KR20190096030A

KR20190096030A - DNA aptamer binding to edifenphos with specificity and Uses thereof

Info

Publication number: KR20190096030A
Application number: KR1020180015459A
Authority: KR
Inventors: 구만복; 김상훈; 조항석; 김은령
Original assignee: 고려대학교 산학협력단
Priority date: 2018-02-08
Filing date: 2018-02-08
Publication date: 2019-08-19
Also published as: KR102196281B1

Abstract

The present invention relates to a nucleic acid aptamer binding to edifenphos with specificity and uses thereof. According to the present invention, a nucleic acid aptamer for detecting edifenphos, a method for detecting a target including the same, a composition for detection, a sensor for detection, and a kit for detection are useful for the detection of edifenphos present in a sample, based on the high specificity and binding ability of an edifenphos aptamer to edifenphos.

Description

DNA aptamer binding to edifenphos with specificity and Uses

본 발명은 에디펜포스(edifenphos)에 결합할 수 있는 핵산 앱타머 및 그의 용도에 관한 것으로, 보다 상세하게는 특이적으로 에디펜포스에 결합할 수 있는 핵산 앱타머 및 이를 이용한 에디펜포스의 검출 및 제거방법에 관한 것이다.The present invention relates to a nucleic acid aptamer capable of binding to edifenphos and its use, and more particularly, to a nucleic acid aptamer capable of specifically binding to edifene and the detection of edifene using the same. And a method of removal.

유기인계 농약은 가장 널리 사용되고 있는 농약으로, 해충구제를 위한 살충제의 목적으로 시판되고 있다. 유기염소계에 비해 지속성이 약해 잔류의 위험이 적으며 살충력이 강하지만, 사람과 가축에 대한 독성이 강한 약제가 많으며, 지속성이 약해서 비교적 많은 양의 사용을 필요로 한다.Organophosphorus pesticides are the most widely used pesticides and are marketed for the purpose of insecticides for pest control. Compared with organochlorine, it is less durable and has a lower risk of pesticides and insecticides. However, many drugs are highly toxic to humans and livestock.

에디펜포스(edifenphos)는 주로 벼 도열병에 사용되는 유기인 살균, 살충제로서 상대적으로 낮은 독성을 가지고 있기 때문에 가장 많이 사용하고 있는 농약들이다. 현재 광범위한 사용량으로 인하여 채소를 비롯한 농수산물에 잔류할 가능성이 높아 빠른 검출을 요하고 있다. 더 나아가 급성 중독될 시 인간에게 영향을 끼칠 수 있으며 이는 메스꺼움, 구토, 인두통, 복통과 심한 설사, 구토에 의한 탈수성 쇼크, 대사성 산성증(Acidosis), 혈압 저하, 핍뇨 등으로 나타난다. 또한, 에디펜포스(edifenphos) 등의 농약이 잔류되어 있는 농축수산물을 장기간 섭취할 경우에 내장기능 이상, DNA 손상, 신경계와 발달에 해독을 끼치며 암, 기형아 출산, 유산 등이 일어날 수 있다. 따라서 농약 오남용을 방지하는 것은 물론이고 식품의 안전성을 확보하기 위해 토양, 수질, 농수산물에 잔류되어 있는 농약을 검출해 내는 방법을 개발하는 것 또한 필요한 실정이다.Edifenphos is an organic pesticide and insecticide mainly used in rice blasts, and is the most widely used pesticide because it has a relatively low toxicity. At present, due to the wide range of usage, it is likely to remain in vegetables and agricultural products. Furthermore, acute poisoning can affect humans, including nausea, vomiting, pharyngeal pain, abdominal pain and severe diarrhea, dehydration shock from vomiting, metabolic acidosis, lowered blood pressure, and urination. In addition, long-term intake of concentrated aquatic products containing pesticides such as edifenphos may cause visceral dysfunction, DNA damage, nervous system and development, and cancer, birth defects, and miscarriage. Therefore, it is also necessary to develop a method for detecting pesticide residues in soil, water quality, and agricultural and aquatic products to prevent food abuse, as well as to ensure food safety.

그러나 기존의 잔류 농약 검출방법은 잔류 농약이 녹아있는 성분에 따라 각기 다른 시험용액을 조제하여 잔류 농약을 추출, 정제 후 액체 크로마토그래피를 이용해 정량하는 방법을 주로 사용한다. 그러나, 기존의 방법은 녹인 물질에 따른 시험법도 소수이며, 시험용액을 각기 조제하는 데에도 번거롭다. 또한, 추출, 정제 과정 중에 표적 샘플의 손실이 있을 수도 있으므로 정확한 정량이 어렵다. 특히 상수원 및 하천, 약수 등으로 이용되는 수질 자원에 존재하는 농약의 분석이 중요한데, 기존의 검출방법은 주로 기기분석에 기대고 있기 때문에, 현장 분석이 거의 불가능하며, 분석 비용이 비싼 단점이 있다.However, the conventional method of detecting residual pesticides mainly uses a method of extracting and purifying residual pesticides by quantifying liquid chromatography after preparing different test solutions according to the components of residual pesticides. However, the existing method has few test methods for dissolved substances, and it is cumbersome to prepare each test solution. In addition, there may be a loss of the target sample during the extraction and purification process, so accurate quantification is difficult. In particular, the analysis of pesticides present in water resources used as water sources, rivers, and mineral waters is important. Existing detection methods are expected to be mainly used for device analysis, which makes field analysis almost impossible and expensive.

앱타머(aptamer)는 10^12~14 정도의 다양성을 가지는 랜덤 핵산 라이브러리로부터 얻어지는 특정 타겟에 대해 높은 특이성과 친화도를 가지는 단일가닥 DNA 또는 RNA 분자 구조체를 말한다. 또한, 앱타머는 센서 분야에서 이용되는 기존의 감지물질인 항체와는 달리 핵산구조체 이므로 열 안정성이 우수하며, 시험관내(in vitro)에서 합성되기 때문에, 동물이나 세포가 따로 필요하지 않아 생산 비용 면에서도 경제적이며, 타겟 물질에 제약이 없어 단백질, 아미노산 같은 생분자 물질부터 환경호르몬, 항생제, 잔류 의약품 등의 저분자 유기화학 물질, 박테리아, 바이러스 등의 다양한 타겟에 대한 앱타머를 합성할 수 있다. 따라서 다양한 타겟 물질에 대한 앱타머가 만들어지고 있으며, 표적 물질과 특이성과 강한 친화도를 가지고 결합하는 앱타머의 특성으로 인해 최근 들어 앱타머를 신약 개발, 약물 전달 시스템 그리고 바이오센서 등에 응용하는 많은 연구가 이루어지고 있다. 따라서, 앱타머는 인체 유래물 내 극미량의 타겟 (ODAM, Odontogenic AMeloblast-Associated protein) 농도 측정에 매우 적절한 물질이며, 이를 활용한 나노 바이오 기술을 통해 치주염 관련 질환과 연관된 특정 단백질을 검출하는데도 응용할 수 있다.An aptamer refers to a single-stranded DNA or RNA molecular structure having high specificity and affinity for a specific target obtained from a random nucleic acid library having a variety of about 10 to ^{12 to 14} . In addition, aptamers are nucleic acid structures unlike antibodies, which are used in the field of sensors, and have excellent thermal stability, and because they are synthesized in vitro, they do not require animals or cells. It is economical and there is no restriction in the target substance, so it is possible to synthesize aptamers for various targets such as biomolecules such as proteins and amino acids, low molecular organic chemicals such as environmental hormones, antibiotics and residual medicines, bacteria and viruses. Therefore, aptamers for various target materials are being produced, and due to the properties of aptamers that bind with specificity and strong affinity with target materials, many researches have recently applied aptamers to drug development, drug delivery systems, and biosensors. It is done. Therefore, aptamers are very suitable for measuring the concentration of trace amount of target (ODAM, Odontogenic AMeloblast-Associated protein) in human derivatives, and nano biotechnology can be used to detect specific proteins associated with periodontitis-related diseases.

