KR101826963B1 - Single-stranded nucleic acid aptamers specifically binding to E.coli and method for detecting E.coli using the same - Google Patents

Abstract

The present invention relates to a single-stranded nucleic acid aptamer selectively binding to E. coli and a method of detecting E. coli using the same. The method, kit or sensor of the present invention can not only specifically detect E. coli among microorganisms present in a water system, but can also be used in fields such as food hygiene and medical diagnosis.

Description

Single-stranded nucleic acid aptamers specifically binding to E.coli and method for detecting E.coli using the same}

The present invention relates to a single-stranded nucleic acid aptamer specifically binding to E. coli and a method for detecting E. coli using the same.

Currently, it is regulated to detect only Total Coliforms in surface water as an index to confirm the presence of harmful microorganisms in the water system. In drinking water, the presence or absence of coliforms is quantified based on the ability to break down lactose. However, this test method is complicated and takes more than 4 days, and the error is large and unclear because the result is calculated based on the statistical table. Therefore, there is a need for a highly selective E. coli monitoring sensor system capable of monitoring the presence of pathogenic microorganisms in real time so that harmful microorganism contamination in the water system can be quickly examined. In particular, in order to develop a sensor system having high sensitivity and stability, it is necessary to secure a receptor that recognizes E. coli with high selectivity.

Aptamer refers to a single-stranded nucleic acid having high specificity and affinity for various target substances. Most conventional sensor technologies for disease diagnosis or detection of harmful microorganisms have used an immunological analysis method using antibodies. In recent years, research to use an aptamer having high specificity and affinity for a target substance for disease diagnosis or biosensor technology has been actively conducted. Aptamers can impart various chemical functional groups to the ends, and can maximize specificity and affinity through the process of being screened under in vitro conditions. In addition, since it is easy to chemically synthesize, it can be mass-produced at low cost with high purity, and it is stable against heat and can be stored for a long time at room temperature. In addition, the aptamer can increase the specificity of the target substance by performing counter selection on various substances having a structure similar to the target or present in a large number of actual samples during the selection process.

Therefore, in the present invention, it is intended to provide a simple, fast, and accurate method for detecting E. coli in water using a single-stranded nucleic acid aptamer that specifically binds to E. coli.

One aspect is to provide a single-stranded nucleic acid aptamer that specifically binds to E. coli.

Another aspect provides a method of detecting E. coli in a sample using a single-stranded nucleic acid aptamer that specifically binds to E. coli.

Another aspect provides an E. coli detection kit and an E. coli detection sensor comprising a single-stranded nucleic acid aptamer that specifically binds to E. coli.

One aspect provides a single-stranded nucleic acid aptamer comprising DNA, RNA, PNA, or a combination thereof that specifically binds to E. coli. The term "aptamer" is a single-stranded nucleic acid molecule having a characteristic that can bind to a target molecule with high affinity and specificity while having a stable tertiary structure by itself. The aptamer may have a nucleotide sequence comprising SEQ ID NOs: 1 to 28 or a combination thereof, for example, SEQ ID NOs: 1, 2, 10, 12, or combinations thereof.

The aptamer may have a detectable label attached thereto. The detectable label may be a moiety that can be detected by a detection method known in the art. For example, the detectable label may be an optical label, an electrochemical label, a radioactive isotope, or a combination thereof. The label may be attached to a specific base of the aptamer, a specific structure, for example, a specific site of a hairpin-loop structure, or a 3'end or 5'end of the aptamer.

The optical label may be, for example, a fluorescent material. The fluorescent material is fluorescein, 6-FAM, rhodamine, Texas Red, tetramethylrhodamine, carboxyrhodamine, carboxyrotamine 6G, carboxyrodol, carboxyrhodamine 110, cascade blue ( Cascade Blue), Cascade Yellow, Komarin, Cy2 (cyanine 2), Cy3, Cy3.5, Cy5, Cy5.5, Cy-chrome, phycoerythrin, PerCP (peridinine chlorophyll-a protein) , PerCP-Cy5.5, JOE(6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein), NED, ROX(5-(and-6)-carboxy-X- Rhodamine), HEX, Lucifer Yellow, Marina Blue, Oregon Green 488, Oregon Green 500, Oregon Green 514, Alexa Floor, 7-amino-4-methylcommarin-3 -Acetic acid, BODIPY FL, Bodipy FL-Br 2, Bodipy 530/550, conjugated products thereof and combinations thereof. For example, the fluorescent material may be fluorescein, Cy3, or Cy5.

