KR20110116644A - Method of providing information for diagnosis of tuberculosis and diagnostic kit comprising thereof - Google Patents

Abstract

The present invention relates to a method for providing information for diagnosing tuberculosis with significantly reduced blood volume and treatment time used as compared to a conventional diagnostic kit for tuberculosis, and a kit for diagnosing tuberculosis.

Description

Method of providing information for diagnosis of tuberculosis and diagnostic kit comprising thereof

The present invention relates to a method for providing information for the diagnosis of tuberculosis and tuberculosis diagnostic kit for the same, and more specifically, to provide information for the diagnosis of tuberculosis with significantly reduced blood volume and processing time used compared to the conventional tuberculosis diagnostic kit It relates to a method and a kit for diagnosing tuberculosis.

Tuberculosis is a chronic infectious disease caused by infection with Mycobacterium M. tuberculosis, which is not only a major disease in developing countries but also increases its severity in developed countries around the world. New onset and about 3 million patients die. Although tuberculosis may be asymptomatic for a significant time even after infection, the disease most commonly manifests as acute inflammation of the lungs, resulting in fever and unproductive cough, which if not treated usually leads to serious complications and death.

Therefore, the early diagnosis and treatment of tuberculosis is of the utmost importance, and the tuberculin skin test (TST) has conventionally been used worldwide to monitor tuberculosis infection. TST is an antigen-specific reaction that measures the degree of reaction (delayed hypersensitivity reaction) appearing at the injection site after 2-3 days after injecting tuberculin purified by filtering the culture medium obtained by heat sterilizing the tuberculosis bacteria culture medium. However, TST cross-reacts in people who have been sensitized to non-tuberculosis mycobacteria (NTM), and the probability of false positives is very high when BCG vaccination is common in Korea. In addition, some patients with tuberculosis responded negatively, reducing their credibility as a criterion for screening TB infection. However, due to its low specificity, high sensitivity, and low cost, it is still widely used as a method for detecting tuberculosis infection in developing and developing countries.

A commonly used method is a culture method. However, when the bacteria are directly isolated from the patient's specimen in the laboratory and tested, the risk of infection is very high, and since the tuberculosis bacteria take at least 4-6 weeks to grow, there is a considerable time and cost.

On the other hand, the detection method using the blood of the patient is safer, faster, and can be performed using a part of the blood necessary for a general clinical test because it detects the immune response caused by the infection of Mycobacterium tuberculosis rather than Mycobacterium tuberculosis. It's a convenient way for everyone.

    The test methods for blood developed so far include serological methods for detecting antibodies to Mycobacterium tuberculosis antigens and IGRA assays for detecting the amount of IFN-γ secreted by Mycobacterium tuberculosis infection (NCBI ACCESSION NO: NM_000619). Specifically, the serological diagnostic method has the advantage of being very easy to use, easy and quick to interpret the results, but has the disadvantage that the specificity and sensitivity are very low and the quantitative test cannot be performed.

The IGRA test, which is a method of quantitatively analyzing IFN-γ protein secreted by T cells stimulated by Mycobacterium tuberculosis-specific antigen, was performed by QuantiFERON (ELISA) and T-Spot.TB (ELISPOT) using a single antibody against IFN-γ. It is widely used in developed countries because of its high specificity compared to the existing test method. However, IGRA tests have the following disadvantages that are difficult to commercialize worldwide.

First, the IGRA test requires about 3ml of whole blood of the patient, but it is very difficult to obtain the blood volume for the test in the case of children or the elderly who have difficulty in collecting blood through the syringe to obtain this blood volume. There was a very troublesome problem.

Secondly, it takes about two to two days for the test results to take 16-24 hours to process the TB-specific antigen in the sampled blood.

Third, commercial kits rely on imports, and the price is also very expensive, about 5 million won per 100 tests.

Fourth, in case of IGRA test using ELISA method, a standard calibration curve should be set for each test, so there is a cost burden to test a small number of samples, and when a large number of samples are tested at one time There is a problem that it is difficult to obtain a constant result because the action of the color developing reagent used in the present invention may be delayed.

The present invention has been made to solve the above problems, the first problem to be solved of the present invention is to provide an information providing method for diagnosing tuberculosis that can significantly reduce the test time while significantly reducing the required blood volume will be.

