WO2015046737A1

WO2015046737A1 - Dna aptamer specifically binding to virulence regulatory factor prfa protein of listeria and use thereof

Info

Publication number: WO2015046737A1
Application number: PCT/KR2014/007044
Authority: WO
Inventors: 김양훈; 이상희; 엄현주
Original assignee: 충북대학교 산학협력단; 한국보건산업진흥원
Priority date: 2013-09-26
Filing date: 2014-07-31
Publication date: 2015-04-02
Also published as: KR20150034345A; KR101541221B1

Abstract

The present invention relates to a DNA aptamer specifically binding to the PrfA protein, which is a virulence regulatory factor of Listeria and a use thereof, and more specifically, a method for detecting Listeria monocytogenes using a DNA aptamer specifically binding to the PrfA protein of Listeria monocytogenes, and to a composition for diagnosing listeriosis. The DNA aptamer according to the present invention has activity to specifically bind to the PrfA protein of Listeria monocytogenes, and thus can be useful in early detection of Listeria monocytogenes, which is the harmful bacterium present in the conventional natural environment, food, and the human body, and early diagnose listeriosis. In addition, the DNA aptamer of the present invention has high specificity to PrfA protein of Listeria monocytogenes, thereby improving diagnostic sensitivity and mass-producing the same quality of aptamer at a low cost, and thus can be effectively used from an economical aspect.

Description

DNA Aptamer specifically binding to the pathogenic regulator PRFA protein of Listeria and its use

The present invention relates to a DNA aptamer specifically binding to PrfA (virulence regulator PrfA), which is a pathogenic regulatory protein of Listeria monocytogenes that causes Listeriosis.

Listeriosis, a common acquired disease, occurs when a person eats food contaminated with Listeria monocytogenes . Prostate symptoms including fever, anxiety, and typical listeriosis, such as meningitis, sepsis or encephalitis, is a high-risk disease that threatens human life. In particular, patients with immune diseases, newborns and pregnant women are more than 20 times more likely to be infected than normal people.In pregnant women, premature delivery, spontaneous abortion, stillbirth, and fetal infections occur, and infected mothers and fetuses have meningitis or endocarditis. It is known to cause serious complications and lead to death. In particular, Listeria caused by Listeria monocytogenes is a fatal disease with the lowest morbidity but high mortality compared to other food poisoning bacteria. It is the PrfA protein that takes contaminated food and controls pathogenic outbreaks in the body. When activated, it causes pathogenicity in the body.

As mentioned above, Listeria monocytogenes, which causes fatal diseases, is the number of occurrences of health and environmental diseases caused by various pathogenic microorganisms, human infections and public due to the increase of imported livestock, processed processed foods and the increase of domestic average temperature due to global warming and extreme weather. The rate of transmission to the environment is increasing rapidly. Accordingly, there is a demand for developing a technology capable of effectively detecting Listeria monocytogenes contained in various foods such as processed foods, imported livestock products, dairy products, and drinking water.

Conventionally, culture-based microbial identification, microscopy, and biochemical serological methods have been used as a method for early diagnosis of Listeriosis, which is caused by the infection of food and drinking water and the human body. . These methods have the disadvantage of having to go through DNA extraction, target microorganism separation and culture step in order to increase the detection efficiency, so it takes a long time to confirm the detection of pathogenic microorganisms after sample pretreatment, and it is often ambiguous even when interpreting the results. There are disadvantages such as two or three experiments must be performed in parallel for accurate detection and confirmation. Therefore, there is a need for a high-efficiency Listeriosis diagnosis system that can be processed quickly and simply.

Recently, detection methods using polymerase chain reaction (PCR) techniques and immunological diagnostic methods using antigen antibodies have been developed and used for the rapid and sensitive diagnosis of Listeriosis. These methods target specific pathogenic factors of Shigella Sonei, which can detect specific causative organisms more sensitively and faster than conventional sample culture methods. The main pathogenic factors mainly used for the diagnosis of listeriosis are proteins expressed by genes such as prfA, inlA, inlB, and actA. In particular, PrfA encoded by the prfA gene is known. Proteins regulate the onset through quorum recognition of Listeria monocytogenes. As such, PCR and immunological diagnostic methods based on pathogenic genes and proteins encoded therein have the advantages of being more sensitive and faster than conventional culture-based detection methods. Expensive analytical equipment for analyzing the sample pretreatment process and results such as the process is required, which has a disadvantage in that the field of application is very low. Therefore, there is an urgent need to develop a system for the diagnosis of high-efficiency listeriasis that can accurately and quickly process large-scale samples.

Aptamers are short-length oligomers that form specific tertiary structures with high affinity to specific targets. In addition, by using chemical synthesis techniques, it is possible to mass-produce in a short time and at low cost, and has an excellent advantage of continuously producing aptamers having the same ability once produced and produced. In addition, it is highly stable to the surrounding pH and temperature, and recently, the possibility of use in various fields, such as the detection of target substances and the development of disease diagnosis sensors, is widely appreciated.

Therefore, the present inventors have succeeded in developing a DNA aptamer capable of early diagnosis of Listeriosis, and have succeeded in synthesizing and selecting a DNA Aptamer specifically binding to the PrfA protein that controls the pathogenicity of Listeriosis. The present invention was completed by making a kit for early diagnosis of Listeriosis using the same.

Accordingly, it is an object of the present invention to provide a DNA aptamer specifically binding to PrfA protein, which is a Listeriosis pathogenic regulator for early diagnosis of Listeriosis.

Another object of the present invention is a Listeria monocytogenes detection or listeria monocytogenes ( Listeria monocytogenes) comprising a DNA aptamer that specifically binds to the PrfA protein as an active ingredient, Listeria monocytogenes detection or diagnostic composition, diagnostic kit and diagnostic bio To provide a chip.

It is still another object of the present invention to provide a method for preparing a biologically active product comprising (a) contacting a biological sample isolated from a living body with a DNA aptamer that specifically binds to the PrfA protein of Listeria monocytogenes ; And (b) confirming the presence of Listeria monocytogenes through a PrfA protein specific binding reaction between the biological sample and the DNA aptamer. Listeria monocytogenes detection method comprising: It is to provide the information necessary for the diagnosis of Listeriosis.

For this purpose, the present invention provides a PrfA protein specific DNA aptamer that specifically binds to the PrfA protein of Listeria monocytogenes.

In one embodiment of the present invention, the DNA aptamer is an oligonucleotide having a nucleotide sequence having at least 90% identity with any one nucleotide sequence selected from the group consisting of nucleotide sequences of SEQ ID NO: 7 to SEQ ID NO: 19 Can be.

In one embodiment of the present invention, the DNA aptamer may be an oligonucleotide having any one nucleotide sequence selected from the group consisting of the nucleotide sequences of SEQ ID NO: 7 to SEQ ID NO: 19.

In one embodiment of the present invention, the DNA ampamer may further comprise a labeling material.

In one embodiment of the present invention, the DNA aptamer may be one of the labeling material selected from the group consisting of fluorescent material, amine group, biotin and thiol group is labeled at the 5 'end or 3' end of the DNA aptamer. have.

