KR101911859B1 - Signal Probe Using Double-stranded Nucleic Acid and a Method for Detecting a Target Molecule Using the Same - Google Patents

Abstract

The present invention discloses stable double-stranded nucleic acid signal probes which are unaffected by temperature, pH, slat, ionic strength, and the like since single-stranded nucleic acids constituting double-stranded nucleic acids are complementarily crosslinked (or covalently bonded) to each other. In addition, the present invention discloses a method for detecting a target molecule in which a stable nucleic acid signal probe in the detection of the target molecule is used to form a complex with the target molecule, and only the signal probe is separated from the complex by heating and the like and the signal probe is detected.

Description

TECHNICAL FIELD [0001] The present invention relates to a double-stranded nucleic acid signal probe, and a method for detecting a target molecule using the double-stranded nucleic acid signal probe.

The present invention relates to a double-stranded nucleic acid signal probe and a method for detecting a target molecule using the same.

Genetic information encoded in the DNA of a cell is transmitted to the offspring through DNA replication. Genetic information is also expressed through DNA, RNA, and protein pathways in RNA. All cells are made up of biomolecules that are involved in the transmission or expression of genetic information, and their presence plays an important role in the function of the organism.

The target molecule (or biomarker) is a biomolecule that is clinically detectable and selected for specific applications. Biomolecules can be expressed or secreted in cells as disease progresses or progresses and can easily spread through blood flow from specific tissues to terminal tissues. In addition, even when cells are destroyed, biomolecule changes occur.

Representative biomolecules include nucleic acids and amino acids. Nucleic acid constitutes DNA that carries genetic information and RNA that acts as an intermediary for information. Chromosomal aberrations, DNA methylation, and gene variation influence the expression of genetic information. There are two types of gene mutations: Single Nucleotide Polymorphism (SNP) and Structural Variation. SNP means a genetic change or mutation that shows the difference of one base sequence (A, T, G, C) in DNA base sequence. Structural mutations refer to DNA structural variations such as deletions, inversions, additions, and replication. Genetic mutations are known to determine individual differences, such as phenotype changes, susceptibility to disease, and response to therapeutic agents. In particular, mutations involved in disease development and progression are known as disease-associated genetic mutations (Disease-associated Genetic Variants).

A gene is a unit of genetic information that is a trait-generating factor. Each cell has about 50,000 to 100,000 genes, but cells selectively use genes. Many of them are genes that are used for life-sustaining activities or daily activities of the cell itself. An endogenous standard expression gene is a gene used for comparison of a specific gene or a plurality of gene expression amounts, and is based on the form of messenger RNA (mRNA). Quantitative analysis of in vivo samples is important for the search for the function of a specific gene, the search for a gene that exhibits a specific function, the confirmation of gene expression patterns under specific conditions, and various other molecular biological purposes. Various gene expression measurement methods using an endogenous standard expression gene Is being developed.

There is a DNA microarray method which is a high-speed parallel analysis technique by a typical gene expression measurement method. Since DNA microarrays detect target sequences only by hybridization method, there arises a problem of genuine positivity due to crossing reaction, and there is a problem that reliability of hybridization signal must be improved. Also, in the case of a conventional microarray, since a nucleic acid in a sample is detected by a hybridization method, there is a problem that a complicated washing process is required after hybridization, and a process of making a target sequence into a single strand before hybridization is indispensably required. On the other hand, since the recently announced on-chip PCR is detected by hybridization or probe extension method, it is a heterogenous assay system like existing microarrays, and real-time detection is impossible and accurate quantification is difficult.

The biomolecule can be, in addition to nucleic acid, an amino acid, a peptide, a protein, a carbohydrate, a lipid, a polysaccharide, a glycoprotein, a hormone, a receptor, an antigen, an antibody, a virus, a pathogen, a toxic substance, a substrate, a metabolite, Cofactors, inhibitors, drugs, dyes, nutrients, growth factors, cells, tissues, etc. Theoretically, the scope is not limited. Almost all chemical or biological effectors are involved and are composed of molecules of various sizes. It is desired to develop such an efficient real-time detection and accurate quantification of such biomolecules.

