KR101822881B1 - Aptamer specifically binding to nonylphenol and detecting method using thereof - Google Patents

Abstract

The present invention relates to a nucleic acid pyramer specific to nonylphenol and a method for detecting and / or eliminating nonylphenol using the same. The nucleic acid abdomen capable of specifically binding to the nonylphenol according to the present invention can detect a small amount of nonylphenol, and the detection method of the target substance and the detection kit can be used directly and easily.

Description

[0001] The present invention relates to an abatumer specifically binding to nonylphenol, and a method for detecting nonylphenol using the same.

The present invention relates to an elliptylphenol-specific tyramine and a method for detecting nonylphenol using the same. Specifically, the present invention relates to a method for detecting nonylphenol such as nonylphenol by specifically detecting an environmental hormone And to a non-phenol detection method using the same.

Endocrine disruptors among environmentally harmful substances are known as major reproductive toxicants. Endocrine disruptors are exogenous compounds that act like endocrine hormones in humans and animals. They are thought to interfere with the normal function of the endocrine system, resulting in degradation of ecosystems and human reproductive function, malformations, growth disorders, and cancer.

Most of them known as environmentally harmful substances are industrial harmful substances. Unlike biohormones, they are not easily decomposed and remain stable in the environment or in the living body for a long time.

Among these harmful substances, nonylphenol is used as a surfactant for household cleaners, fabric softeners, paint additives, ink binders and the like, and some kinds of nonylphenols are classified as prohibited substances. Such nonylphenol accumulates in the human body, thereby inhibiting the activity of androgen and consequently lowering male reproductive function, and it is known to act on some cells to cause apoptosis.

Nonylphenol is produced by the decomposition of nonylphenol ethoxylates (NPEs). NPEs can be used as oil-soluble surfactants and emulsifiers (especially for the production of anionic surfactants), lubricants, antistatic agents, high performance fiber-scouring agents, emulsifiers for pesticides, antioxidants .

Due to its high hydrophobicity, low solubility and accumulation in the environment, nonylphenol is widely detected in steel, water, soil, groundwater, sediments, atmospheric, sewage sludge and even drinking water. In particular, interest in alkylphenols found in drinking water and sewage is increasing (Blair et al., 2000). They have been shown to have estrogenic activity in vivo and in vitro with phenol ring (a structural feature commonly found in natural estrogens) (Matthews et al. (2000)).

Many attempts have been made to detect nonylphenol due to the risk of nonylphenol. In particular, most of the existing analysis methods use bulky and complex analysis equipment. Fogarty et al., 2000) and capillary electrophoresis (CE) (Regan et al., 2002, 2003) were used for the analysis of gas chromatography-mass spectrometry (GC-MS) (Markham et al., 1998; Gonzalez- the main analytical tools used for the separation and measurement of these. Many methods have been developed to overcome this detection method. For example, a method using a poly-film senses bisphenol by an electrochemical method, but it does not specifically detect bisphenol but uses a potential difference to recognize a common benzene ring (Biosensors and Bioelectronics 20 (2004) 367-377 )to be. Sensors and Actuators B (ChemicalVolume 152, Issue 2, 1 March 2011, Pages 292-298) have been developed to detect metal surfaces with imprinting method.

(Chemosphere 2004 Nov; 57 (8): 975-85). However, this method is not suitable for use in general environmental samples because the stability of the antibody is difficult to use in general environmental samples Because of this, it was possible to obtain the results only under highly controlled experimental conditions such as Biacore, rather than simple sensors. Therefore, in order to detect, remove, and use nonylphenol under general environmental conditions in general, a method of specifically recognizing nonylphenol should be developed.

In addition, it is not easy to remove nonylphenol contained in such water by a general physicochemical purification method. To remove the nonylphenol, a method using porous elastic material or nanofilter technology has been developed. However, effective removal technology has been developed yet There is a need for new technology development.

In particular, detection methods using simple devices (electrochemical, optical, etc.) are important to be used for field detection while sensitive and specific detection of nonylphenol in the environment. A large number of bioprobes are used to detect small molecules such as nonylphenol. The types of bio-probes include antibodies, peptides, and plasters.

The name Aptamer is derived from the Latin word "aptus", which means "fit". It is a single molecule that binds to a variety of target substances, from small molecules to proteins and antibodies, with high affinity and specificity. Stranded nucleic acid fragment. (Ellington, A.D. and Szostak, J.W., Nature 346 (6287), 818-822)

In particular, aptamer, unlike antibody, can be used as a target molecule for various organic and inorganic substances including toxins, and can be chemically synthesized. Through in vitro synthesis, it is possible to mass-reproduce at a low cost and can be thermally stable, Lt; RTI ID = 0.0 > in vivo < / RTI > (6), 680, 2008). The advantages and structural characteristics of such aptamer are not only the development of various biosensors for biomedical devices, but also their use as biomarkers for cancer cells in combination with biomolecules (Pooja Dua, et al. Cancer Res March 15, 2013 73: 1934-1945). (Que-Gewirth, N. S. and Sullenger, B. A. Gene Ther 14 (4), 283-291)

Screening of platemers is done through an in vitro SELEX process. This process is called SELEX and the patent expired at the end of 2010. The DNA of the target ligand is amplified by amplifying the nucleic acid having high binding ability to the target ligand among the nucleic acid libraries having random sequences ranging from 1014 to 1015. In the traditional SELEX method, the prepared library is flowed to a target substance immobilized on a bead or resin to remove nucleic acids that are not bound to the ligand, and then the electrometer candidate combined with the ligand is washed with a buffer, After obtaining a high affinity tympanic membrane through selection - amplification, the affatamer affinity is measured and its sequence is confirmed by sequencing. (Marshall, K.A. and Ellington, A.D. Methods Enzymol 318, 193-214, Fitzwater, T. and Polisky, B. Methods Enzymol 267, 275-301)

SELFEX technology has been developed by a team of researchers.