In one embodiment of the present invention, the DNA aptamer is any one of the group consisting of a hydrogen atom, a fluorine atom, -OR, -OCOR and a hydroxyl group of the ribose 2 'position of one or more nucleotides constituting the DNA aptamer It may be substituted with one.

The present invention also provides a composition for detecting Listeria monocytogenes or diagnosing Listeria, comprising as an active ingredient a DNA aptamer that specifically binds to PrfA protein of Listeria monocytogenes .

In another aspect, the present invention provides a kit for detecting Listeria monocytogenes detection or Listeria syndrome comprising DNA aptamer specifically binding to PrfA protein of Listeria monocytogenes as an active ingredient.

In addition, the present invention is for detecting Listeria monocytogenes detecting or diagnosing Listeriosis in which a DNA aptamer that specifically binds to the PrfA protein of Listeria monocytogenes is integrated on a substrate and specifically reacts to a sample containing the PrfA protein. Provide biochips.

In one embodiment of the present invention, the substrate may be selected from the group consisting of paper, plastic, glass, metal and silicon.

In another aspect, the present invention comprises the steps of (a) contacting a biological sample isolated from the living body to a DNA aptamer that specifically binds to the PrfA protein of Listeria monocytogenes ; And (b) confirming the presence of Listeria monocytogenes through a PrfA protein specific binding reaction between the biological sample and the DNA aptamer. Listeria monocytogenes detection method comprising a to provide.

In addition, the present invention comprises the steps of (a) contacting a biological sample isolated from the living body to a DNA aptamer that specifically binds to the PrfA protein of Listeria monocytogenes ( Listeria monocytogenes ); And (b) confirming the presence or absence of Listeria monocytogenes through a PrfA protein-specific binding reaction between the biological sample and the DNA aptamer. The information necessary for diagnosing Listeriosis includes Provide a way to provide.

The DNA aptamer according to the present invention has an activity of specifically binding to Listeria monocytogenes PrfA protein, thereby early detection of Listeria monocytogenes, a harmful bacterium existing in the natural environment, food and human body, and premature listeriosis. This can be useful for diagnosis.

In addition, the DNA aptamer of the present invention has a high specificity for the PrfA protein of Listeria monocytogenes can increase the sensitivity of the diagnosis, and can be effectively used economically in the mass production of the same quality aptamer at a low cost Could be.

1 is a result of transducing the expression vector containing the Listeria monocytogenes prfA gene into E. coli and expressing the GST fusion PrfA protein produced therefrom, and confirmed by SDS-PAGE (10%). Lane M: protein size marker (Elpis, Korea) (lane 1: water soluble protein (1 mM IPTG induction, 18 ° C. culture), lane 2: pellet protein (1 mM IPTG induction, 18 ° C. culture), lane 3: water soluble protein (18 ° C.) culture), lane 4: pellet protein (18 ° C culture))

Figure 2 shows the results of amplifying the random DNA aptamer using the PCR technique and the result of the ssDNA production using the heat-cooling (Heating-cooling) technique by comparing the result by 10% acrylamide gel electrophoresis. Lane M: 100 bp DNA marker (Elpis, Korea), Lane 1: DNA aptamer was amplified by PCR technique. Lane 2: DNA aptamer pool obtained by PCR amplification was heated-cooled to ssDNA. As a result)

Figure 3 shows the SELEX process for the production of DNA aptamers specifically binding to Listeria monocytogenes PrfA protein.

Figure 4 is a quantitative measurement of the concentration of Listeria monocytogenes PrfA protein specific binding DNA aptamer candidates eluted in each SELEX round after the SELEX process to produce Listeria monocytogenes PrfA protein specific binding DNA aptamer using a Nanodrop spectrophotometer One result.

Figure 5 illustrates a method for evaluating the binding capacity of Listeria monocytogenes PrfA protein and Listeria monocytogenes PrfA protein specific binding DNA aptamer. In order to use Biacore equipment, each process of activating the surface of the carboxyl sensor chip, CM5, through EDC / NHS buffer solution and fixing Listeria monocytogenes PrfA protein to bind to Listeria monocytogenes PrfA protein specific binding DNA aptamer Is a diagram showing.

6 is a Listeria monocytogenes PrfA protein specific binding DNA aptamer showing high specificity with Listeria monocytogenes PrfA protein among Listeria monocytogenes PrfA protein specific binding DNA aptamers. (a) Listeria monocytogenes PrfA protein specific binding DNA aptamer (LMPA5) is a SPR measurement sensorgram (sensorgram) showing the binding capacity with Listeria monocytogenes PrfA protein by concentration. (b) Listeria monocytogenes PrfA protein specific binding DNA aptamer (LMPA7) is a SPR measurement sensorgram (Sensorgram) showing the binding capacity of Listeria monocytogenes PrfA protein by concentration. (c) Listeria monocytogenes PrfA protein specific binding DNA aptamer (LMPA9) is a SPR measurement sensorgram (Sensorgram) showing the binding capacity with Listeria monocytogenes PrfA protein by concentration. (D) Listeria monocytogenes PrfA protein specific binding DNA aptamer (LMPA12) is a SPR measurement sensorgram (Sensorgram) showing the binding capacity of Listeria monocytogenes PrfA protein by concentration.

FIG. 7 is a diagram showing the secondary structure of a total of four Listeria monocytogenes PrfA protein specific binding DNA aptamers selected as having a Listeria monocytogenes PrfA protein specific binding ability.

FIG. 8 is a schematic diagram of a diagnostic kit for Listeriosis using an aptamer specifically binding to Listeria monocytogenes PrfA protein. Panel (a) is a diagram showing the configuration of a simple diagnostic kit capable of early detection of Listeria monocytogenes PrfA protein, and panel (b) shows Listeria monocytogenes PrfA for early detection of Listeria monocytogenes PrfA protein. This is a schematic of the principles of a simple kit for diagnosing Listeria and detecting Listeria monocytogenes using protein-specific binding DNA aptamers.

Hereinafter, the present invention will be described in detail.

The present invention relates to DNA aptamers that specifically bind to PrfA proteins that regulate listeriosis.

As used herein, the term “DNA aptamer” refers to a DNA nucleic acid molecule capable of binding to a specific molecule with high affinity and specificity. As used herein, “DNA aptamer” is used interchangeably with “DNA oligonucleotide”.

As used herein, the term “oligonucleotide” generally refers to a nucleotide polymer having less than about 200 lengths, which may include DNA and RNA, and is preferably a DNA molecule. A nucleotide may be any substrate that can be introduced into a polymer by deoxyribonucleotides, ribonucleotides, modified nucleotides or bases and / or analogs thereof, or by DNA or RNA polymerase or by synthetic reactions. If modifications to the nucleotide structure are present, such modifications may be added before or after the synthesis of the oligonucleotide polymer. Nucleotide sequences can be interrupted by non-nucleotide components. Oligonucleotides can be further modified after synthesis, for example by binding to a label.

