In order to maintain the viable state, the experiment is carried out in Nutrient broth with 3% NaCl culture medium, which is a culture condition of Vibrio parahaemolyticum.

(Iii).

After the prepared Vibrio parahaemolyticus and ssDNA aptamer are allowed to react with each other in contact with each other, the unbound ssDNA aptamer is washed and removed, and only the specifically bound ssDNA is eluted. At this stage, it may include a Negative SELEX step to remove ssDNA binding to another bacterium, for example, Gram-negative bacteria Escherichia coli and Gram-positive bacteria Bacillus bacteria.

In the method of the present invention, it is possible to use a method of quantifying ssDNA eluted by a nano drop method in order to select an optimal SELEX round in which DNA aptamers specifically binding to the surface of Vibrio parahaemolyticus live up to the maximum.

In the method of the present invention, in order to select the DNA aptamer exhibiting the optimum binding force with Vibrio parahaemolyticus during the optimal SELEX round, all of the aptamer sequences secured in the optimum round were obtained in the same manner as the optimal SELEX round selection, . After SELEX was performed, the optimal vibrio parahaemolyticus DNA aptamer was selected by measuring the eluted aptamer concentration using a nano-drop method using a nano-drop method.

The DNA aptamer of the present invention is preferably an oligonucleotide having a nucleotide sequence as set forth in any one of the nucleotide sequences shown in SEQ ID NOS: 1 to 28.

The secondary structure of SEQ ID NOS: 1 and 13, which was the most specific among the aptamers of SEQ ID NOS: 1 to 28 of the present invention, is presumed to form the secondary structure shown in FIG.

The DNA aptamer of the present invention also includes an oligonucleotide having a nucleotide sequence that exhibits substantial identity with any one of the nucleotide sequences of SEQ ID NOS: 1 to 28 while retaining the specific binding property to the surface of the live cell of Vibrio parahaemolyticus .

The present invention relates to a composition for detecting Vibrio parahaemolyticus containing the DNA aptamer as an active ingredient. As demonstrated in the following specific examples of the present invention, the DNA aptamer of the present invention specifically binds to the surface of live bacterium of Vibrio parahaemolyticus, so that the presence or absence of Vibrio parahaemolyticus present in various environments is detected Can be used effectively.

The present invention relates to a kit for detecting Vibrio parahaemolyticus live bacteria comprising the DNA aptamer as an active ingredient. The kit may be in the form of a chip in which a DNA aptamer that specifically binds to the surface of a live bacterium of Vibrio parahaemolyticus is immobilized on a chip, or a microarray in which a DNA aptamer is immobilized on a substrate. The DNA aptamer can be immobilized on a chip or a substrate using a method known in the art.

According to a specific embodiment of the present invention, a chip or a substrate is modified with streptavidin, the 5 'end of the DNA aptamer is subjected to biotinylation, and the biotin of the DNA aptamer and the streptavidin Can be immobilized using binding with avidin.

The invention Vibrio, comprising the steps of para to Mora ET kusu (Vibrio parahaemolyticus) relates to a method for detecting live cells of the: (a) Vibrio para to Mora ET kusu (Vibrio parahaemolyticus ) live bacteria and the DNA aptamer; And (b) to the Vibrio para coupled to the DNA aptamer Mora ET kusu (Vibrio parahaemolyticus ) to identify live bacteria.

Since the DNA aptamer of the present invention has an excellent ability to bind to the surface of the live bacteria of the Vibrio parahaemolyticus, the bacteria can be detected by contacting the sample expected to contain the DNA aptamer and the Vibrio parahaemolyticus. Detection of Vibrio parahaemolyticus bound to the DNA aptamer can be based on a method for detecting DNA aptamer and Vibrio parahaemolyticus binding complex. To facilitate detection of the complex, the DNA aptamer can be a fluorescent substance, such as fulorescein, Cy3 or Cy5; Radioactive materials, or chemicals, such as nucleotides labeled with biotin or modified with primary amines. Samples expected to include Vibrio parahaemolyticus may include, but are not limited to, animal products, processed foods, dairy products, drinking water, cookware, and water resources.

The present invention relates to a DNA aptamer which specifically binds to the surface of a live bacterium of Vibrio parahaemolyticus, and its use. The DNA aptamer of the present invention has an activity of specifically binding to the surface of a live bacterium of Vibrio parahaemolyticus, so that it can be used as an active ingredient in a sample such as an animal product, a processed food, a dairy product, a drinking water, Can be detected and information useful for diagnosis of food poisoning can be provided.