In addition, the optical label includes a fluorescent donor chromogen and a fluorescent acceptor chromogen that are separated by an appropriate distance, and fluorescence resonance energy transfer (FRET) pair in which the fluorescence emission of the donor is suppressed by the recipient. I can. Donor chromogens may include FAM, TAMRA, VIC, JOE, Cy3, Cy5 and Texas Red. The recipient chromogen may be selected such that its excitation spectrum overlaps the donor's emission spectrum. Further, the recipient may be a non-fluorescent recipient who quenches a wide range of donors. Other examples of donor-acceptor FRET pairs are known in the art.

The electrochemical label includes an electrochemical label known in the art. For example, the electrochemical label may be methylene blue.

Another aspect is the step of forming an E. coli-aptamer complex by contacting a single-stranded nucleic acid aptamer including DNA, RNA, PNA or a combination thereof, which specifically binds to E. coli with a sample;

Measuring a signal from the E. coli-aptamer complex; And

It provides a method for detecting E. coli including the step of confirming the presence or concentration of E. coli in the sample from the measurement signal.

In the above method, the contact between the sample and the aptamer may be performed in a reaction solution. For example, the aptamer may be performed in a reaction solution containing a composition of a salt capable of binding well with E. coli and an element preventing non-specific binding. Elements that prevent the non-specific binding may include, for example, salmon sperm DNA, BSA and/or Tween-20. The reaction temperature may be, for example, 5 to 35°C, 10 to 30°C, 15 to 25°C, or 20 to 25°C. The reaction time may be, for example, 1 hour or more, 10 to 60 minutes, 20 to 60 minutes, 30 to 50 minutes, or 40 to 50 minutes. The aptamer may have a nucleotide sequence comprising SEQ ID NOs: 1 to 28 or a combination thereof, for example, SEQ ID NOs: 1, 2, 10, 12, or combinations thereof. The aptamer may have a detectable label attached thereto. The detectable label may be, for example, an optical label, an electrochemical label, a radioactive isotope, or a combination thereof.

In the above method, the signal from the E. coli-aptamer complex may be generated by an optical label, an electrochemical label, or a combination thereof. The optical label may be, for example, a donor-acceptor FRET pair. The electrochemical label may be, for example, methylene blue.

In the above method, the presence or concentration of E. coli in the sample may be confirmed by comparing with a control group. The control may be an aptamer in a state that is not bound to E. coli. For example, when the label attached to the aptamer is a donor-receptor FRET pair, the control may be an aptamer in which the fluorescent signal of the fluorescent donor chromogen is suppressed by the recipient chromogen. When the E. coli-aptamer complex is formed, the FRET efficiency decreases, thereby changing the fluorescence signal, and the presence or concentration of E. coli can be confirmed from the change in the signal. For example, when the label attached to the aptamer is an electrochemical label, the control may be the labeled aptamer fixed to the electrode. Due to the change in the structure of the aptamer bound to E. coli, the electrochemical label is moved away from, closer to, or separated from the aptamer from the electrode, thereby changing the electrochemical signal, and the presence or concentration of E. coli can be confirmed from the change in the signal.

The method may further include separating the E. coli-aptamer complex from the sample and the reactant including the aptamer. The separation step may be performed after the E. coli-aptamer complex is formed and before measuring a signal from the complex. The separation may be performed, for example, by a membrane filtration method or a centrifugal separation method. In addition, the separation may be washing the aptamer when it is fixed to the substrate. The optical label attached to the aptamer may be a fluorescent material as described above. For example, the fluorescent material may be fluorescein, Cy3 or Cy5. The signal generated from the separated E. coli-aptamer complex may be measured, for example, by fluorescence measurement or radioisotope detection.

Another aspect provides a kit for detecting E. coli that specifically binds to E. coli, comprising a single-stranded nucleic acid aptamer comprising DNA, RNA, PNA, or a combination thereof.