Recently, the development of convergence technology that combines nanoflow technology such as microfluidic technology and Lab-on-a-chip has made it possible to reduce manufacturing time and material cost, thus making it easy to apply pharmaceuticals and medical applications. (Hybarger, G. et al., Anal Bioanal Chem 384 (1), 191-198)

In particular, Prof. Kim So-yeon of Dongguk University developed a lab-on-a-chip method that utilizes a substance called solgel to immobilize the target ligand without chemical modification and utilizes fluid mechanics technology capable of multiplex selection We have uniquely identified aptamers in a simpler way than previously. (Park, S. M. et al., Lab Chip 9 (9), 1206-1212)

Accordingly, an object of the present invention is to provide a platemer specifically binding to nonylphenol, which is a kind of endocrine disruptor, and a method for effectively detecting nonylphenol contained in water such as drinking water using the platemer, To provide a method to do so.

In order to solve the above problems, the present invention provides a DNA strand that specifically binds to nonylphenol, a group consisting of SEQ ID NOS: 1 to 40, And a sequence having at least 80% sequence homology in the 19th to 28th sequences in the 5 'to 3' direction of any one of the selected sequences in the above group. To provide phenol-specific nucleic acid plasmids.

In another embodiment of the present invention, the 19th to 28th sequences may have a consensus sequence.

Sequence homology is the same if two or more sequences have the same length and the same nucleotide or amino acid sequence. % Identity generally refers to the same degree of two sequences, in other words, the percent identity refers to the percentage of nucleotides that match the same nucleotides of the reference sequence, usually the sequence position of the nucleotide. In order to measure the degree of identity, the sequences to be compared are considered to be identical in length (i.e., the longest sequence of the sequences to be compared).

The sequences of the nucleic acid plasmids of the present invention may share a common base sequence.

In the present invention, the nucleic acid sequence represented by SEQ ID NO: 1 to SEQ ID NO: 11 of the Conventional Sequencing Group is characterized by having the following sequence.

SEQ ID NO: 1: 5'-ATACCAGCTTATTCAATTATACTGTGCAAAGGTACGGGCGGAGGGTGGGTTTGCACAAGATAGTAAGTGCAATCT-3 '

SEQ ID NO: 2: ATACCAGCTTATTCAATTGGGAGGAGGGGGATCAATAAGGGGGAGGCAGGGGGAACCAAGATAGTAAGTGCAATCT

SEQ ID NO: 3: ATACCAGCTTATTCAATTACCAAGGGGGACGGAGGGGGAATAACTAGGGGGAGGAGGGAGATAGTAAGTGCAATCT

SEQ ID NO: 4: ATACCAGCTTATTCAATTGCATTGGGGGTGGGTTTTACTGAGGTCGGGTGGGGGAGGGATATAGTAAGTGCAATCT

SEQ ID NO: 5: ATACCAGCTTATTCAATTCGTCGGGGAGTGGAGGGCGGGGGTAAGAGGGGGACGGCAAAGATAGTAAGTGCAATCT

SEQ ID NO: 6: ATACCAGCTTATTCAATTGTACCGGGAGGCGGCGGGGCGGAGGGAGTGAGAGGGGGCGAGATAGTAAGTGCAATCT

SEQ ID NO: 7: ATACCAGCTTATTCAATTGCATTGGGGGTGGGTTTTACTGAGGTCGGGTGGGGGAGGGAGATAGTAAGTGCAATCT

SEQ ID NO: 8: ATACCAGCTTATTCAATTGGGAGGGGGTGGGCTGGAGTCATTTTGGGTGGGGGTTACGAGATAGTAAGTGCAATC

SEQ ID NO: 9 (NP10R-13)

ATACCAGCTTATTCAATTACACGTTTGGGTGGGAGGGCGGGCATGGAAACGTGTCATAAGATAGTAAGTGCAATCT

SEQ ID NO: 10 (NP10R-16)

ATACCAGCTTATTCAATTCCACGTTTGGGTGGGAGGGCGGGCATGGAAACGTGTCATAAGATAGTAAGTGCAATCT

SEQ ID NO: 11 (NP10R-42)

ATACCAGCTTATTCAATTACACGTTCGGGTGGGAGGGCGGGCATGGAGACGTGTCATAAGATAGTAAGTGCAATCT

NGD Group I, II & III is characterized by having the following nucleic acid sequence represented by SEQ ID NO: 12 to SEQ ID NO: 40.

SEQ ID NOS: 12-40

SEQ ID NO: 12 (NP-21-4)

ATACCAGCTTATTCAATTATACTGTGCAAAGGTACGGGCGGGAGGGTGGGTTTGCACAAGATAGTAAGTGCAATCT

SEQ ID NO: 13 (NP-11-9)

ATACCAGCTTATTCAATTGGGAGGGGGTGGGCTGGAGTCATTTTGGGTGGGGGTTACGAGATAGTAAGTGCAATCT

SEQ ID NO: 14 (NP-6-2)

ATACCAGCTTATTCAATTGGGAGGAGGGGGATCAATAAGGGGGAGGCAGGGGGAACCAAGATAGTAAGTGCAATCT

SEQ ID NO: 15 (NP-5-1)

ATACCAGCTTATTCAATTACCAAGGGGGACGGAGGGGGAATAACTAGGGGGAGGAGGGAGATAGTAAGTGCAATCT

SEQ ID NO: 16 (NP-7-5)

ATACCAGCTTATTCAATTAACGGCAGGGGGAGAATGGGGGCGGGAGGTGAGGGGCTGCAGATAGTAAGTGCAATCT

SEQ ID NO: 17 (NP-10-6)

ATACCAGCTTATTCAATTCGTCGGGGAGTGGAGGGCGGGGGTAAGAGGGGGACGGCAAAGATAGTAAGTGCAATCT

SEQ ID NO: 18 (NP-36-11)

ATACCAGCTTATTCAATTGTACCGGGAGGCGGCGGGGCGGAGGGAGTGAGAGGGGGCGAGATAGTAAGTGCAATCT

SEQ ID NO: 19 (NP-16-10)

ATACCAGCTTATTCAATTGCATTGGGGGTGGGTTTTACTGAGGTCGGGTGGGGGAGGGAGATAGTAAGTGCAATCT

SEQ ID NO: 20 (NP-50-18)