The second problem to be solved of the present invention is to provide a kit for diagnosing tuberculosis containing a novel primer that can significantly lower the production cost while reducing the amount of blood required compared to the conventional tuberculosis diagnostic kit.

In order to achieve the first object of the present invention, (1) treating the tuberculosis-specific antigen in the blood of suspected tuberculosis patients, (2) separating the full-length RNA from the blood treated with the tuberculosis-specific antigen, (3) Synthesizing cDNA from the isolated full-length RNA, (4) using the primers capable of amplifying the synthesized cDNAs and a control gene for amplifying the expression level of IFN- [gamma] It provides an information providing method for diagnosing tuberculosis, comprising: performing RT-PCR, and (5) measuring mRNA expression level of the amplified IFN-γ and mRNA expression level of a control gene.

According to a preferred embodiment of the present invention, the blood may be whole blood.

 According to another preferred embodiment of the present invention, before the step (1) may further comprise the step of collecting blood of suspected tuberculosis patients.

According to another preferred embodiment of the present invention, the blood collection may be to collect blood of less than 1ml, more preferably 0.2 to 0.5ml of blood.

According to another preferred embodiment of the present invention, the Mycobacterium tuberculosis specific antigen of step (2) may be any one or more of ESAT-6, CFP-10 and TB7.7.

According to another preferred embodiment of the present invention, the control gene may be GAPDH.

According to another preferred embodiment of the present invention, the primer capable of amplifying the GAPDH may comprise a primer pair consisting of SEQ ID NOs: 3 and 4.

According to another preferred embodiment of the present invention, the primer capable of amplifying the IFN-γ may comprise a primer pair consisting of SEQ ID NO: 1 and 2.

According to another preferred embodiment of the present invention, after the step (5), it may further comprise the step of comparing the mRNA expression level of IFN-γ relative to the mRNA expression level of the control gene.

In order to achieve the second object, to provide a diagnostic composition for tuberculosis comprising a primer specifically binding to the gene for measuring the mRNA expression level of the human IFN-γ gene.

According to a preferred embodiment of the present invention, the primer may comprise a primer pair consisting of SEQ ID NO: 1 and 2.

According to another preferred embodiment of the present invention, in order to measure the mRNA expression level of GAPDH may further comprise a primer specifically binding to the gene, more preferably the primer consists of SEQ ID NOs: 3 and 4 Primer pairs may be included.

According to another preferred embodiment of the present invention, there is provided a diagnostic kit for tuberculosis comprising the tuberculosis diagnostic composition and RT-PCR kit comprising the same.

Hereinafter, terms used in the present invention will be described.

The term "method of providing information for diagnosis" is a preliminary step for diagnosis and provides objective basic information necessary for the diagnosis of tuberculosis, excluding the clinical judgment or findings of the doctor.

The term "primer" refers to a short nucleic acid sequence that is capable of forming base pairs with complementary templates with nucleic acid sequences having short free 3-terminal hydroxyl groups and that serves as a starting point for template strand copying. Primers can initiate DNA synthesis in the presence of four different nucleoside triphosphates and reagents for polymerization (ie, DNA polymerase or reverse transcriptase) at appropriate buffers and temperatures. Primers of the invention are sense and antisense nucleic acids having 7 to 50 nucleotide sequences as primers specific for each marker gene. Primers can incorporate additional features that do not change the basic properties of the primers that serve as a starting point for DNA synthesis.

The term "mRNA expression level measurement" is a process of determining the presence and expression of mRNA in a biological sample to provide information for diagnosing tuberculosis.

The term "reverse transcriptase polymerase reaction (RT-PCR)" is a molecular biological polymerization method that amplifies cDNA produced after reverse transcription of RNA into complementary DNA (cDNA) using a reverse transcriptase as a template.

The conventional IGRA method for testing IFN- [gamma] protein requires blood collection through a syringe because at least 3 ml or more of blood is required. It is possible to test with only a small amount of blood detected after stabbing a patient with a needle such as a blood needle rather than a syringe, which can significantly reduce the burden on the syringe. In addition, due to the reduced antigen processing time (within 4 hours) compared to the conventional method (16 to 24 hours), the existing total test time can be reduced, so that TB patients can be identified more quickly.