앱타머 개발 방법에 있어서 가장 중요한 요소는 타겟물질에 결합한 DNA (혹은 RNA)와 결합하지 않은 DNA를 구별하는 것인데, 이를 위하여 타겟을 고정하거나 DNA 랜덤 라이브러리를 고정하여 DNA를 구별하는 방법이 시도되었다. 그러나 이러한 고정화 방식은 고정화 수율이 낮고 고정화 수율 자체를 분석하는데 많은 비용과 시간이 소모된다. 또한 고정화에 사용되는 분리용 물질 (자성 비드, 컬럼 등)에 DNA가 비특이적으로 결합할 가능성을 완전히 배제할 수 없으며 고정된 타겟에 결합한 DNA를 다시 분리해내는 과정에서 DNA 풀의 손실이 일어날 수 있다는 것 등이 여전히 문제이다. 그 외에도 중금속 이온 등은 고정화 자체가 어려워 고정화 방식을 이용한 앱타머의 합성은 타겟 선정에도 제약이 있을 수 있다. 이에, 고정화 방식의 한계를 극복하는 비고정화 방식의 앱타머 개발 기술이 시도되었다. 그러나 비고정화 방식의 미세전자기계 시스템 (MEMS), 모세관 전기이동 시스템 (Capillary Electrophoresis) 기술은 고가의 장비, 장치 사용의 복잡성, 숙련된 인력의 필요성 드이의 문제점이 나타났다. 한편, 그래핀은 2차원 구조의 탄소 구조체이므로 열안정성, 전기적 특성 및 강도가 매우 우수하며, 단일가닥 DNA의 염기 부분과 π-스태킹을 통해 결합하기 때문에 이런 특성을 응용한 광범위한 연구가 진행되고 있다.The most important factor in the aptamer development method is to distinguish between DNA (or RNA) bound to a target material and non-binding DNA. To this end, a method of distinguishing DNA by fixing a target or fixing a random DNA library has been attempted. However, this immobilization method has a low immobilization yield and is expensive and time consuming to analyze the immobilization yield itself. In addition, the possibility of nonspecific binding of DNA to separation materials (magnetic beads, columns, etc.) used for immobilization cannot be completely ruled out, and DNA pool loss may occur in the process of re-isolating DNA bound to a fixed target. It is still a problem. In addition, since heavy metal ions are difficult to immobilize themselves, synthesis of aptamers using immobilization may have limitations in target selection. Accordingly, an attempt has been made to develop a non-immobilized aptamer that overcomes the limitations of immobilization. However, non-immobilized microelectromechanical systems (MEMS) and capillary electrophoresis technology have shown problems such as expensive equipment, complex use of devices, and the need for skilled personnel. On the other hand, since graphene is a two-dimensional carbon structure, it has excellent thermal stability, electrical properties, and strength. Since graphene binds to the base portion of single-stranded DNA through π-stacking, extensive research is being applied to apply this property. .

그래핀 SELEX를 이용하여, 이프로벤포스를 검출하는 압타머가 개발된 바 있다(대한민국 특허 제10-1612882호, Kwaon YS et al., Anal Chim Acta, Vol. 868, pp60-66, 2015). 그러나, SELEX 앱타머 개발방법은 PCR을 위한 프라이머 및 임의의 랜덤서열(random sequence)이 필수적이기 때문에 비결합 부분(non-binding region)을 가지는 앱타머가 생산되는 단점이 있다. 즉, 제작한 앱타머의 일부 서열만이 타겟과 결합하고, 그 외 나머지는 결합에 불필요한 부분인 것이다. 이러한 결합에 불필요한 부분은 타겟과의 결합체 구조형성에 관여하지 않아, 타겟과 앱타머 간의 결합 저해 요소가 된다.Using graphene SELEX, an aptamer has been developed to detect ifprobenfos (Korean Patent No. 10-1612882, Kwaon YS et al., Anal Chim Acta, Vol. 868, pp 60-66, 2015). However, the SELEX aptamer development method has a disadvantage in that an aptamer having a non-binding region is produced because a primer for PCR and an arbitrary random sequence are essential. That is, only a part of the sequence of the produced aptamer binds to the target, and the rest is unnecessary for binding. The unnecessary portion of the binding does not participate in the formation of the conjugate structure with the target, and thus becomes an inhibitor of binding between the target and the aptamer.

이를 개선하기 위하여, 앱타머의 구조적 특징을 살펴 잘린(truncated or shorten) 앱타머를 개발할 경우, 종래 앱타머 염기서열에서 일부를 제외하여 타겟과 결합에 필요한 염기서열만을 남겨 타겟과의 친화도를 높이는 시도가 진행되고 있다. 일레로, 대한민국 특허 제10-0961532호에서는 테트라사이클린 및 그 유도체에 특이적으로 결합하는 21종의 단일가닥 핵산 구조체 앱타머를 개발하였으며, 대한민국 특허 제10-1342710호에서는 상기 21종의 단일가닥 핵산 구조체 앱타머의 염기서열을 최소화 하여 종래의 앱타머보다 1000배 이상의 친화도를 가지는 앱타머를 개발한 바 있다.In order to improve this, when developing a truncated or shorten aptamer by examining the structural characteristics of the aptamer, only a portion of the nucleotide sequence necessary for binding with the target is removed from the conventional aptamer nucleotide sequence to increase affinity with the target. Attempts are underway. Illero, Republic of Korea Patent No. 10-0961532 has developed 21 kinds of single-stranded nucleic acid structure aptamer specifically binding to tetracycline and its derivatives, Republic of Korea Patent No. 10-1342710 the 21 kinds of single-stranded nucleic acid By minimizing the nucleotide sequence of the structure aptamer, the aptamer having affinity 1000 times or more than the conventional aptamer has been developed.

한편, 금 나노입자 기반의 색도진단법은, 그 준비의 편리성과 간단한 작동법 그리고 육안으로 색 변화를 관찰할 수 있다는 점에서 최근 들어 온사이트(on-site) 탐지의 새로운 대안으로 떠오르고 있다[Zhao, W., Brook, M.A., Li, Y., 2008a. ChemBioChem 9, 2363-2371]. 이러한 금 나노입자 기반 앱타 센서에는 두 가지 종류가 있는데, 하나는 금 나노입자 표면을 변형하여 앱타머를 금 나노입자 표면에 공유결합 등으로 고정하여 타겟 물질이 있을 때 두 개 이상의 금 나노입자 거리가 서로 가까워짐으로 인해 응집(aggregation)이 일어나서 금 나노입자 용액의 색이 붉은색에서 푸른색 계열로 변하는 특징을 이용한 것이고, 다른 하나는 변형되지 않은 금 나노입자 표면에 앱타머가 물리적으로 흡착되어 있다가 타겟 물질이 있을 때 흡착되어 있던 앱타머과 타겟과의 결합으로 인해 금 나노입자의 표면에서 떨어져 나오는 현상에 의해 색이 변하는 특성을 이용하는 것이다. 순수한 금 나노 입자의 용액 색은 붉은색이고, 앱타머가 물리적으로 금 나노입자에 흡착이 된 후 타겟을 넣어주면, 앱타머와 타겟 간의 친화도가 앱타머와 금 나노입자 간의 친화도보다 크기 때문에 앱타머는 타겟과 결합하게 된다[Y. S. Kim,et al., A novel colorimetric aptasensor using gold nanoparticle for a highly sensitive and specific detection of oxytetracycline, Biosensors and ioelectronics, Volume 26, Issue 4, 15 2010]. 이때, NaCl을 첨가해주면 타겟을 첨가해준 튜브에서는 금 나노 입자가 뭉치게 되면서 색깔 변화를 관찰 할 수 있다. 반면,타겟이 없는 튜브에서는 앱타머가 NaCl로 인한 금 나노 입자의 응집(aggregation)을 방해하기 때문에, 색 변화를 관찰할 수 없다. 이러한 특성을 바탕으로 앱타머-금 나노입자를 이용하여 타겟 물질을 검출할 수 있는 것이다. 또한, 금 나노입자 용액을 UV 분광광도계(spectrophotometer)로 흡광도를 측정하면, 순수한 금 나노입자 용액은 520 nm 에서 가장 높은 흡광도를 보이는 반면에 색이 푸른 계열로 변한 후에는 650 nm 에서 가장 높은 흡광도를 보이게 된다. 따라서 650 nm 에서의 흡광도 값을 520 nm 에서의 흡광도 값으로 나눈 값은 타겟에 의해 응집(aggregation)이 일어난 정도와 비례해서 증가한다. 이러한 원리를 통해 금 나노입자를 이용하여 핵산 앱타머의 타겟 결합 친화도를 분석할 수 있다.On the other hand, gold nanoparticle-based chromaticity diagnosis has recently emerged as a new alternative to on-site detection in terms of the convenience of preparation, simple operation, and the ability to observe color changes with the naked eye. [Zhao, W , Brook, MA, Li, Y., 2008a. Chem Bio Chem 9, 2363-2371. There are two kinds of such gold nanoparticle-based apta sensors. One is to modify the gold nanoparticle surface and fix the aptamer to the gold nanoparticle surface by covalent bonds. Aggregation occurs due to proximity to each other, and the color of the gold nanoparticle solution is changed from red to blue. The other is that the aptamer is physically adsorbed on the surface of the unmodified gold nanoparticle. When the material is present, the aptamer adsorbed by the target is combined with the target, and the color changes by the phenomenon of falling off the surface of the gold nanoparticles. The solution color of pure gold nanoparticles is red, and when the aptamer is physically adsorbed on the gold nanoparticles and the target is inserted, the aptamer is more affinity between the aptamer and the target than the affinity between the gold nanoparticles. Mer combines with the target [Y. S. Kim, et al., A novel colorimetric aptasensor using gold nanoparticle for a highly sensitive and specific detection of oxytetracycline, Biosensors and ioelectronics, Volume 26, Issue 4, 15 2010]. In this case, if NaCl is added, gold nanoparticles aggregate in the tube to which the target is added, and the color change can be observed. On the other hand, in tubes without targets, color changes cannot be observed because aptamers interfere with the aggregation of gold nanoparticles due to NaCl. Based on these characteristics, the target material can be detected using aptamer-gold nanoparticles. In addition, if the gold nanoparticle solution was measured for absorbance with a UV spectrophotometer, the pure gold nanoparticle solution showed the highest absorbance at 520 nm, but after the color turned blue, the highest absorbance at 650 nm. It becomes visible. Therefore, the absorbance value at 650 nm divided by the absorbance value at 520 nm increases in proportion to the degree to which aggregation occurs by the target. This principle allows gold nanoparticles to be analyzed for target binding affinity of nucleic acid aptamers.

