KR102009016B1 - DNA aptamer binding to ODAM(Odontogenic Ameloblast-Associated protein) with specificity and Uses thereof - Google Patents
DNA aptamer binding to ODAM(Odontogenic Ameloblast-Associated protein) with specificity and Uses thereof Download PDFInfo
- Publication number
- KR102009016B1 KR102009016B1 KR1020170166589A KR20170166589A KR102009016B1 KR 102009016 B1 KR102009016 B1 KR 102009016B1 KR 1020170166589 A KR1020170166589 A KR 1020170166589A KR 20170166589 A KR20170166589 A KR 20170166589A KR 102009016 B1 KR102009016 B1 KR 102009016B1
- Authority
- KR
- South Korea
- Prior art keywords
- odam
- associated protein
- aptamer
- nucleic acid
- dna
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
- G01N33/54306—Solid-phase reaction mechanisms
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
- G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
- G01N2333/46—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans from vertebrates
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/18—Dental and oral disorders
Abstract
본 발명은 오담(ODAM, Odontogenic Ameloblast-Associated protein)에 특이적으로 결합하는 핵산 앱타머 및 그 용도에 관한 것이다. 본 발명에 따르면 오담 검출용 핵산 앱타머, 이를 포함하는 오담의 검출방법, 검출용 조성물, 검출용 센서 및 검출용 키트는 오담 앱타머의 오담에 대한 높은 특이성과 결합력을 바탕으로 시료 내 존재하는 오담의 검출에 유용하다. The present invention relates to a nucleic acid aptamer specifically binding to Odontogenic Ameloblast-Associated protein (ODAM) and its use. According to the present invention, the nucleic acid aptamer for detecting the odam, the method for detecting the odam, the composition for detecting the same, the detecting sensor, and the kit for detecting the odam are present in the sample based on the high specificity and binding force of the odam aptamer. It is useful for the detection of.
Description
본 발명은 오담(ODAM, Odontogenic Ameloblast-Associated protein)에 특이적으로 결합하는 핵산 앱타머 및 그 용도에 관한 것으로, 더욱 상세하게는 오담에 높은 친화도를 가지고 특이적으로 결합하는 서로 다른 핵산 앱타머와 이를 이용한 오담 검출방법 및 검출용 조성물, 센서, 키트에 관한 것이다.The present invention relates to a nucleic acid aptamer that specifically binds to Odontogenic Ameloblast-Associated protein (ODAM) and its use, and more particularly to different nucleic acid aptamers that specifically bind to odam with high affinity. And relates to a method for detecting the odam using the same and a composition, a sensor, a kit for detection.
오담 (ODAM, Odontogenic AMeloblast-Associated protein)은 잇몸(치은)의 접합상피가 치아에 부착하는데 있어 필수적인 단백질이다. 잇몸에 치주염이 발생하여 치아와 상피간의 부착이 상실되면, 상피에 있던 오담 (ODAM, Odontogenic AMeloblast-Associated protein) 이 치주낭으로 유리되어 구강 내 치은열구액 및 타액에서 검출된다. 이를 바탕으로 오담 (ODAM, Odontogenic AMeloblast-Associated protein)을 초기 잇몸질환 (치주질환, 임플란트 주위염)을 조기에 진단할 수 있는 초기 치주염 특이 바이오마커로 활용하고자 한다(KR 10-2016-0060288). 치주염은 환자 스스로의 자각증상이 늦게 나타나는 만성질환으로, 환자가 느끼지 못하는 사이에 염증이 진행되어 치아 주변 조직의 심한 파괴를 야기한다(Lee et al., J Biol Chem. Vol. 290(23), PP. 14740-53, 2015). 따라서 발치가 요구되는 상태로 뒤늦게 치과에 내원하는 경우가 흔하며 이는 임플란트 및 틀니 치료를 요구하여 막대한 경제적 손실을 가져온다. 이에 대해 현재 사용되고 있는 진단 방법은 질환의 결과만을 보여줄 수 있기 때문에 현재 질환의 활성화 상태를 보여줄 수는 없으며, 더불어 높은 거짓 양성을 보이는 한계점을 지닌다. 따라서 치과 혹은 다른 내과 영역에서의 이용이 용이한 형태의 진단 도구, 더 나아가서는 환자 스스로 집에서 손쉽게 자가 진단할 수 있는 진단 키트의 개발이 필요한 실정이다. Odontogenic AMeloblast-Associated protein (ODAM) is an essential protein for the attachment of the gum epithelium to the teeth. When periodontitis develops in the gum and the adhesion between the tooth and the epithelium is lost, the ODAM (Odontogenic AMeloblast-Associated protein) in the epithelium is released into the periodontal sac and is detected in the gingival sulcus and saliva in the oral cavity. Based on this, Odon (Odontogenic AMeloblast-Associated protein) is used as an early periodontitis specific biomarker for early diagnosis of periodontal gum disease (periodontal disease, peri-implantitis) (KR 10-2016-0060288). Periodontitis is a chronic disease that causes the patient's self-recognition to be late. Inflammation progresses without the patient's feeling, causing severe destruction of tissues around the teeth (Lee et al., J Biol Chem. Vol. 290 (23), Pp. 14740-53, 2015). Therefore, it is common to visit the dentist lately with extractions required, which requires implant and denture treatment, resulting in enormous economic loss. The diagnostic method currently used can only show the result of the disease, and thus cannot show the active state of the disease, and also has a high false positive limit. Therefore, it is necessary to develop a diagnostic tool that can be easily used in dentistry or other medical fields, and furthermore, a diagnostic kit that can easily self-diagnose itself at home.
앱타머(aptamer)는 1012~14 정도의 다양성을 가지는 랜덤 핵산 라이브러리로부터 얻어지는 특정 타겟에 대해 높은 특이성과 친화도를 가지는 단일가닥 DNA 또는 RNA 분자 구조체를 말한다. 또한, 앱타머는 센서 분야에서 이용되는 기존의 감지물질인 항체와는 달리 핵산구조체 이므로 열 안정성이 우수하며, 시험관내(in vitro)에서 합성되기 때문에, 동물이나 세포가 따로 필요하지 않아 생산 비용 면에서도 경제적이며, 타겟 물질에 제약이 없어 단백질, 아미노산 같은 생분자 물질부터 환경호르몬, 항생제, 잔류 의약품 등의 저분자 유기화학 물질, 박테리아, 바이러스 등의 다양한 타겟에 대한 앱타머를 합성할 수 있다. 따라서 다양한 타겟 물질에 대한 앱타머가 만들어지고 있으며, 표적 물질과 특이성과 강한 친화도를 가지고 결합하는 앱타머의 특성으로 인해 최근 들어 앱타머를 신약 개발, 약물 전달 시스템 그리고 바이오센서 등에 응용하는 많은 연구가 이루어지고 있다. 따라서, 앱타머는 인체 유래물 내 극미량의 오담 (ODAM, Odontogenic AMeloblast-Associated protein) 농도 측정에 매우 적절한 물질이며, 이를 활용한 나노 바이오 기술을 통해 치주염 관련 질환과 연관된 특정 단백질을 검출하는데도 응용할 수 있다.An aptamer refers to a single-stranded DNA or RNA molecular structure having high specificity and affinity for a specific target obtained from a random nucleic acid library having a variety of about 10 to 12 to 14 . In addition, aptamers are nucleic acid structures unlike antibodies, which are used in the field of sensors, and have excellent thermal stability, and because they are synthesized in vitro, they do not require animals or cells. It is economical and there is no restriction in the target substance, so it is possible to synthesize aptamers for various targets such as biomolecules such as proteins and amino acids, low molecular organic chemicals such as environmental hormones, antibiotics and residual medicines, bacteria and viruses. Therefore, aptamers for various target materials are being produced, and due to the properties of aptamers that bind with specificity and strong affinity with target materials, many researches have recently applied aptamers to drug development, drug delivery systems, and biosensors. It is done. Therefore, aptamers are very suitable for measuring trace amounts of Odontogenic AMeloblast-Associated protein (ODAM) in human derivatives, and nano biotechnology can be used to detect specific proteins associated with periodontitis-related diseases.
앱타머 개발 방법에 있어서 가장 중요한 요소는 타겟물질에 결합한 DNA (혹은 RNA)와 결합하지 않은 DNA를 구별하는 것인데, 이를 위하여 타겟을 고정하거나 DNA 랜덤 라이브러리를 고정하여 DNA를 구별하는 방법이 시도되었다. 그러나 이러한 고정화 방식은 고정화 수율이 낮고 고정화 수율 자체를 분석하는데 많은 비용과 시간이 소모된다. 또한 고정화에 사용되는 분리용 물질 (자성 비드, 컬럼 등)에 DNA가 비특이적으로 결합할 가능성을 완전히 배제할 수 없으며 고정된 타겟에 결합한 DNA를 다시 분리해내는 과정에서 DNA 풀의 손실이 일어날 수 있다는 것 등이 여전히 문제이다. 그 외에도 중금속 이온 등은 고정화 자체가 어려워 고정화 방식을 이용한 앱타머의 합성은 타겟 선정에도 제약이 있을 수 있다. 이에, 고정화 방식의 한계를 극복하는 비고정화 방식의 앱타머 개발 기술이 시도되었다. 그러나 비고정화 방식의 미세전자기계 시스템 (MEMS), 모세관 전기이동 시스템 (Capillary Electrophoresis) 기술은 고가의 장비, 장치 사용의 복잡성, 숙련된 인력의 필요성 드이의 문제점이 나타났다. 한편, 그래핀은 2차원 구조의 탄소 구조체이므로 열안정성, 전기적 특성 및 강도가 매우 우수하며, 단일가닥 DNA의 염기 부분과 π-스태킹을 통해 결합하기 때문에 이런 특성을 응용한 광범위한 연구가 진행되고 있다.The most important factor in the aptamer development method is to distinguish between DNA (or RNA) bound to a target material and non-binding DNA. To this end, a method of distinguishing DNA by fixing a target or fixing a random DNA library has been attempted. However, this immobilization method has a low immobilization yield and is expensive and time consuming to analyze the immobilization yield itself. In addition, the possibility of nonspecific binding of DNA to separation materials (magnetic beads, columns, etc.) used for immobilization cannot be completely ruled out, and DNA pool loss may occur in the process of re-isolating DNA bound to a fixed target. It is still a problem. In addition, since heavy metal ions are difficult to immobilize themselves, synthesis of aptamers using immobilization may have limitations in target selection. Accordingly, an attempt has been made to develop a non-immobilized aptamer that overcomes the limitations of immobilization. However, non-immobilized microelectromechanical systems (MEMS) and capillary electrophoresis technology have shown problems such as expensive equipment, complex use of devices, and the need for skilled personnel. On the other hand, since graphene is a two-dimensional carbon structure, it has excellent thermal stability, electrical properties, and strength. Since graphene binds to the base portion of single-stranded DNA through π-stacking, extensive research is being applied to apply this property. .