Although various biomolecular analytical methods have been developed in terms of improvement of detection sensitivity and improvement of multi-analyzing ability, they still face the technical problem of reducing analysis cost, shortening analysis time, improving sensitivity and increasing reproducibility.

On the other hand, US Patent No. 8,519,115 (Nat Biotechnol. 2008, 26: 317-325) discloses a fluorescent barcode probe capable of molecular counting of a target biomolecule. And a target molecule binding region, which is a complementary single-stranded nucleic acid that specifically binds to the target nucleic acid, and a signal generating region formed by complementary and continuous connection of the dog to the complementary DNA backbone. This fluorescent barcode probe combines with the target nucleic acid to form a complex, generates a detection signal specific to the target molecule, and enables the molecular count of the complex (i.e., target molecule). The fluorescent barcode probe is a DNA-RNA double-stranded nucleic acid. The single-stranded nucleic acid is composed of base-pair hydrogen bonds and its stability is influenced by temperature, pH, salt, ionic strength and the like. That is, when the double stranded nucleic acid of the fluorescent barcode probe is separated by temperature or the like, accurate information on the target molecule can not be provided. Therefore, the method of analyzing a target molecule disclosed in the above-mentioned U.S. Patent No. 8,519,115 has inherent limitations in consideration of temperature, pH, salt, ionic strength and the like.

The present invention has been proposed in order to overcome these limitations. A double-stranded nucleic acid probe is disclosed in which a single-stranded nucleic acid forms a double-stranded nucleic acid complementarily to each other but forms a complementary covalent bond and is not affected by temperature, pH, salt, ionic strength or the like.

It is an object of the present invention to provide a method for producing a double-stranded nucleic acid, wherein the single-stranded nucleic acid forms a double-stranded nucleic acid complementary to each other but forms a crosslinked (or covalent bond) Discloses a nucleic acid signal probe.

Another object of the present invention is to provide a method for detecting a target molecule using the double-stranded nucleic acid signal probe.

Other objects and specific objects of the present invention are set forth below.

In one aspect, the invention provides a double-stranded nucleic acid signal probe.

As described above, the double-stranded nucleic acid signal probe of the present invention is characterized in that the single-stranded nucleic acids constituting the double-stranded nucleic acid are complementarily crosslinked (or covalently bonded) to each other.

Specifically, the double-stranded nucleic acid signal probe of the present invention comprises (i) a region specifically binding to a target molecule, wherein the " region " moiety) and (ii) a signal generating region which is bound to a specific binding region with the target molecule and generates a signal unique (or specific) to the signal probe, Double-stranded nucleic acids that are complementarily crosslinked (i.e., covalently linked) to each other, wherein the double-stranded nucleic acid has two or more regions labeled with the same signal generating material or labeled with different signal generating materials Quot; may be represented by a " segment " for a clear distinction between the same or similar terms in other parts).

In the signal probe of the present invention, the region specifically binding with the target molecule may be typically a single-stranded nucleic acid, an antibody, or an aptamer. When the specific binding region is composed of a single-stranded nucleic acid, the target molecule is a nucleic acid such as mRNA. When the specific binding region is composed of an antibody, the target molecule is an antigen having an epitope specifically recognized by the antibody. And a protein such as an antigen that aptamer specifically recognizes and binds.