이에, 본 발명자들은 기존의 핵산 앱타머보다 높은 친화도로 에디펜포스(edifenphos)에 결합하는 앱타머를 개발하기 위해 예의 연구 노력한 결과, 에디펜포스(edifenphos)에 대해 특이적으로 높은 친화도를 보이는 핵산 구조체인 DNA 앱타머를 금 나노입자 색도기반 스크리닝 방법을 통해 개발하였다. 또한, 상기 핵산 앱타머를 포함하는 조성물을 이용하면, 식품 등에 잔류하는 미량의 에디펜포스(edifenphos)를 효과적으로 검출 또는 제거할 수 있음을 확인하고, 본 발명을 완성하였다.Accordingly, the present inventors have diligently researched to develop an aptamer that binds to edifenphos with a higher affinity than a conventional nucleic acid aptamer, and thus show a particularly high affinity for edifenphos. DNA aptamers, nucleic acid constructs, were developed through gold nanoparticle chromaticity-based screening methods. In addition, by using the composition comprising the nucleic acid aptamer, it was confirmed that a trace amount of edifenphos (edifenphos) remaining in food or the like can be effectively detected or removed, and completed the present invention.

본 배경기술 부분에 기재된 상기 정보는 오직 본 발명의 배경에 대한 이해를 향상시키기 위한 것이며, 이에 본 발명이 속하는 기술분야에서 통상의 지식을 가지는 자에게 있어 이미 알려진 선행기술을 형성하는 정보를 포함하지 않을 수 있다.The above information described in this Background section is only for improving the understanding of the background of the present invention, and therefore does not include information that forms a prior art known to those of ordinary skill in the art. You may not.

본 발명의 목적은 에디펜포스(edifenphos)를 특이적으로 검출할 수 있는 핵산 앱타머 및 그 용도를 제공하는 것이다.It is an object of the present invention to provide a nucleic acid aptamer capable of specifically detecting edifenphos and its use.

상기 목적을 달성하기 위하여, 본 발명은 서열번호 2 내지 4, 6 및 8 중 어느 하나의 염기서열로 표시되는, 에디펜포스(edifenphos)에 특이적으로 결합하는 핵산 앱타머를 제공한다. In order to achieve the above object, the present invention provides a nucleic acid aptamer specifically binding to edifenphos, represented by the base sequence of any one of SEQ ID NO: 2 to 4, 6 and 8.

본 발명은 또한, 상기 핵산 앱타머를 이용한 에디펜포스의 검출방법을 제공한다. The present invention also provides a method for detecting edifene force using the nucleic acid aptamer.

본 발명은 또한, 상기 핵산 앱타머를 이용한 에디펜포스의 분리방법을 제공한다.The present invention also provides a method for separating edifene force using the nucleic acid aptamer.

본 발명은 또한, 상기 핵산 앱타머가 고상담체에 고정되어 있는 복합체를 제공한다. The present invention also provides a complex in which the nucleic acid aptamer is fixed to a solid carrier.

본 발명은 또한, 상기 핵산 앱타머 또는 상기 복합체를 포함하는 에디펜포스 검출용 조성물, 센서, 및 검출용 키트를 제공한다. The present invention also provides a composition, a sensor, and a detection kit for detecting a defensive force comprising the nucleic acid aptamer or the complex.

본 발명에 따르면 에디펜포스(edifenphos)에 특이적으로 결합 가능한 DNA 앱타머를 이용하여 시료 내 에디펜포스(edifenphos)를 보다 간편하게 검출할 수 있다. 또한, 본 발명의 DNA 앱타머를 포함하는 에디펜포스 검출 방법 및 장치에 이용하여 극소량의 에디펜포스가 포함되어 있는 시료에서 타겟을 선택적으로 측정할 수 있다. 따라서, 샘플 내에 존재하는 에디펜포스(edifenphos) 농도를 쉽고 빠르게 측정함으로써 에디펜포스(edifenphos) 검출 및 분리에 유용하다.According to the present invention, it is possible to more easily detect edifenphos in a sample by using a DNA aptamer that can specifically bind to edifenphos. In addition, the target can be selectively measured in a sample containing a very small amount of edifene force using the method and apparatus for edifene force detection comprising the DNA aptamer of the present invention. Therefore, it is useful for the detection and separation of edifenphos by measuring the edifenphos concentration present in the sample easily and quickly.

도 1은 앱타머 및 염 유도 금 나노입자 응집현상을 이용하여 타겟물질을 검출하는 원리를 설명하는 개략도이다.
도 2는 서열번호 1로 표시되는 에디펜포스(edifenphos)에 특이적으로 결합하는 핵산 앱타머의 2차 구조이며, 자른(truncation)위치를 표시한 것이다.
도 3은 자른(truncation) 핵산 앱타머 후보군 8종의 서열정보이다.
도 4의 윗 패널은 8개 앱타머 후보군에 음성대조군(NC)과 에디펜포스(PC)의 금 나노입자 기반 색도분석에 따른 A650/A520 값을 계산한 결과이며, 아래 패널은 8개 앱타머 후보군에 음성대조군(NC)과 에디펜포스(PC)의 금 나노입자 기반 색도분석에 따른 UV/Vis 스펙트럼 그래프이다.
도 5의 윗 패널은 8개 앱타머 후보군 중 결합력이 가장 좋은 C19-1 앱타머의 다양한 종류의 유기인 농약 잔류물에 대한 특이성 시험결과(specificity test)를 A650/A520 값을 보여주는 그래프이며, 아래 패널은 그에 대한 UV/Vis 스펙트럼 그래프이다.
도 6은 8개 앱타머 후보군에서 결합력이 가장 뛰어난 C19-1 앱타머의 2차 구조이다.
도 7은 C19-1 핵산 앱타머의 농도별 금 나노입자 기반 타겟 물질과의 결합력을 분석한 결과이다. 1 is a schematic diagram illustrating a principle of detecting a target material using aptamer and salt induced gold nanoparticle aggregation.
FIG. 2 is a secondary structure of a nucleic acid aptamer specifically binding to edifenphos represented by SEQ ID NO: 1, and shows a truncation position.
3 shows sequence information of eight truncation nucleic acid aptamer candidate groups.
The upper panel of FIG. 4 is the result of calculating the A650 / A520 values according to the gold nanoparticle-based chromatic analysis of the negative control group (NC) and edifenforce (PC) in eight aptamer candidate groups, and the lower panel shows eight aptamers. It is a UV / Vis spectral graph according to chromatic analysis based on gold nanoparticles of the negative control group (NC) and Ediffenforce (PC).
The top panel of FIG. 5 is a graph showing specificity test results of A650 / A520 values of various types of organic pesticide residues of C19-1 aptamer having the best binding ability among the eight aptamer candidate groups. The panel is a UV / Vis spectral graph for it.
FIG. 6 is a secondary structure of C19-1 aptamer having the highest binding force in eight aptamer candidate groups.
FIG. 7 shows the results of analyzing the binding force of the C19-1 nucleic acid aptamer according to the concentration of gold nanoparticle-based target material.