1 is a schematic diagram showing an information providing method for diagnosing tuberculosis according to an embodiment of the present invention.
Figure 2 is a tube containing Mycobacterium tuberculosis specific antigen for performing RT-PCR according to an embodiment of the present invention.
3 and 4 is a table showing a comparison result according to a conventional QuatiFERON (IFN-γELISA) test results and blood samples according to a preferred embodiment of the present invention.
Figure 5 is an electrophoresis picture of the RT-PCR according to a preferred embodiment of the present invention according to the reaction time of the tuberculosis bacteria specific antigen and blood.
FIG. 6 is an electrophoretic photograph of a small amount of blood and RT-PCR according to a preferred embodiment of the present invention.

Hereinafter, the present invention will be described in more detail.

As described above, the conventional IGRA test for the diagnosis of tuberculosis has a problem that it is difficult to be widely used because the amount of blood required and the test time is at least 24 hours or more, and the price of the manufactured kit is significantly high.

In the present invention, (1) treating the tuberculosis specific antigen in the blood of suspected tuberculosis, (2) separating the full-length RNA from the blood treated with the tuberculosis specific antigen, (3) cDNA from the isolated full-length RNA (4) performing RT-PCR using the primers capable of amplifying the synthesized cDNA with IFN-γ and a primer capable of amplifying a control gene for contrast with the expression level of IFN-γ. , And (5) to provide an information providing method for diagnosing tuberculosis, including measuring the mRNA expression level of the amplified IFN-γ and the mRNA expression level of a control gene. In particular, since IFN-γ is quantitatively analyzed at the mRNA expression level, not at the protein expression level, blood volume, test time, and test cost required for the TB test can be significantly reduced.

First, blood of a suspected tuberculosis tuberculosis may be collected as a preliminary step for step (1). In the conventional IGRA test, the minimum amount of blood required is more than 3 ml. In order to collect this amount of blood, blood must be drawn from a suspected tuberculosis patient through a syringe. Due to the difficulty of blood collection, the elderly, young children and women had a problem that the tuberculosis test is difficult. However, according to one feature of the present invention, since the required blood volume is 1 ml or less, preferably 0.3 to 0.5 ml can provide information to determine whether tuberculosis, simply by a method such as a blood needle rather than a syringe Blood can be collected, which can relieve much of the psychological burden of blood collection. On the other hand, the blood used in the present invention may preferably be whole blood.

Next, the tuberculosis specific antigen is treated in the blood of the suspected tuberculosis tuberculosis patient as step (1). This is to provide information for judging tuberculosis through the mRNA expression level of IFN-γ secreted by T cells in response to Mycobacterium tuberculosis specific antigen. In the present invention, IFN-γ is not a quantification of the expression level of IFN-γ protein. It provides information for diagnosing tuberculosis by quantifying mRNA expression level of Therefore, the Mycobacterium tuberculosis-specific antigen that can be used in step (1) can be used for the IGRA test, and is specifically present only in Mycobacterium tuberculosis. . Preferably, ESAT-6 (NCBI ACCESSION NO: YP_178023), CFP-10 (NCBI ACCESSION NO: NP_218391), and TB7.7 (NCBI ACCESSION NO: NP_217171) as a Mycobacterium tuberculosis specific antigen are treated alone or mixed within about 4 hours. Can be.

Next, the steps of (2) and (3) specifically to separate the full-length RNA (Total RNA) in the blood treated with the Mycobacterium tuberculosis specific antigen, (3) comprising the step of synthesizing the cDNA from the isolated full-length RNA do. Steps (2) and (3) of the present invention are a method for separating total RNA, which is generally used as a preliminary step for performing RT-PCR, and a method for synthesizing cDNA therefrom through known methods. A detailed description of this process can be performed by Joseph Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001); And Noonan, KF, and the like, which may be incorporated by reference of the present invention.

Next, as step (4), RT-PCR is performed using a primer capable of amplifying the synthesized cDNA with a primer capable of amplifying IFN-γ and a control gene for contrast with the expression level of IFN-γ.

Primers of the invention can be chemically synthesized using phosphoramidite solid support methods, or other well known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include methylation, “capsulation”, substitution of one or more homologs of natural nucleotides, and modifications between nucleotides, eg, uncharged linkages such as methyl phosphonate, phosphoester, phosph Modifications to poroamidates, carbamates, etc.) or charged linkers (eg, phosphorothioates, phosphorodithioates, etc.). Nucleic acids may be selected from one or more additional covalently linked residues, such as proteins (eg, nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), inserts (eg, acridine, psoralene, etc.). ), Chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.), and alkylating agents. Nucleic acid sequences of the invention can also be modified using a label that can provide a detectable signal directly or indirectly. Examples of labels include radioisotopes, fluorescent molecules, biotin, and the like.

