KR101789778B1

KR101789778B1 - A nucleic acid aptamer specifically binding to BDE-47 and the use thereof

Info

Publication number: KR101789778B1
Application number: KR1020150148014A
Authority: KR
Inventors: 김병찬; 김언정
Original assignee: 한국과학기술연구원
Priority date: 2015-10-23
Filing date: 2015-10-23
Publication date: 2017-10-25
Also published as: KR20170047648A

Abstract

A nucleic acid aptamer specifically binding to BDE-47, a composition and kit for detecting BDE-47 comprising the aptamer, and a method for detecting BDE-47 in a sample using the aptamer and a method for detecting BDE- 47 is removed.

Description

A nucleic acid aptamer specifically binding to BDE-47 and a nucleic acid aptamer specifically binding to BDE-47,

A nucleic acid aptamer that specifically binds to BDE-47, and uses thereof.

Aptamers refer to nucleic acid or peptide molecules that have high specificity and affinity for a variety of target substances. The aptamer is advantageous in that it is more stable than the antibody, and the receptor specific to the target substance can be relatively easily obtained. Aptamers are capable of imparting a variety of chemical functional groups to the ends and are easy to chemically synthesize, enabling high-purity, low-cost mass production.

Polybrominated diphenyl ether (PBDE) is a representative brominated flame retardant added to various kinds of products. PBDE has been designated as a persistent organic pollutant (POP) for use by the Stockholm Convention since 2009. PBDEs are characterized by their ability to remain in the environment for a long period of time without degradation or metabolism.

Current PBDE analysis usually takes more than a week to produce the results and requires significant analysis costs. Alternatively, ELISA may be used, but this method also has technical limitations in rapid screening and separation. Therefore, there is a need for a system that can rapidly screen and isolate the presence of PBDE in a variety of environments.

One aspect provides a nucleic acid aptamer that specifically binds to BDE-47.

Another aspect provides a composition and a kit for detecting BDE-47, comprising the aptamer.

Yet another aspect provides a method for detecting BDE-47 in a sample and a method for removing BDE-47 from a sample using the aptamer.

One aspect provides a nucleic acid aptamer that specifically binds to 2,2 ', 4,4'-tetrabromodiphenyl ether (BDE-47). BDE-47 is a representative isomer of polybrominated diphenyl ether in which four hydrogens on the diphenyl group are each substituted with bromine and has the molecular formula C ₁₂ H ₆ Br ₄ O. BDE-47 is also named 2,2 ', 4,4'-tetrabromobiphenyl ether or PBDE-47.

The term "aptamer " refers to a nucleic acid molecule that itself forms a stable tertiary structure and is capable of binding to the target molecule with high affinity and specificity. The term "nucleic acid" is a polymer of nucleotides, which may be used in an equivalent sense to oligonucleotides or polynucleotides. The nucleic acid may comprise a deoxyribonucleotide (DNA), a ribonucleotide (RNA), a nucleotide analog, and / or a peptide nucleic acid (PNA) molecule. The aptamer may be present as a single stranded nucleic acid. The aptamer can form a tertiary structure and bind to BDE-47.

The term "specifically binding" means that the aptamer does not substantially bind to other organic chemicals other than BDE-47 or shows a large difference in affinity, allowing the distinction between BDE-47 and other organic chemicals . Such other organic chemicals may include polybrominated diphenyl ethers other than BDE-47, derivatives thereof, and / or other brominated flame retardants such as tetrabromobisphenol A and hexabromocyclododecane. The polybrominated diphenyl ether is formed by substituting the hydrogen of the phenyl group with bromine. Depending on the position and the number of the substituted bromine atom, about 200 kinds of structural isomers exist. The aptamer may specifically bind to BDE-47 among these isomers.