FRET(fluorescence resonance energy transfer) 진단법은 그 준비의 편리성과 간단한 작동법으로 인해 앱타머의 작동여부를 빠르고 간단하게 확인하는데 적합하다. 그래핀옥사이드는 소광물질(quencher)로서 FAM이라는 형광물질과 특정 거리 내에 존재할 때 520nm 근처에서 방출하는 FAM의 빛 에너지를 흡수한다. 이러한 현상을 FRET이라고 하며 이 실험은 다음과 같은 원리로 이루어진다. FAM으로 단일 가닥 DNA의 3’끝을 표지하고 이를 그래핀옥사이드와 반응시킨다. 그래핀옥사이드는 단일 가닥 DNA와 π-π 결합을 통해 비특이적으로 결합하고 이에 의해 FAM의 형광은 그래핀옥사이드에 의해 소광된다. 이 후 타겟을 넣어주면 단일 가닥 DNA와 타겟 간의 친화도가 그래핀옥사이드와의 친화도보다 큰 경우에 DNA가 그래핀 옥사이드로부터 떨어져 나와 다시 FAM의 형광이 나타난다. 반면 DNA와 타겟 사이 친화도가 더 낮은 경우에는 표적 단백질이 그래핀옥사이드에서 DNA 를 분리하지 못해 형광은 소광된 상태를 유지한다. 결합력의 차이가 형광의 방출량 차이로 나타나는 이러한 특성을 바탕으로 형광을 측정함으로써 단일 가닥 DNA과 타겟 간의 결합력을 확인할 수 있다(Zhu Y et al., ACS Appl Mater Interfaces, Vol 7(14, pp. 7492-7496, 2015). 또한, 앱타머를 사용하여 타겟의 유무를 판단하는데도 사용할 수 있다. Fluorescence resonance energy transfer (FRET) diagnostics are suitable for quick and simple verification of the aptamer's operation due to its ease of preparation and simple operation. Graphene oxide is a quencher and absorbs the light energy of FAM, which emits near 520 nm when present within a certain distance from a fluorescent material called FAM. This phenomenon is called FRET and this experiment is based on the following principle. The 3 'end of the single stranded DNA is labeled with FAM and reacted with graphene oxide. Graphene oxide binds non-specifically with single-stranded DNA through π-π binding, whereby fluorescence of FAM is quenched by graphene oxide. Subsequently, when the target is added, the DNA is released from the graphene oxide when the affinity between the single-stranded DNA and the target is greater than that of the graphene oxide, and the fluorescence of FAM appears again. On the other hand, when DNA and the target have lower affinity, the target protein does not separate the DNA from the graphene oxide and the fluorescence remains quenched. Based on these characteristics, where the difference in binding force is the difference in the amount of fluorescence emitted, fluorescence can be measured to confirm the binding force between single-stranded DNA and the target (Zhu Y et al., ACS Appl Mater Interfaces, Vol 7 (14, pp. 7492). -7496, 2015. It can also be used to determine the presence or absence of a target using aptamers.
SPR(surface plasmon resonance) 진단법은 매우 민감한 진단법으로 타겟의 존재 양을 민감하게 확인하는데 유용하다. SPR 칩의 금속 표면에 일정 질량 이상이 결합하게 되면 이는 금속표면에 형성되는 플라스몬(plasmon)을 동요시켜 공명 파장 변화를 일으키는데 이는 결과적으로 표면 위 굴절률 변화로 나타난다. SPR 칩 위에 스트렙타아비딘(streptavidin)-비오틴(biotin) 결합을 이용해 앱타머를 고정시키고 그 위로 타겟을 흘려주면 앱타머와 결합한 타겟의 양에 비례하여 SPR 신호가 증가한다. 이러한 특성을 바탕으로 SPR을 통해 타겟 단백질을 정량적으로 검출할 수 있다(Lee et al., Anal CHem, Vol 80(8), pp. 2867-2873, 2008). 뿐만 아니라, 하나의 타겟 단백질의 서로 다른 부위 혹은 여러 개의 동일한 부위에 결합할 수 있는 앱타머 듀오를 스크리닝하고 이를 타겟 검출법에 활용함으로써, 타겟에 대한 앱타머의 민감도를 향상시킬 수 있다.Surface plasmon resonance (SPR) diagnostics are very sensitive and useful for sensitively determining the amount of target present. When more than a certain mass is bonded to the metal surface of the SPR chip, it causes a change in the resonant wavelength by shaking the plasmon formed on the metal surface, which results in a change in refractive index on the surface. Using a streptavidin-biotin bond on the SPR chip to fix the aptamer and shed the target over it increases the SPR signal in proportion to the amount of target bound to the aptamer. Based on these characteristics, target proteins can be detected quantitatively through SPR (Lee et al., Anal CHem, Vol 80 (8), pp. 2867-2873, 2008). In addition, by screening aptamer duo which can bind to different sites or several same sites of a single target protein and using it in the target detection method, sensitivity of the aptamer to the target can be improved.
이에, 본 발명자들은 오담 (ODAM, Odontogenic AMeloblast-Associated protein) 검출 방법의 개선을 위해 예의 연구 노력한 결과, 오담 (ODAM, Odontogenic AMeloblast-Associated protein)에 대해 특이적으로 높은 친화도를 보이는 핵산 구조체인 DNA 앱타머를 SELEX를 통해 개발하였다. 또한, 상기 오담 (ODAM, Odontogenic AMeloblast-Associated protein)에 특이적으로 결합 가능한 DNA 앱타머를 포함하는 SPR 칩을 제조하여 오담 (ODAM, Odontogenic AMeloblast-Associated protein)을 효과적으로 검출할 수 있음을 확인하고, 본 발명을 완성하였다.Therefore, the present inventors have made intensive studies to improve the detection method of Odontogenic AMeloblast-Associated protein (ODAM), and thus, DNA, which is a nucleic acid construct showing a particularly high affinity for Odontogenic AMeloblast-Associated protein (ODAM) Aptamer was developed by SELEX. In addition, it was confirmed that the OPR (ODAM, Odontogenic AMeloblast-Associated protein) can be effectively detected by preparing an SPR chip including a DNA aptamer specifically binding to the Odontogenic AMeloblast-Associated protein (ODAM). The present invention has been completed.
본 배경기술 부분에 기재된 상기 정보는 오직 본 발명의 배경에 대한 이해를 향상시키기 위한 것이며, 이에 본 발명이 속하는 기술분야에서 통상의 지식을 가지는 자에게 있어 이미 알려진 선행기술을 형성하는 정보를 포함하지 않을 수 있다.The above information described in this Background section is only for improving the understanding of the background of the present invention, and therefore does not include information that forms a prior art known to those of ordinary skill in the art. You may not.
본 발명의 목적은 오담 (ODAM, Odontogenic AMeloblast-Associated protein)을 특이적으로 검출할 수 있는 핵산 앱타머 및 그 용도를 제공하는 것이다.It is an object of the present invention to provide a nucleic acid aptamer capable of specifically detecting Odontogenic AMeloblast-Associated protein (ODAM) and its use.
상기 목적을 달성하기 위하여, 본 발명은 서열번호 1 내지 18 중 어느 하나의 염기서열로 표시되는, 오담 (ODAM, Odontogenic AMeloblast-Associated protein)에 특이적으로 결합하는 핵산 앱타머를 제공한다. In order to achieve the above object, the present invention provides a nucleic acid aptamer specifically binding to Odam (Odontogenic AMeloblast-Associated protein), represented by any one of SEQ ID NO: 1 to 18.
본 발명은 또한, 상기 핵산 앱타머를 이용한 오담의 검출방법을 제공한다. The present invention also provides a method for detecting odam using the nucleic acid aptamer.
본 발명은 또한, 상기 핵산 앱타머를 포함하는 오담 관련 질환의 진단용 조성물을 제공한다.The present invention also provides a composition for diagnosing an odam-related disease comprising the nucleic acid aptamer.
본 발명은 또한, 상기 핵산 앱타머가 고상담체에 고정되어 있는 복합체를 제공한다.The present invention also provides a complex in which the nucleic acid aptamer is fixed to a solid carrier.
본 발명은 또한, 상기 핵산 앱타머 또는 상기 복합체를 포함하는 오담 검출용 조성물, 센서, 및 검출용 키트를 제공한다.The present invention also provides a composition for detecting odam, a sensor, and a kit for detecting the nucleic acid aptamer or the complex.
본 발명에 따르면 오담 (ODAM, Odontogenic AMeloblast-Associated protein)에 특이적으로 결합 가능한 DNA 앱타머를 이용하여 체내의 오담 (ODAM, Odontogenic AMeloblast-Associated protein)을 보다 간편하게 검출할 수 있다. 또한, 본 발명의 DNA 앱타머를 포함하는 오담 검출 방법 및 장치에 이용하여 극소량의 오담이 포함되어 있는 시료에서 타겟을 선택적으로 측정할 수 있다. 따라서, 인간의 혈중 내에 존재하는 오담 (ODAM, Odontogenic AMeloblast-Associated protein) 농도를 쉽고 빠르게 측정함으로써 오담 (ODAM, Odontogenic AMeloblast-Associated protein) 관련 질병 진단에 유용하다.According to the present invention, it is possible to more easily detect ODAM (Odontogenic AMeloblast-Associated protein) in the body by using a DNA aptamer that can specifically bind to Odontogenic AMeloblast-Associated protein (ODAM). In addition, the target can be selectively measured in a sample containing a very small amount of odam by using the odam detection method and apparatus including the DNA aptamer of the present invention. Therefore, it is useful for diagnosing diseases related to Odontogenic AMeloblast-Associated protein (ODAM) by quickly and easily measuring the concentration of Odontogenic AMeloblast-Associated protein (ODAM) present in human blood.
도 1은 앱타머를 이용한 FRET 분석법을 나타낸 것이다.
도 2는 그래핀옥사이드를 이용하여 오담 (ODAM, Odontogenic AMeloblast-Associated protein)에 특이적으로 결합 가능한 DNA 앱타머 제조 과정의 모식도이다.
도 3은 selection round 에서부터 얻어진 오담 (ODAM, Odontogenic AMeloblast-Associated protein)에 결합하는 ssDNA 의 양이 증가함을 보여주는 그래프이다
도 4 내지 도 21은 본 발명에 따른 서열번호 1 내지 서열번호 18의 오담 (ODAM, Odontogenic AMeloblast-Associated protein)에 특이적으로 결합 가능한 DNA 앱타머의 2차 구조를 나타낸 것이다.
도 22는 DNA 앱타머의 오담 (ODAM, Odontogenic AMeloblast-Associated protein)에 대한 친화도에 대한 FRET 분석 결과를 나타낸 것이다.
도 23은 DNA 앱타머 OD 5R-35 및 OD 5R-64를 이용한 오담 (ODAM, Odontogenic AMeloblast-Associated protein)과 타액 내에 가장 많이 존재하며 오담 단백질과 구분되어야 할 대표 단백질인 알파 아멜라아제(alpha amylase)와의 앱타머 반응정도를 SPR 로 비교 분석한 결과를 나타낸 것이다.
도 24는 DNA 앱타머 OD 5R-64를 이용한 다양한 오담 (ODAM, Odontogenic AMeloblast-Associated protein) 농도에 대해 OD 5R-35 앱타머 듀오를 샌드위치 방식으로 반응시킨 후 SPR 분석 결과를 두 가지 그래프로 나타낸 것이다. Figure 1 shows the FRET assay using aptamers.