According to an aspect of the present invention, IFN-γ is a protein secreted by T cells stimulated by Mycobacterium tuberculosis-specific antigen, and in the present invention, the expression level is measured at the mRNA level rather than the protein through RT-PCR. To this end, a primer that specifically binds to the IFN-γ gene is required, and in the present invention, [5 'TGCAGGTCATTCAGATGTAGCGGATA 3' (SEQ ID NO: 1)] as a front primer and [5 'TCATGTATTGCTTTGCGTTGGACA 3' (SEQ ID NO: 2) as a rear primer. )] Novel primer pairs can be used.

According to another aspect of the present invention, RT-PCR may be performed using a primer capable of amplifying a control gene for contrast with the expression level of IFN-γ. At this time, the control gene that can be applied to the present invention is a reference gene for relatively determining the expression level of IFN-γ. In the present invention, the GAPDH gene (NCBI ACCESSION NO: NM_002046) is used as an example of the control gene. RT-PCR can be performed to express mRNA. GAPDH gene is a housekeeping gene, which is a gene that is constantly expressed in a constant amount to maintain minimal function in human cells. There are many genes besides GAPDH, but GAPDH is the most frequent in quantitative RT-PCR analysis. It is used. Therefore, the present invention is not limited thereto, and genes that may be used as criteria for relatively determining the expression level of IFN-γ may be applied to the present invention. Meanwhile, in the present invention, since the GAPDH gene is used as a control gene, a primer capable of specifically binding to the gene is required. In the present invention, [5 'CGGGAAGCTTGTGATCAATGG 3' (SEQ ID NO: 3)] as a front primer and a rear primer [ 5 'GGCAGTGATGGCATGGACTG 3' (SEQ ID NO: 4)]. RT-PCR method applied to the present invention can be carried out through known procedures commonly used in the art.

Next, the mRNA expression level of the amplified IFN-γ and the mRNA expression level of the control gene are measured as step (5). This step is to relatively measure the expression level of mRNA of the mRNA and the control gene of the IFN-γ can be used without limitation as long as it is a method for measuring the normal mRNA expression level, preferably the RT-PCR PCR products amplified through the electrophoresis by measuring the mRNA expression level of IFN-γ and mRNA level of the control gene by a densitometer (Densitometer) or by electrophoresis to confirm the band pattern and band thickness by FN-γ MRNA expression level and mRNA expression level of the control gene can be measured.

In other words, the amount of IFN-γ and GAPDH mRNA expression was calculated for each blood sample (sample), and the amount of IFN-γ mRNA expression increased and decreased compared to GAPDH mRNA expression in multiples of several times. Relative quantification of increases and decreases can provide information that can be used to determine tuberculosis.

According to another aspect of the present invention includes a diagnostic composition for tuberculosis comprising a primer specifically binding to the gene for measuring the mRNA expression level of the human IFN-γ gene. As a specific aspect, the diagnostic kit may be a kit for diagnosing tuberculosis, characterized in that it includes essential elements necessary to perform reverse transcriptase. The reverse transcription polymerase kit may comprise each primer pair specific for the human IFN- [gamma] gene. The primer is a nucleotide having a sequence specific to the nucleic acid sequence of each marker gene, and may be about 7 bp to 50 bp in length, more preferably about 10 bp to 30 bp in length, and more preferably SEQ ID NOs: 1 and 2 It may include a novel primer pair represented by.

In addition, a primer specific for the nucleic acid sequence of the control gene may be included. Preferably, the primer may further include a primer specifically binding to the gene for measuring the mRNA expression level of GAPDH, more preferably the primer. May comprise a novel primer pair consisting of SEQ ID NOs: 3 and 4.

Other reverse transcriptase kits include test tubes or other suitable containers, reaction buffers (pH and magnesium concentrations vary), enzymes such as deoxynucleotides (dNTPs), Taq-polymerase and reverse transcriptase, DNAse, RNAse inhibitor DEPC -May include DEPC-water, sterile water, and the like.