A single-stranded nucleic acid as a specific binding region with a target molecule may be a single-stranded DNA or a single-stranded RNA as well as a nuclease or heat-stable PNA (Peptide Nucleic Acid) as long as it has a specific binding ability to a nucleic acid such as mRNA, , LNA (Locked Nucleic Acid), HNA (Hexitol Nucleic Acids), ANA (Altritol Nucleic Acids), and MNA (Mannitol Nucleic Acids). In addition, it may include a modified nucleotide as well as a natural nucleotide having a specific binding ability to a nucleic acid such as mRNA as the target molecule. Such modified nucleotides may be modified in their sugars, their phosphates and / or their bases. Modified nucleotides in such sugars, phosphates and / or bases are specifically known in the art, including their preparation methods. For example, nucleotides modified in sugars include those in which the hydroxyl group (OH group) of the sugar is modified with a halogen group, an aliphatic group, an ether group, an amine group or the like, a sugar analogue in which ribose or dioxyribose itself can be substituted but are not limited to, epimeric sugars such as alpha-anomeric sugars, arabinose, xyloses or lyxoses, pyranose sugars, Furanose sugars, and the like. In addition, for example, modifications in the phosphate may be accomplished by the reaction of the phosphate with a phosphate such as thioate, P (O) S (dithioate), P (O) NR2 (amidate), P Or CH2 (formacetal). Wherein R or R 'is H or substituted or unsubstituted alkyl, etc., and when the phosphate is modified, its linking group becomes -O-, -N-, -S- or -C-, and through this linkage the adjacent nucleotides Respectively.

Nucleic acid analogs or modified nucleotides, single-stranded nucleic acids containing such modified nucleotides, etc. are described in Sproat, et al, Nucl. Acid Res. 19: 733-738 (1991)], Cotten, et al, Nucl. Acid Res. 19: 2629-2635 (1991)], Hobbs, et al, Biochemistry 12: 5138-5145 (1973), and more specifically, these documents can be referred to. All of the documents cited herein, including these documents, are considered part of this specification.

The length of a single-stranded nucleic acid as a specific binding region with a target molecule is not particularly limited provided that the single-stranded nucleic acid can maintain a specific binding with the target molecule. Usually, it is composed of 5 to 70 nucleotides. However, when the length of the probe is too long or too short, nonspecific binding may occur, so that it will be composed of preferably 15 to 50 bases.

The antibody as the specific binding region with the target molecule may be a monoclonal antibody, a polyclonal antibody as well as a multispecific antibody (that is, an antibody recognizing two or more epitopes or two or more epitopes, such as a bispecific antibody) A fragment of an antibody, a chemically modified antibody, a humanized antibody, a recombinant antibody, or the like, so long as it has the ability to specifically bind to a target molecule. Various fragments of antibody fragments, chemically modified antibodies are known in the art and include, for example, Fab, F (ab ') 2, scFv (antibodies in which the Fv of the heavy or light chain is linked by a suitable linker), Fv, Fab / An antibody having one Fab and complete Fc), and antibody fragments obtained by treating the antibody with a protein-cleaving enzyme such as papain or pepsin.

An aptamer as a specific binding region with a target molecule may be a single-stranded DNA compactor or a single-stranded RNA absorber. The aptamer means a nucleic acid ligand capable of specifically binding to a target molecule such as a target protein as in the case of an antibody. The aptamer may be a double-stranded DNA or an RNA abundant if it can specifically bind to a target molecule. The production of aptamer capable of specifically binding to such a target molecule, the selection method and the like are all known in the art, and in particular, SELEX technology can be used. This SELEX technology is a technology termed as the abbreviation of " Systematic Evolution of Ligands by EXponential Enrichment ", which technique is described in Science 249 (4968): 505-510, 1990, US Patent No. 5,475,096, US Patent No. 5,270,163 WO 91/19813 and the like, and specific methods for selecting platemers and the use of suitable reagents, materials, etc. can be found in Methods Enzymol 267: 275-301, 1996, Enzymol 318: 193-214, 2000). Aptamer may also be modified in its sugar, its phosphate and / or its base.