DNA aptamers of the invention can typically be obtained by in vitro selection methods for binding of target molecules. Methods of selecting aptamers that specifically bind to a target molecule are known in the art. For example, organic molecules, nucleotides, amino acids, polypeptides, marker molecules on the cell surface, ions, metals, salts, polysaccharides can be suitable target molecules that separate aptamers that can specifically bind to each ligand. . Screening of aptamers can utilize in vivo or in vitro selection techniques known as the Systematic Evolution of Ligands of Exponential enrichment (SELEX) method (Ellington et al., Nature 346, 818-22, 1990; and Tuerk et al. m Science 249, 505-10, 1990). As used herein, the term “SELEX method” refers to a method of determining a DNA binding sequence of a molecule by selecting and amplifying a DNA having a high binding strength to a specific molecule in a randomly synthesized DNA set (Louis et al., 1992. Nature 355,564-566). Specific methods for the selection and preparation of aptamers are described in US Pat. No. 5,582,981, WO 00/20040, US Pat. No. 5,270,163, Lorsch and Szostak, Biochemistry, 33: 973 (1994), Mannironi et al., Biochemistry 36: 9726 (1997), Blind, Proc. Natl. Acad. Sci. USA 96: 3606-3610 (1999), Huizenga and Szostak, Biochemistry, 34: 656-665 (1995), WO 99/54506, WO 99/27133, WO 97/42317 and US Pat. No. 5,756,291, supra. Are incorporated herein by reference.

According to one specific embodiment of the present invention, the DNA aptamer of the present invention is selected through the following steps; (i) extracting and expressing the prfA gene in Listeria monocytogenes; (ii) amplifying DNA aptamers using PCR techniques and preparing ssDNA aptamers through heat treatment and streptavidin binding; (iii) screening DNA aptamers that specifically bind to PrfA protein after immobilizing PrfA, a listeriosis regulatory protein, on an immobilization column (see FIG. 3); (iv) analyzing specificity of selected DNA aptamers.

This is explained in more detail.

(i) extracting and expressing the prfA gene in Listeria monocytogenes

In order to secure PrfA, which is a listeriosis pathogenic regulatory protein, genomic DNA is extracted from listeria monocytogenes and amplified genes encoding PrfA protein. Primers are prepared using the sequence information of prfA gene, which is known from the National Center for Biotechnology Information (NCBI) database, and amplified using PCR technique. The amplified prfA gene is treated with the same restriction enzyme as the protein expression vector pGEX-4T-1, ligation and transformed into E. coli BL21. Recombinant transformants are cultured in LB broth and treated with IPTG to induce overexpression of PrfA protein encoding pathogenic regulatory proteins. The overexpressed PrfA protein is purified using Glutathione-S-Transferase (GST) protein, a fusion protein present in pGEX 4T-1, to obtain pure PrfA protein.

(ii) amplifying DNA aptamers using PCR techniques and preparing ssDNA aptamers through heat treatment and streptavidin binding

Amplify the random dsDNA library using PCR technique. This method secures only ssDNA from the amplified random dsDNA library. The method for screening ssDNA aptamer, for example, amplifies dsDNA by attaching biotin to a reverse primer during PCR, induces the amplification product to fall to a single strand, and then treats streptavidin. Only the ssDNA aptamer can be selected by forming a biotin-streptavidin complex to selectively remove the complex. The obtained ssDNA aptamer can be confirmed by electrophoresis on acrylamide gel (see Fig. 1). The prepared ssDNA aptamer is heated for denaturation for use in the SELEX method and then slowly reacts at room temperature to induce the formation of a three-dimensional structure.

(iii) screening DNA aptamers that specifically bind to PrfA after immobilizing PrfA, a listeriosis regulator protein, on an immobilization column (see FIG. 3 ).

The ssDNA aptamer and PrfA protein prepared above react with each other by inducing contact with each other, and the ssDNA aptamer which does not bind is washed and removed, and only ssDNA that specifically binds to PrfA protein is eluted. This step may include a Negative SELEX step to remove ssDNA that binds to conditions other than PrfA, such as protein immobilization resin and buffer components.

In the method of the present invention, the eluted ssDNA was selected from the nano-Drop spectrophotometer (Thermo Scientific.) To select an optimal SELEX round in which DNA aptamers specifically binding to the listeriosis control protein PrfA were eluted. Can be quantified using.

(iv) specificity analysis of selected DNA aptamers

In the method of the present invention, each of the aptamer sequences is secured for the selection of the PrfA protein-specific binding DNA aptamer during the optimal SELEX round to confirm the similarity between the obtained sequences. For example, the acquired sequences can be analyzed for homology between the sequences using the Cluster X program.

The DNA aptamer of the present invention may include any DNA aptamer that binds to the PrfA protein, but preferably may be an oligonucleotide having a nucleotide sequence disclosed in any one of SEQ ID NOS: 7-19.

DNA aptamer of the present invention is to include an oligonucleotide having a nucleotide sequence showing a substantial identity to the base sequence of any one of SEQ ID NO: 7 to 19, while maintaining the property of binding specifically to PrfA, a listeriosis regulator protein Interpreted The substantial identity above aligns the nucleotide sequence of the present invention with any other sequence to the maximum correspondence, and the algorithm commonly used in the art (Smith and Waterman, Adv. Appl. Math. 2: 482 (1981) ) Needleman and Wunsch, J. Mol. Bio. 48: 443 (1970); Pearson and Lipman, Methods in Mol. Biol. 24: 307-31 (1988); Higgins and Sharp, Gene 73: 237-44 (1988) Higgins and Sharp, CABIOS 5: 151-3 (1989); Corpet et al., Nuc.Acids Res. 16: 10881-90 (1988); Huang et al., Comp.Appl. BioSci. 8: 155-65 (1992) and Pearson et al., Meth. Mol. Biol. 24: 307-31 (1994)), when analyzing aligned sequences, at least 90% identity, more preferably at least 95% Means a nucleotide sequence that exhibits identicality, most preferably at least 98% identity. The "% sequence homology" for a polynucleotide is determined by comparing the comparison regions with two optimally arranged sequences, wherein part of the polynucleotide sequence in the comparison region is the reference sequence (addition or deletion) for the optimal alignment of the two sequences. It may include the addition or deletion (ie, gap) compared to).

In the method of the present invention, surface plasmon resonance (SPR) may be used to quantitatively provide the binding force of the listeriosis regulatory protein PrfA and the DNA aptamer specifically binding thereto. For example, the Biacore 3000, a device capable of measuring SPR-based binding forces, is used to process EDC / NHS on a commonly used CM5 chip and react with Ethanolamine to encode an unactivated gold surface. After fixing the PrfA protein having an amine group, it is possible to measure the binding force with the PrfA protein while inducing the reaction by flowing the each aptamer secured.

On the other hand, the DNA aptamer belonging to SEQ ID NO: 7 sequence 19 of the present invention that binds with a high affinity to the PrfA protein through the above experiment can form a secondary structure shown in FIG.