FIG. 1 shows the results obtained by amplifying random DNA aptamer using PCR method, then selectively recovering only ssDNA using streptavidin agarose resin, and amplifying only by PCR. Lane 1: 100 bp DNA size marker; Lane 2: amplification of DNA aptamers by PCR; Lane 3: After amplification by PCR method, only ssDNA was recovered using streptavidin agarose resin.
FIG. 2 is a graph showing the results of quantitative measurement of the concentration of Vibrio parahaemolyticus DNA aptamer recovered in each round of the SELEX process for the production of Vibrio parahaemolyticus DNA aptamer using nano-drop to be.
Fig. 3 shows the results of the first (a), second (b), and second (b) analyzes of the Vibrio parahaemolyticus DNA aptamer candidates obtained in the selected rounds after the SELEX process for producing Vibrio parahaemolyticus DNA aptamers. The elution solution was quantitatively measured using nano drop.
Fig. 4 shows the predicted structure of Vibrio parahaemolyticus surface-bound DNA aptamers VPCA-01 and VPCA-02 using an m-fold program.
FIG. 5 shows a process of fixing Vibrio parahaemolyticus surface-bound DNA aptamer to the surface of a sensor chip SA coated with streptavidin and binding Vibrio parahaemolyticus live cells.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are only for describing the present invention in more detail and that the scope of the present invention is not limited by these embodiments in accordance with the gist of the present invention .

Example 1: Preparation of a DNA aptamer pool

1. Synthesis of primer and DNA aptamer pool

(5'-ATACCAGCTTATTCAATT (SEQ ID NO: 29)) as a site for easily amplifying the aptamer pool at both ends in order to prepare a Vibrio parahaemolyticus-specific DNA aptamer that specifically binds to Vibrio parahaemolyticus (SEQ ID NO: 30) and having 40 consecutive random nucleotides in the center at the ratio of dA: dG: dC: dT = 1.5: 1.15: 1.25: 1, and amplifying this DNA library Biotinylated reverse primer was custom-made in Bioneer, Korea to obtain forward primer and single strand DNA that could be used (forward primer: 5'-ATACCAGCTTATTCAATT-3` (SEQ ID NO: 31), biotinylated Biotinylated reverse primer: 5'-biotin-AGATTGCACTTACTATCT-3` (SEQ ID NO: 32)).

2. Amplification of DNA aptamer pool using PCR technique

The synthesized primer and any DNA library having 40 consecutive random sequences were amplified using PCR (Bioneer, Korea). The PCR reaction composition for amplification of the 76 bp DNA library was composed of 5 μl of 10 × PCR buffer, 4 μl of each 2.5 mM dNTP mixture, 2 μl of 10 μM forward primer, 2 μl of biotinylated reverse primer, Mu] l of Ex Taq polymerase (TaKaRa, Japan) and 34.7-35.7 [mu] l of distilled water. The PCR reaction conditions were first denatured at 94 ° C for 5 minutes, followed by 20 cycles of reaction at 94 ° C for 30 seconds, 52 ° C for 30 seconds, and 72 ° C for 30 seconds, followed by extension at 72 ° C for 5 minutes Was used. After the PCR reaction, 3 μl was taken and 2% agarose gel was used to confirm that the band appeared at the correct size of 76 bp. The identified DNA was recovered from the DNA aptamer pool using a PCR purification kit (Qiagen, USA).

3. DNA aptamer pool ssDNA production and purification

As described above, to make 5'-biotinylated dsDNA aptamer pool as a ssDNA aptamer pool, 200 쨉 l of biotinylated dsDNA aptamer pool was boiled at 85 째 C for 5 minutes and then rapidly cooled on ice. Streptavidin agarose resin was added to 100 μl of the dsDNA aptamer pool and reacted with streptavidin for 1 hour or more at room temperature. Subsequently, centrifugation (4 ° C, 13,000 rpm) was carried out for 10 minutes to precipitate streptavidin agarose resin, thereby removing one of the biotinylated dsDNA aptamer pools through streptavidin-biotin binding to obtain ssDNA aptamer Pools were made. Then, 200 μl of the upper layer was transferred to a new tube to obtain a pure ssDNA aptamer pool. And generally utilized the PCI treatment and ethanol precipitation method used in the industry. In this method, 200 μl of the same amount of PCI was added to the transferred ssDNA aptamer pool, and lipids and proteins remaining in the ssDNA were removed by stirring. After centrifugation (4 ° C., 13,000 rpm) was performed for 15 minutes, To remove phenol. After that, 600 μl of ethanol was added in triplicate to the amount of DNA, 20 μl of 1/10 fold of 3M sodium acetate, and 1-2 μl of tRNA were added and reacted in a deep freezer at 70 ° C for 1 hour or longer. After that, DNA was precipitated by centrifugation (4 ° C, 13,000 rpm) for 20 minutes, and the upper layer was removed. After drying in a heat block at 85 ° C, 100 μl of distilled water was added to obtain a ssDNA aptamer pool.