다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로 본 명세서에서 사용된 명명법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

본 발명의 한 양태에 따르면, 본 발명은 GO-SELEX 프로세스를 통해 선별한 에디펜포스(edifenphos) 및 이프로벤포스(iprobenfos)에 특이적으로 결합 가능한 DNA 앱타머의 특정 부위를 자른(truncation) 다음, 각 후보군의 결합력을 금 나노입자 기반 색도 분석법을 통해 선별하였다. 그 결과, 서열번호 2 내지 4, 6 및 8의 염기서열로 표시되는 핵산 앱타머가 상기 에디펜포스에 특이적으로 결합하는 것을 확인하였다. 즉, 본 발명의 일 실시예에서는, 에디펜포스에 특이적으로 결합 가능한 DNA 앱타머를 금 나노입자 기반 색도분석법을 이용하여 선별한 것이다.According to one aspect of the present invention, the present invention is characterized by following the truncation of a specific site of the DNA aptamer capable of specifically binding to edifenphos and iprobenfos selected by the GO-SELEX process. The binding force of each candidate group was selected through gold nanoparticle-based chromatic analysis. As a result, it was confirmed that the nucleic acid aptamer represented by the nucleotide sequences of SEQ ID NOs: 2 to 4, 6, and 8 specifically binds to the edifene force. That is, in one embodiment of the present invention, DNA aptamers capable of specifically binding to edifene force are selected using gold nanoparticle-based chromatic analysis.

본 발명의 “핵산 앱타머”란, 높은 친화성으로 타겟물질을 특이적으로 인지할 수 있는 작은 단일가닥 올리고 핵산을 말한다.The "nucleic acid aptamer" of the present invention refers to a small single-stranded oligonucleotide capable of specifically recognizing a target substance with high affinity.

본 발명에서 "시료"란, 에디펜포스를 함유하거나 함유하고 있는 것으로 추정되어 분석이 행해질 조성물로, 액체, 토양, 공기, 식품, 폐기물, 동식물 장내 및 동식물 조직 중 어느 하나 이상에서 채취된 시료로부터 검출되는 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다. 이때, 액체는 물, 혈액, 소변, 눈물, 땀, 타액,림프 및 뇌척수액 등임을 특징으로 할 수 있으며, 상기 물은 강수(江水), 해수(海水), 호수(湖水) 및 우수(雨水) 등을 포함하고, 폐기물은 하수, 폐수 등을 포함하며, 상기 동식물은 인체를 포함한다. 또한, 상기 동식물 조직으로는 점막, 피부, 외피, 털, 비늘, 안구, 혀, 뺨, 발굽, 부리, 주둥이, 발, 손, 입, 유두, 귀, 코 등의 조직을 포함한다.In the present invention, "sample" is a composition containing or estimated to contain edifene force and is to be analyzed. The sample is taken from any one or more of liquid, soil, air, food, waste, flora and fauna and flora and fauna. It may be characterized in that the detection, but is not limited thereto. In this case, the liquid may be characterized in that the water, blood, urine, tears, sweat, saliva, lymph and cerebrospinal fluid, and the water is precipitation, sea water, lake and rainwater. Including, waste includes sewage, wastewater, and the like, the flora and fauna includes the human body. In addition, the animal and plant tissues include tissues such as mucous membranes, skin, skin, hair, scales, eyes, tongue, cheeks, hoofs, beaks, snouts, feet, hands, mouths, nipples, ears, and nose.

따라서, 본 발명은 일 관점에서, 서열번호 2 내지 4, 6 및 8 중 어느 하나의 염기서열로 표시되는, 에디펜포스(edifenphos)에 특이적으로 결합하는 핵산 앱타머에 관한 것이다.Therefore, in one aspect, the present invention relates to a nucleic acid aptamer specifically binding to edifenphos, represented by the nucleotide sequence of any one of SEQ ID NOs: 2 to 4, 6, and 8.

핵산 앱타머는 단일가닥 DNA 또는 RNA로서 제공되는 것으로서, 본 발명에서 상기 핵산이 RNA인 경우에는 상기 핵산서열에서 T는 U로 표시되며, 이러한 서열이 본 발명의 범위에 포함됨은 본 발명이 속하는 기술분야에서 통상의 지식을 가지는 자에게 자명한 사항이라 할 것이다.Nucleic acid aptamers are provided as single-stranded DNA or RNA, and in the present invention, when the nucleic acid is RNA, T is represented by U in the nucleic acid sequence, and such a sequence is included in the scope of the present invention. It is obvious to those who have ordinary knowledge in Esau.

앱타머 C12-1: 5’- CGTACGGAATTCGCTAGCTAAGGGATTCCTGTAG 3’ (서열번호 2)Aptamer C12-1: 5'- CGTACGGAATTCGCTAGCTAAGGGATTCCTGTAG 3 '(SEQ ID NO: 2)

앱타머 C12-2: 5’- AGGAGCAGTCTGGATCCGAGCTCCACGTG 3’ (서열번호 3)Aptamer C12-2: 5'- AGGAGCAGTCTGGATCCGAGCTCCACGTG 3 '(SEQ ID NO: 3)

앱타머 C14-1: 5’- CGTACGGAATTCGCTAGCTAAGGGATTCCTGTAGAAGGAGC 3’ (서열번호 4)Aptamer C14-1: 5’- CGTACGGAATTCGCTAGCTAAGGGATTCCTGTAGAAGGAGC 3 ’(SEQ ID NO: 4)

앱타머 C16-1: 5‘- CGTACGGAATTCGCTAGCTAAGGGATTCCTGTAGAAGGAGCAGTCTG 3’ (서열번호 6)Aptamer C16-1: 5'- CGTACGGAATTCGCTAGCTAAGGGATTCCTGTAGAAGGAGCAGTCTG 3 '(SEQ ID NO: 6)

앱타머 C19-1: 5’- CGTACGGAATTCGCTAGCTAAGGGATTCCTGTAGAAGGAGCAGTCTGGATCCGAG 3’ (서열번호 8)Aptamer C19-1: 5'- CGTACGGAATTCGCTAGCTAAGGGATTCCTGTAGAAGGAGCAGTCTGGATCCGAG 3 '(SEQ ID NO: 8)

본 발명은 다른 관점에서, 본 발명의 핵산 앱타머를 시료와 접촉시키는 단계를 포함하는 에디펜포스(edifenphos)의 검출방법에 관한 것이다. In another aspect, the present invention relates to a method for detecting edifenphos comprising contacting a nucleic acid aptamer of the present invention with a sample.

본 발명에 있어서, 상기 시료는 물, 토양, 폐기물, 식품, 동식물 장내 및 동식물 조직으로 구성된 군에서 선택되는 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다. In the present invention, the sample may be selected from the group consisting of water, soil, waste, food, flora and fauna and flora and fauna, but is not limited thereto.

본 발명에 있어서, 상기 금 나노입자 기반 색도 분석으로 검출하는 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다. In the present invention, it may be characterized in that the detection by the gold nanoparticle-based chromaticity analysis, but is not limited thereto.

본 발명에서 상기 검출은 금 나노입자 표면을 변형하여 앱타머를 금 나노입자 표면에 공유결합 등으로 고정하여 타겟 물질이 있을 때 두 개 이상의 금 나노입자 거리가 서로 가까워짐으로 인해 응집(aggregation)이 일어나서 금 나노입자 용액의 색이 붉은색에서 푸른색 계열로 변하는 특징을 이용하거나, 변형되지 않은 금 나노입자 표면에 앱타머가 물리적으로 흡착되어 있다가 타겟 물질이 있을 때 흡착되어 있던 앱타머과 타겟과의 결합으로 인해 금 나노입자의 표면에서 떨어져 나오는 현상에 의해 색이 변하는 특성을 이용하여 타겟을 검출할 수 있다. In the present invention, the detection is performed by modifying the surface of the gold nanoparticles to fix aptamers on the surface of the gold nanoparticles by covalent bonding, etc., when the target material is present, when aggregation of two or more gold nanoparticles is brought closer to each other. By utilizing the feature that the color of the gold nanoparticle solution changes from red to blue, or the aptamer is physically adsorbed on the surface of the unmodified gold nanoparticle, the aptamer adsorbed when the target material is present Therefore, the target may be detected by using a characteristic of changing color due to the phenomenon of falling off the surface of the gold nanoparticles.

상기 검출은 또한, 금 칩(gold chip)을 이용한 자기공명분석 SPR (Surface Plasmon Resonance) 장비로 타겟을 검출할 수 있다. 즉, 금 칩 (gold chip)에 앱타머를 공유결합 등으로 고정하여 타겟 물질이 있을 때 증가하는 response unit 값을 측정하는 방식을 이용하여 타겟을 검출할 수 있다. The detection may also detect a target by magnetic resonance analysis SPR (Surface Plasmon Resonance) equipment using a gold chip. In other words, the target can be detected by using a method of measuring a response unit value that increases when there is a target material by fixing an aptamer to a gold chip by a covalent bond.