The invention also provides compositions and methods for diagnosing Listeria monocytogenes PrfA specific binding DNA aptamer based Listeriasis and detecting Listeria monocytogenes. In the present invention, the detection of the PrfA protein is based on the method for detecting the binding complex of the DNA aptamer and the PrfA protein proposed in the present invention. In order to facilitate detection of the binding complex, the DNA aptamer may be a coloring material, for example, a fluorescent material such as fluorescein, Cy3, or Cy5, and may include nanoparticles; Nucleotides modified with radioactive substances or chemicals such as biotin or modified to have primary amines, thiol groups can be included in the DNA aptamers. The DNA aptamers of the invention can be biotinylated, for example, which can be successfully immobilized on a streptavidin coated substrate. The DNA aptamer of the present invention immobilized on a substrate can bind to and capture the PrfA protein, and the captured PrfA protein can be visualized by using a DNA aptamer that specifically binds to the PrfA protein. have.

The present invention also relates to a method for detecting diseased PrfA protein of Listeria monocytogenes comprising the steps of: (a) reacting the DNA aptamer with a sample expected to contain PrfA protein; (b) identifying the DNA aptamer bound to the protein PrfA protein. Since the DNA aptamer of the present invention has a property of specifically binding to PrfA protein in Listeria monocytogenes, preferably Listeria monocytogenes, early detection of Listeria monocytogenes is possible.

The present invention provides a sensor for diagnosing Listeriosis comprising the DNA aptamer as an active ingredient. In the sensor, the DNA aptamer may be immobilized on a chip or a substrate, and specifically, the DNA aptamer may be in the form of a microarray immobilized on a substrate. In the microarray of the present invention, "microarray" refers to a microarray in which oligonucleotide groups are immobilized at a high density on a substrate, and the oligonucleotide groups are immobilized in a predetermined region, respectively. Such microarrays are well known in the art. For example, microarrays are disclosed in US Pat. Nos. 5,445,934 and 5,744,305, the contents of which are incorporated herein by reference, wherein the term “microarray” is used herein to refer to specific regions of the substrate. Refers to an array (array) to which DNA nucleic acid material is attached at a high density. As used herein, the term “substrate” of a microarray is a support having suitable rigidity or semi-rigidity, where “substrate” refers to any substrate to which a DNA aptamer can be attached under conditions where the background level of binding is kept low. Say. Examples include, but are not limited to, glass, membranes, slides, filters, chips, wafers, fibers, magnetic beads or nonmagnetic beads, gels, tubing, plates, polymers, microparticles, and capillaries. The DNA aptamer of the invention is arranged and immobilized on the substrate. This immobilization is carried out by chemical bonding methods or by covalent binding methods such as UV. For example, DNA oligonucleotides can be bound to glass surfaces that have been modified to include epoxy compounds or aldehyde groups, and can also be bound by UV at the polylysine coating surface. In addition, the DNA oligonucleotide may be bound to the substrate via a linker (eg, ethylene glycol oligomer and diamine). The DNA aptamers of the present invention can be biotinylated, for example, which can be successfully bound onto a substrate that has been encoded with strapavidin. The sensor of the present invention is a sensor for use in detecting Listeria monocytogenes PrfA protein in a sample can be used for the diagnosis of Listeriosis, and the use of a sensor chip for the diagnosis and the instructions or labels for using the sensor further May contain

The present invention provides a diagnostic kit for detecting the presence of PrfA protein of Listeria monocytogenes in patients and biological samples suspected of Listeria infection to provide information necessary for diagnosing Listeria (see FIG. 8). Specifically, the term “biological sample” may include blood, saliva, tear fluid, urea, vigor, mucus, cells, tissues, and other tissues and body fluids, as well as cell culture supernatants, ruptured eukaryotic cells, and bacterial expression systems. It also includes, but is not limited to, water samples and food in the environment.

The present invention provides a diagnostic method for a kit for early diagnosis of Listeriosis using DNA aptamer as an active ingredient: (a) containing a target substance in a first aptamer fixed to a solid phase and specifically binding to the target substance Reacting by adding a second aptamer specifically bound to the sample and the target material and to which a labeling substance is attached; And (b) analyzing the label to detect the target. In the present invention, the "solid phase" is a solid support in which the aptamer is fixed, and the shape or material is not limited as long as the aptamer can be fixed. In the embodiment of the present invention was fixed on the membrane, in order to easily analyze with the naked eye was used nanoparticles that can be identified with the naked eye, but the color factor is not limited to nanoparticles having ordinary skill in the art. Will be self-evident. Also, multi-well type microplates can be generally used for the convenience of performing analytical methods, but other shapes such as sensor chips, plastics, polypropylene, or columns filled with beads such as Sepharose or Agarose can also be used. have. For example, when a fluorescent material is used as a label, emission or color change occurs in the presence of the target material, and thus the target material can be detected by measuring the same. For example, an image scanner capable of detecting a fluorescent dye may be scanned to determine whether a target substance is detected by scanning a well that caused a reaction, and the amount of detection may be measured by measuring the degree of thickening of the image through software.

On the other hand, the method according to the invention may be provided in the form of a kit, in order to increase portability. That is, in another aspect, the present invention includes a detection reagent containing a solid phase in which a first aptamer specifically binding to a target material is immobilized on a solid phase, and a second aptamer specifically binding to the target material. The present invention relates to a kit for detecting a target substance. In this case, the detection reagent containing the second aptamer may be provided in a separate container or in a reaction part to perform sandwich bonding. In addition to the above, the detection kit may include a detection buffer solution and the like, and may further include a tool for mixing the detection reagent and a sample solution to be detected. The optimal Listeria monocytogenes PrfA protein binding DNA aptamer according to the present invention can be utilized for early detection of Listeria in the medical field and the environment and food industry for the diagnosis of Listeriosis.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. .

Listeria monocytogenes prfA gene selection, cloning and expression and purification of recombinant PrfA protein

<1-1> Selection of Listeria monocytogenes prfA gene

In order to detect Listeria monocytogenes early and to select a target protein for early diagnosis of Listeriosis, a literature search was conducted on the list of genes related to Listeriosis. The pathogenic genes for diagnosing listeria are involved in genes such as prfA, inlA, inlB, and actA. In particular, the prfA gene controls the onset of sperm recognition during infection of Listeria. Therefore, the Listeria monocytogenes PrfA protein is selected and has an advantage of early diagnosis of Listeriosis before onset. First, to obtain Listeria monocytogenes PrfA protein expressed from Listeria monocytogenes prfA gene, the prfA gene sequence information of Listeria monocytogenes provided by a database of the National Center for Biotechnology Information (NCBI) is used. (GenBank: EU294523.1).