2 is a schematic diagram of a DNA aptamer manufacturing process capable of specifically binding to Odontogenic AMeloblast-Associated protein (ODAM) using graphene oxide.
3 is a graph showing the increase in the amount of ssDNA binding to Odontogenic AMeloblast-Associated protein (ODAM) obtained from the selection round.
4 to 21 show the secondary structure of the DNA aptamer specifically bindable to Odontogenic AMeloblast-Associated protein (ODAM) of SEQ ID NO: 1 to SEQ ID NO: 18 according to the present invention.
Figure 22 shows the results of the FRET analysis of the affinity of DNA aptamer Odontogenic AMeloblast-Associated protein (ODAM).
FIG. 23 shows alpha amelase (alpha amylase), which is a representative protein that is most frequently present in odontogenic AMeloblast-Associated protein (ODAM) and saliva using
FIG. 24 shows two graphs showing the results of SPR analysis after sandwiching the
다른 식으로 정의되지 않는 한, 본 명세서에서 사용된 모든 기술적 및 과학적 용어들은 본 발명이 속하는 기술분야에서 숙련된 전문가에 의해서 통상적으로 이해되는 것과 동일한 의미를 갖는다. 일반적으로 본 명세서에서 사용된 명명법은 본 기술분야에서 잘 알려져 있고 통상적으로 사용되는 것이다. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.
본 발명의 한 양태에 따르면, 본 발명은 오담 (ODAM, Odontogenic AMeloblast-Associated protein)에 특이적으로 결합 가능한 DNA 앱타머를 GO-SELEX 프로세스를 이용하여 선별하였다. 그 결과, 서열번호 1 내지 18의 염기서열로 표시되는 핵산 앱타머가 상기 오담에 특이적으로 결합하는 것을 확인하였다. 즉, 본 발명의 일 실시예에서는, 오담에 특이적으로 결합 가능한 DNA 앱타머를 GO-SELEX 프로세스를 이용하여 선별한 것이다.According to one aspect of the present invention, the present invention screened DNA aptamers specifically binding to Odontogenic AMeloblast-Associated protein (ODAM) using the GO-SELEX process. As a result, it was confirmed that the nucleic acid aptamer represented by the nucleotide sequences of SEQ ID NOs: 1 to 18 specifically binds to the odam. That is, in one embodiment of the present invention, DNA aptamers specifically bound to odam are selected using the GO-SELEX process.
본 발명의 용어 “GO-SELEX 프로세스”란 임의적으로 합성된 DNA 또는 RNA의 집합에서 특정 분자에 대해 높은 결합력을 지니는 DNA 또는 RNA를 선별하여 증폭시킴으로써 해당 분자의 DNA 결합 서열을 알아내는 방법(J.W. Park, R.Tatavarty, D.W.Kim, H.T.Jung and M.B.Gu (2012), Immobilization-free screening of aptamers assisted by graphene oxide, Chemical Communications, 48,15,2071-2073)을 말한다.The term “GO-SELEX process” of the present invention refers to a method of determining the DNA binding sequence of a molecule by selecting and amplifying a DNA or RNA having a high binding capacity to a specific molecule in a collection of randomly synthesized DNA or RNA (JW Park , R. Tatavarty, DWKim, HTJung and MBGu (2012), Immobilization-free screening of aptamers assisted by graphene oxide, Chemical Communications, 48,15,2071-2073.
따라서, 본 발명은 일 관점에서, 서열번호 1 내지 18 중 어느 하나의 염기서열로 표시되는, 오담 (ODAM, Odontogenic AMeloblast-Associated protein)에 특이적으로 결합하는 핵산 앱타머에 관한 것이다.Therefore, in one aspect, the present invention relates to a nucleic acid aptamer that specifically binds to Odontogenic AMeloblast-Associated protein (ODAM), which is represented by the nucleotide sequence of any one of SEQ ID NOs: 1-18.
본 발명에 있어서, 상기 핵산 앱타머가 RNA인 경우에는 상기 핵산서열에서 T는 U임을 특징으로 할 수 있다.In the present invention, when the nucleic acid aptamer is RNA, T in the nucleic acid sequence may be characterized as U.
본 발명의 핵산 앱타머는 GO-SELEX 공정에 의해 선택된, 오담 (ODAM, Odontogenic AMeloblast-Associated protein)에 특이적으로 결합하는 임의의 염기서열의 핵산 앱타머일 수 있다.The nucleic acid aptamer of the present invention may be any sequence of nucleic acid aptamer specifically binding to Odontogenic AMeloblast-Associated protein (ODAM) selected by the GO-SELEX process.
더욱 구체적으로, 본 발명의 오담 (ODAM, Odontogenic AMeloblast-Associated protein)에 특이적으로 결합할 수 있는 상기 핵산 앱타머는 하기의 단계를 포함하는 방법에 의해 제조될 수 있다:More specifically, the nucleic acid aptamer capable of specifically binding to the Odontogenic AMeloblast-Associated protein (ODAM) of the present invention may be prepared by a method comprising the following steps:
a) 양끝에 PCR용 프라이머 영역을 포함하고 중앙에 30 내지 50개의 임의의 염기를 가지는 단일가닥 핵산 풀 (pool)과 카운터 타겟물질을 완충용액에서 혼합하여 상온에서 결합을 유도하는 단계;a) inducing binding at room temperature by mixing a single-stranded nucleic acid pool having a primer region for PCR at both ends and a 30-50 arbitrary base in the center and a counter target material in a buffer solution;
b) 상기 혼합액에 그래핀을 첨가하여 카운터 타겟물질에 결합하지 않는 단일가닥 핵산이 그래핀 표면에 흡착하도록 유도하는 단계;b) adding graphene to the mixed solution to induce a single-stranded nucleic acid that does not bind to the counter target material to adsorb to the graphene surface;
c) 상기 카운터 타겟물질에 결합하는 타겟 비특이적인 단일가닥 핵산을 제거하고, 오담을 첨가하여 그래핀에 결합된 타겟 특이적인 단일가닥 핵산에 대해 타겟에 의한 배좌 변위(conformational change)를 유발시켜 그래핀으로부터 타겟 특이적인 앱타머를 분리하는 단계;c) removing target nonspecific single-stranded nucleic acid binding to the counter target material, and adding odam, causing conformational change by the target with respect to the target specific single-stranded nucleic acid bound to graphene. Separating the target specific aptamer from the;
d) 상기 단계에서 얻은 타겟물질에 특이적으로 결합하는 단일가닥 핵산에 대해 상기 PCR용 프라이머를 이용하여 PCR을 수행하여 증폭시키는 단계; 및d) amplifying the single-stranded nucleic acid specifically binding to the target material obtained in the step by performing PCR using the primer for PCR; And
e) 상기 단계에서 얻은 PCR 생산물로부터 단일가닥 핵산을 분리하고 상기 단일가닥 핵산을 a) 단계의 혼합액에 첨가하여 그래핀 기반 선별과정을 반복 수행하는 단계.e) separating the single-stranded nucleic acid from the PCR product obtained in the step and adding the single-stranded nucleic acid to the mixture of step a) to repeat the graphene-based selection process.
상기 핵산 앱타머 제조방법의 d) 단계에서, 프라이머 쌍 중 하나에 플루오레세인(fluorescein)이 붙여진 프라이머를 사용하여 PCR을 수행한 후, 전기영동을 통해 기 변성된 단일가닥 DNA를 분리하는 단계를 더 포함하는 것을 특징으로 할 수 있다.In step d) of the nucleic acid aptamer manufacturing method, PCR is performed using a primer to which fluorescein is attached to one of the primer pairs, and then the single-stranded DNA is separated by electrophoresis. It may be characterized in that it further comprises.
본 발명은 다른 관점에서, 본 발명의 핵산 앱타머를 시료와 접촉시키는 단계를 포함하는 오담 (ODAM, Odontogenic AMeloblast-Associated protein)의 검출방법에 관한 것이다. In another aspect, the present invention relates to a method for detecting Odontogenic AMeloblast-Associated protein (ODAM) comprising contacting a nucleic acid aptamer of the present invention with a sample.
본 발명에 있어서, 상기 시료는 조직, 세포, 혈액, 혈청, 혈장, 타액, 객담 및 뇨로 구성된 군에서 선택되는 것을 특징으로 할 수 있으나, 이에 제한되는 것은 아니다. 상기 시료는 포유류, 바람직하게는 인체에서 분리된 것으로, 최소 침습으로 확보 가능한 시료 또는 분비체액, in vitro 세포배양액 성분 시료 등 오담을 포함하고 있을 수 있는 시료이면, 상기에 한정되지 않음은 자명하다. 보다 바람직하게는 타액 일 수 있다. In the present invention, the sample may be selected from the group consisting of tissues, cells, blood, serum, plasma, saliva, sputum and urine, but is not limited thereto. If the sample is separated from a mammal, preferably a human body, and the sample may contain odam, such as a sample or secretory fluid that can be obtained with minimal invasion, in vitro cell culture solution component, it is obvious that the sample is not limited to the above. More preferably saliva Can be.
본 발명에 있어서, 상기 검출은 표면 플라스몬 공명(SPR, Surface Plasmon Resonance), FRET(Fluorescence resonance energy transfer) 및 금 나노입자 기반 색도 분석으로 구성된 군에서 선택되는 방법으로 검출하는 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.In the present invention, the detection may be characterized by detecting by a method selected from the group consisting of surface plasmon resonance (SPR, Surface Plasmon Resonance), FRET (Fluorescence resonance energy transfer) and gold nanoparticle-based chromaticity analysis It is not limited to this.
본 발명에서 상기 검출은 금 나노입자 표면을 변형하여 앱타머를 금 나노입자 표면에 공유결합 등으로 고정하여 타겟 물질이 있을 때 두 개 이상의 금 나노입자 거리가 서로 가까워짐으로 인해 응집(aggregation)이 일어나서 금 나노입자 용액의 색이 붉은색에서 푸른색 계열로 변하는 특징을 이용하거나, 변형되지 않은 금 나노입자 표면에 앱타머가 물리적으로 흡착되어 있다가 타겟 물질이 있을 때 흡착되어 있던 앱타머과 타겟과의 결합으로 인해 금 나노입자의 표면에서 떨어져 나오는 현상에 의해 색이 변하는 특성을 이용하여 오담을 검출할 수 있다. In the present invention, the detection is performed by modifying the surface of the gold nanoparticles to fix aptamers on the surface of the gold nanoparticles by covalent bonding, etc., when the target material is present, when aggregation of two or more gold nanoparticles is brought closer to each other. By utilizing the feature that the color of the gold nanoparticle solution changes from red to blue, or the aptamer is physically adsorbed on the surface of the unmodified gold nanoparticle, the aptamer adsorbed when the target material is present Due to the phenomenon that the color changes by the phenomenon of falling off the surface of the gold nanoparticles can detect the odam.