ATACCAGCTTATTCAATTGCGGGGGAGAGTGAGGGAGGCGGGGCGGCGGAGGGCCATGAGATAGTAAGTGCAATCT

SEQ ID NO: 21 (NP-18-3)

ATACCAGCTTATTCAATTACACGTTTGGGTGGGAGGGCGGGCATGGAAACGTGTCATAAGATAGTAAGTGCAATCT

SEQ ID NO: 22 (NP-42-37)

ATACCAGCTTATTCAATTTGTTTGACTGGGGGTTATGGGGAGGGCGTTACCGGGGGAGAGATAGTAAGTGCAATCT

SEQ ID NO: 23 (NP-44-38)

ATACCAGCTTATTCAATTCGAGGGGGCCATTGCGGGAGGGGTATTGGGGGTCAGTTTGAGATAGTAAGTGCAATCT

SEQ ID NO: 24 (NP-38-39)

ATACCAGCTTATTCAATTGGGGGTACCAGGGGTGGAGGAGGGGAGGTAGACGGGGCCAAGATAGTAAGTGCAATCT

SEQ ID NO: 25 (NP-43-41)

ATACCAGCTTATTCAATTGGGGGAACCAGGGGTGGAGGAGGGGAGGTGGACGGGGCCAAGATAGTAAGTGCAATCT

SEQ ID NO: 26 (NP-40-40)

ATACCAGCTTATTCAATTACCGGGGCAGATGGAGGGGAGGAGGTGGGGACCATGGGGGAGATAGTAAGTGCAATCT

SEQ ID NO: 27 (NP-1-7)

ATACCAGCTTATTCAATTGGGGGAACCAGGGGTGGAGGAGGGGAGGTAGACGGGGCCAAGATAGTAAGTGCAATCT

SEQ ID NO: 28 (NP-28-30)

ATACCAGCTTATTCAATTGCCGGGGGAGAACCGAGGGGGAATGCTTAGCGGGCGGGGGAGATAGTAAGTGCAATCT

SEQ ID NO: 29 (NP-2-8)

ATACCAGCTTATTCAATTACCGGGGCAGATGGAGGGGAGGAGGTGGGGACCAAGGGGGAGATAGTAAGTGCAATCT

SEQ ID NO: 30 (NP-24-25)

ATACCAGCTTATTCAATTGGGGGCGGGCGATTCGTAAGGGGGAGCCAAGAGGGGGCCGAGATAGTAAGTGCAATCT

SEQ ID NO: 31 (NP-14-13)

ATACCAGCTTATTCAATTGTATCGTTGTATATGCAGGGAATCTCACTTGTACAGGGCCAGATAGTAAGTGCAATCT

SEQ ID NO: 32 (NP-13-14)

ATACCAGCTTATTCAATTCCGGGACATGTTCACTCTAAGGGACGTATATGTTGCTATGAGATAGTAAGTGCAATCT

SEQ ID NO: 33 (NP-15-20)

ATACCAGCTTATTCAATTCGGGGGAGAGCATACGGTGGGGCTCAAAGGAGGGGTGGGAAGATAGTAAGTGCAATCT

SEQ ID NO: 34 (NP-12-17)

ATACCAGCTTATTCAATTGGGTGGGGAGGAAACTCGGGGTGGCATACGAGAGGGGGCTAGATAGTAAGTGCAATCT

SEQ ID NO: 35 (NP-17-33)

ATACCAGCTTATTCAATTTCGGGGCGGGGGTGGCTTAGGTGACGGGACGGGGAGGCCAAGATAGTAAGTGCAATCT

SEQ ID NO: 36 (NP-20-48)

ATACCAGCTTATTCAATTACCGGAGGGGCAGGGCAGTGGATTCGGTGGGGGCGGGGCTAGATAGTAAGTGCAATCT

SEQ ID NO: 37 (NP-3-15)

ATACCAGCTTATTCAATTGGCCAGCGGGGGTAGGACGGGATGGTGGGGGAGGGTCGGGAGATAGTAAGTGCAATCT

SEQ ID NO: 38 (NP-9-31)

ATACCAGCTTATTCAATTCGGGAGGGGAGGATCACCTGGGGTTGCTGGTGTGGGGTGAGATAGTAAGTGCAATCT

SEQ ID NO: 39 (NP-4-19)

ATACCAGCTTATTCAATTGGGCTGGGAGGGGGTGGTAGGGCAGGATGGGGGCGACCGGAGATAGTAAGTGCAATCT

SEQ ID NO: 40 (NP-8-28)

ATACCAGCTTATTCAATTGTGGGGTGTGGTCGTTGGGGTCCACTAGGAGGGGGAGGGCAGATAGTAAGTGCAATCT

The inventors of the present invention have found that the use of DNA tympanone that specifically binds to nonylphenol can effectively detect and / or eliminate nonylphenol present in water.

The aptamer of the present invention means a small single-stranded oligonucleotide capable of specifically recognizing a target substance with high affinity.

The present invention also relates to a method for detecting nonylphenol using an electrometer selected from the group consisting of SEQ ID NOS: 1 to 40. The nonylphenol may be detected from a sample collected from at least one of water, soil, air, food, waste, animal or plant and animal or plant tissues, but is not limited thereto. At this time, the water includes precipitation, seawater, lake water and rainwater, and the waste includes sewage, wastewater and the like, and the plants and animals include the human body.

In another embodiment of the present invention, the nucleic acid plasmids represented by SEQ ID NOS: 1 to 40 are selected through a SELEX process and then subjected to RT-PCR and BLI (Biolayer Interferometry) The affinity was measured and it was confirmed that the nucleic acid sequences shown in SEQ ID NOS: 1 to 34 were specifically bound to nonylphenol.

The SELEX (Systematic Evolution of Ligand by Exponential Enrichment) is a method of selecting a nucleic acid binding to a specific target substance, and DNA or RNA having a high binding force to a specific target substance is selected from a set of arbitrarily synthesized nucleic acids (Louis et al., 1992. Nature 355, 564-566) by amplifying the nucleotide sequence of the molecule.

A process of selecting a new app tamer through SELEX according to an embodiment of the present invention will be described below.