The aptamer may comprise a nucleotide sequence having 90% or more, 95% or more, 97% or more, or 98% or more identity with the nucleotide sequence of SEQ ID NO: 1. The aptamer may be one in which some of the nucleotides of the nucleotide sequence of SEQ ID NO: 1 have been substituted, inserted, and / or deleted. For example, the aptamer may be one in which a nucleotide which is not essential for the specific binding with BDE-47 in the nucleotide sequence of SEQ ID NO: 1 is replaced with another nucleotide. The term "nucleotides not essential for specific binding with BDE-47 in the nucleotide sequence of SEQ ID NO: 1" refers to a nucleotide corresponding to the PCR primer region at both ends of the aptamer, for example, Lt; / RTI > nucleotides. The aptamer may comprise the nucleotide sequence of SEQ ID NO: 1. The aptamer may consist of the nucleotide sequence of SEQ ID NO: 1.

The aptamer may further comprise a detectable labeling substance. The labeling substance may be a substance which generates a detectable signal. The detectable signal may be an optical signal, an electrochemical signal, a signal by a radioactive isotope, an enzyme signal, or a combination thereof.

The material that generates the optical signal may be a fluorescent material or a phosphorescent material. The fluorescent material may be, for example, fluorescein, rhodamine, Cy2, Cy3, Cy3.5, Cy5, or Cy5.5. Examples of fluororesin dyes include 6-carboxyl fluorosine (6-FAM), 5-tetrachloro-fluorescein phosphoramidite (TET), hexachlorofluorene (HEX) 5-dichloro-dimethoxy-fluororesin (JOE) may be included. In addition, the optical signal may be generated by a pair of fluorescence resonance energy transfer (FRET). Materials known in the art can be used as the FRET pair. The material generating the electrochemical signal may be methylene blue. The radioisotope may be C ¹⁴ , I ¹²⁵ , P ³² , or S ³⁵ . The enzyme may be alkaline phosphatase, beta-galactosidase, horseradish peroxidase, luciferase, cytogrom P450, or glucose oxidase.

The labeling substance may bind to the 3 'terminal or the 5' terminal of the aptamer. The labeling substance may be bound to a specific site of the aptamer. The particular region may be, for example, part of a hairpin-loop structure.

Another aspect provides a composition for detecting BDE-47, comprising a nucleic acid aptamer that specifically binds BDE-47.

Yet another aspect provides a kit for detecting BDE-47, comprising a nucleic acid aptamer that specifically binds to BDE-47.

In the composition or kit, the aptamer may comprise a nucleotide sequence having 90% or more, 95% or more, 97% or more, or 98% or more identity with the nucleotide sequence of SEQ ID NO: 1. The aptamer may comprise the nucleotide sequence of SEQ ID NO: 1. The aptamer may consist of the nucleotide sequence of SEQ ID NO: 1. The aptamer may further comprise a detectable labeling substance. The labeling substance may bind to the 3 'terminal or the 5' terminal of the aptamer. The labeling substance may be bound to a specific site of the aptamer.

The composition or kit can be used for rapid screening for the presence or absence of BDE-47 in a sample prior to detection using an instrument such as HPLC, LC / MS, or GC / MS or detection using an antibody. The composition or kit may further comprise a reaction buffer. The kit may further include instructions describing a method for detecting BDE-47 in a sample.

In the kit, the aptamer may be immobilized on a substrate. The term "substrate" refers to a solid support onto which the aptamer can be immobilized. The substrate may be a bead, a membrane, a microtiter plate, or a chip. The aptamer may be, for example, immobilized on a magnetic bead. In this case, the aptamer specifically bound to BDE-47 can be separated using magnets. The aptamer may be covalently coupled to the substrate directly or by a linker. The aptamer may further comprise a covalently associatable functional group. The functional group may be a carboxyl group, a hydroxyl group, or an amine group. The aptamer may be, for example, biotinylated. Biotinylated aptamers can be immobilized by streptavidin coated on a substrate.

Another aspect is a method of detecting a BDE-47 comprising contacting a sample with a nucleic acid aptamer that specifically binds BDE-47; And confirming whether or not the BDE-47 and the aptamer are bound to each other; and detecting BDE-47 in the sample.

Yet another aspect relates to a method for detecting BDE-47 comprising contacting a sample comprising BDE-47 with a nucleic acid aptamer that specifically binds to BDE-47 to form an Aptamer complex with BDE-47; And removing the complex. &Lt; Desc / Clms Page number 3 >

The term "sample" means a substance that is suspected of containing or containing BDE-47. The sample may be collected from at least one of food, drinking water, factory wastewater, livestock wastewater, domestic wastewater, waste, soil, air, precipitation, seawater, foodstuffs, tissues or cells of animals and plants, or liquids from animals and plants.