상기 검출은 또한, 금 칩(gold chip)을 이용한 자기공명분석 SPR (Surface Plasmon Resonance) 장비로 오담을 검출할 수 있다. 즉, 금 칩 (gold chip)에 앱타머를 공유결합 등으로 고정하여 타겟 물질이 있을 때 증가하는 response unit 값을 측정하는 방식을 이용하여 오담을 검출할 수 있다.The detection may also detect odam with magnetic resonance analysis SPR (Surface Plasmon Resonance) equipment using gold chips. In other words, the aptamer may be fixed to the gold chip by covalent bonds to detect the dam by using a method of measuring a response unit value that increases when there is a target material.
상기 검출은 또한, 그래핀옥사이드 기반 FRET 방법으로 오담을 검출할 수 있다. 즉, 그래핀옥사이드는 소광물질(quencher)로서 FAM이라는 형광물질과 특정 거리 내에 존재할 때 520nm 근처에서 방출하는 FAM의 빛 에너지를 흡수한다. 이러한 현상을 FRET이라고 하며 이 실험은 다음과 같은 원리로 이루어진다. FAM으로 단일 가닥 DNA(본원 발명의 앱타머)의 3’끝을 표지하고 이를 그래핀옥사이드와 반응시킨다. 그래핀옥사이드는 단일 가닥 DNA(본원 발명의 앱타머)와 π-π 결합을 통해 비특이적으로 결합하고 이에 의해 FAM의 형광은 그래핀옥사이드에 의해 소광된다. 이 후 시료 내 오담이 존재할 경우, 단일 가닥 DNA(본원 발명의 앱타머)와 오담 간의 친화도가 그래핀옥사이드와의 친화도보다 큰 경우에 DNA가 그래핀 옥사이드로부터 떨어져 나와 다시 FAM의 형광이 나타난다. 반면 DNA(본원 발명의 앱타머)와 오담 사이 친화도가 더 낮은 경우에는 오담이 그래핀옥사이드에서 DNA 를 분리하지 못해 형광은 소광된 상태를 유지한다. 결합력의 차이가 형광의 방출량 차이로 나타나는 이러한 특성을 바탕으로 형광을 측정함으로써 단일 가닥 DNA과 오담 간의 결합력을 확인할 수 있다. The detection can also detect odam with a graphene oxide based FRET method. That is, graphene oxide absorbs the light energy of FAM emitted near 520 nm when present within a specific distance from a fluorescent material called FAM as a quencher. This phenomenon is called FRET and this experiment is based on the following principle. FAM is used to label the 3 ′ end of single-stranded DNA (aptamers of the present invention) and react with graphene oxide. Graphene oxide binds nonspecifically with single-stranded DNA (aptamers of the present invention) through π-π binding, whereby the fluorescence of FAM is quenched by graphene oxide. Subsequently, in the presence of odam in the sample, when the affinity between single stranded DNA (aptamer of the present invention) and odam is greater than that of graphene oxide, the DNA is released from the graphene oxide and the fluorescence of FAM is displayed again. . On the other hand, in the case where the affinity between DNA (aptamer of the present invention) and odam is lower, it does not separate DNA from graphene oxide, so fluorescence remains quenched. Based on this characteristic, where the difference in binding force is the difference in the amount of emission of fluorescence, the binding force between the single-stranded DNA and the dam can be confirmed by measuring fluorescence.
본 발명의 앱타머는 이 기술분야에서 이미 공지된 방법에 의해 화학 합성할 수도 있다.The aptamers of the present invention may also be chemically synthesized by methods already known in the art.
본 발명의 핵산 앱타머는, 오담에 대한 결합성, 안정성 등을 높이기 위해, 각 뉴클레오티드의 당 잔기 (예를 들어, 리보오스나 디옥시리보스)가 수식된 것이어도 좋다. 당잔기에서 수식되는 부위로서는, 예컨대 당잔기의 2'부위, 3'부위 및/또는 4'부위의 산소원자를 다른 원자로 치환한 것 등을 들 수 있다. 수식의 종류로서는, 예컨대 플루오로화, O-알킬화(예, O-메틸화, O-에틸화), O-알릴화, S-알킬화(예, S-메틸화, S-에틸화), S-알릴화, 아미노화(예, -NH)를 들 수 있다. 이러한 당잔기의 변형은, 자체 공지의 방법에 의해 행할 수 있다 (Sproat et al.,(1991) Nucle. Acid. Res. 19, 733-738; Cotton et al., (1991) Nucl. Acid. Res. 19, 2629-2635; Hobbs et al., (1973) Biochemistry 12, 5138-5145). The nucleic acid aptamer of the present invention may be modified with sugar residues (for example, ribose or deoxyribose) of each nucleotide in order to increase binding to, stability, and the like. Examples of the moiety modified in the sugar residue include those in which the oxygen atoms at the 2 ', 3' and / or 4 'sites of the sugar residue are replaced with other atoms. As the kind of modification, for example, fluorination, O-alkylation (eg O-methylation, O-ethylation), O-allylation, S-alkylation (eg S-methylation, S-ethylation), S-allyl And amination (for example, -NH). Such a sugar residue can be modified by a method known per se (Sproat et al., (1991) Nucle. Acid. Res. 19, 733-738; Cotton et al., (1991) Nucl. Acid.Res). 19, 2629-2635; Hobbs et al., (1973) Biochemistry 12, 5138-5145).
본 발명의 핵산 앱타머는 또한 오담에 대한 결합성 등을 높이기 위해, 핵산염기 (예를 들면, 푸린, 피리미딘)가 변형 (예를 들면, 화학적 치환)된 것이어도 좋다. 이러한 변형으로서는, 예컨대, 5부위 피리미딘 변형, 6 및/또는 8부위 푸린 변형, 환외(環外) 아민에서의 변형, 4-티오우리딘으로의 치환, 5-브로모 또는 5-요오드-우리실으로의 치환을 들 수 있다. The nucleic acid aptamer of the present invention may also be a modified (eg, chemically substituted) nucleic acid base (for example, purine, pyrimidine) in order to increase the binding to odam and the like. Such modifications include, for example, 5-site pyrimidine modifications, 6- and / or 8-site purine modifications, modifications in extrafoam amines, substitution with 4-thiouridines, 5-bromo or 5-iodine-uri Substitution with a thread is mentioned.
또한, 뉴클레아제 및 가수분해에 대하여 내성을 갖도록, 본 발명의 핵산 앱타머에 포함되는 인산기가 변형되어 있어도 좋다. 예컨대, P(0)0기가, P(0)S(티오에이트), P(S)S(디티오에이트), P(O)NR2(아미데이트), P(O)R, R(O)OR', CO 또는 CH2(포름아세탈) 또는 3'-아민(-NH-CH2-CH2-)으로 치환되어 있어도 좋다. 여기서 각각의 R 또는 R'은 독립적으로, H이거나, 또는 치환되어 있거나, 또는 치환되어 있지 않은 알킬 (예, 메틸, 에틸)이다. 연결기로서는, -O-, -N- 또는 -S-가 예시되고, 이들의 연결기를 통하여 인접하는 뉴클레오티드에 결합할 수 있다. In addition, the phosphate group contained in the nucleic acid aptamer of the present invention may be modified so as to be resistant to nuclease and hydrolysis. For example, P (0) 0 group is P (0) S (thioate), P (S) S (dithioate), P (O) NR2 (amidate), P (O) R, R (O) OR ', CO or CH2 (formacetal) or 3'-amine (-NH-CH2-CH2-) may be substituted. Wherein each R or R ′ is independently H, substituted or unsubstituted alkyl (eg methyl, ethyl). As a linking group, -O-, -N-, or -S- is illustrated, and can couple | bond with adjacent nucleotides through these linking groups.
본 발명에서의 변형은 또한, 캡핑과 같은 3' 및 5'의 변형을 포함하여도 좋다.Modifications in the present invention may also include 3 'and 5' modifications, such as capping.
변형은 또한, 폴리에틸렌글리콜, 아미노산, 펩티드, inverted dT, 핵산, 뉴클레오시드, 미리스토일 (Myristoyl), 리쏘콜릭-올레일 (Lithocolic-oleyl), 도코사닐 (Docosanyl), 라우로일 (Lauroyl), 스테아로일 (Stearoyl), 팔미토일 (Palmitoyl), 올레오일 (Oleoyl), 리놀레오일 (Linoleoyl), 그 외 지질, 스테로이드, 콜레스테롤, 카페인, 비타민, 색소, 형광물질, 항암제, 독소, 효소, 방사성 물질, 비오틴 등을 말단에 부가함으로써 행해질 수 있다. 이러한 변형에 대해서는, 예컨대 미국특허 제5,660,985호, 미국특허 제5,756,703호를 참조한다.Modifications also include polyethyleneglycols, amino acids, peptides, inverted dT, nucleic acids, nucleosides, Myristoyl, Lithocolic-oleyl, Docosanyl, Lauroyl Stearoyl, Palmitoyl, Oleoyl, Linoleoyl, Other Lipids, Steroids, Cholesterol, Caffeine, Vitamins, Pigments, Phosphors, Anticancer Agents, Toxins, Enzymes, It can be done by adding radioactive material, biotin and the like to the ends. See, for example, US Pat. No. 5,660,985 and US Pat. No. 5,756,703.
본 발명의 다른 실시예에서는 상기 서열번호 1 내지 18로 표시되는 핵산 앱타머 중 가장 높은 친화도를 보인 서열번호 4로 표시되는 핵산 앱타머인 OD 5R-35 및 서열번호 6으로 표시되는 핵산 앱타머인 OD 5R-64에 대하여, SPR 칩 기반 결합력 분석을 수행한 결과, 오담에 해당 앱타머가 특이적으로 결합함을 확인하였다.In another embodiment of the present invention, the nucleic acid aptamer represented by SEQ ID NO: 4 having the highest affinity among nucleic acid aptamers represented by SEQ ID NOs: 1 to 18,
따라서, 본 발명은 또 다른 관점에서, 상기 핵산 앱타머를 포함하는 오담 관련 질환의 진단용 조성물에 관한 것이다.Therefore, in another aspect, the present invention relates to a composition for diagnosing an odam related disease comprising the nucleic acid aptamer.
본 발명에 있어서, 오담 관련 질환은 오담의 농도가 정상 범위를 벗어나게 되어 발생하는 질환이면 모두 이용 가능하나, 바람직하게는 치주염, 치은염, 상피성 치주암, 두개내 동맥류 및 임플란트 주위염으로 구성된 군에서 선택되는 것을 특징으로 할 수 있으며 이에 제한되는 것은 아니다.In the present invention, odam-related diseases can be used as long as the disease is caused by the concentration of odam outside the normal range, preferably periodontitis, gingivitis, epithelial periodontal cancer, intracranial aneurysm and It may be characterized in that it is selected from the group consisting of peri-implantitis, but is not limited thereto.
상기 오담 관련 질환의 진단은 상기 앱타머와 조직, 세포, 혈액, 혈청, 혈장, 타액, 객담 및 뇨 중에서 선택되는 시료와 접촉시키는 단계를 포함할 수 있다. 상기 시료는 포유류, 바람직하게는 인체에서 분리된 것으로, 최소 침습으로 확보가 가능한 시료 또는 분비체액, in vitro 세포배양액 성분 시료 등 오담을 포함하고 있을 수 있는 시료이면, 상기에 한정되지 않음은 자명하다. Diagnosis of the odam-related disease may include contacting the aptamer with a sample selected from tissue, cells, blood, serum, plasma, saliva, sputum and urine. As long as the sample is separated from a mammal, preferably a human body, a sample capable of securing minimal invasion, or a sample which may contain odam, such as a secretory fluid or an in vitro cell culture component sample, is not limited thereto. .