상기 검출은 또한, 그래핀옥사이드 기반 FRET 방법으로 타겟을 검출할 수 있다. 즉, 그래핀옥사이드는 소광물질(quencher)로서 FAM이라는 형광물질과 특정 거리 내에 존재할 때 520nm 근처에서 방출하는 FAM의 빛 에너지를 흡수한다. 이러한 현상을 FRET이라고 하며 이 실험은 다음과 같은 원리로 이루어진다. FAM으로 단일 가닥 DNA(본원 발명의 앱타머)의 3’끝을 표지하고 이를 그래핀옥사이드와 반응시킨다. 그래핀옥사이드는 단일 가닥 DNA(본원 발명의 앱타머)와 π-π 결합을 통해 비특이적으로 결합하고 이에 의해 FAM의 형광은 그래핀옥사이드에 의해 소광된다. 이 후 시료 내 타겟이 존재할 경우, 단일 가닥 DNA(본원 발명의 앱타머)와 타겟 간의 친화도가 그래핀옥사이드와의 친화도보다 큰 경우에 DNA가 그래핀 옥사이드로부터 떨어져 나와 다시 FAM의 형광이 나타난다. 반면 DNA(본원 발명의 앱타머)와 타겟 사이 친화도가 더 낮은 경우에는 타겟이 그래핀옥사이드에서 DNA 를 분리하지 못해 형광은 소광된 상태를 유지한다. 결합력의 차이가 형광의 방출량 차이로 나타나는 이러한 특성을 바탕으로 형광을 측정함으로써 단일 가닥 DNA과 타겟 간의 결합력을 확인할 수 있다. The detection can also detect a target by a graphene oxide based FRET method. That is, graphene oxide absorbs the light energy of FAM emitted near 520 nm when present within a specific distance from a fluorescent material called FAM as a quencher. This phenomenon is called FRET and this experiment is based on the following principle. FAM is used to label the 3 ′ end of single-stranded DNA (aptamers of the present invention) and react with graphene oxide. Graphene oxide binds nonspecifically with single-stranded DNA (aptamers of the present invention) through π-π binding, whereby the fluorescence of FAM is quenched by graphene oxide. Subsequently, if there is a target in the sample, the DNA is released from the graphene oxide and the fluorescence of FAM appears again when the affinity between the single-stranded DNA (aptamer of the present invention) and the target is greater than that of graphene oxide. . On the other hand, when the affinity between DNA (aptamer of the present invention) and the target is lower, the target does not separate DNA from graphene oxide, so the fluorescence remains quenched. Based on this characteristic, where the difference in binding force is the difference in the amount of fluorescence emitted, the binding force between the single-stranded DNA and the target can be confirmed by measuring fluorescence.

본 발명의 앱타머는 이 기술분야에서 이미 공지된 방법에 의해 화학 합성할 수도 있다.The aptamers of the present invention may also be chemically synthesized by methods already known in the art.

본 발명의 핵산 앱타머는, 타겟에 대한 결합성, 안정성 등을 높이기 위해, 각 뉴클레오티드의 당 잔기 (예를 들어, 리보오스나 디옥시리보스)가 수식된 것이어도 좋다. 당잔기에서 수식되는 부위로서는, 예컨대 당잔기의 2'부위, 3'부위 및/또는 4'부위의 산소원자를 다른 원자로 치환한 것 등을 들 수 있다. 수식의 종류로서는, 예컨대 플루오로화, O-알킬화(예, O-메틸화, O-에틸화), O-알릴화, S-알킬화(예, S-메틸화, S-에틸화), S-알릴화, 아미노화(예, -NH)를 들 수 있다. 이러한 당잔기의 변형은, 자체 공지의 방법에 의해 행할 수 있다 (Sproat et al.,(1991) Nucle. Acid. Res. 19, 733-738; Cotton et al., (1991) Nucl. Acid. Res. 19, 2629-2635; Hobbs et al., (1973) Biochemistry 12, 5138-5145). The nucleic acid aptamer of the present invention may be modified with sugar residues (for example, ribose or deoxyribose) of each nucleotide in order to enhance binding to the target, stability, and the like. Examples of the moiety modified in the sugar residue include those in which the oxygen atoms at the 2 ', 3' and / or 4 'sites of the sugar residue are replaced with other atoms. As the kind of modification, for example, fluorination, O-alkylation (eg O-methylation, O-ethylation), O-allylation, S-alkylation (eg S-methylation, S-ethylation), S-allyl And amination (for example, -NH). Such a sugar residue can be modified by a method known per se (Sproat et al., (1991) Nucle. Acid. Res. 19, 733-738; Cotton et al., (1991) Nucl. Acid.Res). 19, 2629-2635; Hobbs et al., (1973) Biochemistry 12, 5138-5145).

본 발명의 핵산 앱타머는 또한 타겟에 대한 결합성 등을 높이기 위해, 핵산염기 (예를 들면, 푸린, 피리미딘)가 변형 (예를 들면, 화학적 치환)된 것이어도 좋다. 이러한 변형으로서는, 예컨대, 5부위 피리미딘 변형, 6 및/또는 8부위 푸린 변형, 환외(環外) 아민에서의 변형, 4-티오우리딘으로의 치환, 5-브로모 또는 5-요오드-우리실으로의 치환을 들 수 있다. The nucleic acid aptamer of the present invention may also be a modified (eg, chemically substituted) nucleic acid base (for example, purine, pyrimidine) in order to enhance binding to a target and the like. Such modifications include, for example, 5-site pyrimidine modifications, 6- and / or 8-site purine modifications, modifications in extrafoam amines, substitution with 4-thiouridines, 5-bromo or 5-iodine-uri Substitution with a thread is mentioned.

또한, 뉴클레아제 및 가수분해에 대하여 내성을 갖도록, 본 발명의 핵산 앱타머에 포함되는 인산기가 변형되어 있어도 좋다. 예컨대, P(0)0기가, P(0)S(티오에이트), P(S)S(디티오에이트), P(O)NR2(아미데이트), P(O)R, R(O)OR', CO 또는 CH2(포름아세탈) 또는 3'-아민(-NH-CH2-CH2-)으로 치환되어 있어도 좋다. 여기서 각각의 R 또는 R'은 독립적으로, H이거나, 또는 치환되어 있거나, 또는 치환되어 있지 않은 알킬 (예, 메틸, 에틸)이다. 연결기로서는, -O-, -N- 또는 -S-가 예시되고, 이들의 연결기를 통하여 인접하는 뉴클레오티드에 결합할 수 있다. In addition, the phosphate group contained in the nucleic acid aptamer of the present invention may be modified so as to be resistant to nuclease and hydrolysis. For example, P (0) 0 group is P (0) S (thioate), P (S) S (dithioate), P (O) NR2 (amidate), P (O) R, R (O) OR ', CO or CH2 (formacetal) or 3'-amine (-NH-CH2-CH2-) may be substituted. Wherein each R or R ′ is independently H, substituted or unsubstituted alkyl (eg methyl, ethyl). As a linking group, -O-, -N-, or -S- is illustrated, and can couple | bond with adjacent nucleotides through these linking groups.

본 발명에서의 변형은 또한, 캡핑과 같은 3' 및 5'의 변형을 포함하여도 좋다. Modifications in the present invention may also include 3 'and 5' modifications, such as capping.

변형은 또한, 폴리에틸렌글리콜, 아미노산, 펩티드, inverted dT, 핵산, 뉴클레오시드, 미리스토일 (Myristoyl), 리쏘콜릭-올레일 (Lithocolic-oleyl), 도코사닐 (Docosanyl), 라우로일 (Lauroyl), 스테아로일 (Stearoyl), 팔미토일 (Palmitoyl), 올레오일 (Oleoyl), 리놀레오일 (Linoleoyl), 그 외 지질, 스테로이드, 콜레스테롤, 카페인, 비타민, 색소, 형광물질, 항암제, 독소, 효소, 방사성 물질, 비오틴 등을 말단에 부가함으로써 행해질 수 있다. 이러한 변형에 대해서는, 예컨대 미국특허 제5,660,985호, 미국특허 제5,756,703호를 참조한다. Modifications also include polyethyleneglycols, amino acids, peptides, inverted dT, nucleic acids, nucleosides, Myristoyl, Lithocolic-oleyl, Docosanyl, Lauroyl Stearoyl, Palmitoyl, Oleoyl, Linoleoyl, Other Lipids, Steroids, Cholesterol, Caffeine, Vitamins, Pigments, Phosphors, Anticancer Agents, Toxins, Enzymes, It can be done by adding radioactive material, biotin and the like to the ends. See, for example, US Pat. No. 5,660,985 and US Pat. No. 5,756,703.

본 발명은 또 다른 관점에서 본 발명의 핵산 앱타머가 고상담체에 고정되어 있는 복합체에 관한 것이다.In another aspect, the present invention relates to a complex in which the nucleic acid aptamer of the present invention is immobilized on a solid carrier.