In this method, the aptamer may comprise a nucleotide sequence having 90% or more, 95% or more, 97% or more, or 98% or more identity with the nucleotide sequence of SEQ ID NO: 1. The aptamer may comprise the nucleotide sequence of SEQ ID NO: 1. The aptamer may consist of the nucleotide sequence of SEQ ID NO: 1. The aptamer may further comprise a detectable labeling substance. The labeling substance may bind to the 3 'terminal or the 5' terminal of the aptamer. The labeling substance may be bound to a specific site of the aptamer.

The contact between the sample and the aptamer can take place under suitable reaction conditions, such as the composition of the salt and the pH. Those skilled in the art can easily set such reaction conditions. A suitable pH may be, for example, 5 to 8.5, 6 to 8, or 7 to 8. The reaction temperature may be, for example, 15 to 50 占 폚, 20 to 45 占 폚, or 30 to 40 占 폚. The aptamer may be provided in the form of a composition or kit as described above. The aptamer may be immobilized on a substrate. The substrate may be a bead, a membrane, a microtiter plate, or a chip.

The combination of the BDE-47 and the aptamer can be confirmed through the sensor connected to the aptamer. Sensors known in the art can be used for this purpose. The coupling may be confirmed by measuring a signal generated by coupling. The signal may be an optical signal, an electrochemical signal, a signal by an enzyme, or a combination thereof. The binding can be confirmed, for example, by detecting a change in an optical signal or a change in an electrochemical signal caused by a structural change of an aptamer combined with BDE-47. Alternatively, it can be confirmed whether or not the aptamers are bonded by measuring the difference in cohesive or repulsive force between the fixed support and the BDE-47. Samples in which the presence of BDE-47 has been confirmed by the above method can be further analyzed through analytical methods known in the art.

The removal of the complex can be carried out by a separation method using magnetism, filtration, a method using carrier adsorption, a centrifugation method, or a combination thereof.

According to one embodiment, the presence and / or concentration of BDE-47 in a sample can be quickly identified and isolated by using a nucleic acid aptamer that specifically binds to BDE-47.

1 is a schematic diagram of a magnetic bead-SELEX method for screening a DNA aptamer capable of selectively binding to BDE-47.
FIG. 2 is a graph of percentage recovery (%) of ssDNA binding to BDE-47 among the ssDNA libraries used in each selection round.
3 is a schematic diagram of a secondary structure for an aptamer selectively binding to BDE-47 predicted using an mfold program.
FIG. 4 is a graph showing the results of analysis of binding force with BDE-47 for aptamers selectively binding to BDE-47. FIG.
FIG. 5 is a graph showing the results of specificity analysis on aptamers selectively binding to BDE-47. FIG.

Hereinafter, the present invention will be described in more detail with reference to Examples. These embodiments are only for illustrating the present invention, and the scope of the present invention is not construed as being limited to these embodiments.

Example One : BDE Lt; RTI ID = 0.0 > DNA Aptamer Produce

1.1 BDE -47 and Of a magnetic bead Combination

A magnetic bead solution was prepared by washing the equivalent of 1 mg of magnetic beads (-COOH magnetic bead, Invitrogen) with carboxyl groups immobilized three times with dimethylformamide (DMF) and then suspended in 1 mL of DMF. A hydroxy (-OH) OH-BDE-47 having a functional group (Wellington Laboratories) to binding buffer (100 mM NaCl, 20 mM Tris -HCl, 2 mM MgCl 2, 5 mM KCl, 1 mM CaCl 2, pH 7.6) The solution was dissolved and OH-BDE-47 solution was prepared by adding an excess of dicyclohexylcarbodiimide (DCC). The OH-BDE-47 solution was mixed with the magnetic bead solution and reacted at 38 ° C for 24 hours. A 50 mM ethanolamine solution was added to the reaction solution and incubated at room temperature for 45 minutes to quench the -COOH functional group which did not react with OH-BDE-47. Thereafter, the reaction solution was rinsed 3 times with washing buffer (10 mM Tris-HCl, 1 mM EDTA, 2 M NaCl, pH 7.5) and dissolved in DMF to obtain a magnetic bead solution to which OH-BDE-47 was bound. The binding of OH-BDE-47 to magnetic beads was confirmed by ATR-FT-IR (attenuated total reflectance-IR absorption spectroscopy).