(i) Using DNA synthesis, various types of nucleic acid libraries (> 1015) are made. (ii) only the nucleic acid constructs capable of binding nonylphenol among the various nucleic acid constructs (aptamer candidate molecules) in the nucleic acid construct library are selected as if the antibody binds to various kinds of antigens. (iii) Unbound nucleic acid constructs such as affinity chromatography can be selectively removed only by binding to nonylphenol. (iv) Finally, the nucleic acid construct is eluted from nonylphenol. After amplifying the nucleic acid, the nucleic acid construct obtained is repeated 5 to 15 times more to obtain nonylphenol Specific tumors can be uncovered.

The present invention provides a detection sensor for nonylphenol containing an abatumer that specifically binds to the nonylphenol.

According to one embodiment of the present invention, the aptamer of the present invention can be used as a sensor for increasing the specificity of nonylphenol detection using a binding-based assay as a marker of a biochip like an antibody.

The sensor used in the present invention is a sensor in which at least one aptamer according to an embodiment of the present invention selectively recognizes an analyte (in particular, nonylphenol) and generates a signal that the transducer can measure, , Optical, magnetic, piezoelectric, electronic, and the like, and can be included in the scope of the present invention if it is a recognizable method through the detection of the analyte.

An example of such a detection sensor is Camille L.A. Hamula; Jeffrey W. Guthrie; Hongquan Zhang; Xing-Fang Li; X. Chris Le, Selection and analytical applications of aptamers Trends in Analytical Chemistry 25 (2006) 681-91. , But are not limited thereto.

Any technology that can specifically detect nonylphenol using the platemer sequence of the present invention can utilize all the techniques, and is not particularly limited to the kind or characteristics of the sensor technology.

More specifically, for example, a sensor using an abutmenter may include a marking-type sensing system and a non-marking-type sensing system. In a sensor using a marking-type sensing pad, . Sensing systems with a labeling system can be measured with a variety of techniques, have high sensitivity (X. Chu et al., Anal. Chem., 2007, 79, 7492-7500) (XB Yin et al., Anal. Chem., 2009, 81, 9929-9305 and MC Rodrluezet al., Talanta, 2009, 78, 212-216).

A detection sensor system containing an abdominal that specifically binds to the nonylphenol may be provided in the form of a kit.

The kit may further comprise at least one selected from the group consisting of silica, semiconductor, plastic, gold, silver, magnetic molecules, nylon, poly (dimethylsiloxane) PDMS), cellulose or nitrocellulose, and may preferably be immobilized on a support such as a glass slide. There is no particular restriction on the shape of the support, but may be in the form of a thin plate that can be held by hand, such as, for example, a glass slide, or in the form of a bead that is less than 0.1 mm in size, . The surface of the support may be functionalized with functional groups such as an aldehyde group, a carboxyl group, an epoxy group, an isothiocyanate group, an N-hydroxysuccinimidyl group, and an activated ester group, particularly an epoxy group. However, after the probe is fixed, it can be stabilized through a process of blocking the residual functional group to reduce the background signal.

Nonylphenol detection kits may take the form of bottles, tubs, sachets, envelopes, tubes, ampoules, and the like, which may be partially or wholly made of plastic, glass, paper, foil, Wax, and the like. The container may be fitted with a cap which is initially part of the container or can be fully or partially detachable, which may be attached to the container by mechanical, adhesive, or other means. The kit may include an external package, and the external package may include instructions for use of the components.

The aptamer specifically binding to nonylphenol according to the present invention can also specifically detect only nonylphenol and can provide a composition for detecting or removing nonylphenol including the same.

Since the amount of nonylphenol remaining in the environment is often very small, there is a limit to the detection even when using a conventional physicochemical method such as a conventionally known method, or a method using a nano filter technology or the like. Therefore, the inventors of the present invention found that the sensitivity of detection of nonylphenol was determined by checking the degree of detection of nonylphenol contained in a sample using a detection kit fixed with a DNA aptamer having any one of the nucleotide sequences selected from the group consisting of SEQ ID NOS: 1 to 8 And it was confirmed that 0.3 mu M to 30 mu M nonylphenol contained in the sample could be detected.

It is expected that even a very small amount of nonylphenol has a high affinity and it is possible to detect a very small amount of nonylphenol present in the environment and it will be a breakthrough invention to identify and remove nonylphenol which was difficult to detect in the past.

In another aspect, the present invention relates to a method for removing nonylphenol using an abatumer that specifically binds to nonylphenol. According to an embodiment of the present invention, preferably, the aptamer can fill the column with fixed beads and pass nonylphenol-containing samples to remove nonylphenol.

The present invention provides a nucleic acid pyramer capable of specifically binding to nonylphenol, and a method for detecting and / or eliminating nonylphenol using the same. Nucleic acid < RTI ID = 0.0 > exonamycin < / RTI > capable of specifically binding to nonylphenol according to the present invention can also detect small amounts of nonylphenol present in the environment.

1 is a view showing a state in which nonylphenol is fixed to an epoxy activated beads.
FIG. 2 is a schematic diagram illustrating a process of selecting an extruder using SELEX. Nonylphenol is attached to Super Magnetic Bead (Dynabeads®M-270 Epoxy), and SELTEX is used to select the platamer that binds to the target.
FIG. 3 shows that SEQ ID Nos. 1 to 8 indicate the finding of eight dentical sequences and similar sequences through conventional Sanger sequencing after SELEX.
4 is a table showing the next generation sequence of the present invention.
5 is a diagram showing the secondary structure of eight plumbers among the selected plumbers. The primer regions are shown in green, and A to H are the numbers of Abtamer NP-21-4, NP-6-2, NP-5-1, NP-7-5, NP-10-6, , NP-16-10, and NP-11-9.
Figure 6 shows the binding affinities (KDs) of selected platamers measured by bio-layer interferometry (n = 3). The graph showed a circular shape (<10 μM) with a high affinity, a diamond shape (20-30 μM) with a medium affinity, and a hexagonal shape (> 30 μM) with a low affinity.
FIG. 7 is a graph and a graph showing the sol-gel sensing system of plumbers. FIG. (A) is a scanning image showing the results of Cy3-labeled aptamers combined with nonylphenol immobilized on a sol-gel chip. (B) shows the signal intensity.
9 is a standard curve for measuring the coupling efficiency of nonyl phenol and beads.
10 shows the plummet candidate group obtained from the 9th and 10th rounds.
Figure 11 shows the ssDNA urea PAGE separation procedure.
Fig. 12 shows the results of the S1 nuclease treatment, which is a method of confirming ssDNA.