4. PAGE for identification of ssDNA aptamer pool

The ssDNA aptamer pool recovered via streptavidin and biotin binding was confirmed by electrophoresis on 0.5X TBE acrylamide gel. The composition of the 0.5X TBE (Tris-borate-EDTA) acrylamide gel was prepared by adding 3.75 ml of 40% acrylamide and 0.75 ml of 10X TBE buffer and filling with 15 ml of distilled water. Then, 135 μl of 10% APS (Ammonium per sulfate) (Tetramethylethylenediamine). The acrylamide gel was mixed with 10 μl of ssDNA aptamer pool and 2 μl of DNA loading dye. A 100 bp DNA marker was used as a ladder marker. The acrylamide gel for identification of ssDNA aptamer pool for polyacrylamide gel electrophoresis (PAGE) was electrophoresed on a power supply (Major Science, USA) at 150 V for 45 minutes. The electrophoretic acrylamide gels were stained with ETBR solution for 5 minutes and then observed with ultraviolet light by Gel-doc (Bio-Rad, USA). (Fig. 1)

5. DNA Aptamer  Construction of pool structure

The ssDNA aptamer pool, confirmed by PAGE, was added to 100 μl of ssDNA aptamer pool which had been prepared to make its own 3-dimensional structure, and 100 μl of 2X Nutrient broth with 3% NaCl was added. For 5 minutes to induce denaturation of the ssDNA aptamer pool. The denatured ssDNA was slowly cooled at room temperature for 2 hours or more to induce its own three - dimensional structure formation.

Example  2: Vibrio Parahay Mora Itikus  Live bacteria binding DNA Aptamer  Live cells for production ( Live - cell ) Preparation

1. Vibrio Parahaya Moraitikusu  Culture preparation and culture

For the production of Vibrio parahaemolyticus DNA-Aptamer, Vibrio parahaemolyticus was obtained through culture. Nutrient broth with 3% NaCl (Difco, USA) was used as the culture medium and cultured in a 37 ° C agitator for 14 hours. In order to remove other substances that are formed during cultivation to bind only to the live cells, the cultured vibrio parahaemolyticus was washed with a cleaning solution having a composition of 10 mmol / L of Tris base, 0.85% of NaCl and pH 8.0. For the washing method, the cultured Vibrio parahaemolyticus was centrifuged (4 ° C, 13,000 rpm) for 10 minutes to precipitate Vibrio parahaemolyticum and the upper layer was removed. After that, 200 μl of washing solution was added, and the surface of Vibrio parahaemolyticus was removed by pipetting, followed by centrifugation (4 ° C., 13,000 rpm) for 10 minutes to precipitate Vibrio parahaemolyticum and remove the upper layer Respectively. The above procedure was repeated three times to clean the surface of Vibrio parahaemolyticus.

2. Negative selection  Cultivating and securing other bacteria for progress

A negative selection using Escherichia coli and Bacillus was performed to remove non-specific aptamer candidates binding to other strains of the Vibrio parahaemolyticus yeast specific binding DNA aptamer candidate group specifically binding to Vibrio parahaemolyticus .

2-1. E. coli ( E. coli ) Culture and securing

Negative selection LB broth was used as a culture medium for Escherichia coli. 5 ml of LB broth was inoculated and cultured at 37 DEG C for 12 hours. Then, the cultured Escherichia coli was centrifuged (4 캜, 13,000 rpm) for 10 minutes to precipitate and the upper layer was removed. After that, 200 μl of washing solution was added, and the surface of E. coli was washed by pipetting and centrifugation (4 ° C., 13,000 rpm) was performed for 10 minutes to precipitate and remove the upper layer. The above procedure was repeated three times to wash the surface of E. coli.

2-2. Bacillus Subtilis  ( B. subtilis ) Culture and securing

Negative selection LB broth was used as a culture medium for Bacillus subtilis. 5 ml of LB broth was inoculated with Bacillus subtilis and cultured at 37 DEG C for 12 hours. Subsequently, the cultured Bacillus subtilis was centrifuged (4 캜, 13,000 rpm) for 10 minutes to precipitate and the upper layer was removed. Thereafter, the surface of Bacillus subtilis was washed with pipetting by adding 200 세척 of washing solution, centrifuged (4 캜, 13,000 rpm) for 10 minutes to precipitate and the upper layer was removed. The above procedure was repeated three times to clean the Bacillus subtilis surface.