After all, the conventional IGRA method for testing IFN- [gamma] protein requires at least 3 ml or more of blood, so the blood must be drawn through a syringe. However, in the present invention, a very small amount of 1 ml (preferably 0.5 ml or less) of tuberculosis test is required. Since it is possible to test the patient with a small amount of blood detected after poking a needle such as a blood needle rather than a syringe, the burden of the syringe can be significantly reduced. In addition, due to the reduced antigen processing time (within 4 hours) compared to the conventional method (16 to 24 hours), the existing total test time can be reduced, so that TB patients can be identified more quickly.

Hereinafter, the configuration of the present invention will be described in more detail with reference to Examples, but the scope of the present invention is not limited to the following Examples.

<Example 1> Mycobacterium tuberculosis specific antigen treatment to whole blood of patient

After collecting blood from the patient, a tube containing the antigen used for the IGRA test was imported from Cellestis, Australia, and 1 ml of blood was added to each of the three tubes (FIG. 2). The nil tube contains no antigen and is used as a negative control in the IGRA test. The TB antigen tube is a tube containing three antigens, ESAT-6, CFP-10, and TB7.7, which are specific to Mycobacterium tuberculosis and induce an immune response in the host. The TB mitogen tube contains phytohaemagglutinin (PHA) that acts as a mitogen and was used as a positive control in the IGRA test.

        In the present invention, to compensate for the shortcomings of the IGRA test, the antigen treatment time and blood volume were reduced as follows.

          1) Antigen Treatment Time: 12 hours, 8 hours, 4 hours, 2 hours, 1 hour, 30 minutes

2) Blood volume: 1 ml, 0.3 ml

< Example 2> Isolation of total RNA from antigen-treated blood

       In Example 1, the antigen-treated blood was added to about 10-fold RNA and DNA stabilization solution (Roche), and total RNA was isolated using a QIAamp Blood RNA Mini kit (Qiagen).

Example 3 Synthesis of Complementary cDNA from Isolated Total RNA

9 μl total RNA isolated, 0.25ug random primer (Invitrogen), 250uM dNTP (Cosmo gene tech), 50mM Tris-HCl (pH 8.3), KCl 75mM, MgCl ₂ 3 mM, DTT 8 mM and MMLV reverse transcriptase 200units (Invitrogen) were added, and DEPC treated DW was added and stirred to a final volume of 25 ul. The cDNA synthesis reaction was then reacted with a thermocycler (ABI) at 25 ° C. for 10 minutes, at 37 ° C. for 50 minutes, and at 70 ° C. for 15 minutes to synthesize cDNA.

Example 4 Amplification of IFN-γ and GAPDH Using Synthesized cDNA as a Template

The composition of the RT-PCR reactants was KCl 50 mM, Tris-HCl 10 mM (pH8.3), MgCl ₂ 1.5 mM, gelatin 0.001% (w / v), 250 uM dNTP, 1 unit Tag DNA polymerase (Solgent) and each of the front primer and the back primer 10 pmole. 2 μl of the synthesized cDNA was added thereto, and the final volume was 20 μl. The base sequence of each primer added is as follows.

       (1) IFN-γ primer (size of amplified product-287bp)

        Forward-5 'TGCAGGTCATTCAGATGTAGCGGATA 3' (SEQ ID NO: 1)

        Reverse-5 'TCATGTATTGCTTTGCGTTGGACA 3' (SEQ ID NO: 2)

        (2) GAPDH primer (size of amplified product -357bp)

         Forward-5 'CGGGAAGCTTGTGATCAATGG 3' (SEQ ID NO: 3)

         Reverse-5 'GGCAGTGATGGCATGGACTG 3' (SEQ ID NO: 4)

RT-PCR reaction (Applied Biosystems (GeneAmp PCR System 2700), MJ Research Inc. (PTC-100)) was performed once at a denaturation temperature of 95 ° C. for 5 minutes, at a denaturation temperature of 95 ° C. for 30 seconds, and at an annealing temperature of 55 ° C. 35 cycles of 30 seconds at 30 seconds, elongation temperature at 72 ° C. and finally a final extension reaction at 72 ° C. for 10 minutes.

Example 5 Confirmation of Amplification by Electrophoresis and Quantification of Amplified Product

      After RT-PCR was completed, 5 μl of PCR product was taken and subjected to 2% agarose gel electrophoresis to confirm amplification of IFN-γ and GAPDH PCR products. The results of electrophoresis were used to quantify whether IFN-γ mRNA was expressed by densitometer and normalized to the expression level of GAPDH mRNA, a house keeping gene that is constantly expressed for comparison.