본 발명에 있어서, 상기 고상 담체는 기판, 수지, 플레이트, 필터, 카트리지, 컬럼 및 다공재질인 고상 담체로 구성된 군에서 선택되는 것을 특징으로 할 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the solid carrier may be selected from the group consisting of a substrate, a resin, a plate, a filter, a cartridge, a column, and a porous solid carrier, but is not limited thereto.

본 발명에 있어서, 상기 기판은 니켈-PTFE (폴리테트라플루오로에틸렌) 기판, 유리 기판, 아파타이트 (apatite) 기판, 실리콘 기판, 금 기판, 은 기판, 그래핀 옥사이드 기판 및 알루미나 기판으로 구성된 군에서 선택되는 것을 특징으로 할 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the substrate is selected from the group consisting of nickel-PTFE (polytetrafluoroethylene) substrate, glass substrate, apatite substrate, silicon substrate, gold substrate, silver substrate, graphene oxide substrate and alumina substrate It may be characterized as being, but is not limited thereto.

본 발명의 기판은 칩이나 단백질 칩 등에 사용되고 있는 것 등일 수 있고, 예컨대 니켈-PTFE (폴리테트라플루오로에틸렌) 기판이나 유리 기판, 아파타이트 (apatite) 기판, 실리콘 기판, 금, 은, 그래핀 옥사이드 또는 알루미나 기판 등으로, 이들의 기판에 폴리머 등의 코팅을 실시한 것을 들 수 있다. The substrate of the present invention may be a chip, a protein chip, or the like, for example, a nickel-PTFE (polytetrafluoroethylene) substrate, a glass substrate, an apatite substrate, a silicon substrate, gold, silver, graphene oxide, or the like. As an alumina substrate, what coated these board | substrates with polymer etc. is mentioned.

상기 수지는 아가로스 (agarose) 입자, 실리카 입자, 아크릴아미드와 N, N'-메틸렌비스아크릴아미드의 공중합체, 폴리스티렌 가교 디비닐벤젠 입자, 덱스트란을 에피클로로히드린으로 가교한 입자, 셀룰로오스파이버, 알릴덱스트란과 N, N'-메틸렌비스아크릴아미드의 가교폴리머, 단분산계 합성폴리머, 단분산계 친수성폴리머, 세파로오스 (Sepharose) 또는 토요펄(Toyopearl) 등을 들 수 있고, 또한 이들의 수지에 각종 관능기를 결합시킨 수지를 사용할 수 있다. The resin is agarose particles, silica particles, copolymers of acrylamide and N, N'-methylenebisacrylamide, polystyrene crosslinked divinylbenzene particles, particles crosslinked with dextran with epichlorohydrin, cellulose fiber , Crosslinked polymers of allyldextran and N, N'-methylenebisacrylamide, monodisperse synthetic polymers, monodisperse hydrophilic polymers, Sepharose or Toyopearl, and the like, and these resins may also be mentioned. Resin which combined various functional groups to can be used.

상기 고상담체는 타겟의 정제, 타겟 단백질의 검출 또는 정량에 유용할 수 있다. The solid carrier may be useful for purifying the target, detecting or quantifying the target protein.

본 발명의 핵산 앱타머는 공지의 방법에 의해 고상담체에 고정할 수 있다. 예컨대, 친화성 물질이나 소정의 관능기를 본 발명의 앱타머에 도입하고, 계속해서 이 친화성 물질이나 소정의 관능기를 이용하여 고상담체에 고정화하는 방법을 들 수 있다. 소정의 관능기는 커플링 반응에 제공하는 것이 가능한 관능기일 수 있고, 예컨대 아미노기, 티올기, 히드록실기, 카르복실기를 들 수 있다. 예를 들어, 상기 앱타머의 말단에 바이오틴을 결합시켜 복합체를 형성하고, 상기 칩 등의 기판 표면에 스트렙타비딘을 고정화시켜, 상기 바이오틴과 기판 표면에 고정화된 스트렙타비딘의 상호작용에 의하여 상기 앱타머를 기판 표면에 고정화시킬 수 있다. The nucleic acid aptamer of the present invention can be fixed to a solid carrier by a known method. For example, a method of introducing an affinity substance or a predetermined functional group into the aptamer of the present invention and subsequently immobilizing the solid carrier using the affinity substance or the predetermined functional group is mentioned. The predetermined functional group may be a functional group which can be provided to the coupling reaction, and examples thereof include amino groups, thiol groups, hydroxyl groups, and carboxyl groups. For example, the biotin is bonded to the terminal of the aptamer to form a complex, and the streptavidin is immobilized on the surface of the chip such as the chip so that the biotin interacts with the streptavidin immobilized on the substrate surface. The aptamer can be immobilized on the substrate surface.

앱타머가 고정화된 고상담체를 이용하여 타겟 단백질을 검출하는 방법은, 예를 들어, 본 발명의 DNA 앱타머를 칩 (chip)상에 형광물질, 발색물질 또는 항체 등과 함께 스팟팅 한 후 혈액샘플을 반응시킴으로써 검출 시료, 예를 들어, 혈액 중에 포함된 미량의 타겟의 수준을 신속하게 측정할 수 있다. 또 다른 방법으로는 자성 비드에 상기 DNA 앱타머를 고정화시켜 타겟을 결합시키게 되면 결합된 DNA 앱타머-타겟 복합체를 자석을 이용하여 분리할 수 있게 되고, 이 복합체로부터 다시 타겟을 분리함으로써 타겟만을 선택적으로 검출할 수 있게 된다. A method for detecting a target protein using an immobilized immobilized solid carrier, for example, spotting a blood sample after spotting a DNA aptamer of the present invention on a chip with a fluorescent material, a chromophore or an antibody, etc. By reacting, the level of trace target contained in a detection sample, for example, blood, can be measured rapidly. In another method, when the DNA aptamer is immobilized on magnetic beads to bind a target, the bound DNA aptamer-target complex can be separated using a magnet, and the target is selectively removed by separating the target from the complex again. Can be detected.

본 발명은 또 다른 관점에서, 본 발명의 핵산 앱타머 또는 상기 핵산 앱타머가 고상담체에 고정되어 있는 복합체를 포함하는 에디펜포스 검출용 조성물에 관한 것이다. In still another aspect, the present invention relates to a composition for detecting edifene force, comprising a nucleic acid aptamer or a complex in which the nucleic acid aptamer is fixed to a solid carrier.

본 발명의 에디펜포스 검출용 조성물은 에디펜포스를 검출하기 위한 것으로, 에디펜포스의 검출을 위해 본 발명의 핵산 앱타머를 이용하여 어떠한 형태로도 사용할 수 있다. 예를 들어, 본 발명의 핵산 앱타머를 자성비드에 고정화시켜 에디펜포스를 결합시키게 되면 결합된 DNA 앱타머-에디펜포스 복합체(complex)를 자석을 이용하여 분리할 수 있게 되고, 이 복합체로부터 다시 에디펜포스를 분리함으로서 에디펜포스만을 선택적으로 검출할 수 있게 된다. The composition for detecting edifene force of the present invention is for detecting edifene force, and can be used in any form using the nucleic acid aptamer of the present invention for detecting edifene force. For example, by immobilizing the nucleic acid aptamer of the present invention to magnetic beads to bind the edifene force, the bound DNA aptamer-edifenforce complex can be separated using a magnet, and from this complex By separating the edifene force again, only the edifene force can be selectively detected.

본 발명의 조성물을 이용하는 에디펜포스의 제거방법의 한 예를 들면, 상기 핵산 앱타머가 고정화된 자성비드를 컬럼 (column)에 채운 후 타겟을 포함하는 시료를 통과시켜 에디펜포스만을 선택적으로 제거할 수 있다. As an example of the method for removing edifene force using the composition of the present invention, after filling a column with magnetic beads immobilized with the nucleic acid aptamer, a sample containing a target may be passed to selectively remove edifene force. Can be.

본 발명은 또한, 상기 타겟에 특이적으로 결합하는 앱타머 또는 상기 핵산 앱타머가 고상담체에 고정되어 있는 복합체를 함유하는 에디펜포스의 검출센서에 관한 것이다.The present invention also relates to a sensor for detecting afenifene containing an aptamer specifically binding to the target or a complex in which the nucleic acid aptamer is fixed to a solid carrier.