2-3. Listeria Monosaitogenes  ( L. monocytogenes ) Culture and securing

NA broth was used as a culture medium for Listeria monocytogenes, a strain for eliminating aptamer that binds nonspecifically in SPR measurement. 5 ml of NA broth was inoculated with Listeria monocytogenes and cultured at 37 占 폚 for 12 hours. The cultured Listeria monocytogenes was then centrifuged (4 ° C, 13,000 rpm) for 10 minutes to precipitate and the upper layer was removed. Thereafter, the surface of Listeria monocytogenes was washed with pipetting by adding 200 세척 of wash solution, centrifuged (4 캜, 13,000 rpm) for 10 minutes to precipitate and the upper layer was removed. The above procedure was repeated three times to wash the Listeria monocytogenes surface.

2-4. vibrio Fishery  ( V. fischeri ) Culture and securing

LBS broth was used as the culture medium of Vibrio Fischeri, a strain to eliminate non-specific binding aptamers in SPR measurement. 5 ml of LBS broth was inoculated with Vibrio fischeri and cultured at 37 DEG C for 12 hours. The cultured Vibrio fischeri was then centrifuged (4 ° C, 13,000 rpm) for 10 minutes to precipitate and the upper layer was removed. Thereafter, 200 μl of washing solution was added, and the surface of the Vibrio facial was cleaned by pipetting and centrifugation (4 ° C, 13,000 rpm) was performed for 10 minutes to precipitate and remove the upper layer. The above procedure was repeated three times to clean the Vibrio facial surface.

Example  3: Vibrio Parahaya Moraitikusuwa  Specifically, Parahay Mora Itikus  Fabrication of surface bonding aptamer

1. Vibrio Parahay Mora Itikus  Specific binding to live cells DNA Aptamer  Screening and securing candidates

200 μl of the ssDNA aptamer pool forming the self-3-dimensional structure with the live bacteria washed in Example 2 was added and reacted for 1 hour at 4 ° C. and 500 rpm in a thermo mixer (Eppendorf, USA). Then, the tube was taken out and centrifuged (4 ° C, 13,000 rpm) was performed for 10 minutes to precipitate the Vibrio parahaemolyticus, to which the ssDNA aptamer pool was bound, and the upper layer was removed. The Vibrio parahaemolyticus DNA aptamer precipitated by the weight of Vibrio parahaemolyticum, and the unbound ssDNA aptamers remained in the upper layer.

Vibrio parahaemolyticus and Vibrio parahaemolyticus in precipitated Vibrio parahaemolyticus candidates in the candidate group of vibrio parahaemolyticus were sieved to remove ssDNA aptamer pool which was not bound to vibrio parahaemolyticus and pipetted After centrifugation (4 ° C, 13,000 rpm) for 10 minutes, the Vibrio parahaemolyticus was precipitated and the upper layer was removed. The above procedure was repeated three times to remove the ssDNA aptamer pool that was non-specifically bound to V. parahaemolyticum. Then, 100 쨉 l of a DNA aptamer elution solution composed of 10 mM Tris (pH 7.5) and 1 mM EDTA was added to the precipitate. After incubation at 85 ℃ for 5 minutes, the cells were incubated for 10 minutes at 4 ℃ and 13,000 rpm to precipitate V. parahaemolyticus. Vibrio parahaemolyticus DNA-aptamer The eluted supernatant was transferred to a new tube to recover a candidate DNA aptamer that specifically binds to Vibrio parahaemolyticus. The above procedure was repeated twice to recover 100 μl of each DNA aptamer pool.

2. Vibrio Parahay Mora Itikus  Specific binding of live bacteria DNA Aptamer  Refining and Elong  Concentration measurement

Vibrio parahaemolyticus live cell specific binding DNA Aptamer PCI and ethanol precipitation methods commonly used in the industry were used to remove protein and lipid remaining in the pool and recover only DNA. 100 μl of each recovered DNA aptamer pool was treated with 100 μl of PCI solution and mixed. After centrifugation (4 ° C, 13,000 rpm) was performed for 15 minutes, 100 μl of the upper layer was transferred to a new tube. After that, 300 μl of ethanol (100% Ethanol) was added, and 10 μl of 3M sodium acetate and 1 μl of tRNA were added and reacted for 1 hour or more in a deep freezer at 70 ° C. After that, DNA was precipitated by centrifugation (4 ° C, 13,000 rpm) for 20 minutes, and the upper layer was removed. After drying in a heat block at 85 ° C, 50 μl of distilled water was added to obtain a DNA aptamer pool eluted. 1 μl of the obtained DNA aptamer pool was measured by nano-drop to confirm the DNA concentration.