Meanwhile, the values of IFN-γ and GAPDH were quantified from three tubes, TB mitogen tube, TB antigen tube, and Nil tube, which were used in the embodiment of the present invention.

[Relationship 1]

(IFN-γ expression value of TB antigen tube-GAPDH expression value of same tube) / (IFN-γ expression value of Nil tube-GAPDH expression value of same tube)

TB Ag / Nil obtained by substitution in the above formula 1 can be determined as tuberculosis positive if 1.5 or more, and tuberculosis negative if 1.5 or less. In addition, the difference between the positive control TB mitogen tube value and the negative control Nil tube value is determined to determine whether or not the sound is negative. Equation 1 above and the determination of tuberculosis infection according to the standard of the general IGRA test.

Evaluation Example 1 Evaluation of Possibility of Tuberculosis Diagnosis by Quantifying IFN-r mRNA Isolated from Antigen-treated Blood

About 16 clinical specimens and QuatiFERON (IFN-γELISA) test results from Severance Hospital, Chon, TB tuberculosis under the same conditions (3 ml blood and 16 hours of antigen treatment) used for the IGRA test, which tests the existing IFN-γ protein. Specific antigen was treated to perform the RT-PCR based IGRA assay of the present invention and the results were compared (Fig. 3, 4).

    Specifically, Figure 3 is tested with a product called QuatiFERON sold as a commercial kit, and the result of the tuberculosis-positive patient sample treated with TB-specific antigen under the same conditions as the existing IGRA test and RT-PCR based IGRA assay of the present invention Is a table comparing the results. As a result, it can be confirmed that the RT-PCR based IGRA assay of the present invention shows the same test results as the conventional commercial kit, compared to the conventional commercial kit.

   FIG. 4 shows the results of RT-PCR based IGRA assay of the present invention after subjecting the patient specimens with tuberculosis negative and uninterpretable results as a result of testing with QuatiFERON, which is sold as a commercial kit. Is a table comparing the results. As a result, it can be seen that each of the positive and negative samples from the existing commercial kits were not interpretable results, and the other tuberculosis-negative samples were all the same.

As can be seen in Figures 3 and 4 after the antigen treatment under the same conditions (3 ml blood, 16 hours of antigen treatment) and the IGRA test to test the existing protein, by performing the RT-PCR based IGRA assay IFN-γ As a result of evaluating the possibility of diagnosis of tuberculosis through mRNA quantification, it can be seen that the method of providing tuberculosis information through IFN-γ mRNA quantification using RT-PCR of the present invention is significant.

Evaluation Example 2 Establishment of RT-PCR based IGRA assay as a rapid test method

   The existing IGRA test for IFN-γ protein took two days to obtain the final test results due to the long TB-specific antigen treatment time. In the case of the existing IGRA, the target is an IFN-γ protein, but in the present invention, since the IFN-γ mRNA is a target, it is hypothesized that the expression can be confirmed at a faster time. Using the same amount of blood (3 ml each; 1 ml each of mitogen (M), TB Ag, and Nil (N) tubes), the reaction time of the TB-specific antigen and blood was 4 and 8 hours, respectively. , And changed to 12 hours to perform RT-PCR based IGRA assay (FIG. 5).

   RESULTS: In the newly developed RT-PCR based assay, when the antigens were treated with the same amount of blood for a short time, a significant test result was obtained with only 4 hours of antigen treatment.

In FIG. 5, M denotes TB mitogen, TB denotes TB Ag, and N denotes Nil, and RT-PCR is performed after not treating these antigens by time, 4 hours treatment, 8 hours treatment, and 16 hours treatment. . The results confirmed that the expression of IFN-γ mRNA even after 4 hours of antigen treatment. Through this, it can be seen that the antigen treatment time, which was 16 hours to 24 hours when performing the existing IFN-γ ELISA, can be shortened to within 4 hours.

Evaluation Example 3 Establishment of Conditions Using a Small Volume of Blood

   For the IGRA test for conventional IFN- [gamma] proteins, 3 ml of blood was required to perform the test. However, patients with difficulty in collecting blood, such as children and the elderly, had a disadvantage in that 3 ml of blood was difficult to collect. Therefore, the inventors performed the RT-PCR based IGRA assay with a very small amount of blood (0.3ml) to overcome this disadvantage (Fig. 6). As a result, the amount of IFN-r expression was confirmed in a small amount of blood about 1/10 the amount of blood required for the conventional IGRA test, and a significant result was obtained.