Further, a magnetic bead solution to which ethanolamine was bonded was prepared. Except that the magnetic bead solution was reacted only with ethanolamine. This solution was used as a counter selection control sample to exclude binding to OH-BDE-47 and the possibility of binding to the magnetic beads themselves in the SELEX process.

1.2 ssDNA Library synthesis

For selective aptamer screening of BDE-47, ssDNA libraries composed of single stranded DNA oligonucleotides were synthesized as follows. The synthesized ssDNA library is a total 83-mer-length random ssDNA library having a fixed base sequence region (underlined portion) annealed at both ends with a primer pair annealed and a nucleotide sequence region (N ₄₀ ) randomly arranged at the center. Herein, N ₄₀ is generally made up of 40 arbitrary A, G, T, and C bases, but the number of bases is not necessarily limited to 40. Any number of bases in 40 can be added or omitted by repeated PCR and cloning procedures of the SELEX procedure, thereby altering the overall length of the ssDNA library.

_{5'- GCAATGGTACGGTACTTCC -N 40 - CAAAAGTGCACGCTACTTTGCTAA -3 '} ( SEQ ID NO: 2)

The synthesized ssDNA library was dissolved in binding buffer (100 mM NaCl, 20 mM Tris-HCl, 2 mM MgCl ₂ , 5 mM KCl, 1 mM CaCl ₂ , pH 7.6), heated at 90 ° C for 10 minutes, Lt; 0 > C for 15 minutes to prepare an ssDNA library solution.

1.3 Magnetic Bead - SELEX process

1) SELEX screening and ssDNA screening

The ssDNA library solution was incubated at room temperature for 5 minutes, mixed with the magnetic bead solution with ethanolamine prepared in 1.1, and reacted at room temperature for 30 minutes. The ssDNA library, which was non-selectively bound to magnetic beads bound with ethanolamine, was separated using a magnetic stand, and the supernatant remaining was taken. This supernatant and a magnetic bead solution containing OH-BDE-47 prepared in 1.1 were reacted at 35 ° C for 1 hour and 30 minutes. OH-BDE-47 bound to magnetic beads and unreacted ssDNA were removed using a magnetic stand. The remaining reaction solution was rinsed three times with wash buffer (10 mM Tris-HCl, 1 mM EDTA, 2 M NaCl, pH 7.5) to mix OH-BDE-47-bound magnetic beads and ssDNA- mM Tris-HCl, 10 mM EDTA, 3.5 M urea, 0.02% Tween 20, pH 8.0). The suspension was incubated at 80 DEG C for 8 minutes to elute the bound ssDNA from the magnetic beads. The eluted ssDNA was separated from the magnetic beads using a magnetic stand. The same elution procedure was repeated four times to recover the remaining ssDNA to a maximum extent.

2) PCR amplification and purification

The amount of recovered ssDNA was amplified by PCR reaction. And purified using a MinElute PCR Purification kit (QIAGEN). Two primers for PCR are as follows. The 5 'end of the forward primer (5'-GCAATGGTACGGTACTTCC-3': SEQ ID NO: 3) was used without terminal modification and the 5 'end was labeled with biotin in the case of the reverse primer (5'-biotin-TTAGCAAAGTAGCGTGCACTTTTG- To separate double stranded PCR products into single stranded DNA. 20 μl of ssDNA of about 100 ng and 2.5 μl of 10 μM of primer were mixed with 25 μl of a PCR master mix and the PCR reaction was performed at 95 ° C. for 30 seconds, 56.3 ° C. for 30 seconds, 10 sec). The number of repetitions was 10. The PCR products were analyzed by electrophoresis on 2% agarose gel. The PCR product was purified using a PCR product kit (MinElute PCR Purification kit, QIAGEN).