Example  4: Vibrio Parahaya Moraitikusuwa  Exhibit optimal bonding strength DNA Aptamer  Selection of candidates

1. Each round DNA Aptamer  Selection and securing of pool

50 μl of the ssDNA aptamer pool of each round obtained after preparing the ssDNA using the eluted DNA aptamer pool of each round using the above-described method was subjected to a PCR reaction using Vibrio parahaemolyticum (Eppendorf, USA) at 4 ° C and 500 rpm for 1 hour. Then, the tube was taken out and centrifuged (4 ° C, 13,000 rpm) was performed for 10 minutes to precipitate the Vibrio parahaemolyticus bound to the structure-forming ssDNA aptamer pool. After removing the upper layer, 200 μl of the washing solution was pipetted After centrifugation (4 ° C, 13,000 rpm) for 10 minutes, the upper layer was removed and washed three times. 100 μl of the eluate was added, heated at 85 ° C for 5 minutes, centrifuged (4 ° C, 13,000 rpm) Was performed for 10 minutes to obtain eluted DNA aptamer of each round.

2-1. Nano - drop Respectively. round Elong DNA Aptamer  Analysis of pools

In order to remove proteins and lipids remaining in the DNA aptamer pool of each round and to recover only the DNA, it was purified using the PCI and ethanol precipitation methods conventionally used in the art. 1 μl of DNA aptamer pool of each round was measured with nano-drop. DNA concentration was checked. After 2 negative selections, 8 rounds of aptamer candidates with the highest concentration were selected. (See FIG. 2)

2-2. Real - time PCR Respectively. round Elong DNA Aptamer  Analysis of pools

Real-time PCR analysis was used for in-depth analysis of the elution DNA aptamer candidates measured by nano-drop. Initial DNA aptamer pools and 7, 8, and 9 rounds after negative selection were diluted to 1/1, 1/10, and 1/100 concentrations, respectively. As a result of the analysis, it was judged that the efficiency was the best at a concentration of 1/1 of 8 rounds.

Sample Efficiency  (%) C (t) 0 round 1/1 68.42 13.72 0 round 1/10 79.25 14.59 0 round 1/100 63.67 15.96 7 round 1/1 93.81 8.73 7 round 1/10 81.35 12.63 7 round 1/100 85.52 14.86 8 round 1/1 99.56 7.68 8 round 1/10 81.73 11.73 8 round 1/100 79.90 15.86 9 round 1/1 92.98 7.95 9 round 1/10 78.51 12.71 9 round 1/100 71.08 17.31

Example  5: Selected round From Vibrio Parahama Mora Itikusu  Specifically, Parahay Mora Itikus  Surface bonding DNA Aptamer  Candidate group analysis

One. DNA Aptamer  The T- vector cloning  Performance and selection

For the selection of DNA aptamer candidates for 8 rounds selected, 5 μl of 10X PCR buffer solution, 4 μl of each 2.5 mM dNTP mixture, 2 μl of 10 pM forward primer, reverse direction 2 μl of primer, 1-2 μl of template DNA library, 0.3 μl (1 unit / μl) of Ex Taq polymerase (TaKaRa, Japan) and 34.7-35.7 μl of distilled water. The PCR reaction conditions were first denatured at 94 ° C for 5 minutes, followed by 20 cycles of reaction at 94 ° C for 30 seconds, 52 ° C for 30 seconds, and 72 ° C for 30 seconds, followed by extension at 72 ° C for 5 minutes Was used. The amplified DNA aptamer was ligated with 1 μl of T-blunt vector, 1 μl of 6 × cloning buffer and 4 μl of PCR product using a T-vector cloning kit (Solgent, Korea) for 10 min at 25 ° C. ( E. coli DH5 [alpha] ), and reacted in ice for 20 minutes. Then, the transformed cells were transformed by reaction with heat shock method at 42 ° C for 30 seconds and transformed with ampicillin (50 μg / ml), kanamycin (50 μg / ml), X- 5 [mu] g / ml) on an LB plate (LB plate). A total of 31 white colonies of colonies grown in the culture medium were selected and inoculated into 5 ml of LB broth supplemented with ampicillin and kanamycin, respectively, and plasmids were extracted using a plasmid DNA prep kit (Intron, USA). Plasmid DNA for each colony was obtained from Solgent (Korea) and sequenced.