In FIG. 6, M denotes TB mitogen, TB denotes TB Ag, and N denotes Nil. Based on the results in FIG. 5, a total of 1 ml of blood from a tuberculosis patient (0.3 ml for each tube) was used and the antigen treatment time was 4 hours ( The experiment was carried out in advance to the conditions of the present invention).

Through the results of FIGS. 5 and 6 Of the present invention The RT-PCR based IGRA assay induced IFN-γ mRNA expression even with a small amount of blood (0.3 ml) and a short antigen treatment time (4 hours), which was detected by RT-PCR based IGRA assay. .

The method of providing information for diagnosing tuberculosis of the present invention and the tuberculosis diagnostic kit therefor are very useful in the medical industry because tuberculosis can be diagnosed in a short time through a very small amount of blood.

<110> INDUSTRY-ACADEMIC COOPERATION FOUNDATION, Yonsei University <120> Method of providing information for diagnosis of tuberculosis and          diagnostic kit comprising <160> 4 <170> KopatentIn 1.71 <210> 1 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 1 tgcaggtcat tcagatgtag cggata 26 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 2 tcatgtattg ctttgcgttg gaca 24 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 3 cgggaagctt gtgatcaatg g 21 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 4 ggcagtgatg gcatggactg 20

Claims (17)

(1) treating Mycobacterium tuberculosis specific antigen in the blood of suspected tuberculosis patient;
(2) separating the full-length RNA from the blood treated with Mycobacterium tuberculosis specific antigen;
(3) synthesizing cDNA from the isolated full-length RNA;
(4) performing RT-PCR using the synthesized cDNA using a primer capable of amplifying IFN-γ and a primer capable of amplifying a control gene for contrast with the expression level of IFN-γ; And
(5) measuring the mRNA expression level of the amplified IFN-γ and mRNA expression level of the control gene; information providing method for the diagnosis of tuberculosis comprising a. The method of claim 1,
The blood is information providing method for the diagnosis of tuberculosis, characterized in that whole blood. The method of claim 1,
The method of providing information for diagnosing tuberculosis further comprising the step of collecting blood of suspected tuberculosis patient before step (1). The method of claim 3,
The blood collection is an information providing method for the diagnosis of tuberculosis, characterized in that the blood collection of less than 1ml. The method of claim 3,
The blood collection is an information providing method for the diagnosis of tuberculosis, characterized in that the blood collection of 0.2 ~ 0.5ml. The method of claim 1,
Mycobacterium tuberculosis specific antigen of step (2) is any one or more of ESAT-6, CFP-10 and TB7.7 providing information for the diagnosis of tuberculosis. The method of claim 1,
The control gene is GAPDH information providing method for the diagnosis of tuberculosis, characterized in that. The method of claim 7, wherein
Primer capable of amplifying the GAPDH is an information providing method for the diagnosis of tuberculosis, characterized in that it comprises a primer pair consisting of SEQ ID NO: 3 and 4. The method of claim 1,
The primer capable of amplifying the IFN-γ may provide a method for diagnosing tuberculosis, characterized in that it comprises a primer pair consisting of SEQ ID NO: 1 and 2. The method of claim 1,
After the step (5), the method of providing information for diagnosing tuberculosis further comprising the step of comparing the mRNA expression level of IFN-γ relative to the mRNA level of the control gene. Tuberculosis diagnostic composition comprising a primer specifically binding to the gene for measuring the mRNA expression level of the human IFN-γ gene. The composition for diagnosing tuberculosis according to claim 11, wherein the primer comprises a primer pair consisting of SEQ ID NOs: 1 and 2. 13. The composition for diagnosing tuberculosis according to claim 11, further comprising a primer specifically binding to the gene for measuring mRNA expression level of the control gene. The composition for diagnosing tuberculosis according to claim 13, wherein the control gene is GAPDH. The composition for diagnosing tuberculosis according to claim 14, wherein the primer comprises a primer pair consisting of SEQ ID NOs: 3 and 4. 16. Tuberculosis diagnostic kit comprising a composition according to any one of claims 11 to 15. RT-PCR kit comprising the tuberculosis diagnostic kit of claim 16.

Images