<1-2> Cloning of Listeria monocytogenes prfA gene

In order to secure an active recombinant Listeria monocytogenes PrfA protein, a recombinant expression vector including a Listeria monocytogenes prfA gene was constructed as a first step for the production of recombinant strains. First, for amplification of the Listeria monocytogenes prfA gene, a pair of primers containing a gene sequence and a restriction enzyme site were prepared by Bioneer, Korea. [Forward primer: 5'-ATTGTCGACAGATGAACGCTCAAGCAGAA-3 ', (SEQ ID NO: 1), reverse primer: 5'-ATAGCGGCCGCATTTAATTTTCCCCAAGTA-3', (SEQ ID NO: 2)]. Using the prepared primers, the Listeria monocytogenes prfA gene was amplified and the reaction composition was 1 to 2 µl of template DNA, 5 µl of 10X PCR buffer, 4 µl of each 2.5 mM dNTP mixture, 2 µl of 25 uM forward primer and 25 µM reverse primer. 2 μl, Ex Taq polymerase (TaKaRa, Japan) 0.3 μl (1 unit / μl) and 35.7 to 34.7 μl of water. PCR reaction conditions were first denatured at 94 ° C. for 5 minutes, repeated 30 cycles at 94 ° C. for 30 seconds, 65 ° C. for 30 seconds, and 72 ° C. for 30 seconds, and then further extended at 72 ° C. for 5 minutes. Was used. Thereafter, the amplified Listeria monocytogenes prfA gene and pGEX 4T-1 vector were cut with the same restriction enzyme (SalI / NotI), and then ligated to prepare a recombinant expression vector. Recombinant expression vector induces transformation in E. coli BL21 hosts by electroporation, and selects colonies that are resistant to ampicillin and chloramphenicol antibiotics to select recombinant Listeria monocytogenes prfA gene. An expression vector having was obtained.

<1-3> Expression and Purification of Listeria monocytogenes PrfA Protein Using Recombinant Listeria monocytogenes PrfA Protein Expression Vector

Overexpression of PrfA protein was induced by using the Lac operon system in a recombinant expression vector containing a prfA gene. Culture conditions at the time of passage were added 10 ml LB broth, 1 mM IPTG (isopropylthio-β-D-galactoside). As the reaction conditions, 100 μl of transformed E. coli BL21 was inoculated into 10 ml of LB broth, and incubated at 18 ° C. for 10 hours. When the OD ₆₀₀ reached 0.5, IPTG was 0 mM, 0.1 mM, and 1 mM, respectively. IPTG induction to be incubated for 20 hours at 18 ℃. The cell culture was centrifuged at 13,000 rpm for 10 minutes at 4 ° C to separate only cells. The cells obtained through centrifugation were resuspended in 10 mM Tris-HCl (pH 8.0) and centrifuged again to wash the cells. Thereafter, the cells were disrupted using an ultrasonic grinder, and then centrifuged at 13,000 rpm for 10 minutes at 4 ° C to separate soluble proteins and insoluble proteins. Each result was confirmed using a 10% SDS-PAGE gel (see Fig. 1).

<1-4> Purification and Dialysis of PrfA Protein Using GST System

In order to purely separate PrfA protein among variously expressed proteins, pure separation of GST fusion PrfA protein was performed using GST protein, a tagging system of the recombinant expression vector pGEX 4T-1. Purification was performed using glutathione sepharose 4B (GE Healthcare) having covalent bonds with GST. Glutathione Sepharose 4B was washed with 500 μl of 1 × PBS and centrifuged (4 ° C., 13,000 rpm) for 10 minutes to remove the upper layer. The washed glutathione Sepharose 4B was combined with the GST fusion PrfA protein and centrifuged (4 ° C., 13,000 rpm) for 10 minutes to remove unbound proteins from the upper layer. For purely isolated GST fusion PrfA protein, glutathione Sepharose 4B and GST fusion PrfA protein were separated using 100 μl of reduced glutathione. The reduced glutathione solution was removed from the isolated PrfA protein of Listeria monocytogenes, and dialyzed with 1X PBS for long term storage of the PrfA protein. The reaction composition of dialysis was injected with a PrfA protein solution obtained by using a syringe into a Slide-A-Lyzer dialysis cassette (Thermo scientific, USA), and proceeded with 1 L of 1X PBS buffer three times. As a reaction condition, a reaction of stirring a Slide-A-Lyzer dialysis cassette for 1 hour at 1 L of 1X PBS buffer at 4 ° C. using a stirrer (Cole-parmer instrument, USA) was performed three times. Then, the PrfA protein of the Slide-A-Lyzer dialysis cassette was extracted and secured using a syringe. The obtained PrfA protein was measured for protein concentration using a brad-ford assay. The measured PrfA protein was confirmed using 10% SDS-PAGE.

Construction of DNA Aptamer Pools

<2-1> Synthesis of Primer and DNA Aptamer Pools

To construct a PrfA protein specific binding DNA aptamer that specifically binds to the PrfA protein, the site of 5`-ATACCAGCTTATTCAATT and 3`-AGATTGCACTTACTATCT are composed of 40 sites at the center to easily amplify the aptamer pool at both ends. 76 bp of template DNA (5′-ATACCAGCTTATTCAATT-N40-AGATTGCACTTACTATCT-3; SEQ ID NO: 3) having a continuous random nucleotide in the ratio dA: dG: dC: dT = 1.5: 1.15: 1.25: 1 A biotinylated reverse primer to be used for the purpose of recovering amplified forward primer and single-stranded DNA was ordered to Bioneer, Korea. [Forward primer: 5`-ATACCAGCTTATTCAATT-3` (SEQ ID NO: 4) , Reverse primer: 5′-AGATTGCACTTACTATCT-3 (SEQ ID NO: 5), biotinylated reverse primer: 5′-biotin-AGATTGCACTTACTATCT-3 (SEQ ID NO: 6)].

<2-2> Amplification of DNA Aptamer Pool Using PCR Technique

Any DNA library having synthesized primers and 40 consecutive random sequences was amplified using PCR (Bioneer, Korea). PCR reaction composition for amplification of 76 bp DNA library includes 5 μl of 10X PCR buffer, 4 μl of each 2.5 mM dNTP mixture, 2 μl of 10 pM forward primer (SEQ ID NO: 4), and a biotinylated reverse primer (SEQ ID NO: 6). ) 2 μl, template DNA library (SEQ ID NO: 3) 1-2 μl, Ex Taq polymerase (TaKaRa, Japan) 0.3 μl (1 unit / μl) and distilled water 34.7-35.7 μl. PCR reaction conditions were first denatured at 94 ° C. for 5 minutes, followed by 20 cycles of reaction for 30 seconds at 94 ° C., 30 seconds at 52 ° C., and 30 seconds at 72 ° C., followed by further extension at 72 ° C. for 5 minutes. Was used. After the PCR reaction, 3 μl was taken to confirm that the band appeared at the correct size of 76 bp using 2% agarose gel. Confirmed DNA was recovered from the DNA aptamer pool using a PCR purification kit (Qiagen, USA). The recovered aptamer pool was confirmed by using a 10% acrylamide gel to show the band of the correct size (see Figure 2, lane 1).

<2-3> ssDNA Fabrication Using Heating-cooling Technique

50 μl of distilled water was added to 50 μl of the DNA library recovered using the PCR technique and the PCR purification kit, and then the volume was adjusted to 100 μl. Then, the dsDNA was denatured to ssDNA using a heating-cooling technique. . Specifically, the dsDNA obtained in Example was reacted at 85 ° C. for 5 minutes to denature the dsDNA to ssDNA, and immediately after the reaction was completed, the reaction solution was cooled to 4 ° C. to prepare ssDNA.