본 발명은 또 다른 관점에서 본 발명의 핵산 앱타머가 고상담체에 고정되어 있는 복합체에 관한 것이다.In another aspect, the present invention relates to a complex in which the nucleic acid aptamer of the present invention is immobilized on a solid carrier.
본 발명에 있어서, 상기 고상 담체는 기판, 수지, 플레이트, 필터, 카트리지, 컬럼 및 다공재질인 고상 담체로 구성된 군에서 선택되는 것을 특징으로 할 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the solid carrier may be selected from the group consisting of a substrate, a resin, a plate, a filter, a cartridge, a column, and a porous solid carrier, but is not limited thereto.
본 발명에 있어서, 상기 기판은 니켈-PTFE (폴리테트라플루오로에틸렌) 기판, 유리 기판, 아파타이트 (apatite) 기판, 실리콘 기판, 금 기판, 은 기판, 그래핀 옥사이드 기판 및 알루미나 기판으로 구성된 군에서 선택되는 것을 특징으로 할 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the substrate is selected from the group consisting of nickel-PTFE (polytetrafluoroethylene) substrate, glass substrate, apatite substrate, silicon substrate, gold substrate, silver substrate, graphene oxide substrate and alumina substrate It may be characterized as being, but is not limited thereto.
본 발명의 기판은 칩이나 단백질 칩 등에 사용되고 있는 것 등일 수 있고, 예컨대 니켈-PTFE (폴리테트라플루오로에틸렌) 기판이나 유리 기판, 아파타이트 (apatite) 기판, 실리콘 기판, 금, 은, 그래핀 옥사이드 또는 알루미나 기판 등으로, 이들의 기판에 폴리머 등의 코팅을 실시한 것을 들 수 있다.The substrate of the present invention may be a chip, a protein chip, or the like, for example, a nickel-PTFE (polytetrafluoroethylene) substrate, a glass substrate, an apatite substrate, a silicon substrate, gold, silver, graphene oxide, or the like. As an alumina substrate, what coated these board | substrates with polymer etc. is mentioned.
상기 수지는 아가로스 (agarose) 입자, 실리카 입자, 아크릴아미드와 N, N'-메틸렌비스아크릴아미드의 공중합체, 폴리스티렌 가교 디비닐벤젠 입자, 덱스트란을 에피클로로히드린으로 가교한 입자, 셀룰로오스파이버, 알릴덱스트란과 N, N'-메틸렌비스아크릴아미드의 가교폴리머, 단분산계 합성폴리머, 단분산계 친수성폴리머, 세파로오스 (Sepharose) 또는 토요펄(Toyopearl) 등을 들 수 있고, 또한 이들의 수지에 각종 관능기를 결합시킨 수지를 사용할 수 있다.The resin is agarose particles, silica particles, copolymers of acrylamide and N, N'-methylenebisacrylamide, polystyrene crosslinked divinylbenzene particles, particles crosslinked with dextran with epichlorohydrin, cellulose fiber , Crosslinked polymers of allyldextran and N, N'-methylenebisacrylamide, monodisperse synthetic polymers, monodisperse hydrophilic polymers, Sepharose or Toyopearl, and the like, and these resins may also be mentioned. Resin which combined various functional groups to can be used.
상기 고상담체는 오담의 정제, 오담 단백질의 검출 또는 정량에 유용할 수 있다.The solid carrier may be useful for purifying odam, detecting or quantifying odam protein.
본 발명의 핵산 앱타머는 공지의 방법에 의해 고상담체에 고정할 수 있다. 예컨대, 친화성 물질이나 소정의 관능기를 본 발명의 앱타머에 도입하고, 계속해서 이 친화성 물질이나 소정의 관능기를 이용하여 고상담체에 고정화하는 방법을 들 수 있다. 소정의 관능기는 커플링 반응에 제공하는 것이 가능한 관능기일 수 있고, 예컨대 아미노기, 티올기, 히드록실기, 카르복실기를 들 수 있다. 예를 들어, 상기 앱타머의 말단에 바이오틴을 결합시켜 복합체를 형성하고, 상기 칩 등의 기판 표면에 스트렙타비딘을 고정화시켜, 상기 바이오틴과 기판 표면에 고정화된 스트렙타비딘의 상호작용에 의하여 상기 앱타머를 기판 표면에 고정화시킬 수 있다.The nucleic acid aptamer of the present invention can be fixed to a solid carrier by a known method. For example, a method of introducing an affinity substance or a predetermined functional group into the aptamer of the present invention and subsequently immobilizing the solid carrier using the affinity substance or the predetermined functional group is mentioned. The predetermined functional group may be a functional group which can be provided to the coupling reaction, and examples thereof include amino groups, thiol groups, hydroxyl groups, and carboxyl groups. For example, the biotin is bonded to the terminal of the aptamer to form a complex, and the streptavidin is immobilized on the surface of the chip such as the chip so that the biotin interacts with the streptavidin immobilized on the substrate surface. The aptamer can be immobilized on the substrate surface.
앱타머가 고정화된 고상담체를 이용하여 오담 단백질을 검출하는 방법은, 예를 들어, 본 발명의 DNA 앱타머를 칩 (chip)상에 형광물질, 발색물질 또는 항체 등과 함께 스팟팅 한 후 혈액샘플을 반응시킴으로써 검출 시료, 예를 들어, 혈액 중에 포함된 미량의 오담의 수준을 신속하게 측정할 수 있다. 또 다른 방법으로는 자성 비드에 상기 DNA 앱타머를 고정화시켜 오담을 결합시키게 되면 결합된 DNA 앱타머-오담 복합체를 자석을 이용하여 분리할 수 있게 되고, 이 복합체로부터 다시 오담을 분리함으로써 오담만을 선택적으로 검출할 수 있게 된다. A method for detecting an odam protein using a solid carrier having an aptamer immobilized, for example, spotting a blood sample after spotting a DNA aptamer of the present invention on a chip with a fluorescent material, a coloring material or an antibody, etc. By reacting, the level of trace odam contained in a detection sample, for example, blood, can be measured promptly. In another method, when the DNA aptamer is immobilized on magnetic beads to bind the odam, the bound DNA aptamer-odam complex can be separated using a magnet. Can be detected.
본 발명은 또 다른 관점에서, 본 발명의 핵산 앱타머 또는 상기 핵산 앱타머가 고상담체에 고정되어 있는 복합체를 포함하는 오담 검출용 조성물에 관한 것이다.In still another aspect, the present invention relates to a composition for detecting odam comprising a nucleic acid aptamer or a complex in which the nucleic acid aptamer is fixed to a solid carrier.
본 발명의 오담 검출용 조성물은 오담을 검출하기 위한 것으로, 오담의 검출을 위해 본 발명의 핵산 앱타머를 이용하여 어떠한 형태로도 사용할 수 있다. 예를 들어, 본 발명의 핵산 앱타머를 자성비드에 고정화시켜 오담을 결합시키게 되면 결합된 DNA 앱타머-어딤 복합체(complex)를 자석을 이용하여 분리할 수 있게 되고, 이 복합체로부터 다시 오담을 분리함으로서 오담만을 선택적으로 검출할 수 있게 된다.The composition for detecting odam of the present invention is for detecting odam, and may be used in any form using the nucleic acid aptamer of the present invention for detecting odam. For example, by immobilizing the nucleic acid aptamer of the present invention to magnetic beads to bind the dam, the bound DNA aptamer-dim complex can be separated using a magnet, and the dam is separated from the complex again. By doing so, only the odam can be selectively detected.
본 발명의 조성물을 이용하는 오담의 제거방법의 한 예를 들면, 상기 핵산 앱타머가 고정화된 자성비드를 컬럼 (column)에 채운 후 오담을 포함하는 시료를 통과시켜 오담만을 선택적으로 제거할 수 있다.As an example of a method for removing odam using the composition of the present invention, after filling the column with magnetic beads immobilized with the nucleic acid aptamer, a sample containing odam may be selectively removed.
본 발명의 다른 실시 예에서는 상기 서열번호 1 내지 18로 표시되는 핵산 앱타머 중 가장 높은 친화도를 보인 서열번호 6으로 표시되는 핵산 앱타머 OD 5R-64에 대하여 SPR 칩 및 금 나노입자로 표지된 OD 5R-35 기반의 샌드위치 분석을 수행한 결과, 상기 샌드위치 방식을 사용할 경우, 오담에 대한 민감도가 증가함을 확인하였다. In another embodiment of the present invention is labeled with SPR chip and gold nanoparticles for the nucleic
따라서 본 발명은 또 다른 관점에서, (a) 서열번호 6으로 표시되는 앱타머가 고상담체에 고정되어 있는 복합체, 또는 서열번호 6으로 표시되는 앱타머를 함유하는 키트 또는 센서에 시료를 접촉시키는 단계; 및 (b) 서열번호 4로 표시되는 앱타머를 추가로 접촉시키는 단계; 를 포함하는 오담(ODAM, Odontogenic Ameloblast-Associated protein) 검출방법에 관한 것이다.Therefore, in another aspect, the present invention provides a method for preparing a kit comprising: (a) contacting a sample with a kit or sensor containing a complex having an aptamer represented by SEQ ID NO: 6 fixed to a solid carrier, or an aptamer represented by SEQ ID NO: 6; And (b) further contacting the aptamer represented by SEQ ID NO: 4; It relates to a method for detecting ODAM (ODAM, Odontogenic Ameloblast-Associated protein).
본 발명에 있어서, 상기 서열번호 4로 표시되는 앱타머는 금 나노입자로 표지되는 것을 특징으로 할 수 있으나, 이에 한정되는 것은 아니다.In the present invention, the aptamer represented by SEQ ID NO: 4 may be characterized by being labeled with gold nanoparticles, but is not limited thereto.
본 발명은 또한, 상기 오담에 특이적으로 결합하는 앱타머 또는 상기 핵산 앱타머가 고상담체에 고정되어 있는 복합체를 함유하는 오담의 검출센서에 관한 것이다.The present invention also relates to a sensor for detecting an odam containing an aptamer specifically binding to the odam or a complex in which the nucleic acid aptamer is fixed to a solid carrier.