2. clustal Vibrio via -X Parahay Mora Itikus  Specific binding of live bacteria DNA Aptamer  Grouping of candidate sequences

The DNA aptamer sequence inserted through cloning among the sequences for each colony was identified and sequenced and analyzed using the Clustal-X program. A group was formed for each sequence, and the sequence similarity between each sequence was analyzed, and 28 sequences grouped into 26 including 3 identical sequences were obtained. (See Table 2)

Group Sequence SEQ ID NO: Size  ( bp ) Clone Group-1 CATACCAAGGCTACCGAGGTTCCAGATATTGGCCGCTATG One 40 2 Group-2 CCACGTTTCCACGTATCCTCGGAGCTTGCTTAACCGTACG 2 40 2 Group-3 TGCGTAGTTCTTTTAACAACCATTCAGCGTATTTTCGTGG 3 40 2 Group-4 CCCTCGGCGTAACTAGTACCGTTGCACCACCAACGTGATT 4 40 One Group-5 CGCAAGGGATTTCGGACCGGGCTTGGTCACACACAGAGCA 5 40 One Group-6 CCAGCAGTGGGGCATGGGGGAACGATAAGATTATAAGGGGG 6 41 One Group-7 CACGCAAGCAGAAGCCACTCCCCCTGGTCGTACTATTTAG 7 40 One Group-8 CACAGGCGTACCACTGCCCCAACGATCCTTTTGGTTACCG 8 40 One Group-9 GTCGGAGAGCCTGGCCGTCTGCTCGTAAGTACTATCATAGC 9 41 One Group-10 TGGAGAAGCGGCAGTTGATGCCTGGTACCCGTCTGCTACG 10 40 One Group-11 CGTAAAGGACGCTGCCATGAATGTGCTATCCAAGCCTGGG 11 40 One CGTAAAGAACGCTGCCATGAATGTGCTATCCAAGCCTGGG 12 40 CGTAAGAACGCTGCCATGAATGTGCTATCCAGGCCTGGG 13 39 Group-12 CAACGGAGGGAAGTTTCCATGTCCGGTACCAAGCGGTTTTTG 14 42 One Group-13 GCACGGGAGGCACCCTGACATTGCAAATCCCATCGGTGTG 15 40 One Group-14 ACCTATAACAGCCATCATACGAGGTAATCCCCTCCCTCGA 16 40 One Group-15 CCAACTGGATCTTACTGAGGAACGGTCCATTAGCACATCG 17 40 One Group-16 CGCGACCACATCCTGCGTAAACACATCTCCGCCAGTCCAT 18 40 One Group-17 CGCAAGAGCAGCATACAGCACGAACGAGCCATTTACGCCA 19 40 One Group-18 CGAAGACCAGACATGGTAGCCACGCATAGTCCAACTTAAG 20 40 One Group-19 ACACCACACTAATGCATGCATTCTGTGAGTCACAGTTCA 21 39 One Group-20 CACTCAAACCCAAACCATGCAAACTGAACAACGCAACACA 22 40 One Group-21 CACCAAACTGCCCAAATTTGAGGACGCCCTATACATGCG 23 39 One Group-22 GCCCAATACGTATGTTGATACATGCCCCTTACCCTTTGCG 24 40 One Group-23 CACCGTAGTAAGTAAGCAGACGCTAAGGATGTTGCCAGTG 25 40 One Group-24 GTGACATGAACTGGTTTTCCACAGCTTAGGATCATGGATG 26 40 One Group-25 GGGCATGTGGGCTTGCGATTTCGGTTTGGTGTGGTTGGGG 27 40 One Group-26 CCGTCGCTATAACCCTGTCTTTATATATCTTCGCCCACGGG 28 41 One

Example  6: Vibrio Parahay Mora Itikus  Specific binding of live bacteria DNA Aptamer  Evaluation of candidates' affinity

1. Vibrio Parahay Mora Itikus  Specific binding of live bacteria DNA Aptamer  Refinement of candidates

In order to purify the candidate group of Vibrio parahaemolyticus specific binding DNA aptamer, which had been previously obtained, a pure Vibrio parahaemolyticus DNA aptamer candidate group purified by the PCI treatment and the ethanol precipitation method was obtained.

2. Nano - drop Vibrio using Parahay Mora Itikus  Specific binding DNA Aptamer  Evaluation of candidates' affinity

Each 1 μl of each candidate Vibrio parahaemolyticus DNA aptamer selected for evaluation of the affinity for the purified Vibrio parahaemolyticus candidates for specific binding DNA aptamer candidates was measured by nano-drop The DNA concentrations of the DNA aptamers were measured. The DNA aptamer candidates 1 and 13 were selected as VPCA-01 and VPCA-02, respectively, in the first elution and the second elution. (Fig. 3)

Example  7: Selected DNA Of app tamer  Gain a picture of the expected structure

1. Each DNA Aptamer  Construction of the candidate structure

In order to confirm the expected structure of the selected VPCA-01 and VPCA-02, we constructed the predicted structure using the m-fold program of http://mfold.rna.albany.edu/. The sequence of DNA aptamer was designated as a linear strand and the temperature of the structure was set at 25 ° C, which is room temperature. The expected structure was constructed by designating the concentration of sodium that could affect the structure to be 0.5M, the concentration of Nutrient broth with 3% NaCl as a culture medium. (See FIG. 4)