The target molecule and the specific binding region are typically a single-stranded nucleic acid, an antibody, or an extramammer. However, an antibody against an intrinsic antigen in a biological sample may be used as a target molecule and may be an antigen in order to detect the target molecule. Herein, the invading antigen is derived from a bacterium, a virus, or the like which has entered the human body, and the detection of an antibody against such an invading antigen may be useful for judging whether or not these bacteria and viruses are infected.

In addition, Fc fragment, peptide, peptidomimetic, gapmer or the like of the antibody may be used as a specific binding region of the target molecule without any particular limitation, as long as the antibody has an ability to specifically bind to the target molecule. Can be used.

The target molecule that can be detected by the signal probe of the present invention includes a single-stranded nucleic acid, an antibody, an extramammer, an antigen, and the like, which are capable of specifically binding to the target molecule, Binding region is any molecule capable of specifically recognizing and binding. The molecule is preferably a biomolecule such as a human or an animal, more preferably a human molecule in a biomolecule. More preferably, it may be a biomarker useful for diagnosis of disease. Typically, it is an antigen derived from a nucleic acid such as mRNA, a bacterium, a virus or the like, or an antibody against the antigen. Furthermore, the target molecule may be a protein on the surface of a bacterium or a virus capable of specifically binding a specific binding region with a target molecule of the signal probe of the present invention, and in this case, detection of a bacterium or a virus may be possible.

In the signal probe of the present invention, the signal generating region is a double-stranded nucleic acid, which is cross-linked between the strands to maintain a stable double bond even at a high temperature and is not affected by pH, salt, ionic strength, Do not. This makes it possible to overcome the disadvantage that the detection accuracy of the target molecule is deteriorated due to the disappearance of the single-stranded nucleic acid generating the detection signal by releasing the double strand due to the change of the temperature etc. during the detection of the target molecule, It is possible to detect the target molecule by detecting the signal probe separated from the complex by heating the complex after the signal probe of the present invention forms and separates the target molecule when the target probe is used to detect the target molecule .

In the present invention, cross-linking between two strands of the signal generating region can be induced using methods known in the art. Specifically, a psoralen derivative such as psoralen, 8-methoxypsoralen and the like known as a nucleic acid double-strand intercalator, mitomycin C, pyrrolobenzodiazepine, A hybrid incarnation, such as melphalan, cyclophosphamide, ethidium bromide, proflavine, daunomycin, doxorubicin, thalidomide, Treated with a double strand and irradiated with UV of an appropriate wavelength. In the following examples of the present invention, when double-stranded cross-linking was induced by irradiating UV at a wavelength of 365 nm using 8-methoxysoralen as a crosslinking agent, it was confirmed that double strands were stably held at a temperature of 95 ° C .

In the present invention, a detectable label of a signal generating region is any substance known in the art that generates a detectable signal. Such a substance may be a single strand or a double strand (or alternatively, A nucleotide which is a constituent unit of the nucleic acid fragment).

(Cy2, Cy3, Cy5), Alexa Fluor Fluorescence Series (Alexa Fluor 350, 405 (a), and the like) as a fluorescent substance, and a fluorescent substance such as a fluorescent substance, a chemiluminescent substance and a radioactive isotope. , 430, 488, 514, 594, 610, 647, etc., ThermoFisher SCIENTIFIC, USA), fluorescein isothiocyanate, tetramethylrhodamine isothiocyanate, substituted rhodamine isothiocyanate, dichlorotriazine Lucigenin, lucigenin, CSPD (3- (2 ' -spiroadamantane) -4-methoxy < / RTI > Phenyl-1,2-dioxetane (AMPPD), Disodium 3- (4-methoxyspiro {1,2-dioxetane-3,2 '- (5'-chloro) tricyclo [3.3. 1.13,7] decan} -4-yl) phenyl phosphate), and radioactive isotopes such as tritium, iodine ( ¹³¹ I, ^{12 5 I, 123 I, 121 I} ), phosphorus ⁽³² P), sulfur ⁽³⁵ S), metals ^{(e.g., 68 Ga, 67 Ga, 68} Ge, 54 Mn, 99 Mo, 99 Tc, 133 Xe , etc.) Etc. may be used. Other examples of signal generating materials, including fluorescent materials, are described, for example, in WO 92/15673, WO 95/07463, WO 98/14605, WO 98/26277, 49019, and the like, as well as U.S. Patent Nos. 5,292,658, 5,418,155, 5,683,888, 5,741,668, 5,777,079, 5,876,995, and the like.