In the kit, the aptamer may have a nucleotide sequence comprising SEQ ID NOs: 1 to 28 or a combination thereof, for example, SEQ ID NOs: 1, 2, 10, 12, or combinations thereof. The aptamer may have a detectable label attached thereto. The detectable label may be, for example, an optical label, a radioactive isotope, or a combination thereof.

The kit may further include a known material required for formation of an E. coli-aptamer complex. The kit may further include elements required for promoting the formation of a specific E. coli-aptamer complex or inhibiting the formation of a non-specific E. coli-aptamer complex, for example, salmon sperm DNA, BSA and/or Tween-20. In addition, the kit may further include a manual describing a method of identifying E. coli in a sample with the aptamer.

Another aspect provides an E. coli detection sensor comprising a single-stranded nucleic acid aptamer comprising DNA, RNA, PNA, or a combination thereof that specifically binds to E. coli.

In the sensor, the aptamer may have a nucleotide sequence including SEQ ID NOs: 1 to 28 or a combination thereof, for example, SEQ ID NOs: 1, 2, 10, 12, or a combination thereof. The aptamer may have a detectable label attached thereto. The detectable label may be, for example, an optical label, an electrochemical label, or a combination thereof. The sensor including the optical label may be one using, for example, the FRET effect. The sensor including the electrochemical label is based on the principle that the label material is moved away from the electrode, closer to the electrode, or separated from the aptamer due to a change in the structure of the aptamer bound to the target material, and the electrochemical signal is changed. I can.

The sensor may include a substrate on which two or more of the aptamers are immobilized, for example, in the form of an array. An array refers to a plurality of specific molecules immobilized on a certain portion on a substrate. The array may include a substrate and an immobilization region formed on the substrate and including an aptamer capable of binding to E. coli. The aptamer may be covalently attached within the immobilization area. The aptamer may further include a plurality of compounds having a functional group that can be covalently attached. Any of the functional groups may be used as long as it allows the aptamer to be attached. For example, it may be an aldehyde, an epoxy or an amine group, and the compound may be a siloxane having an aldehyde, an epoxy or an amine group at the terminal. Materials such as glass, silicon, polypropylene, and polyethylene may be used as the material of the substrate.

According to one embodiment, by using the single-stranded nucleic acid aptamer that specifically binds to E. coli of the present invention, the presence and concentration of E. coli in the aqueous system can be quickly and accurately detected.

1 is a schematic diagram of a Bacteria Cell-SELEX method for selecting a DNA aptamer capable of specifically binding to E. coli.
2 is a graph showing the percentage of single-stranded DNA bound to E. coli among single-stranded DNA libraries used in each selection round.
3 is a schematic diagram of the secondary structure of a DNA aptamer that specifically binds to E. coli predicted using the mfold program.
4 is a graph showing the result of analyzing the binding force for DNA aptamer that specifically binds to E. coli.
5 is a graph showing the results of specificity analysis for DNA aptamer that specifically binds to E. coli.

Hereinafter, the present invention will be described in more detail through examples. Since these examples are for illustrative purposes only, the scope of the present invention is not to be construed as being limited by these examples.

Example 1: specifically binding to E. coli DNA Aptamer Produce

1. Escherichia coli culture

Fecal-derived E. coli KCTC2571 was inoculated in nutrient broth (beef extract 37%, pepton 63%, 8g broth/L DW, pH 6.8) and incubated at 37°C. After the concentration of E. coli ^{reaches 10 8} CFU/ml, wash 3 times with PBS buffer, remove the culture medium, and suspend in binding buffer (1x PBS, 0.1mg/ml salmon sperm DNA, 1% BSA, 0.05% Tween-20) I did.

2. Random ssDNA Preparation of the library

An ssDNA library consisting of the following single-stranded DNA oligonucleotides was synthesized. As a result, a ^{random ssDNA library having 10 15} different nucleotide sequences was prepared.

5'- GCAATGGTACGGTACTTCC -N ₄₅ - CAAAAGTGCACGCTACTTTGCTAA -3' (SEQ ID NO: 29)

In the above, the underlined part means a fixed sequence in which the following primer pairs are annealed, and N ₄₅ means that A, G, T, C bases are randomly present at each position.