상기 오담에 특이적으로 결합하는 앱타머 또는 상기 핵산 앱타머가 고상담체에 고정되어 있는 복합체를 함유하는 검출 센서 시스템은, 키트(kit)의 형태로 제공될 수 있다. 오담 검출용 키트는 병, 통(tub), 작은 봉지(sachet), 봉투(envelope), 튜브, 앰플(ampoule) 등과 같은 형태를 취할 수 있으며 이들은 부분적으로 또는 전체적으로 플라스틱, 유리, 종이, 호일, 왁스 등으로부터 형성될 수 있다. 용기는, 처음에는 용기의 일부이거나 또는 기계적, 접착성, 또는 기타 수단에 의해 용기에 부착될 수 있는, 완전히 또는 부분적으로 분리가 가능한 마개를 장착할 수 있다. 용기는 또한 주사바늘에 의해 내용물에 접근할 수 있는, 스토퍼가 장착될 수 있다. 상기 키트는 외부 패키지를 포함할 수 있으며, 외부 패키지는 구성 요소들의 사용에 관한 사용설명서를 포함할 수 있다.The detection sensor system containing the complex in which the aptamer specifically binding to the odam or the nucleic acid aptamer is fixed to the solid carrier may be provided in the form of a kit. Kits for detecting odor may take the form of bottles, tubs, small sachets, envelopes, tubes, ampoules, etc., which may be partially or wholly plastic, glass, paper, foil, wax And the like. The container may be equipped with a fully or partially separable stopper, which may initially be part of the container or attached to the container by mechanical, adhesive, or other means. The container may also be equipped with a stopper, which may be accessible to the contents by a needle. The kit may include an external package, which may include instructions for use of the components.
본 발명에 따른 오담에 특이적으로 결합하는 앱타머는 또한, 오담만을 특이적으로 검출하는바, 이를 포함하여 오담의 검출 또는 제거용 조성물을 제공할 수 있음은 본 발명이 속하는 기술분야에서 당업자에게 자명한 것이다.Aptamers that specifically bind to odam according to the present invention also specifically detect only odam, and it is apparent to those skilled in the art that the present invention can provide a composition for detecting or removing odam. It is.
본 발명은 또 다른 관점에서, 오담에 특이적으로 결합하는 앱타머 또는 상기 핵산 앱타머가 고상담체에 고정되어 있는 복합체를 이용한 오담의 제거방법에 관한 것이다. 본 발명의 한 양태에 따르면, 바람직하게는 상기 앱타머가 고정된 비드를 컬럼에 충진하고 오담이 포함된 시료를 통과시켜 오담을 제거할 수 있다.In another aspect, the present invention relates to a method for removing odam using an aptamer specifically binding to odam or a complex in which the nucleic acid aptamer is fixed to a solid carrier. According to one aspect of the present invention, preferably, the aptamer-immobilized beads may be filled in a column and passed through a sample containing the odam to remove the odam.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다. Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as being limited by these examples.
실시예 1: 임의의 염기서열을 가지는 DNA pool 합성Example 1 DNA Pool Synthesis with Arbitrary Sequences
56mer DNA pool로서 양 끝에 PCR을 위한 프라이머 영역(primer region)이 있고 중앙에 임의의 염기를 가진 DNA pool을 아래와 같은 방법으로 합성하였다. 본 발명에 사용된 DNA pool은 Genotech Inc. Korea에 화학적으로 합성을 의뢰하였다.As a 56mer DNA pool, a primer region for PCR at both ends and a DNA pool having an arbitrary base in the center were synthesized as follows. DNA pools used in the present invention is Genotech Inc. Chemically commissioned to Korea.
CCATTCGTACGCAACAGG -random region- GTGGATGGCTCTGAATGCCCATTCGTACGCAACAGG -random region- GTGGATGGCTCTGAATGC
서열번호 19: CCATTCGTACGCAACAGGSEQ ID NO: 19: CCATTCGTACGCAACAGG
서열번호 20: GCATTCAGAGCCATCCACSEQ ID NO: 20 GCATTCAGAGCCATCCAC
실시예 2: GO-SELEX 프로세스를 이용한 오담 (ODAM, Odontogenic AMeloblast-Associated protein)에 특이 DNA 앱타머의 선별Example 2: Screening of Specific DNA Aptamers to Odontogenic AMeloblast-Associated Protein (ODAM) Using GO-SELEX Process
실시예 1에서 합성한 랜덤 DNA pool을 버퍼용액(137mM NaCl, 2.7mM KCl, 10mM Na2HPO4, 1.8mM KH2PO4)에 넣고 그래핀옥사이드 용액과 혼합하여 30분간 상온에서 반응시켰으며, 그래핀옥사이드와 결합하지 않은 DNA를 원심분리 후 상층액을 제거함으로써 제거하였다. 본 혼합액에 타겟을 혼합하여 30 분간 4 ℃에서 반응시킨 다음, 원심분리를 통해 그래핀옥사이드를 제거한 후, 에탄올 침전법으로 타겟에 의해 그래핀옥사이드에서 분리된 DNA를 확보하였다.The random DNA pool synthesized in Example 1 was added to a buffer solution (137mM NaCl, 2.7mM KCl, 10mM Na2HPO4, 1.8mM KH2PO4) and mixed with a graphene oxide solution and reacted at room temperature for 30 minutes, and not bound with graphene oxide. DNA was removed by centrifugation to remove supernatant. The target was mixed with the target mixture and reacted at 4 ° C. for 30 minutes. After removing the graphene oxide by centrifugation, the DNA was separated from the graphene oxide by the target by ethanol precipitation.
수득한 오담 (ODAM, Odontogenic AMeloblast-Associated protein)에 특이적으로 결합하는 DNA의 양을 측정한 결과, 도 3에 개시된 바와 같이 각 선별단계 (selection round) 에서 수득한 오담 (ODAM, Odontogenic AMeloblast-Associated protein) 에 결합하는 DNA의 양이 증가하는 것을 확인하였다.As a result of measuring the amount of DNA specifically binding to the obtained Odontogenic AMeloblast-Associated protein (ODAM), Odontogenic AMeloblast-Associated obtained in each selection round as shown in FIG. The amount of DNA that binds to the protein) was increased.
GO-Counter SELEX에서는 랜덤 DNA pool과 그래핀옥사이드를 반응시킨 후 카운터 타겟[타액]을 혼합하여 30분간 4 ℃에서 반응시킨 후, 원심분리하여 상층액을 제거함으로써 카운터 타겟에 의해 그래핀옥사이드로부터 분리된 DNA를 제거한 다음, 타겟[오담 (ODAM, Odontogenic AMeloblast-Associated protein)]를 넣고 30분간 4 ℃에서 반응시키고 나서, 원심분리를 통해 그래핀옥사이드를 제거한 후 에탄올 침전법으로 타겟에 얻어진 그래핀옥사이드에서 분리된 DNA를 확보하였다. In GO-Counter SELEX, after reacting random DNA pool and graphene oxide, the counter target [saliva] is mixed and reacted at 4 ° C. for 30 minutes, and then separated from the graphene oxide by counter target by centrifugation to remove supernatant. After removing the DNA, the target [ODAM (Odontogenic AMeloblast-Associated protein)] was added and reacted at 4 ° C. for 30 minutes, followed by centrifugation to remove graphene oxide, followed by graphene oxide obtained on the target by ethanol precipitation. DNA isolated from was obtained.
실시예 3: 오담 (ODAM, Odontogenic AMeloblast-Associated protein) 에 결합 가능한 DNA 앱타머 pool의 제조Example 3: Preparation of DNA Aptamer Pool Binding to Odontogenic AMeloblast-Associated Protein (ODAM)
오담 (ODAM, Odontogenic AMeloblast-Associated protein)과 결합 특이적인 DNA의 양을 늘리기 위해 이미 알고 있는 프라이머 영역을 이용하여 PCR을 수행하였다. PCR was performed using known primer regions to increase the amount of binding specific DNA with Odontogenic AMeloblast-Associated protein (ODAM).
PCR 생산물은 두 가닥의 DNA이므로 이를 단일가닥으로 분리하기 위한 과정을 위하여, 아래와 같이 하나의 프라이머에는 플루오레세인(fluorescein)을 고정하였다.Since PCR products are two strands of DNA, in order to separate them into single strands, fluorescein was immobilized on one primer as follows.
forward (APTFf) 5-fluorescein- CCATTCGTACGCAACAGG-3forward (APTFf) 5-fluorescein- CCATTCGTACGCAACAGG-3
: 서열번호19SEQ ID NO: 19
reverse (APTR) 5- GCATTCAGAGCCATCCAC-3: 서열번호 20reverse (APTR) 5- GCATTCAGAGCCATCCAC-3: SEQ ID NO: 20
PCR 반응물을 정제키트(purification kit)를 이용하여 정제한 후, 이중가닥의 DNA를 단일가닥으로 만들기 위해 폴리아크릴아마이드젤 전기영동을 실시하였다.After purifying the PCR reaction using a purification kit (purification kit), polyacrylamide gel electrophoresis was performed to make double-stranded DNA into a single strand.
10%의 폴리아크릴아마이드 젤에는 6M의 요소(urea), 20%의 포름아마이드(formamaid)가 포함되어 있어 전기영동 후에는 두 개의 밴드가 생기는데, 이는 전기영동 과정에서 두 가닥의 DNA가 변성되어 플루오레세인이 붙어있는 DNA 가닥은 위에, 붙어있지 않은 DNA 가닥은 아래에 각각 위치하게 된다. 플루오레세인이 붙어 있는 DNA 밴드를 잘라내어 젤 추출(gel extraction)을 실시한 후, 다시 에탄올 침전법으로 분리된 DNA를 확보하였다. The 10% polyacrylamide gel contains 6M of urea and 20% formamide, resulting in two bands after electrophoresis, which results in two strands of DNA being denatured during electrophoresis. Resins are attached to the top of the DNA strands, while the unattached DNA strands are located below. DNA bands with fluorescein were cut out and gel extracted, followed by ethanol precipitation to obtain DNA separated.
이 때 확보된 DNA pool은 다시 처음의 타겟이 들어 있는 버퍼용액과 혼합하여 새로운 선별과정을 시작한다. 이러한 과정의 모식도를 도 2 에 나타내었고, 일련의 과정(SELEX process)을 한 번의 선별 (selection)이라 하면 GO-SELEX 는 총 4번의 선별과정과 2번의 카운터 선별과정을 거쳐 오담 (ODAM, Odontogenic AMeloblast-Associated protein)에 결합하는 DNA pool을 얻었다. At this time, the obtained DNA pool is mixed with the buffer solution containing the original target to start a new screening process. A schematic diagram of this process is shown in FIG. 2, and if a series of processes (SELEX process) is one selection, GO-SELEX undergoes a total of four screening processes and two counter screening processes (ODAM, Odontogenic AMeloblast). DNA pools that bind to associated proteins were obtained.
최종적으로 얻어진 DNA pool을 Qiagen cloning kit를 이용하여 클로닝(cloning)하고 얻어진 콜로니에서부터 DNA를 추출하여 염기분석을 시행할 결과 오담 (ODAM, Odontogenic AMeloblast-Associated protein)에 특이적으로 결합하는 핵산 구조체를 확보하였다.Finally, the DNA pool was cloned using a Qiagen cloning kit, and DNA was extracted from the colonies to obtain a nucleic acid construct that specifically binds to Odontogenic AMeloblast-Associated protein (ODAM). It was.
실시예 4: DNA 앱타머의 염기서열 분석 및 특이성 분석Example 4 Sequencing and Specificity Analysis of DNA Aptamers
오담 (ODAM, Odontogenic AMeloblast-Associated protein)에 높은 친화도를 가지고 특이적으로 결합하는 DNA의 염기서열을 분석한 결과를 하기 표 1에 제시하였다. 또한, 이 오담 (ODAM, Odontogenic AMeloblast-Associated protein) 앱타머의 2차 구조를 m-fold 프로그램을 이용하여 예측한 결과를 도 4 내지 도 21에 나타내었다.Table 1 shows the results of analyzing the nucleotide sequence of DNA specifically binding with high affinity to Odontogenic AMeloblast-Associated protein (ODAM). In addition, the secondary structure of this Odontogenic AMeloblast-Associated protein (ODAM) aptamer is shown in Figs.