상기 에디펜포스에 특이적으로 결합하는 앱타머 또는 상기 핵산 앱타머가 고상담체에 고정되어 있는 복합체를 함유하는 검출 센서 시스템은, 키트(kit)의 형태로 제공될 수 있다. 타겟 검출용 키트는 병, 통(tub), 작은 봉지(sachet), 봉투(envelope), 튜브, 앰플(ampoule) 등과 같은 형태를 취할 수 있으며 이들은 부분적으로 또는 전체적으로 플라스틱, 유리, 종이, 호일, 왁스 등으로부터 형성될 수 있다. 용기는, 처음에는 용기의 일부이거나 또는 기계적, 접착성, 또는 기타 수단에 의해 용기에 부착될 수 있는, 완전히 또는 부분적으로 분리가 가능한 마개를 장착할 수 있다. 용기는 또한 주사바늘에 의해 내용물에 접근할 수 있는, 스토퍼가 장착될 수 있다. 상기 키트는 외부 패키지를 포함할 수 있으며, 외부 패키지는 구성 요소들의 사용에 관한 사용설명서를 포함할 수 있다. The detection sensor system containing an aptamer specifically binding to the edifene force or a complex in which the nucleic acid aptamer is fixed to a solid carrier may be provided in the form of a kit. Target detection kits may take the form of bottles, tubs, small sachets, envelopes, tubes, ampoules, etc., which may be partially or wholly plastic, glass, paper, foil, wax And the like. The container may be equipped with a fully or partially separable stopper, which may initially be part of the container or attached to the container by mechanical, adhesive, or other means. The container may also be equipped with a stopper, which may be accessible to the contents by a needle. The kit may include an external package, which may include instructions for use of the components.

본 발명에 따른 에디펜포스에 특이적으로 결합하는 앱타머는 또한, 에디펜포스만을 특이적으로 검출하는바, 이를 포함하여 에디펜포스의 검출 또는 제거용 조성물을 제공할 수 있음은 본 발명이 속하는 기술분야에서 당업자에게 자명한 것이다. The aptamer specifically binding to edifene force according to the present invention also specifically detects edifene force, and can provide a composition for detecting or removing edifene force, including the same. It will be apparent to those skilled in the art.

본 발명은 또 다른 관점에서, 에디펜포스에 특이적으로 결합하는 앱타머 또는 상기 핵산 앱타머가 고상담체에 고정되어 있는 복합체를 이용한 에디펜포스의 제거방법에 관한 것이다. 본 발명의 한 양태에 따르면, 바람직하게는 상기 앱타머가 고정된 비드를 컬럼에 충진하고 타겟이 포함된 시료를 통과시켜 타겟을 제거할 수 있다. In still another aspect, the present invention relates to a method for removing edifene force using an aptamer specifically binding to edifene force or a complex in which the nucleic acid aptamer is fixed to a solid carrier. According to one aspect of the invention, preferably, the aptamer-fixed beads may be filled in a column and passed through a sample containing a target to remove the target.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다. Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.

실시예 1: 앱타머 흡착 금 나노입자 색도 분석을 이용한 앱타머 스크리닝Example 1: Aptamer Screening Using Aptamer Adsorption Gold Nanoparticle Chromatography

1.1 비 고정화 방식의 앱타머 흡착 금 나노입자의 제조1.1 Preparation of Non-immobilized Aptamer Adsorption Gold Nanoparticles

비 고정화 방식 앱타머 흡착 금나노입자를 만드는데 이용하기 위해 시트로산염(citrate)으로 안정화된 금 나노입자를 제조하였다. 큰 비커에 HCL과 HNO₃를 3:1 비율로 섞어서 왕수를 만들어 준비한 뒤, 금 나노입자를 만드는데 사용할 200ml 플라스크와 자석막대를 적어도 15분 이상 담가두어 오염물질을 제거하였다. Non-immobilized aptamer adsorbed gold nanoparticles were prepared to stabilize the citrate (citrate) to make gold nanoparticles. A large beaker was prepared by mixing HCL and HNO ₃ in a 3: 1 ratio to form aqua regia. The 200 ml flask and magnetic rod used to make gold nanoparticles were soaked for at least 15 minutes to remove contaminants.

위와 같이 준비한 플라스크에 3차 증류수를 98 ml 넣고 핫플레이트 위에서 저어주면서(stirring) 50mM HAuCl₄ 용액을 2ml 첨가하여 HAuCl₄의 최종 농도가 1mM이 되도록 하였다. 이 용액이 끓기 시작하면 빠르게 38.8mM의 시트르산나트륨(sodium citrate) 용액을 10ml 첨가하였다. 그러면 용액의 색이 밝은 노란색에서 짙은 붉은색으로 1분 안에 변화하였다. 20분 더 끓인 뒤에는 상온에서 식을 때까지 stirring 하면서 놔두었다. 이 용액은 0.45μm nitrocellulose 필터 페이퍼를 이용하여 여과하여 만드는 과정에서 응집된 금 나노입자 혹은 그 외의 불순물을 제거하였다. 완성된 금나노입자 용액은 4℃에 냉장 보관하였다.98 ml of tertiary distilled water was added to the flask prepared as described above, and 2 ml of 50 mM HAuCl ₄ solution was added while stirring (stirring) on a hot plate so that the final concentration of HAuCl ₄ was 1 mM. When the solution started to boil, 10 ml of 38.8 mM sodium citrate solution was added rapidly. The color of the solution then changed from bright yellow to deep red in 1 minute. After boiling for another 20 minutes, the mixture was left to stir until cooled at room temperature. The solution was filtered using 0.45μm nitrocellulose filter paper to remove aggregated gold nanoparticles or other impurities. The gold nanoparticle solution was stored refrigerated at 4 ℃.

1-2: 후보군 앱타머 제작1-2: Candidate Aptamers

서열번호 1로 표시되는 에디펜포스에 특이적으로 결합하는 핵산 앱타머를 도 2에 표시된 구역으로 ssDNA 서열을 합성하여 서열번호 1로 표시되는 기존의 핵산 앱타머 서열에 대한 truncation을 수행하였다. A nucleic acid aptamer specifically binding to the edifene force represented by SEQ ID NO: 1 was synthesized into the region shown in FIG. 2 to perform truncation of the existing nucleic acid aptamer sequence represented by SEQ ID NO: 1.

최종적으로 8개의 truncated 핵산 앱타머 후보군을 제조하였으며, 그 결과는 표 1 및 도 3과 같다.Finally, eight truncated nucleic acid aptamer candidate groups were prepared, and the results are shown in Table 1 and FIG. 3.

핵산 앱타머 서열정보Nucleic Acid Aptamer Sequence Information 앱타머Aptamers 서열번호SEQ ID NO: Size
(mer)Size
(mer) 서열(5‘-3’)Sequence (5'-3 ') EIA2EIA2 1One 6464 CGTACGGAATTCGCTAGCTAAGGGATTCCTGTAGAAGGAGCAGTCTGGATCCGAGCTCCACGTGCGTACGGAATTCGCTAGCTAAGGGATTCCTGTAGAAGGAGCAGTCTGGATCCGAGCTCCACGTG C12-1C12-1 22 55 CGTACGGAATTCGCTAGCTAAGGGATTCCTGTAGACGTACGGAATTCGCTAGCTAAGGGATTCCTGTAGA C12-2C12-2 33 2929 AGGAGCAGTCTGGATCCGAGCTCCACGTGAGGAGCAGTCTGGATCCGAGCTCCACGTG C14-1C14-1 44 4141 CGTACGGAATTCGCTAGCTAAGGGATTCCTGTAGAAGGAGCCGTACGGAATTCGCTAGCTAAGGGATTCCTGTAGAAGGAGC C14-2C14-2 55 2323 AGTCTGGATCCGAGCTCCACGTGAGTCTGGATCCGAGCTCCACGTG C16-1C16-1 66 4747 CGTACGGAATTCGCTAGCTAAGGGATTCCTGTAGAAGGAGCAGTCTGCGTACGGAATTCGCTAGCTAAGGGATTCCTGTAGAAGGAGCAGTCTG C16-2C16-2 77 1717 GATCCGAGCTCCACGTGGATCCGAGCTCCACGTG C19-1C19-1 88 5555 CGTACGGAATTCGCTAGCTAAGGGATTCCTGTAGAAGGAGCAGTCTGGATCCGAGCGTACGGAATTCGCTAGCTAAGGGATTCCTGTAGAAGGAGCAGTCTGGATCCGAG C19-2C19-2 99 99 CTCCACGTGCTCCACGTG

1-3: 앱타머 스크리닝에 사용된 금 나노입자 색도 변화 분석법1-3: Method for Chromatographic Changes in Gold Nanoparticles Used in Aptamer Screening

실시예1-1에서 제조한 2nM의 금 나노입자와 실시예1-2에서 제조한 8μM의 8개의 앱타머 후보군은 각각 완충용액(10% MeOH, 100mM NaCl, 20mM Tris-HCl, 2mM MgCl₂, 5mM KCl, and 1mM CaCl₂가 초순수물 속에 녹아 있는 용액)에 넣고 상온에서 30분간 반응시킨 후, 25μM의 에디펜포스를 첨가하여 30분간 반응시켰다. 그 다음 상기 용액에 2M NaCl을 첨가하여 염 유발 금 뭉침 현상(salt induced gold aggregation)을 유도하여 UV/VIS 분광기(Ultraspec 6300 Amersham Biosciences)를 이용하여 금 나노입자의 UV 흡광도를 측정하였다. 이는 도1의 모식도와 같다.The 8 nM aptamer candidate groups of 2 nM gold nanoparticles prepared in Example 1-1 and 8 μM prepared in Example 1-2 were each buffered (10% MeOH, 100 mM NaCl, 20 mM Tris-HCl, 2 mM MgCl ₂ , 5mM KCl, and 1mM CaCl ₂ dissolved in ultrapure water) and reacted for 30 minutes at room temperature, and then reacted for 30 minutes by the addition of 25μM ediffenforce. Then, 2M NaCl was added to the solution to induce salt induced gold aggregation, and the UV absorbance of the gold nanoparticles was measured using a UV / VIS spectrometer (Ultraspec 6300 Amersham Biosciences). This is the same as the schematic diagram of FIG.