3. Whole - Cell SELEX

10 ^{Random ssDNA libraries with 15} different nucleotide sequences were dissolved in binding buffer (1x PBS, 0.1mg/ml salmon sperm DNA, 1% BSA, 0.05% Tween-20), heated at 95° C. for 5 minutes, and the temperature was immediately increased. The mixture was lowered and treated at 4° C. for 10 minutes, then ^{mixed with 1 mL of E. coli suspension (10 7} cells) and well mixed at room temperature for 1 hour. The E. coli/ssDNA complex was separated from the mixture by centrifugation (13,000 rpm, 10 minutes). The separated E. coli/ssDNA complex was suspended in PBS buffer and this process was repeated three times. Finally, E. coli/ssDNA was resuspended in sterilized distilled water. The resuspended solution was heated at 95° C. for 10 minutes and immediately placed at 4° C. for 10 minutes to isolate ssDNA from the E. coli/ssDNA complex. The separated ssDNA was recovered by centrifugation (13,000 rpm, 10 minutes).

The amount of ssDNA selected through the above process was amplified through a PCR reaction. The forward primer was labeled with fluorescein at the 5'-end, and the reverse primer was used with biotin labeled at the 5'-end. Since the PCR product is dsDNA, this is to separate it into single-stranded DNA.

forward: 5'-fluorescein-GCAATGGTACGGTACTTCC-3' (SEQ ID NO: 30)

reverse: 5'-biotin-TTAGCAAAGTAGCGTGCACTTTTG-3' (SEQ ID NO: 31)

PCR is a total amount of 25 ul by mixing 10 ul of ssDNA and 12.5 ul of PCR master mix, respectively, and 12.5 ul of ssDNA corresponding to about 100 ng, 95°C (30 seconds), 56.3°C (30 seconds), 72 It was carried out under °C (10 seconds) and the number of repetitions was 10 times. It was confirmed that PCR was properly performed by electrophoresis on 2% agarose gel. Then, the PCR product was purified with a PCR purification kit (MinElute PCR Purification kit, QIAGEN). The purified 100 uL PCR product was mixed with 50 uL avidin-coated magnetic beads (Dynabeads MyOne™ Streptavidin, Invitrogen), reacted at room temperature for 10 minutes, and washed with 1 ml of PBS buffer using a magnet. 500 uL of caustic soda (NaOH) 200 mM was added and reacted for 5 minutes to separate dsDNA into ssDNA, and then biotin-attached ssDNA was removed from the reaction solution using a magnet, and ssDNA with fluorescein was recovered I did. The recovered ssDNA was purified/concentrated using a PCR purification kit, and then the concentration was analyzed. The concentrated ssDNA was used in the next round of selection process, and this selection and amplification process was repeated several times as shown in FIG. 2. After a total of 10 screening processes, 93.7% of the ssDNA mixed with E. coli was finally found to be bound to E. coli.

After the 5th, 6th, and 9th screening process of the SELEX process, Klebsiella pneumoniae, Citrobacter freundii, Enterobacter aerogenes, which are frequently found in water systems such as sewage, such as target E. coli, Counter selection was performed three times in total using four types of bacteria of Staphylococcus epidermidis. The experimental method and conditions were the same as the screening process, but in the reverse screening process, the ssDNA binding to the bacteria was discarded, and ssDNAs that did not bind to them were recovered and amplified, and then used in the next screening process.

The ssDNAs finally obtained were PCR performed using the primer pair and then cloned using a cloning kit (TOPO TA cloning kit). Plasmids were extracted from each colony, followed by sequencing, and a total of 28 different nucleotide sequence information was obtained. Table 1 below shows a total of 28 ssDNA nucleotide sequences selected by the SELEX method.