Hereinafter, embodiments of the present invention will be described in detail to facilitate understanding of the present invention. However, the embodiments according to the present invention can be modified into various other forms, and the scope of the present invention should not be construed as being limited to the following embodiments. Embodiments of the invention are provided to more fully describe the present invention to those skilled in the art.

Example 1. Separation of platemers specifically binding to nonylphenol (NP)

1-1. Nonylphenol coupling

Nonylphenol was immobilized on beads by the following procedure in order to isolate the umbilical cord specifically binding to nonylphenol.

First, 10 mM nonylphenol was dissolved in 60% DMF (dimethylforamide). Separations of epoxy-activated beads (Dynabeads® M-270 Epoxy, 108) were used to fix nonylphenol to the hydroxy groups via ether linkages. Nonylphenol was coupled by reacting with the beads in a coupling buffer (60% DMF, pH 11.0) overnight at 37 ° C with rotation at 60 rpm for 16-25 hours. Figure 1 shows the immobilization of nonylphenol.

Table 1 below shows the standard for determining the coupling efficiency of nonylphenol and the composition of the concentration of the sample.

STOCK: 10 mM nonylphenol DMF PH = 10 (1000 [mu] L) standard solution testing volume: 1000 μL standard solution (μM) 1 mM 10 20 40 60 80 100 120 1 mM nonylphenol 60% DMF ([mu] L) 100 (10 mM) 10 20 40 60 80 100 120 60% DMF (μL) PH = 10 900 990 980 960 940 920 900 880 OD × 0.03675 0.05382 0.10823 0.15451 0.20343 0.25698 0.303351

Table 2 shows the results of measuring the coupling efficiency with the composition of Table 1, and the standard curve measuring the coupling efficiency is shown in FIG.

10 mM NP
60% DMF PH = 10 before coupling after coupling total volume (μL) 100 1000 sample (μL) 10 100 60% DMF (μL) PH = 10 990 900 OD 0.265759647 0.252392809 concentration (μM) 102.9038587 97.55712344 dilution factor 100 10 NP amount (μmol) 1.029038587 0.975571234 coupled NP amount
(μmol) 0.053467353 bead amount (mg) 10 ^ 8 1.5 active site amount
(μmol)
(0.1-0.2) mmol / g 0.15 0.3 coupling efficiency (%) 35.64490204 17.82245102

As shown in Table 2, the coupling efficiency of nonylphenol is 35.6%, which is relatively high.

1-2. Negative Bead preparation

Nonylphenol coated beads were extracted using a magnetic concentrator and suspended by mixing slowly with 1 M ethanolamine (PH = 8) and beads at 37 ° C for 6 hours. Blocked beads were washed 4 times with 0.1 M PBS buffer and beads were mixed with 0.1 M PBS buffer and stored at 4 ° C. The original beads contained in the DMF stock were transferred to a new E-tube and the tube was placed in the magnet for 4 minutes. The supernatant was removed and the beads were left. 1 M ethanolamine (PH = 8) and beads were slowly mixed for 6 hours at 37 ° C. The beads coated with ethanolamine were washed 4 times with 0.1 M PBS buffer, and the beads were suspended in 0.1 M PBS buffer .

Two non-immobilized beads and nonylphenol-immobilized beads were prepared and subjected to SELEX.

10 mM NP (60% DMF PH = 11) was prepared and immobilized on Epoxy activated beads by slowly tilt rotation (90 °, 60 rpm) at 37 ° C for 16-25 hours.

1-3. Preparation of ssDNA pool and selection of platemers specifically binding to nonylphenol

A random ssDNA library having the following sequence was chemically synthesized and separated into PAGE (Genotech Inc., Korea).

5'-ATACCAGCTTATTCAATT-N ₄₀ -AGATAGTAAGTGCAATCT-3 '

Asymmetric PCR method was performed for the preparation of ssDNA, and the concentration of ssDNA was measured using Quant-iT ™ Oligreen ssDNA reagent and kit (Invitrogen, USA). ssDNA was confirmed using Nuclease S1 (Sigma-Aldrich, USA). The initial pool contained 1015 molecules.

SELEX screening and amplification were performed 10 times.

In the last round, selected platamers were cloned and sequenced.

To remove non-specific ssDNA negative selection was performed from non-coupled non-phenol-coupled beads. Because nonylphenol uses beads immobilized thereon, ssDNA binding to beads, rather than nonylphenol, can be selected, so that negative selection is carried out to remove it.

In the negative selection method, ssDNA eluted and prepared in the previous step is inserted using beads in which NP is not immobilized, ssDNA not bound to beads is flow-through (effluent), and ethanol precipitation And the ssDNA was isolated from the solution.

These steps were generally performed once every 3 rounds, and 3 times, 6 rounds, and 9 rounds, respectively.

1-4. ssDNA production method

SsDNA extracted for each round was amplified by PCR and ssDNA for the next round was constructed.

In the case of the present invention, unnecessary double strand formation was prevented by using a method of improving the primer and PCR, followed by isolating the desired ssDNA through urea PAGE gel.

SsDNA was prepared by PCR conditions of Table 3 and PCR conditions of Table 4 below.

Template (elute) 2 μl 10 mM dNTP 18 μl 10μMprimer-PS4 10 μl 10μMprimer-R 10 μl 10X buffer 10 μl 5M betaine 20 μl Taq 2 μl DW 28 μl Total 100 μl

95 ℃ 95 ℃ 52 ℃ 72 ℃ 72 ℃ 5min 30sec 1 min 1 min 5min

3 and 4 show examples of the electrometer candidates selected through the conditions of Tables 3 and 4 above.

ssDNA was determined by urea PAGE gel separation method and the amount of ssDNA was determined by staining the ssDNA for the next round and measuring it by Oligreen. For quantitative measurement, standard and ssDNA samples were prepared and measured as follows.