<2-4> Screening and Recovery of ssDNA

In order to remove only the ssDNA and biotin-bound ssDNA from the ssDNA products obtained by using the heat-cooling technique and to secure only pure forward ssDNA, the strept was added to 100 ul of the reaction solution obtained in the present example. 50 μl of avidin agarose resin (Streptavidin agarose resin, Thermo Scientific, USA) was added and reacted at room temperature for 1 hour. The reaction solution was centrifuged for 10 minutes using a centrifugal separator at 4 ° C and 13,000rpm, and then only the supernatant was recovered and treated with the same volume of PCI (phenol: chloroform: isoamylalcohol = 25: 24: 1) solution and then 4 ° C. The supernatant was recovered by centrifugation at 13,000 rpm for 15 minutes at. 1/100 volume of tRNA (sigma aldrich, USA), 1/10 volume of 3 M sodium acetate (pH 4.5) and 3 volumes of 100% ethanol were added to the supernatant for at least 1 hour at -70 ° C. I was. After the reaction was centrifuged for 20 minutes at 13,000 rpm at 4 ℃ to recover only ssDNA. The recovered ssDNA was dried at 65 ° C. and then dissolved in 50 μl of distilled water. 10 μl of the recovered ssDNA was taken, and 10% acrylamide gel was used to confirm that the band of the correct size appeared compared to dsDNA (see FIG. 2 and lane 2).

Screening of DNA Aptamers Specific to PrfA Proteins Using SELEX Technique

<3-1> Composition of each solution used in SELEX

Each solution used in SELEX was used a GST bulk kit (GE healthcare, UK), the composition was as follows. Namely, 1 X aptamer selection solution: 10 mM PBS (pH 7.4), 2 X aptamer selection solution: 20 mM PBS (pH 7.4), washing solution: 1 X aptamer selection solution, DNA aptamer elution solution: 50 mM Tris-HCl (pH 8.0), 10 mM glutathione.

<3-2> Construction of ssDNA Aptamer for SELEX

10 ul of distilled water was added to 40 ul of ssDNA prepared and secured through the method described in <2-4> of Example 2, and 50 ul of 2X DNA aptamer selection solution was added to increase the total reaction volume to 100 ul. After adjusting to boil for 5 minutes at 85 ℃ denatured, and then cooled slowly at room temperature to form a stable three-dimensional structure of the ssDNA aptamer.

<3-3> Screening of DNA aptamer specifically binding to PrfA protein using glutathione sepharose 4B

10 μl of a GST fusion IpaH protein obtained through the method described in Example 1 was prepared in Example 3.2. After mixing with the ssDNA aptamer pool obtained through the method described in the section, the total reaction volume was adjusted to 100 μl with 1 X aptamer selection solution, and then reacted at 4 ° C. for at least 12 hours. In order to activate glutathione sepharose 4B, 200 ml of glutathione sepharose 4B was added with 1 ml of 1 X PBS, stirred at 4 ° C. for 20 minutes, and reacted, followed by centrifugation at 4 ° C. at 13,000 rpm for 10 minutes. The supernatant was removed. After repeating the above procedure twice, the reaction solution of the GST fusion PrfA protein and the ssDNA aptamer pool was reacted with activated glutathione Sepharose 4B at 4 ° C. for 1 hour with stirring. Thereafter, the supernatant was removed by centrifugation at 13,000 rpm for 10 minutes at 4 ° C., followed by three times of washing with 1 ml of 1 × PBS to remove ssDNA aptamer that did not bind with GST fusion PrfA protein. In order to elute the GST fusion PrfA protein and the DNA aptamer specifically binding thereto from glutathione Sepharose 4B, 100 μl of DNA aptamer elution solution (50 mM Tris-HCl (pH 8.0), 10 mM glutathione) was added at 4 ° C. The reaction was stirred for 30 minutes at, followed by centrifugation at 13,000 rpm for 10 minutes at 4 ° C. to obtain an upper elution solution. This procedure was repeated twice to obtain an eluting solution of the upper layer. In order to remove the GST fusion PrfA protein from the binding between the GST fusion PrfA protein and the DNA aptamer specifically binding to it, the same volume of PCI solution was treated in the elution solution, followed by centrifugation at 13,000 rpm for 15 minutes at 4 ° C. To recover only the supernatant.

Subsequently, in order to recover only DNA aptamer specifically binding to GST fusion PrfA, 1/100 volume of tRNA, 1/10 volume of 3M sodium acetate (pH 4.5) and 3 volume in the supernatant recovered by PCI method 100% ethanol was added and reacted at -70 ° C for at least 1 hour, and the reaction solution was centrifuged at 13,000 rpm for 20 minutes at 4 ° C. Through this, only the DNA aptamer specifically binding to the PrfA protein could be recovered. The recovered DNA aptamer was dried at 65 ° C. and dissolved in 50 μl of distilled water.

<3-4> Nonspecific DNA Aptamer Removal Through Negative Selection

To remove nonspecific DNA aptamers that bind to GST protein and glutathione sepharose 4B, but not the PrfA protein, DNA on glutathione sepharose 4B with only GST protein fixed without PrfA protein between SELEX 6 and 7 times. Negative selection was performed to bind the aptamer solution. After fixing the GST protein to activated glutathione sepharose 4B using 1 X aptamer selection solution, the mixture was cooled to room temperature to react with the ssDNA aptamer pool that formed the structure, and the glutathione sepharose 4B and GST protein were reacted. The unbound upper ssDNA aptamer solution was used for 8 SELEX. Thereafter, SELEX was carried out up to 10 times in the same manner as in 3.3.The binding conditions of SELEX decreased the reaction time of ssDNA aptamer pool and GST fusion PrfA protein as the number of times increased. To obtain an aptamer that binds more specifically to the target material PrfA protein.

Selex round screening and final aptamer candidates for optimal DNA aptamer screening specifically binding to GST fusion PrfA protein

<4-1> Selection of Optimal SELEX Rounds for the Preparation of PrfA Protein Specific Binding DNA Aptamers by Quantitative Analysis

In order to quantitatively confirm SELEX progression and the affinity of the ssDNA aptamer eluted in each round after completing SELEX, the concentration of ssDNA bound to PrfA protein, a pathogenic regulator of Listeria monocytogenes recovered in each round, was measured. Measurement was performed using a Nano-drop spectrophotometer (Thermo Scientific). As a result of measuring the concentration of ssDNA aptamer eluted in each round, the highest concentration of 87 rounds was 877.0 ng / μl, and the concentration of 10 rounds was 467.8 ng / μl. Through this, it was confirmed that the optimal aptamer pool that specifically binds to the pathogenic regulatory protein PrfA of Listeria monocytogenes is a 9 round pool (see FIG. 4).