Example  8 : SPR  For measurement DNA With app tamer  vibrio Parahaya Moraitikusu  Ready

One. SPR  ( Surface Plasmon Resornance ) For measurement DNA Of app tamer  Ready

PCR was carried out using the method shown in Example 1, except that 10 pM biotinylated reverse primer and 10 pM biotinylated forward primer and reverse primer were added instead of 10 pM forward primer in the PCR sample. The following procedure was followed in accordance with Example 1 to perform PCR purification. As PCR was performed, asymmetric PCR was used to construct ssDNA. As the reaction composition of asymmetric PCR, 10 μl of 10 × PCR buffer, 8 μl of each 2.5 mM dNTP mixture, 10 μl of 10 pM biotinylated forward primer, 1 μl of reverse primer, 10 μl of template DNA library, 10 μl of Ex Taq polymerase , Japan) (1 unit / ㎕) and 60.5 증 of distilled water. The PCR reaction conditions were first denaturation at 94 ° C for 5 minutes, followed by 15 cycles of reaction at 94 ° C for 30 seconds, 52 ° C for 30 seconds, and 72 ° C for 30 seconds, followed by extension at 72 ° C for 5 minutes Was used. After that, a pure DNA aptamer was obtained using the PCI and ethanol precipitation methods conventionally used in the art.

2. ssDNA Of app tamer  Structure Production

1 μl of the obtained ssDNA was added to the nano-drop, and the ssDNA concentration was measured. Then 99 μl of 2 × Nutrient broth with 3% NaCl was added to the remaining 99 μl of the ssDNA aptamer and heated at 85 ° C for 5 minutes. Lt; / RTI > After that, DNA was prepared by diluting with 1X Nutrient broth with 3% NaCl to a concentration of 25 uM.

3. SPR  ( Surface Plasmon Resornance ) Vibrio for measurement Parahaya Moraitikusu  Ready

In order to measure SPR, Vibrio parahaemolyticus was cultured on the basis of the method shown in Example 2. Thereafter, the surface of the live cells was washed with the washing solution according to Example 2.

Example  9: SPR  Optimal measurement DNA Of app tamer  Selection

One. Sensor chip SA on DNA Aptamer  fixing

Streptavidin immobilized with dextran was activated on the Gold valve by the method described in the protocol provided by GE healthcare. In order to fix the DNA aptamer on the surface of the activated sensor chip SA, a start sensogram was performed first. Thereafter, the flow rate was set at 10 μl / min. Of the four channels of the sensor chip SA, one did not attach an aptamer for testing, and only two, three, or four channels were combined with each selected aptamer. As a binding condition of DNA aptamer, a series of steps of 1 minute inoculation at a flow rate of 10 μl / min was repeated three times each. Thereafter, the HBS-EP buffer was flowed at a flow rate of 10 μl / min for 10 minutes to stabilize the bound ssDNA aptamer.

2. Vibrio Parahaya Moraitikusu  Combination

1 ml of the cultured Vibrio parahaemolyticus culture was transferred to a tube, and then a series of procedures of flowing over the sensor chip SA at a flow rate of 5 μl / min for 20 minutes were repeated twice. During this process, the binding force was confirmed through comparison and analysis of Sensogram of channel 1, 2, 3 and 4 channels. Thereafter, a series of procedures of flowing 50 mM NaOH at a flow rate of 10 μl / min for 5 minutes were repeated twice to remove the combined Vibrio parahaemolyticus and ssDNA aptamer. Then, ssDNA aptamer was treated with 3 Lt; / RTI > (Fig. 5). In this process, the final VPCA-02 was selected as the optimal Vibrio parahaemolyticus DNA binding aptamer. (Table 3)

Aptamer Target microbe kD value VPCA-01 V. parahaemolyticus 4.61e ^-9 ± 1.02 VPCA-02 V. parahaemolyticus 3.00e ^-10 ± 0.87

Example  10: Optimum Vibrio Parahay Mora Itikus  Live bacteria binding DNA Of app tamer  Specificity evaluation

1. Vibrio Fischeri's  Affinity measurement

Vibrio parahaemolyticus was cultured for comparison of binding strength with V. parahaemolyticus. The culture method of Vibrio fischeri was cultivated as shown in Example 2. After that, 1 ml of the culture was transferred to a tube, and then a series of procedures of flowing over the sensor chip SA at a flow rate of 5 μl / min for 20 minutes were repeated twice. Thereafter, a series of procedures of flowing 50 mM NaOH at a flow rate of 10 / / min for 5 minutes were repeated twice to remove the combined Vrio phyuri and ssDNA aptamer, and the ssDNA aptamer was bound 3 times as described above .