Standard sample final oligo conc. (ng / ml) 0 200 400 800 1000 1/1000 1/500 oligo volume (ul)
Stock20ug / ml 0 0.5 One 2 2.5 0.5 One 1X TE buffer (ul) 25 24.5 24 23 22.5 24.5 24 2X oligreen (ul) 25 25 25 25 25 25 25

Table 5 lists the composition of the standard and sample for the oligreen® measurement.

In order to identify ssDNA, S1 nuclease, a nucleotide internal hydrolytic enzyme that specifically hydrolyzes DNA or RNA, was identified by agarose gel. Partial strands of double-stranded DNA or DNA-RNA hybrids, including fault-response, were also degraded to produce mononucleotides or oligonucleotides with 5'-phosphate.

The results of the S1 nuclease treatment, which is the method of confirming the ssDNA, are shown in Fig.

Example 2. Cloning of aptamer candidate group specifically binding to nonylphenol (NP)

The PCR product was purified using the Qiagen ™ PCR purification kit and ligation was performed at room temperature for 5 hours using the pGEM-T easy vector system.

The ligation composition used in the present invention is shown in Table 6 below.

T vector 0.5 μl 2X Lig buffer 5 μl Insert DNA 4 μl T4 DNA Ligase 0.5 μl Total 10 μl

DH5α competent cells were heat-schocked and spread widely on the plates, and colonies were selected and grown in liquid medium at 37 ° C for 7 hours. Purified using Qiagen &lt; (TM) &gt; plasmid kit and the concentration was confirmed by UV spectrophotometer. To confirm the result of the cloning, an EcoRI enzyme having the composition shown in Table 7 below was used to cut at 37 DEG C for one hour, and insertion was confirmed using an agarose gel.

DNA 5 μl 10X EcoRI buffer 1 μl Enzyme 0.5 μl DW 3.5 μl Total 10 μl

Example 3. &lt; RTI ID = 0.0 &gt;

3-1. Compression group analysis using Clustal W

The primary sequence of the aptamer group was analyzed using the Clustal W program, and through the use of the platamer group analysis using the M-fold program, it was found that among the platamer candidate groups shown in Table 2, The secondary structure was predicted by selecting 8 tumor sequences, which are shown in FIG. 3 and FIG.

3-2. Compression group analysis using M-fold program

We analyzed the secondary structure of the aptamer group using the M-fold program.

3-3 Compression method ID - Conventional sequencing and NGS

SEQ ID NOS: 1 to 8 were found to have 8 dentical sequences and similar sequences through conventional Sanger sequencing method after SELEX. 3.

After SELEX we got more enrichment information through next generation sequencing (NGS). (Data sorting through Clustal W grouping program) The most top enriched sequence of enrichment information was analyzed through mfold program.

TA cloning and high throughput sequencing (also referred to as next generation sequencing) were used to identify the sequences of the putamoder candidates. For TA cloning, the eluted extracellular pools were amplified, purified, cloned in pGEM-T easy vector system (Promega, USA) and sequenced (Solgent Inc. Korea). High throughput sequencing was performed using the Genome Analyzer IIx (Gendocs, Korea). The sequences analyzed by the high-speed sequencing method in the repeated rounds were compared with each other, and nucleic acid sequences whose relative ratios were increased with increasing repetition number were selected as the aspirator. The secondary structure of the selected platamer candidates was predicted by the mfold program (http://mfold.rit.albany.edu) by minimizing the free energy using an ion environment of 100 mM NaCl and 10 mM MgCl 2 at 25 ° C.

Example 4. Measurement of detection activity of nonylphenol

The affinity test was performed using the electrothermal sequence and secondary structure analysis.

4-1. Determination of binding affinity for nonylphenol by BLI measurement

Target molecule affinity testing can perform label-free kinetic analysis and quantitation for intermolecular binding analysis using BLI (Bio-Layer Interferometry) technology. In the case of BLI (Bio-Layer Interferometry), a change in the thickness of the sensor surface occurs when the bonding between materials occurs on the optical-layer of the sensor surface. This thickness change is indicated by the change in the wave pattern of white light reflected through the sensor surface. Measuring technology. Through this technique, the interaction of low molecular substances such as nonylphenol of the present invention can be measured.

4-2. Explanation of affinity measurement method by RT-PCR

RT-PCR was performed using three aptamer candidates (20 nM, 40 nM, 80 nM, 100 nM concentration, 5) and magnetic beads (two negative beads and NP coated beads) And the amount of eluted ssDNA was measured. The affinity (Kd value) was calculated from the ssDNA input amount and the eluted ssDNA% non-leaner equation.

4-3. Determination of dissociation constant (KD) for nonylphenol by equilibrium filtration

Octet Red 384 with super streptavidin biosensors was purchased from ForteBio (Pall Lifescience, USA) to measure dissociation constants. The biosensor was equilibrated for 20 minutes, supplied with 100 μg / ml of biotin-conjugated platamer for 30 minutes, washed with biocytin, and blocked. At a final concentration of 30 μM, the target chemistry was diluted to study the interaction with the biotin-conjugated plastomer. Pre-coated sensors at baseline (60 s), association (90 s), and dissociation (120 s) cycles at room temperature at 1000 rpm were rebalanced. References included biocytin-blocked sensor surfaces, and biotin-platemar coated sensors were monitored in the binding buffer via an essay. Sensorgrams were collected and data were analyzed using Fortebio Data Analysis 7.0 software using double reference. Values for the target (nm) were collected and separated by Sigma plot 10.0.

To calculate dissociation constants, the percentage of nonylphenol to ssDNA concentration bound in the following equilibrium form was plotted using Sigmaplot 10.0 software and the data points were fixed by nonlinear regression analysis.

Where y is the value measured by the Octet machine, R max represents the maximum chemical binding response, and KD represents the dissociation constant.

As a result of dissociation constants, Abtamer NP-6-2 (SEQ ID NO: 14) showed the strongest affinity.

The eight compressors shown in FIG. 4 were classified into three groups according to affinity.