Preferably, cyanine fluorescent material or alexafluoro fluorescent material having different colors is used. Generally, when a cyanine fluorescent substance or an Alexafluorophosphate is labeled on a nucleic acid, a specific one of four aminoaryl nucleotides (nucleotides containing an arylamine in the base) (one of four nucleotides, for example, Aminoaryl-dCTP or aminoaryl-UTP) or more aminoaryl nucleotides are used to amplify the nucleic acid so that the one or more aminoaryl nucleotides are added to the nucleic acid strand at regular intervals (e.g., in the dCTP position when aminoaryl-dCTP is used) It is known in the art to bind (covalently bond) an amine group of the specific one or more aminoarylchloides to a fluorescent substance. In the following examples of the present invention, nucleic acids were amplified and synthesized using aminoaryl-dCTP, and four kinds of fluorescent materials such as Alexa Fluor 488 (blule) and Cy3 (green) were bound to aminoaryl-dCTP.

In the present invention, the signal generating region generates a signal unique to the signal probe including the signal generating region. Since the signal probe has a specific binding region with its target molecule, this unique signal generated by the signal generating region becomes a signal unique to the target molecule. Thus, if the signal-generating region consists of only one region of a single nucleic acid fragment and is labeled with only one signal-generating material, the unique signal generated by the signal-generating region is extremely limited by the number of types of signal- The number of target molecule species that can be detected and identified is also extremely limited. Therefore, it is preferable that the signal generation region comprises at least two regions. When the signal generation region is composed of two regions, when the fluorescent material (for example, Alexa Fluor 488 (blule), Cy3 (green) and Cy5 (red)) capable of generating three different signals is used, 9 (= ³² ) unique signals can be generated according to the linear order of the generated signals, and thus the number of target molecule types that can be detected and identified is also increased to nine. In the following embodiments of the present invention, the signal generating region is constituted by six regions and labeled with four different fluorescent materials, and a signal generating region for generating a total of 4,096 (= 4 ⁶ ) different signals 4,096 signal probes including the respective signal generating regions) were manufactured and used. For reference, in the embodiment of U.S. Patent No. 8,519,115 (Nat Biotechnol., 2008, 26: 317-325), a signal generating region is constituted by seven regions and labeled with four different fluorescent materials to form 16,384 (= 4 ⁶ ) kinds of signal probes can be used. The linear order of the signals generated by the respective regions of the signal generation region can be determined using the nCounter digital analyzer (Nanostring technology Inc., USA) or the U.S. Patent No. 8,519,115 (Nicon Eclipse TE2000E) (Perfect Focus, 1.4 NA Plan Apo VC 60X oil-immersion lens (Nikontk, Japan), anX- cite 120 metal halide light source (Exfo, USA), automated H117 stage (Prior Scientific, UK), and Smart Shutter (Sutter Instrument, USA) It is possible to quantify the signals by aligning and detecting the signals on a line by integrating the respective images. U.S. Patent No. 8,519,115 or related paper (Nat Biotechnol. 2008, 26: 317-325) is also considered to be part of this specification.