Random site sequence E1 5'-ACTTAGGTCGAGGTTAGTTTGTCTTGCTGGCGCATCCACTGAGCG-3' (SEQ ID NO: 1) E2 5'-CCATGAGTGTTGTGAAATGTTGGGACACTAGGTGGCATAGAGCCG-3' (SEQ ID NO: 2) E3 5'-AGGTTCGAACGTCATGATGCCCCAGTTGACATCATTCAAACGGAT-3' (SEQ ID NO: 3) E4 5'-TGTTCGTCGCCGCGTGGCCTGGGGGGAGGGTTGCTTGATTGCCTA-3' (SEQ ID NO: 4) E5 5'-CCACTGCGGTTGGCGCGCCGACCTTTCTGTTAGCCTGAAACGCAG-3' (SEQ ID NO: 5) E6 5'-GGGTTTGGTTTGGGACGGGGACCAGATTTTCAGCTTCACTCGTGG-3' (SEQ ID NO: 6) E7 5'-GTGATACGTAGGTAGTGGTGTGGGTCCTCTTTGCACCTTATGGTC-3' (SEQ ID NO: 7) E8 5'-GGGGTGCTCGGGGTCGCAGTCGGTGCCCGCTTGTCACAGATCAGC-3' (SEQ ID NO: 8) E9 5'-TGGTGTAATCAGCCTAGGAGTGGGTCGTGACAGGTTGTATATCTC-3' (SEQ ID NO: 9) E10 5'-GTTGCACTGTGCGGCCGAGCTGCCCCCTGGTTTGTGAATACCCTGGG-3' (SEQ ID NO: 10) E11 5'-GCGTGTGTGTTAGCGACGAGTTGGGGCAACGATAGTCATATGACT-3' (SEQ ID NO: 11) E12 5'-GCGAGGGCCAACGGTGGTTACGTCGCTACGGCGCTACTGGTTGAT-3' (SEQ ID NO: 12) E13 5'-AAAGGAGGCATGGTCTCTGCTAAGCCATCCTACCTATACTGAGGC-3' (SEQ ID NO: 13) E14 5'-TTGGGCATGAGTTGGTGATGCGGGTTTCGATTACGGGTTACTGCG-3' (SEQ ID NO: 14) E15 5'-GCGCTCTACCGCCAGGCTACTCTTGGAGAGTCTTTTGGGCTCTTG-3' (SEQ ID NO: 15) E16 5'-GAAAGGCTGTTTGCGCGCGAGTCTGTAAGATGTGCACTGATCGGT-3' (SEQ ID NO: 16) E17 5'-GAAATAGTGCTGGCTCTTCATCCGTCGGTTGTGTGAGGGGTAGTG-3' (SEQ ID NO: 17) E18 5'-GATGAACTAATCGTGCGCCTCGGGTGGGTTTCCTGCTGCATCCAT-3' (SEQ ID NO: 18) E19 5'-TGAGGGCAGGCCTTAGTATTCTGCCTCTTAGAAAGGCAGGTGCGG-3' (SEQ ID NO: 19) E20 5'-CTACCTGCTATTCACTGACTTTCGTCGCTTGTTTCACAGTGGGAC-3' (SEQ ID NO: 20) E21 5'-CAATTTGCAATTTGGGTATGTCATTATTAGCGTTATTTGACTCAT-3' (SEQ ID NO: 21) E22 5'-ATTCAAGTCCATCTTACCGGTTGTGCTCCTCCTGTGCTACTTACT-3' (SEQ ID NO: 22) E23 5'-GGCCGTGTTCGGACGGTTTCATGCTCTATGAGGGCCCTTTACCCT-3' (SEQ ID NO: 23) E24 5'-CAGTTGAGGTCCCGATTTCACACGTATATCAGGACATTTATCTGA-3' (SEQ ID NO: 24) E25 5'-GCTGTAGATCTATGGGTGGTTGCCTGTTCTGGTTTCCATCGATTT-3' (SEQ ID NO: 25) E26 5'-GCCTTGTTTTGCATTGTATGCACGTACGTGGGGTGCTGCGTCAGAG-3' (SEQ ID NO: 26) E27 5'-AACGCATAGTTTCGGGAATTCTACATGAGCACGCCCATTACCCCG-3' (SEQ ID NO: 27) E28 5'-GCTAGTACGCGTTGTTCTGCAGATTATTTTTGCGAGTTTGTTCGT-3' (SEQ ID NO: 28)

Example 2: Analysis of binding force and selectivity to E. coli

Secondary structure using mfold program (http://mfold.rna.albany.edu/?q=mfold; Zuker, M. Nucleic Acids Res. 2003, 31, 3406) among 28 ssDNAs whose base sequence was analyzed The analysis was carried out. As a result of the analysis, the binding power and selectivity to E. coli were analyzed for 10 kinds of ssDNA, which are predicted to have high binding power to E. coli.