상기의 DNA 앱타머가 오담 (ODAM, Odontogenic AMeloblast-Associated protein)에 대한 특이성이 있는지를 확인하였다.The DNA aptamer was confirmed to have specificity for Odontogenic AMeloblast-Associated protein (ODAM).
3’말단에 FAM을 연결한 DNA 16nM과 20분간 초음파처리한 그래핀옥사이드 6.4ug/ml를 각 125ul을 상온에서 30분간 로테이터 상에서 반응시킨 후, 64 nM의 오담 (ODAM, Odontogenic AMeloblast-Associated protein) 250ul를 첨가해 추가로 30분간 반응시킨 다음, 검은 96-well 플레이트 상에서 멀티플레이트 리더기를 이용하여 형광 값을 측정하였다. 이 때 여기파장(excitation wavelength)은 480nm를 사용하였다. DNA와 그래핀옥사이드 두 가지 만을 반응 시켰을 때 나타나는 형광값을 F0로 하고 오담 (ODAM, Odontogenic AMeloblast-Associated protein) 와 반응했을 때 형광값을 F라고 정의하였으며, (F-F0)/F0 결과 값을 측정한 결과, 도 22에 개시된 바와 같이, 모든 압타머의 (F-F0)/F0 값이 타겟이 존재할 경우가 그렇지 않을 때 보다 증가하는 것을 통해, 각각의 앱타머가 오담에 특이적으로 결합하는 것을 확인할 수 있었다.After reacting 16 μM of DNA with FAM at the 3 'end with 6.4 ug / ml of graphene oxide sonicated for 20 minutes on 125 rotators for 30 minutes at room temperature, 64 nM of ODAM (Odontogenic AMeloblast-Associated protein) After adding 250 ul for an additional 30 minutes, the fluorescence value was measured using a multiplate reader on a black 96-well plate. At this time, the excitation wavelength (480 nm) was used. When the reaction between DNA and graphene oxide alone, the fluorescence value was defined as F0, and the fluorescence value was defined as F when reacted with Odontogenic AMeloblast-Associated protein (ODAM), and the (F-F0) / F0 result was defined as F0. As a result of the measurement, as shown in FIG. 22, the (F-F0) / F0 values of all aptamers are increased more than when the target is not present, indicating that each aptamer specifically binds to the adam. I could confirm it.
실시예 5: DNA 앱타머의 오담 (ODAM, Odontogenic AMeloblast-Associated protein) 과의 결합력 분석Example 5 Analysis of Avidity of DNA Aptamers with Odontogenic AMeloblast-Associated Protein (ODAM)
서로 다른 18종의 오담 (ODAM, Odontogenic AMeloblast-Associated protein)과 결합하는 앱타머 중에서 OD 5R-35 및 OD 5R-64 의 타겟에 대한 Dose-dependency 및 Specificity 를 다음과 같이 SPR 분석법을 통하여 확인하였다. The dose-dependency and specificity of the targets of
SPR 금칩(gold chip)을 DTPA(Dithiophosphoric acid)로 처리 후, 칩의 금 표면을 200mM EDC/50mM NHS (Carbodiimide/ N-Hydroxysuccinimide)에서 1시간, 100ug/ml 스트렙타아비딘 1시간 30분, 50mM 에탄올아민 30분, 비오틴 표지한 앱타머 1uM 1시간, 50ug/ml BSA 1시간을 차례로 상온에서 반응시켰다. 매 단계 3차 증류수로 금 표면을 씻어내고 질소 건을 이용해 건조 시켜주는 과정을 반복한였다. After treatment of SPR gold chip with DTPA (Dithiophosphoric acid), the gold surface of the chip was treated with 200 mM EDC / 50 mM NHS (Carbodiimide / N-Hydroxysuccinimide) for 1 hour, 100 ug / ml streptavidin, 1
상기 과정을 통해 앱타머를 고정시킨 SPR 칩을 SPR 기계에 삽입하고 칩 위로 버퍼 용액 (137mM NaCl, 2.7mM KCl, 10mM Na2HPO4, 1.8mM KH2PO4) 10분, 타겟 단백질[오담 (ODAM, Odontogenic AMeloblast-Associated protein)], 혹은 카운터 타겟 [alpha-amylase] 10분, 버퍼용액 10분을 30ul/sec로 흘려주어 측정한 Response Unit (RU) 값은 도 23에 개시된 바와 같이, 두 종류의 앱타머 모두 오담의 농도에 비례하여 RU 값이 증가하는 것을 확인하였으며, 알파 아밀라아제에는 결합하지 않는 것을 확인할 수 있었다.Insert the SPR chip with the aptamer fixed into the SPR machine through the above procedure, the buffer solution (137mM NaCl, 2.7mM KCl, 10mM Na2HPO4, 1.8mM KH2PO4) for 10 minutes, the target protein [ODAM (Odontogenic AMeloblast-Associated) protein)], or the response unit (RU) value measured by flowing a counter target [alpha-amylase] for 10 minutes and a buffer solution at 10 ul / sec, as shown in FIG. 23. It was confirmed that the RU value was increased in proportion to the concentration, and did not bind to alpha amylase.
실시예 6: DNA 앱타머의 오담 (ODAM, Odontogenic AMeloblast-Associated protein) 과의 앱타머 듀오로서의 결합력 분석Example 6 Analysis of Avidity of DNA Aptamers as Aptamer Duo with Odontogenic AMeloblast-Associated Protein (ODAM)
서로 다른 18종의 오담 (ODAM, Odontogenic AMeloblast-Associated protein)에 특이적으로 결합하는 앱타머 중 OD 5R-35 및 OD 5R-64가 앱타머 듀오로서 오담 (ODAM, Odontogenic AMeloblast-Associated protein)과 결합할 수 있는지의 여부를 SPR 장비를 통해 분석하였다.Of the aptamers that specifically bind to 18 different types of Odontogenic AMeloblast-Associated protein (ODAM),
실시예 5의 방법으로 앱타머 OD 5R-64를 고정시킨 SPR 칩을 SPR 기계에 삽입 후, PBS 10분, 샘플 10분, PBS 10분을 차례로 흘려주었다. 이 때 샘플은 0 nM, 1 nM, 2 nM, 4 nM, 8 nM, 16 nM, 32 nM, 64 nM 의 오담 (ODAM, Odontogenic AMeloblast-Associated protein)이고, PBS 10분을 흘려 OD 5R-64 에 붙지 못한 오담 (ODAM, Odontogenic AMeloblast-Associated protein)을 씻어낸 다음, 차례로 금 나노입자로 표지한 OD 5R-35 를 10분간 흘려주었다. 동일하게 PBS 10분을 다시 흘려줌으로써 오담 (ODAM, Odontogenic AMeloblast-Associated protein)에 붙지 못한 금 나노입자로 표지된 OD 5R-35 를 씻어내었다. After inserting the SPR chip to which the
즉, OD 5R-64를 포함하는 SPR 칩과, 금 나노입자로 표지한 OD 5R-35를 동시에 듀오로서 이용하여, 결합력을 측정한 결과, 도 24에 개시된 바와 같이, 앱타머 듀오를 샌드위치 방식으로 이용할 경우, 그 민감도가 증가하는 것을 확인할 수 있었다. In other words, using the SPR
이상으로 본 발명 내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적 기술은 단지 바람직한 실시 양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의하여 정의된다고 할 것이다.As described above in detail specific parts of the present invention, it will be apparent to those skilled in the art that these specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. will be. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents.
<110> Korea University Research and Business Foundation <120> DNA aptamer binding to ODAM(Odontogenic Ameloblast-Associated protein) with specificity and Uses thereof <130> P17-B291 <160> 20 <170> KoPatentIn 3.0 <210> 1 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 5R-17 <400> 1 ccattcgtac gcaacagggc gtgcgatatc ggacccccgt ggatggctct gaatgc 56 <210> 2 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 5R-29 <400> 2 ccattcgtac gcaacaggga gcaatcaatt cgacaaccgt ggatggctct gaatgc 56 <210> 3 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 5R-32 <400> 3 ccattcgtac gcaacaggct agagcgaaga caccgaaagt ggatggctct gaatgc 56 <210> 4 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 5R-35 <400> 4 ccattcgtac gcaacaggcg acctaaacaa cgcatcaggt ggatggctct gaatgc 56 <210> 5 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 5R-39 <400> 5 ccattcgtac gcaacaggga cgtatgaatc actcgcgtgt ggatggctct gaatgc 56 <210> 6 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 5R-64 <400> 6 ccattcgtac gcaacaggga tgcatcgact gtaaacacgt ggatggctct gaatgc 56 <210> 7 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 5R-78 <400> 7 ccattcgtac gcaacaggta acctcactca tgctaggcgt ggatggctct gaatgc 56 <210> 8 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 5R-82 <400> 8 ccattcgtac gcaacaggac agctggcatc ctaacaccgt ggatggctct gaatgc 56 <210> 9 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 8R-9 <400> 9 ccattcgtac gcaacaggga cgtatgaacc actcgcgtgt ggatggctct gaatgc 56 <210> 10 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 8R-13 <400> 10 ccattcgtac gcaacaggga cgtatgaatc actcgcgtgt ggatggctct gaatgc 56 <210> 11 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> OD 8R-14 <400> 11 ccattcgtac gcaacaggga gcaatcaatc gacaaccgtg gatggctctg aatgc 55 <210> 12 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 8R-18 <400> 12 ccattcgtac gcaacaggga gcaatcaatt cgacaaccgt ggatggctct gaatgc 56 <210> 13 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> OD 8R-37 <400> 13 ccattcgtac gcaacaggcg cagaacaagc attccttgtg gatggctctg aatgc 55 <210> 14 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 8R-55 <400> 14 ccattcgtac gcaacaggtc caatcagaaa taaacctggt ggatggctct gaatgc 56 <210> 15 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> OD 8R-58 <400> 15 ccattcgtac gcaacaggcc aatgtagaca tagtccagtg gatggctctg aatgc 55 <210> 16 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 8R-61 <400> 16 ccattcgtac gcaacaggcg caggccaagg atcatacagt ggatggctct gaatgc 56 <210> 17 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 8R-64 <400> 17 ccattcgtac gcaacaggcc gcaccatgca gcaaactagt ggatggctct gaatgc 56 <210> 18 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 8R-65 <400> 18 ccattcgtac gcaacaggtc tacaccatgc cacaacgcgt ggatggctct gaatgc 56 <210> 19 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> APTFf <400> 19 ccattcgtac gcaacagg 18 <210> 20 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> APTR <400> 20 gcattcagag ccatccac 18 <110> Korea University Research and Business Foundation <120> DNA aptamer binding to ODAM (Odontogenic Ameloblast-Associated) protein) with specificity and Uses <130> P17-B291 <160> 20 <170> KoPatentIn 3.0 <210> 1 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 5R-17 <400> 1 ccattcgtac gcaacagggc gtgcgatatc ggacccccgt ggatggctct gaatgc 56 <210> 2 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 5R-29 <400> 2 ccattcgtac gcaacaggga gcaatcaatt cgacaaccgt ggatggctct gaatgc 56 <210> 3 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 5R-32 <400> 3 ccattcgtac gcaacaggct agagcgaaga caccgaaagt ggatggctct gaatgc 56 <210> 4 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 5R-35 <400> 4 ccattcgtac gcaacaggcg acctaaacaa cgcatcaggt ggatggctct gaatgc 56 <210> 5 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 5R-39 <400> 5 ccattcgtac gcaacaggga cgtatgaatc actcgcgtgt ggatggctct gaatgc 56 <210> 6 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 5R-64 <400> 6 ccattcgtac gcaacaggga tgcatcgact gtaaacacgt ggatggctct gaatgc 56 <210> 7 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 5R-78 <400> 7 ccattcgtac gcaacaggta acctcactca tgctaggcgt ggatggctct gaatgc 56 <210> 8 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 5R-82 <400> 8 ccattcgtac gcaacaggac agctggcatc ctaacaccgt ggatggctct gaatgc 56 <210> 9 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 8R-9 <400> 9 ccattcgtac gcaacaggga cgtatgaacc actcgcgtgt ggatggctct gaatgc 56 <210> 10 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 8R-13 <400> 10 ccattcgtac gcaacaggga cgtatgaatc actcgcgtgt ggatggctct gaatgc 56 <210> 11 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> OD 8R-14 <400> 11 ccattcgtac gcaacaggga gcaatcaatc gacaaccgtg gatggctctg aatgc 55 <210> 12 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 8R-18 <400> 12 ccattcgtac gcaacaggga gcaatcaatt cgacaaccgt ggatggctct gaatgc 56 <210> 13 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> OD 8R-37 <400> 13 ccattcgtac gcaacaggcg cagaacaagc attccttgtg gatggctctg aatgc 55 <210> 14 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 8R-55 <400> 14 ccattcgtac gcaacaggtc caatcagaaa taaacctggt ggatggctct gaatgc 56 <210> 15 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> OD 8R-58 <400> 15 ccattcgtac gcaacaggcc aatgtagaca tagtccagtg gatggctctg aatgc 55 <210> 16 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 8R-61 <400> 16 ccattcgtac gcaacaggcg caggccaagg atcatacagt ggatggctct gaatgc 56 <210> 17 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 8R-64 <400> 17 ccattcgtac gcaacaggcc gcaccatgca gcaaactagt ggatggctct gaatgc 56 <210> 18 <211> 56 <212> DNA <213> Artificial Sequence <220> <223> OD 8R-65 <400> 18 ccattcgtac gcaacaggtc tacaccatgc cacaacgcgt ggatggctct gaatgc 56 <210> 19 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> APTFf <400> 19 ccattcgtac gcaacagg 18 <210> 20 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> APTR <400> 20 gcattcagag ccatccac 18
Claims (13)
DNA represented by a nucleotide sequence of SEQ ID NO: 6; Or a nucleic acid aptamer specifically binding to Odontogenic Ameloblast-Associated protein (ODAM) with RNA substituted with T in SEQ ID NO.