그 결과, 도 4에 개시된 바와 같이, 검출한도인 A650/A520 ratio 값으로 에디펜포스가 안 들어간 음성대조군 값과 에디펜포스가 들어간 양성대조군 값을 종합적으로 고려하여 앱타머 서열 C19-1을 선별하였다. As a result, as shown in FIG. 4, the aptamer sequence C19-1 was selected by comprehensively considering the negative control value without edifene and the positive control value with edifene as the A650 / A520 ratio value. It was.

1-4: 에디펜포스 특이적 앱타머 결합력 확인1-4: Confirmation of ediffenforce specific aptamer binding ability

앱타머 서열 C19-1의 특정 타겟에만 결합하는 여부를 확인하기 위한 특이성 시험(Specificity test)을 금 나노입자 색도 변화 분석법 기반으로 하였다. 에디펜포스에 대해 반응성이 제일 좋았던 앱타머 서열 C19-1만을 선별하여 에디펜포스에 특이적으로 결합하는지 여부를 확인하는 특이성 시험(specificity test)를 진행하였다. Specificity tests to confirm binding to specific targets of the aptamer sequence C19-1 were based on gold nanoparticle chromaticity change assays. Only the aptamer sequence C19-1, which was the most responsive to Ediffenforce, was selected and subjected to a specificity test (specificity test) to confirm whether it specifically binds to EdifenForce.

앱타머 C19-1을 에디펜포스, 펜사이큐론(pencycuron), 카프로파미드(carpropamid), 테트라사이클린(tetracycline), 디클로페낙(diclofenac), DL-알라닌(DL-alanine), 글라이포스페이트(glyphospate) 및 이프로벤포스(iprobenfos)와 각각 결합시켜 그 결합력을 확인하였다.Aptamer C19-1 was used as adifenfos, pencicuron, carpropamid, tetracycline, diclofenac, DL-alanine, glyphospate And iprobenfos (iprobenfos) respectively and confirmed the binding force.

그 결과, 도 5에 개시된 바와 같이, C19-1 앱타머가 에디펜포스에 대하여 특이적으로 결합하는 것을 확인하였으며, C19-1 핵산 앱타머의 예상 2차 구조는 도 6과 같다.As a result, as shown in FIG. 5, it was confirmed that C19-1 aptamer specifically binds to edifene force, and the expected secondary structure of the C19-1 nucleic acid aptamer is shown in FIG. 6.

1-5: 에디펜포스 특이적 앱타머의 농도별 결합력 확인1-5: Confirmation of Avidenforce Specific Aptamer Concentration Adhesion

앱타머 C19-1의 농도별 결합력을 금 나노입자 색도기반 분석법으로 확인한 결과, 도 7에 개시된 바와 같이 28nM의 에디펜포스를 검출할 수 있음을 확인하였다. As a result of confirming the binding force for each concentration of aptamer C19-1 by gold nanoparticle chromaticity analysis method, it was confirmed that 28 nM of edifene force could be detected as shown in FIG. 7.

이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.As described above in detail specific parts of the present invention, it will be apparent to those skilled in the art that these specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. will be. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

<110> Korea University Research and Business Foundation <120> DNA aptamer binding to edifenphos with specificity and Uses thereof <130> P18-B006 <160> 9 <170> KoPatentIn 3.0 <210> 1 <211> 64 <212> DNA <213> Artificial Sequence <220> <223> EIA2 <400> 1 cgtacggaat tcgctagcta agggattcct gtagaaggag cagtctggat ccgagctcca 60 cgtg 64 <210> 2 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> C12-1 <400> 2 cgtacggaat tcgctagcta agggattcct gtaga 35 <210> 3 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> C12-2 <400> 3 aggagcagtc tggatccgag ctccacgtg 29 <210> 4 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> C14-1 <400> 4 cgtacggaat tcgctagcta agggattcct gtagaaggag c 41 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> C14-2 <400> 5 agtctggatc cgagctccac gtg 23 <210> 6 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> C16-1 <400> 6 cgtacggaat tcgctagcta agggattcct gtagaaggag cagtctg 47 <210> 7 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> C16-2 <400> 7 gatccgagct ccacgtg 17 <210> 8 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> C19-1 <400> 8 cgtacggaat tcgctagcta agggattcct gtagaaggag cagtctggat ccgag 55 <210> 9 <211> 9 <212> DNA <213> Artificial Sequence <220> <223> C19-2 <400> 9 ctccacgtg 9 <110> Korea University Research and Business Foundation <120> DNA aptamer binding to edifenphos with specificity and Uses about <130> P18-B006 <160> 9 <170> KoPatentIn 3.0 <210> 1 <211> 64 <212> DNA <213> Artificial Sequence <220> <223> EIA2 <400> 1 cgtacggaat tcgctagcta agggattcct gtagaaggag cagtctggat ccgagctcca 60 cgtg 64 <210> 2 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> C12-1 <400> 2 cgtacggaat tcgctagcta agggattcct gtaga 35 <210> 3 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> C12-2 <400> 3 aggagcagtc tggatccgag ctccacgtg 29 <210> 4 <211> 41 <212> DNA <213> Artificial Sequence <220> <223> C14-1 <400> 4 cgtacggaat tcgctagcta agggattcct gtagaaggag c 41 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> C14-2 <400> 5 agtctggatc cgagctccac gtg 23 <210> 6 <211> 47 <212> DNA <213> Artificial Sequence <220> <223> C16-1 <400> 6 cgtacggaat tcgctagcta agggattcct gtagaaggag cagtctg 47 <210> 7 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> C16-2 <400> 7 gatccgagct ccacgtg 17 <210> 8 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> C19-1 <400> 8 cgtacggaat tcgctagcta agggattcct gtagaaggag cagtctggat ccgag 55 <210> 9 <211> 9 <212> DNA <213> Artificial Sequence <220> <223> C19-2 <400> 9 ctccacgtg 9

Claims

Nucleic acid aptamers that specifically bind to edifenphos, represented by the nucleotide sequence of any one of SEQ ID NOs: 2-4, 6, and 8:
Here, when the nucleic acid aptamer is RNA, T in the nucleic acid sequence is characterized in that U.

A method for detecting edifenphos, comprising contacting a nucleic acid aptamer of claim 1 with a sample.

The method of claim 2, wherein the sample is selected from the group consisting of water, soil, waste, food, flora and fauna and flora and fauna.

The method of claim 3, wherein the detection is performed by color analysis based on gold nanoparticles.

The complex of claim 1, wherein the nucleic acid aptamer is fixed to a solid carrier.

6. The composite according to claim 5, wherein the solid carrier is selected from the group consisting of a substrate, a resin, a plate, a filter, a cartridge, a column, and a porous carrier.

The substrate of claim 6, wherein the substrate is selected from the group consisting of a nickel-PTFE (polytetrafluoroethylene) substrate, a glass substrate, an apatite substrate, a silicon substrate, a gold substrate, a silver substrate, a graphic oxide substrate, and an alumina substrate. Complex.

Claim 1 nucleic acid aptamer or a composition for detecting edifenphos (edifenphos) comprising a complex of claim 5.

Sensor for detecting edifenphos comprising the nucleic acid aptamer of claim 1 or the complex of claim 5.

A kit for detecting edifenphos comprising the nucleic acid aptamer of claim 1 or the complex of claim 7.

A method for separating edifenphos, comprising using the nucleic acid aptamer of claim 1.

12. The method of claim 11, wherein the nucleic acid aptamer comprises passing the sample through a column packed with immobilized beads.