First, E. coli KCTC2571 was inoculated in nutrient broth (beef extract 37%, pepton 63%, 8g broth/L DW, pH 6.8) for the analysis of binding force to E. coli and incubated at 37°C. After the concentration of E. coli ^{reaches 10 8} CFU/ml, wash 3 times with PBS buffer, remove the culture medium, and suspend in binding buffer (1x PBS, 0.1mg/ml salmon sperm DNA, 1% BSA, 0.05% Tween-20) I did. E. coli 100 uL (10 ⁷ cells) was mixed with 100 uL of fluorescently labeled ssDNA (0, 10, 25, 50, 100, 250, 500 nM) of various concentrations and reacted at room temperature for 45 minutes. After the reaction, the ssDNA that did not bind to the E. coli surface was washed twice with PBS buffer, and then the fluorescence intensity of the E. coli/ssDNA complex was measured using a fluorescence analyzer (LS50B, PerkinElmer Co., USA) (Ex/Em= 494 nm /521nm, slit width: 10nm, exposure time: 1s). The fluorescence intensity under each ssDNA concentration condition was plotted using the SigmaPlot program by nonlinear regression method and single site saturation ligand binding method, where F= B _max * C/(Kd + C) equation was used (F is the fluorescence intensity, B _max is the maximum binding site, Kd is the dissociation constant, C is the concentration of ssDNA). As a result of the avidity analysis, the results of the affinity analysis for the 4 types of ssDNA sequences showing high affinity to E. coli are shown in FIG. 4. The avidity (Kd: dissociation constant) of four types of ssDNA showing high affinity to E. coli is as follows, respectively;

E1 (Kd=12.4 nM), E2 (Kd=25.2 nM), E10 (Kd=14.2 nM), E12 (Kd=16.8 nM)

To confirm the selectivity of the above four ssDNAs to E. coli, Klebsiella pneumoniae, Citrobacter freundii, Enterobacter aerogenes, Staphylococcus epidermidis, and four other bacteria were targeted. Selectivity analysis was performed using different types of E. coli (KCTC1682, KCTC2617, KCTC2618). ^{The experiment was performed by reacting 100 uL (10 7} cells) of each bacteria and 100 uL of 500 nM ssDNA at room temperature for 45 minutes, washing with PBS buffer, and measuring and comparing the fluorescence intensity of the bacteria/ssDNA complex. . As shown in FIG. 5, the fluorescence intensity when mixed with Klebsiella, Citrobacter, Enterobacter, and Staphylococcus was very low compared to the target Escherichia coli (KCTC2571) in all of E1, E2, E10, and E12. For other E. coli (KCTC1682, KCTC2617, KCTC2618), the fluorescence intensity was about half or similar to that of the target E.