A method of detecting Odontogenic Ameloblast-Associated protein (ODAM), comprising contacting a nucleic acid aptamer of claim 1 with a sample.
The method of claim 2, wherein the sample is selected from the group consisting of tissues, cells, blood, serum, plasma, saliva, sputum, and urine.
The method of claim 3, wherein the detection is detected by a method selected from the group consisting of Surface Plasmon Resonance (SPR), Fluorescence resonance energy transfer (FRET), and color analysis based on gold nanoparticles (ODAM, Odontogenic Ameloblast-Associated Protein)
Claim 1 diagnostic composition for the disease associated with Odont (Odontogenic Ameloblast-Associated protein) comprising the nucleic acid aptamer of claim 1.
6. The composition of claim 5, wherein the disease associated with Odontogenic Ameloblast-Associated protein (ODAM) is selected from the group consisting of periodontitis, gingivitis, epithelial periodontal cancer, intracranial aneurysms and peri-implantitis.
The complex of claim 1, wherein the nucleic acid aptamer is fixed to a solid carrier.
The composite according to claim 7, wherein the solid carrier is selected from the group consisting of a substrate, a resin, a plate, a filter, a cartridge, a column, and a porous solid carrier.
The substrate of claim 8, wherein the substrate is selected from the group consisting of a nickel-PTFE (polytetrafluoroethylene) substrate, a glass substrate, an apatite substrate, a silicon substrate, a gold substrate, a silver substrate, a graphic oxide substrate, and an alumina substrate. Complex.
Claim 1 nucleic acid aptamer or a composition containing a complex of claim 7 (ODAM, Odontogenic Ameloblast-Associated protein) detection composition.
A sensor for detecting Odontogenic Ameloblast-Associated protein (ODAM) comprising the nucleic acid aptamer of claim 1 or the complex of claim 7.
A kit for detecting Odontogenic Ameloblast-Associated protein (ODAM) comprising the nucleic acid aptamer of claim 1 or the complex of claim 7.
(b) 서열번호 4로 표시되는 앱타머를 추가로 접촉시키는 단계;
를 포함하는 오담(ODAM, Odontogenic Ameloblast-Associated protein) 검출방법.(a) contacting a sample with a kit or sensor containing a complex in which an aptamer represented by SEQ ID NO: 6 is immobilized on a solid carrier, or an aptamer represented by SEQ ID NO: 6; And
(b) further contacting the aptamer represented by SEQ ID NO: 4;
Odam (ODAM, Odontogenic Ameloblast-Associated protein) detection method comprising a.
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020170166589A KR102009016B1 (en) | 2017-12-06 | 2017-12-06 | DNA aptamer binding to ODAM(Odontogenic Ameloblast-Associated protein) with specificity and Uses thereof |
PCT/KR2018/012958 WO2019112178A1 (en) | 2017-12-06 | 2018-10-30 | Dna aptamer binding specifically to odam and use thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020170166589A KR102009016B1 (en) | 2017-12-06 | 2017-12-06 | DNA aptamer binding to ODAM(Odontogenic Ameloblast-Associated protein) with specificity and Uses thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20190066811A KR20190066811A (en) | 2019-06-14 |
KR102009016B1 true KR102009016B1 (en) | 2019-08-08 |
Family
ID=66751092
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020170166589A KR102009016B1 (en) | 2017-12-06 | 2017-12-06 | DNA aptamer binding to ODAM(Odontogenic Ameloblast-Associated protein) with specificity and Uses thereof |
Country Status (2)
Country | Link |
---|---|
KR (1) | KR102009016B1 (en) |
WO (1) | WO2019112178A1 (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN111537489A (en) * | 2020-06-09 | 2020-08-14 | 郑州轻工业大学 | Aptamer, method for regulating signal intensity of aptamer and application |
Family Cites Families (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101222437B1 (en) * | 2010-03-17 | 2013-01-15 | 경북대학교 산학협력단 | Biomarker |
WO2012122640A1 (en) * | 2011-03-17 | 2012-09-20 | Université de Montréal | Compositions, diagnostic methods using epithelial extracellular matrix proteins |
KR101297417B1 (en) * | 2011-08-31 | 2013-08-19 | 고려대학교 산학협력단 | Novel aptamer screening method based on graphene without target immobilization and the Nampt specific aptamers obtained from the above method |
RU2015113089A (en) * | 2012-09-10 | 2016-10-27 | Конинклейке Филипс Н.В. | ANALYSIS OF THE SALIVATE PROTEOM FOR BIOMARKERS OF GINGIVITIS AND PERIODONTITIS USING FT-ICR-MS / MS |
KR101731764B1 (en) * | 2016-08-18 | 2017-05-02 | 서울대학교산학협력단 | Use of ODAM as a biomarker for periodontal disease |
-
2017
- 2017-12-06 KR KR1020170166589A patent/KR102009016B1/en active IP Right Grant
-
2018
- 2018-10-30 WO PCT/KR2018/012958 patent/WO2019112178A1/en active Application Filing
Also Published As
Publication number | Publication date |
---|---|
KR20190066811A (en) | 2019-06-14 |
WO2019112178A1 (en) | 2019-06-13 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US9562907B2 (en) | Aptamers screening method based on graphene without target immobilization and the aptamers obtained from the method | |
Chandola et al. | Application of aptamers in diagnostics, drug-delivery and imaging | |
US5824478A (en) | Diagnostic methods and probes | |
US20170159113A1 (en) | Methods and compositions for detection of analytes | |
JP4111984B2 (en) | Target substance detection method | |
US20220026419A1 (en) | ImmunoLipoplex Nanoparticle Biochip Containing Molecular Probes for Capture and Characterization of Extracellular Vesicles | |
CN113195722B (en) | DNA aptamer specifically bound to chikungunya virus E2 and application thereof | |
JP6262868B2 (en) | Nucleic acid aptamer capable of specifically binding to tebuconazole, mefenacet and inabenfide and use thereof | |
KR102009016B1 (en) | DNA aptamer binding to ODAM(Odontogenic Ameloblast-Associated protein) with specificity and Uses thereof | |
KR101913163B1 (en) | Signal Probe Using Double-stranded Nucleic Acid and a Method for Detecting a Target Molecule Using the Same | |
KR101327249B1 (en) | DNA aptamers for Porcine Reproductive and Respiratory Syndrome(PRRS) virus | |
US20220252542A1 (en) | Single molecule nanoparticle nanowire for molecular electronic sensing | |
KR102196281B1 (en) | DNA aptamer binding to edifenphos with specificity and Uses thereof | |
KR101297417B1 (en) | Novel aptamer screening method based on graphene without target immobilization and the Nampt specific aptamers obtained from the above method | |
KR101841262B1 (en) | Nucleic Acid Aptamer Capable of Specifically Binding to AI Virus and Uses Thereof | |
KR101801227B1 (en) | Nucleic Acid Aptamer Capable of Specifically Binding to Follistatin and Uses Thereof | |
KR101911859B1 (en) | Signal Probe Using Double-stranded Nucleic Acid and a Method for Detecting a Target Molecule Using the Same | |
KR20190031705A (en) | DNA aptamer specifically binding to Avian influenza virus and uses thereof | |
KR101678946B1 (en) | Nucleic Acid Aptamer Capable of Specifically Binding to 25-hydroxy Vitamin D3 and Uses Thereof | |
KR102067476B1 (en) | DNA aptamer binding to tebuconazole, Inabenfide and Iprobenfos with specificity and Uses thereof | |
JP2008175750A (en) | Detection method of substance to be inspected | |
KR101990103B1 (en) | DNA aptamer binding to progesterone with specificity and Uses thereof | |
KR101616524B1 (en) | Aptamer having specific binding ability for vaspin and Biosensor Using therof | |
KR101816104B1 (en) | DNA aptamer binding to progesterone with specificity and Uses thereof | |
Yu | Rapid and sensitive detection of Escherichia coli O157: H7 using a QCM sensor based on aptamers selected by whole-bacterium SELEX and a multivalent aptamer system |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
E701 | Decision to grant or registration of patent right |