<4-2> Securing DNA Aptamer Candidates Specificly Binding to Listeria Monocytogenes PrfA Protein

Forward primers: 5'-ATACCAGCTTATTCAATT-3 '(SEQ ID NO: 4) and reverse primers for the 9 rounds of ssDNA aptamer pool which is determined to have the highest binding efficiency with Listeria monocytogenes PrfA protein via nanodrop spectrophotometer: DsDNA was obtained by PCR using 5′-AGATTGCACTTACTATCT-3 ′ (SEQ ID NO: 5). The dsDNA thus obtained was cloned using a T-blunt cloning kit (Solgent, Korea). Cloning was performed by mixing 1 μl of T-vector (10 ng / μl), 4 μl of PCR product (20 ng / μl), and 1 μl of 6 × T-blunt buffer and reacting at 25 ° C. for 5 minutes. 10 μl of the ligate TA cloned was mixed with 100 μl of DH5α and subjected to a heat shock at 42 ° C. for 1 minute and 30 seconds. 900 μl of SOC (2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10

mM MgCl

2, 10

mM MgSO

4, 20 mM glucose) medium was added thereto, followed by incubation at 37 ° C. for 1 hour. It was. After incubation, 200 μl of solution was taken to contain ampicillin (ampicillin, 50 μg / ml), kanamycin (kanamycin, 50 μg / ml), X-gal (50 μg / ml), and IPTG (5 μg / ml). After spreading to the LB culture plate (LB plate) and incubated for 15 hours at 37 ℃, only 42 white colonies were selected and asked to Solgent (Solgent, Korea) to determine the base sequence of the aptamer. Through sequence analysis, DNA aptamers that bind to 13 non-overlapping sequences of Listeria monocytogenes pathogenic regulatory PrfA protein could be obtained. Table 1 below shows the sequences for 13 PrfA protein binding DNA aptamer candidate groups obtained using the PrfA protein binding DNA aptamer selection SELEX technique using glutathione Sepharose 4B.

Table 1

Clone name	SEQ ID NO:	Selected sequence	Sequence size (bp)	Same sequence number
LMPA-1	SEQ ID NO: 7	TGCCGTACTTGCTGATGCAGGGACCTGCCTAGGGGACGAT	40	7
LMPA-2	SEQ ID NO: 8	TGCCGTACTTGCTGGTGCAGGGACCTGCCTAGGGGACGAT	40	One
LMPA-3	SEQ ID NO: 9	TGCCGTACTTGGCGATGCAGGGACCTGCCTAGGGGACGAT	40	One
LMPA-4	SEQ ID NO: 10	GCCGTGCTTGCTGATGCAGGGACCTGCCTAGGGGACGAT	39	One
LMPA-5	SEQ ID NO: 11	TACGTCGGGCAGGCAGGGACCCTCGAGGTCTTCGCGTTGC	40	One
LMPA-6	SEQ ID NO: 12	TCAGGGCAGGTCGGGTGTGTGGAACTGGCTGTCCCCGTTG	40	One
LMPA-7	SEQ ID NO: 13	GCCTTGGTGGTGCAGGCTTGTGGATACACCTTGTTCCGAT	40	21
LMPA-8	SEQ ID NO: 14	GTCTTGGTGGTGCAGGCTTGTGGATACACCTTGTTCCGAT	40	One
LMPA-9	SEQ ID NO: 15	GCCTTGGTGGTGCAGGCTTGTGGGTACACCTTGTTCCGAT	40	One
LMPA-10	SEQ ID NO: 16	GCCTTGGTGGTGCAGGCTTGTGGATACACTTTGTTCCGAT	40	One
LMPA-11	SEQ ID NO: 17	GCCTTGGTGGTGCAGGCTTGTGGATACACCTTGTTCCGTT	40	One
LMPA-12	SEQ ID NO: 18	CACCTATTCGGATGCTAGGTTTTGACGACCGGATGCTAG	39	4
LMPA-13	SEQ ID NO: 19	GGCAGGGACATGGAACAAGGTTAATCAATAGCCATGTGGG	40	One

Example 5

Affinity test between Listeria monocytogenes PrfA protein and PrfA protein binding aptamer candidate using surface plasmon resonance (SPR)

<5-1> Fabrication of SPR-based PrfA protein-coated sensor chip for quantification of affinity between Listeria monocytogenes PrfA protein and DNA aptamer candidate groups specifically binding to it

In order to quantify the affinity between the PrfA protein and the aptamer candidate groups obtained by the method described in Example 4 above, the inventors have used the Surface Plasmon Resonance (SPR) using BIAcore 3000, an SPR detection system device. The experiment was conducted. In order to quantify the affinity between the PrfA protein and the aptamer candidate group, a sensor chip CM5 (GE Healthcare, UK) coated with a carboxyl group was used. First, 0.05 M Nhydroxysuccinimide (NHS) and 0.2 M Nethyl-N '-(dimethylaminopropyl) carbodiimide (EDC) mixed solution were flowed into the sensor chip CM5 for 10 minutes at a rate of 10 μl / min to make the carboxyl group on the surface of the sensor chip more reactive. Activated with hydroxysuccinimide ester (N-Hydroxy-succinimide ester; NHS-ester). In order to fix the PrfA protein on the surface of the sensor chip CM5 activated with NHS-ester, a solution of PrfA protein dissolved in 70 mM / ml in 10 mM sodium acetate (pH 3.5) buffer at a rate of 10 µl / min was used for 7 minutes. Were treated to coat the chip surface with PrfA protein (see FIG. 5). Thereafter, 1M ethanolamine hydrochloride (pH 8.5) was flowed into the sensor chip to which the GST fusion PrfA protein was fixed at a rate of 10 μl / min for 7 minutes to inactivate the carboxyl reactor remaining on the surface of the sensor chip. This prevented other reagents and DNA aptamers from directly binding to the chip surface. After each experiment, the sensor chip was regenerated with 1 M NaCl and 50 mM NaOH. Binding rate variables were obtained and quantified by the BIA Assessment Program (BIACORE).

<5-2> Affinity of Listeria monocytogenes PrfA protein binding DNA aptamer candidate group

PrfA protein-binding DNA aptamer candidates obtained for screening aptamers having the highest affinity with PrfA protein were dissolved in HBS-EP buffer (GE Healthcare, UK) at concentrations of 300 nM, 500 nM, 1000 nM and 2000 nM, respectively. Ready. The prepared PrfA binding DNA aptamer is bound to PrfA of various concentrations (300 nM, 500 nM, 1000 nM, 2000 nM) to a sensor chip (channel 1) to which nothing is bound, and a sensor chip (channel 2) to which PrfA protein is fixed. Affinity between the PrfA protein and the DNA aptamer candidate group specifically binding thereto was quantified by injecting the DNA aptamer candidate group. Results of dissociation ( K _d , dissociation) of DNA aptamer candidates that specifically bind to each PrfA protein As a result, the dissociation constant of LMPA-9 aptamer of GST fusion PrfA protein binding DNA aptamer candidate group was 2.94 X 10 ^-9 M. It was confirmed that it has the highest affinity value for the target PrfA protein (see Table 2).