<110> KIST <120> single-stranded nucleic acid aptamers for selective binding to E.coli and detection method of E.coli using thereof <130> PN104778 <160> 31 <170> KopatentIn 2.0 <210> 1 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E1 <400> 1 acttaggtcg aggttagttt gtcttgctgg cgcatccact gagcg 45 <210> 2 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E2 <400> 2 ccatgagtgt tgtgaaatgt tgggacacta ggtggcatag agccg 45 <210> 3 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E3 <400> 3 aggttcgaac gtcatgatgc cccagttgac atcattcaaa cggat 45 <210> 4 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E4 <400> 4 tgttcgtcgc cgcgtggcct ggggggaggg ttgcttgatt gccta 45 <210> 5 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E5 <400> 5 ccactgcggt tggcgcgccg acctttctgt tagcctgaaa cgcag 45 <210> 6 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E6 <400> 6 gggtttggtt tgggacgggg accagatttt cagcttcact cgtgg 45 <210> 7 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E7 <400> 7 gtgatacgta ggtagtggtg tgggtcctct ttgcacctta tggtc 45 <210> 8 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E8 <400> 8 ggggtgctcg gggtcgcagt cggtgcccgc ttgtcacaga tcagc 45 <210> 9 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E9 <400> 9 tggtgtaatc agcctaggag tgggtcgtga caggttgtat atctc 45 <210> 10 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E10 <400> 10 gttgcactgt gcggccgagc tgccccctgg tttgtgaata ccctggg 47 <210> 11 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E11 <400> 11 gcgtgtgtgt tagcgacgag ttggggcaac gatagtcata tgact 45 <210> 12 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E12 <400> 12 gcgagggcca acggtggtta cgtcgctacg gcgctactgg ttgat 45 <210> 13 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E13 <400> 13 aaaggaggca tggtctctgc taagccatcc tacctatact gaggc 45 <210> 14 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E14 <400> 14 ttgggcatga gttggtgatg cgggtttcga ttacgggtta ctgcg 45 <210> 15 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E15 <400> 15 gcgctctacc gccaggctac tcttggagag tcttttgggc tcttg 45 <210> 16 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E16 <400> 16 gaaaggctgt ttgcgcgcga gtctgtaaga tgtgcactga tcggt 45 <210> 17 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E17 <400> 17 gaaatagtgc tggctcttca tccgtcggtt gtgtgagggg tagtg 45 <210> 18 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E18 <400> 18 gatgaactaa tcgtgcgcct cgggtgggtt tcctgctgca tccat 45 <210> 19 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E19 <400> 19 tgagggcagg ccttagtatt ctgcctctta gaaaggcagg tgcgg 45 <210> 20 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E20 <400> 20 ctacctgcta ttcactgact ttcgtcgctt gtttcacagt gggac 45 <210> 21 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E21 <400> 21 caatttgcaa tttgggtatg tcattattag cgttatttga ctcat 45 <210> 22 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E22 <400> 22 attcaagtcc atcttaccgg ttgtgctcct cctgtgctac ttact 45 <210> 23 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E23 <400> 23 ggccgtgttc ggacggtttc atgctctatg agggcccttt accct 45 <210> 24 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E24 <400> 24 cagttgaggt cccgatttca cacgtatatc aggacattta tctga 45 <210> 25 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E25 <400> 25 gctgtagatc tatgggtggt tgcctgttct ggtttccatc gattt 45 <210> 26 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E26 <400> 26 gccttgtttt gcattgtatg cacgtacgtg gggtgctgcg tcagag 46 <210> 27 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E27 <400> 27 aacgcatagt ttcgggaatt ctacatgagc acgcccatta ccccg 45 <210> 28 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> ssDNA E28 <400> 28 gctagtacgc gttgttctgc agattatttt tgcgagtttg ttcgt 45 <210> 29 <211> 88 <212> DNA <213> Artificial Sequence <220> <223> ssDNA library <400> 29 gcaatggtac ggtacttccn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60 nnnncaaaag tgcacgctac tttgctaa 88 <210> 30 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 30 gcaatggtac ggtacttcc 19 <210> 31 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 31 ttagcaaagt agcgtgcact tttg 24

Claims (10)

1. A single stranded nucleic acid aptamer that specifically binds to Escherichia coli having the nucleotide sequence of SEQ ID NO: 1, wherein the aptamer is for detecting E. coli in the aqueous system. The aptamer of claim 1, wherein the aptamer is attached with a detectable label. 3. The aptamer of claim 2, wherein the detectable label is an optical label, an electrochemical label, a radioisotope, or a combination thereof. Contacting an Aptamer of any one of claims 1 to 3 with a sample to form an E. coli-aptamer complex;
Measuring a signal from the E. coli-aptamer complex; And
And checking the presence or concentration of E. coli in the sample from the measurement signal. 5. The method according to claim 4, wherein the presence or concentration of E. coli in the sample is compared with a control. 5. The method of claim 4, further comprising separating the E. coli-aptamer complex from the reactant comprising the sample and the aptamer. A kit for detecting Escherichia coli in an aqueous medium comprising an aptamer according to any one of claims 1 to 3. 8. The kit of claim 7, wherein the aptamer is attached with a detectable label and the detectable label is an optical label, a radioisotope, or a combination thereof. A sensor for detecting Escherichia coli in an aqueous system comprising an Aptamer according to any one of claims 1 to 3. The sensor of claim 9, wherein at least two of the aptamers are immobilized.

Images