2. Listeria Mono-cyto-genesis  Affinity measurement

Listeria monocytogenes was cultured for comparison of binding strength with Vibrio parahaemolyticus. The culture method of Listeria monocytogenes was cultivated as described in Example 2. After that, 1 ml of the culture was transferred to a tube, and then a series of procedures of flowing over the sensor chip SA at a flow rate of 5 μl / min for 20 minutes were repeated twice. Thereafter, a series of procedures of flowing 50 mM NaOH at a flow rate of 10 μl / min for 5 minutes were repeated twice to remove the bound Listeria monocytogenes and ssDNA aptamer, followed by ssDNA aptamer 3 times .

3. Shagella Sonei  Affinity measurement

For comparison of binding strength with Vibrio parahaemolyticus, Shigella sonoei were cultured. The culture method of Shigella sognae was cultivated as described in Example 2. After that, 1 ml of the culture was transferred to a tube, and then a series of procedures of flowing over the sensor chip SA at a flow rate of 5 μl / min for 20 minutes were repeated twice. Thereafter, a series of procedures of flowing 50 mM NaOH at a flow rate of 10 μl / min for 5 minutes were repeated twice to remove the bound shhemellose and ssDNA aptamers, followed by ssDNA aptamer 3 times .

4. Escherichia Cola  Affinity measurement

Escherichia coli was cultured for comparison of binding strength with Vibrio parahaemolyticus. The cultivation method of Escherichia coli was cultured as shown in Example 2. After that, 1 ml of the culture was transferred to a tube, and then a series of procedures of flowing over the sensor chip SA at a flow rate of 5 μl / min for 20 minutes were repeated twice. Thereafter, a series of procedures of flowing 50 mM NaOH at a flow rate of 10 / / min for 5 minutes were repeated twice to remove the bound Escherichia coli and the ssDNA aptamer. Then, the ssDNA aptamer was ligated three times . (Table 4)

Target microbe Kd value V. parahaemolyticus 3.00e ^-10 ± 0.87 E. coli 1.24e ^-7 +/- 0.75 L. monocytogenes 2.30e ^-7 + -0.98 S. soneii 5.28e ^-7 ± 0.79 V. fischeri 1.25e ^-6 ? 1.12

Example  11: Ultimately selected Vibrio Parahay Mora Itikus  Surface bonding DNA Of app tamer  Study on Detection Methods in Various Samples for Industrial Applications

In order to industrially utilize the Vibrio parahaemolyticus surface-bound DNA aptamer produced and secured through the above-described examples, the Vibrio parahaemolyticus DNA aptamer in the environment infected with Vibrio parahaemolyticus was used Detection method and detection ability of Vibrio parahaemolyticus in various samples was confirmed in order to confirm the applicability of Vibrio parahaemolyticus to diagnose disease symptoms in an infected animal or human. It is expected that the detection of Vibrio parahaemolyticus in various environments will be possible by utilizing the power of various samples.

The present invention relates to a DNA aptamer which specifically binds to the surface of a live bacterium of Vibrio parahaemolyticus, and its use. The DNA aptamer of the present invention has an activity of specifically binding to the surface of a live bacterium of Vibrio parahaemolyticus, so that it can be used as an active ingredient in a sample such as an animal product, a processed food, a dairy product, a drinking water, Can be detected and information useful for diagnosis of food poisoning can be provided.

Attach an electronic file to a sequence list

Claims (8)

A DNA aptamer characterized in that it is an oligonucleotide having a nucleotide sequence of SEQ ID NO: 1 which specifically binds to the surface of a live bacterium of Vibrio parahaemolyticus .
delete A method for screening a DNA aptamer according to claim 1, comprising the steps of:
(I) amplifying a DNA aptamer using a PCR technique and preparing a ssDNA aptamer;
(Ii) culturing and washing Vibrio parahaemolyticus; And
(Iii) Vibrio parahaemolyticus A step of screening DNA aptamers that specifically bind to the surface of live bacteria of Violeta parahaemolyticus through a Live Cell SELEX technique using live bacteria of Moraiticus.
A composition for detecting Vibrio parahaemolyticus live cells comprising the DNA aptamer according to claim 1 as an active ingredient.
A kit for detecting Vibrio parahaemolyticus live cells containing the DNA aptamer according to claim 1 as an active ingredient.
6. The method of claim 5,
Wherein the kit is in the form of a chip in which the DNA aptamer is immobilized on a chip.
6. The method of claim 5,
Wherein the kit is in the form of a microarray in which DNA aptamers are immobilized on a substrate.
A method for detecting Vibrio parahaemolyticus live cells comprising the steps of:
(a) contacting a test sample containing Vibrio parahaemolyticus live bacteria with a DNA aptamer according to claim 1; And
(b) identifying viable liposomes bound to the DNA aptamer.

Images