NP-6-2 (SEQ ID NO: 14), NP-5-1 (SEQ ID NO: 15), and 10-6 (SEQ ID NO: 17); 4 μM, 1.3 μM, and 5.5 μM, respectively, ,

21- (SEQ ID NO: 12), 36-11 (SEQ ID NO: 18), and 11-9 (SEQ ID NO: 13); 27 μM, 21 μM, and 30 μM, respectively,

low affinity (NP-7-5 (SEQ ID NO: 16), 34 μM;

It is very unusual for the aptamers according to the present invention to exhibit an affinity of the μM level, considering that the affinity of antibodies to small molecules is generally very low when compared with the affinity of antibodies against macromolecules in general. That is, it was confirmed that the aptamer according to the present invention shows a very strong affinity for nonylphenol.

In the case of the above eight platemers, platelets are from SEQ ID NOS: 12 to 19. In the case of high specificity compressors, there is an advantage in that they can be used to make an abdominal pressure specially attached to nonylphenol. On the other hand, aptamers with a low specificity may be used for different purposes because of their ability to detect not only nonylphenol but also alkylphenols of similar structure, have. When detecting nonylphenol with high sensitivity and specificity, the specificity is low, but it can be used differently depending on the detection of various alkylphenols.

Example 5. Detection of nonylphenol using various biochips

5-1. Nonylphenol detection using 3-dimensional biochip

Way:

To carry out the aptamer-sol-gel biosensor system, nonylphenol was mixed with sol-gel and the mixture was dropped onto the porous silicon surface at various concentrations (nonylphenol 2, 10, 50 μM per spot). The chip was bridged with several blocking buffers (20 μg / ml tRNA, 2% BSA, 0.1% 3M ™ Novec ™ Fluorosurfactant in 1X binding buffer) for 1 hour. 100 pmol of Cy3 labeled aptamers (PCL Inc., Korea) in the binding buffer was applied to the chip and incubated for 4 hours. After three washing steps, the chip was dried in a dark room and scanned and analyzed with a fluorescence scanner and Multi-Image Analyzer (Fujifilm, Japan).

result:

Development of Sensor Formats for Alkylphenol Electrodes.

It can be used as an environmental monitoring analysis tool that requires fast, low cost and continuous detection. Previous methods can produce false positive / negative results because of the low sensitivity of detection. Subsequent methods require devices that require sample pretreatment (such as GC / MS or HPLC) and have difficulty in on-site detection. Sol-gel materials can be widely used to encapsulate various biological species such as enzymes, antibodies, and proteins with functional sites. Recently, a sol-gel method has been developed that is applied to entrapping small molecules. Based on the diversity of sol-gel derived methods, the possibility of applying a wide range of detection systems for a large number of water pollutants is expected.

5-2. Sensitive biochip measurement using PS-SG technology

A sol-gel chip array entrapping 2 to 50 μM of nonylphenol was prepared and tested for the amount of platemers bound by fluorescence in order to test the ability to detect waterborne sources using sol-gel chips. At a minimum concentration of 0.6 μM, a minimum concentration of labeled aptamers of greater than 50 μM could be detected, albeit in a small amount that could be detected using the label-free interferometry technique. Since nonylphenol is a chemical with very low solubility (6 ppm), organic solvents such as DMF should be used to dissolve in the sol-gel mixture, which forms a structure (sol-gel crack) for entrapping small molecules can not do it. However, methods for improving the sensitivity of sol-gel chip detection, such as using organic solvents or adding various fluorescent dyes to one pressurizer, or increasing the signal-to-noise ratio of scanners and image analyzers, Screening of appropriate formulations for entrapping non-water soluble chemicals into waterborne contaminant detection.