Then, a desired single strand of the double-stranded PCR product was isolated using a magnetic bead (Dynabeads MyOne ^™ Streptavidin, Invitrogen) in which streptavidin was immobilized on the surface. 50 [mu] l of the PCR product was mixed with 950 [mu] l of streptavidin-coated magnetic beads, incubated at room temperature for 10 minutes, and washed with 0.5 ml of PBS buffer using a magnetic stand. 500 [mu] l of 200 mM caustic soda (NaOH) was added thereto, followed by incubation at room temperature for 10 minutes. The magnetic ssDNA was recovered using a stand. The recovered ssDNA was purified / concentrated using an Amicon filter (Ultra-0.5, Millipore) kit and analyzed for its concentration. Purified / concentrated ssDNA was used for the next round of screening. After a total of 10 rounds of selection, final ssDNA was obtained. As a result, it was confirmed that 99.8% of ssDNA mixed with OH-BDE-47 was bound to OH-BDE-47.

3) Reverse selection in the SELEX process

In addition to the above-described reverse sorting procedure using magnetic beads with ethanolamine bonding, a reverse sorting procedure was further performed to enhance the selectivity of the selected ssDNA to OH-BDE-47. After the 4th selection process in the SELEX process, tetrabromobisphenol A (TBBPA) and hexabromocyclododecane (HBCDD), two brominated flame retardants commonly found in the environment, such as PBDE as the target substance, The reverse sorting was carried out three times in total. In the reverse sorting procedure, the experimental method and conditions were the same as the sorting procedure, except that the ssDNA binding to the reverse sorting substance was discarded and the ssDNAs not binding thereto were recovered and amplified and used for the next step of selection.

1.4 ssDNA of Cloning

Finally, the obtained ssDNA was PCR and cloned by a cloning kit (TOPO TA cloning kit). The plasmid was extracted from each colony and its nucleotide sequence was analyzed to obtain 25 different nucleotide sequence information. Sequence alignments were analyzed for the obtained sequences and analyzed using the mfold program (http://mfold.rna.albany.edu/?q=mfold; Zuker, M. Nucleic Acids Res. 2003, 31, 3406) The car structure was predicted. Based on the results, one representative ssDNA was selected. Table 1 below shows the nucleotide sequence of the selected ssDNA. This ssDNA was named Chem1. The bolded part is the base sequence obtained by the SELEX method in the random library, and the remaining part is the positive and reverse primer regions.

designation The nucleotide sequence (SEQ ID NO: 1) Chem1 5'-GCA ATG GTA CGG TAC TTC C AT TGC ACG TCT CCG CCG CTT GGG TGG AGA GGC TAT TCG GC C AAA AGT GCA CGC TAC TTT GCT AA- 3 '

Example 2: BDE For -47 Of app tamer Bonding force and selectivity analysis

The binding force and selectivity of BDE-47 of aptamer Chem1 were analyzed as follows.

2.1. BDE Analysis of bond strength to -47

The BDE-47 binding buffer (100 mM NaCl, 20 mM Tris -HCl, 2 mM MgCl 2, 5 mM KCl, 1 mM CaCl 2, pH 7.6) suspension and the various concentrations of fluorescently labeled ssDNA (0, 0.25, 0.5 to , 2.5, 5, 25, 50, and 100 nM), and then reacted under the same binding conditions as used in SELEX (1 hour and 30 minutes at 35 ° C). After the reaction, ssDNA not bound to the target was washed and washed 5 times using washing buffer (10 mM Tris-HCl, 1 mM EDTA, 2 M NaCl, pH 7.5), and then analyzed with a fluorescence analyzer using BDE-47 / ssDNA The fluorescence intensity of the complex was measured.

The fluorescence intensity of the complex according to the concentration of ssDNA was plotted using the SigmaPlot program by nonlinear regression and single site saturated ligand binding method. The formula F = _Bmax * C / (Kd + C) was used. In the equation, F is the fluorescence intensity, _Bmax is the maximum binding site, Kd is the dissociation constant, and C is the concentration of ssDNA. The affinity analysis results for Chem1 ssDNA are shown in FIG. The dissociation constant (Kd), which indicates the binding of Chem1 to BDE-47, is 1.532 nM.