TABLE 2

Clone name	K _d (nM)	Clone name	K _d (nM)
LMPA-1	53.4 ± 13.6	LMPA-8	38.2 ± 12.4
LMPA-2	35.8 ± 12.2	LMPA1-9	2.94 ± 0.22
LMPA-3	58.7 ± 19.8	LMPA-10	53.7 ± 15.1
LMPA-4	60.6 ± 5.8	LMPA-11	52.0 ± 21.5
LMPA-5	11.4 ± 2.3	LMPA-12	4.25 ± 0.16
LMPA-6	144 ± 38.5	LMPA-13	63.3 ± 9.2
LMPA-7	4.81 ± 0.71

Structural Determination of PrfA Protein Binding DNA Aptamers

Rensselear polytechnic institute provides the structure of LMPA-5, LMPA-7, LMPA-9, and LMPA-12, among the PrfA-specific binding DNA aptamer candidates of Listeria monocytogenes, with high affinity to the PrfA protein. Imaging was possible using the DNA mfold program (see FIG. 7).

Detection and diagnostic methods for industrial applications of Listeria monocytogenes PrfA protein-specific binding DNA aptamers

Detection method and Listeria using PrfA protein specific binding DNA aptamer in an environment infected with Listeria monocytogenes for industrial use of Listeria monocytogenes pathogenicity-regulated PrfA protein specific binding DNA aptamer prepared and obtained by the above examples The purpose of this study was to identify the potential application of monocytogenes in diagnosing Listeriosis in animals or humans. For this purpose, a simple kit was developed to confirm the detection capability of Listeria monocytogenes in various samples.

<7-1> Membrane Fabrication for PrfA Protein Binding DNA Aptamer-based Detection and Diagnosis

Based on the PrfA protein specific binding aptamer screened and secured through the above examples, in order to detect Listeria monocytogenes in the PrfA protein present sample and to develop a method for diagnosing Listeriosis, the present invention is reported in the form of Rapid test kit. Diagnostic method was used. For the production of aptamer-based Listeria detection and diagnostic kits, a membrane was produced to show the results. The membrane is composed of a sample pad to react the sample and an absorbing pad to draw a solution of the sample pad so that the sample can react with the membrane to form a line on the membrane. It consists of capture line and control line. The control line was prepared to fix the streptavidin to confirm that the reaction occurred even if the PrfA protein was not present in the sample to form a control line by combining the sample with the biotinylated aptamer and nanoparticle complexes. . In addition, PrfA protein-specific binding aptamer LMPA-9 was fixed in front of the control line of the membrane. If PrfA protein is present in the sample, the band is designed to appear in the capture line. The relevant figure is shown in detail in FIG. 8.

<7-2> Affinity of Listeria monocytogenes PrfA protein binding DNA aptamer candidate group

The Listeria simple detection or diagnostic kit using PrfA protein specific binding aptamer is used for the detection of Listeria monocytogenes using streptavidin-biotin binding to LMPA-9 having high affinity with PrfA protein in Example 5. Biotin was labeled at the 3 'end, and an amine group was labeled at the 5' end. Then, LMPA-9 modified at both ends is fixed to the membrane coated with streptavidin obtained through the above process using biotin labeled at the 3 ′ end. After mixing LMPA-12 and Listeria monocytogenes with a sample that can be colored and nanoparticles that can be colored, drop them onto the sample pad of the LMPA-9 immobilized membrane. If Listeria monocytogenes is present in the sample, a line is formed in the capture line and the control line and appears as two lines (see FIG. 8 (c)). It was confirmed that only lines appeared (see FIG. 8 (b)). The table below compares the results with and without the PrfA protein in the sample.

TABLE 3

sample	Control line	Capture line
If no sample is loaded	-	-
PrfA Protein Free Sample	+	-
Sample with PrfA Protein	+	+

It was confirmed that the Listeria monocytogenes detection kit produced through the above experiment was normally made.

So far I looked at the center of the preferred embodiment for the present invention. Those skilled in the art will appreciate that the present invention can be implemented in a modified form without departing from the essential features of the present invention. Therefore, the disclosed embodiments should be considered in descriptive sense only and not for purposes of limitation. The scope of the present invention is shown in the claims rather than the foregoing description, and all differences within the scope will be construed as being included in the present invention.

Claims

PrfA protein specific DNA aptamer that specifically binds to PrfA protein of Listeria monocytogenes .
The method of claim 1,

The DNA aptamer is an DNA aptamer, characterized in that the oligonucleotide (oligonucleotide) having a nucleotide sequence having at least 90% identity with any one selected from the group consisting of the nucleotide sequence of SEQ ID NO: 7 to SEQ ID NO: 19.
The method of claim 1,

The DNA aptamer is an DNA aptamer, characterized in that the oligonucleotide (oligonucleotide) having any one selected from the group consisting of the nucleotide sequence of SEQ ID NO: 7 to SEQ ID NO: 19.
The method according to any one of claims 1 to 3,

The DNA aptamer is DNA aptamer, characterized in that further comprises a labeling material.
The method of claim 4, wherein

The DNA aptamer is a DNA aptamer, characterized in that any one of the labeling material selected from the group consisting of fluorescent material, amine group, biotin and thiol group is labeled at the 5 'end or 3' end of the DNA aptamer.
The method according to any one of claims 1 to 3,

The DNA aptamer DNA app, characterized in that the hydroxyl group of the ribose 2 'position of one or more nucleotides constituting the DNA aptamer is substituted with any one of a group consisting of a hydrogen atom, a fluorine atom, -OR, -OCOR and an amino group Tamer.
Listeria monocytogenes detection ( Listeria monocytogenes ) comprising a DNA aptamer that specifically binds to the PrfA protein of Listeria monocytogenes detection or Listeriosis diagnostic composition.
Listeria monocytogenes detection or listeriosis diagnostic kit comprising as an active ingredient aptamer specifically binding to PrfA protein of Listeria monocytogenes ( Listeria monocytogenes ).
Biochip for detecting Listeria monocytogenes or diagnosing Listeriosis, characterized in that the DNA aptamer specifically binding to the PrfA protein of Listeria monocytogenes is integrated on the substrate and reacts specifically to the sample containing the PrfA protein. .
The method of claim 9,

The substrate is Listia monocytogenes detection or Listeriosis diagnostic biochip, characterized in that selected from the group consisting of paper, plastic, glass, metal and silicon.
(a) contacting a biological sample isolated from the living body with a DNA aptamer that specifically binds to the PrfA protein of Listeria monocytogenes ; And

(b) confirming the presence of Listeria monocytogenes through a PrfA protein specific binding reaction between the biological sample and the DNA aptamer; Listeria monocytogenes detection method comprising a
(a) contacting a biological sample isolated from the living body with a DNA aptamer that specifically binds to the PrfA protein of Listeria monocytogenes ; And

(b) confirming the presence of Listeria monocytogenes through a PrfA protein specific binding reaction between the biological sample and the DNA aptamer; providing information necessary for diagnosing Listeriosis, including How to.