<110> Dongguk University Industry-Academic Cooperation Foundation <120> Aptamer specifically binds to nonylphenol and detecting method          using <130> MP16-410 <150> 10/2014/0038243 <151> 2014-03-31 <160> 40 <170> KoPatentin 3.0 <210> 1 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> nonylphenol binding aptamer 1 <400> 1 ataccagctt attcaattat actgtgcaaa ggtacgggcg ggagggtggg tttgcacaag 60 atagtaagtg caatct 76 <210> 2 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> nonylphenol binding aptamer 2 <400> 2 ataccagctt attcaattgg gaggaggggg atcaataagg gggaggcagg gggaaccaag 60 atagtaagtg caatct 76 <210> 3 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> nonylphenol binding aptamer 3 <400> 3 ataccagctt attcaattac caagggggac ggagggggaa taactagggg gaggagggag 60 atagtaagtg caatct 76 <210> 4 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> nonylphenol binding aptamer 4 <400> 4 ataccagctt attcaattgc attgggggtg ggttttactg aggtcgggtg ggggagggag 60 atagtaagtg caatct 76 <210> 5 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> nonylphenol binding aptamer 5 <400> 5 ataccagctt attcaattcg tcggggagtg gagggcgggg gtaagagggg gacggcaaag 60 atagtaagtg caatct 76 <210> 6 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> nonylphenol binding aptamer 6 <400> 6 ataccagctt attcaattgt accgggaggc ggcggggcgg agggagtgag agggggcgag 60 atagtaagtg caatct 76 <210> 7 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> nonylphenol binding aptamer 7 <400> 7 ataccagctt attcaattgc attgggggtg ggttttactg aggtcgggtg ggggagggag 60 atagtaagtg caatct 76 <210> 8 <211> 75 <212> DNA <213> Artificial Sequence <220> <223> nonylphenol binding aptamer 8 <400> 8 ataccagctt attcaattgg gagggggtgg gctggagtca ttttgggtgg gggttacgag 60 atagtaagtg caatc 75 <210> 9 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP10R-13 <400> 9 ataccagctt attcaattac acgtttgggt gggagggcgg gcatggaaac gtgtcataag 60 atagtaagtg caatct 76 <210> 10 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP10R-16 <400> 10 ataccagctt attcaattcc acgtttgggt gggagggcgg gcatggaaac gtgtcataag 60 atagtaagtg caatct 76 <210> 11 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP10R-42 <400> 11 ataccagctt attcaattac acgttcgggt gggagggcgg gcatggagac gtgtcataag 60 atagtaagtg caatct 76 <210> 12 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-21-4 <400> 12 ataccagctt attcaattat actgtgcaaa ggtacgggcg ggagggtggg tttgcacaag 60 atagtaagtg caatct 76 <210> 13 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-11-9 <400> 13 ataccagctt attcaattgg gagggggtgg gctggagtca ttttgggtgg gggttacgag 60 atagtaagtg caatct 76 <210> 14 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-6-2 <400> 14 ataccagctt attcaattgg gaggaggggg atcaataagg gggaggcagg gggaaccaag 60 atagtaagtg caatct 76 <210> 15 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-5-1 <400> 15 ataccagctt attcaattac caagggggac ggagggggaa taactagggg gaggagggag 60 atagtaagtg caatct 76 <210> 16 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-7-5 <400> 16 ataccagctt attcaattaa cggcaggggg agaatggggg cgggaggtga ggggctgcag 60 atagtaagtg caatct 76 <210> 17 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-10-6 <400> 17 ataccagctt attcaattcg tcggggagtg gagggcgggg gtaagagggg gacggcaaag 60 atagtaagtg caatct 76 <210> 18 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-36-11 <400> 18 ataccagctt attcaattgt accgggaggc ggcggggcgg agggagtgag agggggcgag 60 atagtaagtg caatct 76 <210> 19 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-16-10 <400> 19 ataccagctt attcaattgc attgggggtg ggttttactg aggtcgggtg ggggagggag 60 atagtaagtg caatct 76 <210> 20 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-50-18 <400> 20 ataccagctt attcaattgc gggggagagt gagggaggcg gggcggcgga gggccatgag 60 atagtaagtg caatct 76 <210> 21 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-18-3 <400> 21 ataccagctt attcaattac acgtttgggt gggagggcgg gcatggaaac gtgtcataag 60 atagtaagtg caatct 76 <210> 22 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-42-37 <400> 22 ataccagctt attcaatttg tttgactggg ggttatgggg agggcgttac cgggggagag 60 atagtaagtg caatct 76 <210> 23 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-44-38 <400> 23 ataccagctt attcaattcg agggggccat tgcgggaggg gtattggggg tcagtttgag 60 atagtaagtg caatct 76 <210> 24 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-38-39 <400> 24 ataccagctt attcaattgg gggtaccagg ggtggaggag gggaggtaga cggggccaag 60 atagtaagtg caatct 76 <210> 25 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-43-41 <400> 25 ataccagctt attcaattgg gggaaccagg ggtggaggag gggaggtgga cggggccaag 60 atagtaagtg caatct 76 <210> 26 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-40-40 <400> 26 ataccagctt attcaattac cggggcagat ggaggggagg aggtggggac catgggggag 60 atagtaagtg caatct 76 <210> 27 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-1-7 <400> 27 ataccagctt attcaattgg gggaaccagg ggtggaggag gggaggtaga cggggccaag 60 atagtaagtg caatct 76 <210> 28 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-28-30 <400> 28 ataccagctt attcaattgc cgggggagaa ccgaggggga atgcttagcg ggcgggggag 60 atagtaagtg caatct 76 <210> 29 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-2-8 <400> 29 ataccagctt attcaattac cggggcagat ggaggggagg aggtggggac caagggggag 60 atagtaagtg caatct 76 <210> 30 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-24-25 <400> 30 ataccagctt attcaattgg gggcgggcga ttcgtaaggg ggagccaaga gggggccgag 60 atagtaagtg caatct 76 <210> 31 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-14-13 <400> 31 ataccagctt attcaattgt atcgttgtat atgcagggaa tctcacttgt acagggccag 60 atagtaagtg caatct 76 <210> 32 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-13-14 <400> 32 ataccagctt attcaattcc gggacatgtt cactctaagg gacgtatatg ttgctatgag 60 atagtaagtg caatct 76 <210> 33 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-15-20 <400> 33 ataccagctt attcaattcg ggggagagca tacggtgggg ctcaaaggag gggtgggaag 60 atagtaagtg caatct 76 <210> 34 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-12-17 <400> 34 ataccagctt attcaattgg gtggggagga aactcggggt ggcatacgag agggggctag 60 atagtaagtg caatct 76 <210> 35 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-17-33 <400> 35 ataccagctt attcaatttc ggggcggggg tggcttaggt gacgggacgg ggaggccaag 60 atagtaagtg caatct 76 <210> 36 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-20-48 <400> 36 ataccagctt attcaattac cggaggggca gggcagtgga ttcggtgggg gcggggctag 60 atagtaagtg caatct 76 <210> 37 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-3-15 <400> 37 ataccagctt attcaattgg ccagcggggg taggacggga tggtggggga gggtcgggag 60 atagtaagtg caatct 76 <210> 38 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-9-31 <400> 38 ataccagctt attcaattcg ggagggggag gatcacctgg ggttgctggt gtggggtgag 60 atagtaagtg caatct 76 <210> 39 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-4-19 <400> 39 ataccagctt attcaattgg gctgggaggg ggtggtaggg caggatgggg gcgaccggag 60 atagtaagtg caatct 76 <210> 40 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> NP-8-28 <400> 40 ataccagctt attcaattgt ggggtgtggt cgttggggtc cactaggagg gggagggcag 60 atagtaagtg caatct 76

Claims (9)

A nucleotide sequence consisting of SEQ ID NO: 14; Or a nucleotide sequence having 80% sequence homology with a 19th to 28th sequence in the 5 'to 3' direction of said nucleotide sequence. delete A method for detecting nonylphenol using a nucleic acid plasmid having a nucleotide sequence of SEQ ID NO: 14. 4. The method according to claim 3, wherein the nonylphenol is detected from a sample collected from at least one of water, soil, air, food, waste, plants and animals, and animals and plants. A composition for detecting nonylphenol containing the nucleic acid abstamator of claim 1. A detection sensor for nonylphenol comprising the nucleic acid ablator of claim 1. A detection kit for nonylphenol containing the nucleic acid abdotamer of claim 1. A method for removing nonylphenol using the nucleic acid extruder according to claim 1. A composition for removal of nonylphenol comprising the nucleic acid abatum of claim 1.

Images