2.2 BDE Selectivity analysis for -47

(FDE-BDE-47) (Accustandard, New Haven, CT, USA) in which fluorine was substituted for BDE-47, polybrominated diphenyl isomer (BDE-99) Selectivity analysis was performed by competitive assay using two brominated flame retardants (TBBPA and HBCDD) and bisphenol A (BPA) as comparative substances. This relative comparison method is based on the principle that, when the comparative substance and the aptamer are first bound, the aptamer can not additionally bind to the magnetic beads combined with OH-BDE-47, or the intensity decreases even if they are partially bonded. 100 ng of each comparative substance was mixed with magnetic beads combined with OH-BDE-47, reacted first at room temperature for 1 hour, and then subjected to one-pot reaction to obtain a polybrominated diphenyl ether / The fluorescence intensity of the aptamer complex was measured.

FIG. 5 is a graph showing the results of specificity analysis on aptamers selectively binding to BDE-47. FIG. In the case of the control, the fluorescence signal was measured from the magnetic beads after reacting the aptamer with the magnetic beads in which the OH-BDE-47 was immobilized in the solution not containing the comparative substance. In the case of OH-BDE-47 and BDE-47, a magnetic bead combined with an aptamer and OH-BDE-47 was reacted in a solution in which OH-BDE-47 and BDE-47 were free, respectively Fluorescence signals were measured from magnetic beads. BDE-47, F-BDE-47, BPA, TBBPA, and r-HBCDD were also found in free solutions of each analogous substance in a free state. 47 were reacted with the magnetic beads, and the fluorescence signals were measured from the magnetic beads. The intensity of the measured fluorescence signal was shown as a relative value to the control group.

As shown in FIG. 5, OH-BDE-47 and BDE-47 showed lower fluorescence intensity than the control group. This is the result of a decrease in the amount of aptamer binding OH-BDE-47 on the magnetic bead surface due to the competitive binding of aptamers to OH-BDE-47 or BDE-47 present in free form in solution. In the case of other similar substances, the fluorescence intensity is higher than that of the control group by 50% or more, and it is interpreted that most of the aptamer is mainly bound to the BDE-47 on the surface of the magnetic beads rather than to the similar substance existing in the free state.

Thus, the results in Figure 5 indicate that aptamer Chem1 has selectivity for BDE-47.

<110> Korea Institute of Science and Technology <120> A nucleic acid aptamer specifically binding to BDE-47 and the use the <130> PN111221 <160> 4 <170> Kopatentin 2.0 <210> 1 <211> 83 <212> DNA <213> Artificial Sequence <220> <223> Chem1 <400> 1 gcaatggtac ggtacttcca ttgcacgtct ccgccgcttg ggtggagagg ctattcggcc 60 aaaagtgcac gctactttgc taa 83 <210> 2 <211> 83 <212> DNA <213> Artificial Sequence <220> <223> ssDNA library <400> 2 gcaatggtac ggtacttccn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnc 60 aaaagtgcac gctactttgc taa 83 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 3 gcaatggtac ggtacttcc 19 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 4 ttagcaaagt agcgtgcact tttg 24

Claims

Aptamer which is a nucleic acid aptamer that specifically binds to 2,2 ', 4,4'-tetrabromodiphenyl ether (BDE-47), wherein the aptamer is composed of the nucleotide sequence of SEQ ID NO: 1.

delete

The aptamer of claim 1, wherein the aptamer further comprises a detectable labeling substance.

A composition for detecting BDE-47, comprising an aptamer according to any one of claims 1 and 4.

A kit for detecting BDE-47, comprising an aptamer according to any one of claims 1 and 4.

7. The kit of claim 6, wherein the aptamer is immobilized on a substrate.

8. The kit of claim 7, wherein the substrate is a bead, a membrane, a microtiter plate, or a chip.

Contacting the sample with an app tamer of any one of claims 1 and 4; And
A method for detecting BDE-47 in a sample, comprising the step of: determining whether BDE-47 and said aptamer are combined.

Contacting an Aptamer of any one of claims 1 and 4 with a sample comprising BDE-47 to form an Aptamer complex with BDE-47; And
And removing said complex. &Lt; Desc / Clms Page number 24 >