When the signal generating region is labeled with a fluorescent material (for example, Alexa Fluor 488 (blule), Cy3 (green) and Cy5 (red)) composed of two regions and capable of generating three different signals, A total of 9 signal generating regions (or 9 signal probes including each signal generating region) are generated which can generate 9 (= ³² ) unique signals according to a linear order, The signal generating regions of the branches are labeled with the same signal generating material, and the remaining six signal generating materials are labeled in different orders. Likewise, when the signal generating region is composed of six regions and labeled with a fluorescent material capable of generating four different signals, as in the following embodiment of the present invention, 16,384 (= ⁴⁶⁾ of a total of 16,384 which can generate the specific signal of the signal generating region (or is obtained is 16,384 of signal probes), including the respective signal-generating region, labeled with four of six areas all have the same signal-generating material having Is obtained.

Therefore, in the present invention, when the signal generating region includes two or more regions, the two or more regions are all marked with the same signal generating material, or one or more of the regions is a signal generating material ≪ / RTI >

The length of each region constituting the signal generation region (the number of nucleotides connected to each other) can be determined in consideration of the extent to which the signal generating material is labeled (i.e., the intensity of the generated signal). The length of such a region may typically range from 0.1 kb (kilo base) to 1.5 kb. In the following examples of the present invention, nucleic acid amplification was performed using three kinds of natural nucleotides (i.e. dATP, dTTP and dGTP) and 100% aminoaryl-dCTP (using aminoaryl-dCTP instead of dCTP) Was obtained as a 903 bp-long nucleic acid fragment integrated with aminoaryl-dCTP and labeled with a signal generating substance. If two types of aminoaryl-NTP are used to amplify and label the nucleic acid, the length of the region may be in the range of 0.2 kb to 0.5 kb. In the example of the present invention, 100% of aminoaryl-dCTP was used, but even if using 30 to 70% of aminoaryl-dCTP, the length of about 0.9 bp would be sufficient to generate enough signal.

The signal generating region may be a double-stranded nucleic acid, a complete double-stranded nucleic acid, or a partial double-stranded nucleic acid. As in the following example of the present invention, double-stranded nucleic acid fragments constituting the signal-generating region were prepared and labeled, and the labeled double-stranded nucleic acid fragments were ligated with a linking enzyme such as T4 ligase When linked, the two single-stranded nucleic acids that make up the double-stranded nucleic acid form a complete double-stranded nucleic acid of the same length. On the other hand, single-stranded nucleic acids were prepared by amplifying and separating by PCR as in the US Patent No. 8,519,115 (related paper is Nat Biotechnol. 2008, 26: 317-325), and the single-stranded nucleic acid was used as a template as a T7 RNA polymerase , T3 polymerase, SP6 polymerase, etc., and the signal transduction region is constituted by complementarily hybridizing the RNA transcript with the template after the RNA transcript is labeled, the partial double strand Nucleic acid may be formed.

The signal-generating region of the present invention is a double-stranded nucleic acid. As described above in connection with a specific binding region with a target molecule, the nucleic acid constituting the double-stranded nucleic acid may be a nucleic acid analogue such as PNA and may include a modified nucleotide have.

In the signal probe of the present invention, the binding between the specific binding region with the target molecule and the signal generating region is such that when both of them are nucleic acids (that is, when the specific binding region with the target molecule is a single- ) T4 ligase, etc., and when the specific binding region with the target molecule is an antibody or an umbilifer, it is possible to use an appropriate functional group such as an amino group, a hydroxyl group, a carboxyl group, a carbonyl group or a thiol group a functional group, and a reactive group) can be introduced and linked to the signal generating region in a covalent manner by inducing an amide bond, an ester bond, a sulfide ester bond, an ether bond, or the like.

Between the specific binding region with the target molecule and the signal generating region in the signal probe of the present invention, there may be a spacer and / or a fixed region as shown in FIG. Figure 1 shows the signal probe of the present invention and the major constituents used in the method of detecting a target molecule of the present invention using the signal probe.

The spacer is for separating the specific binding region with the target molecule from the signal generating region. When the specific binding region with the target molecule binds to the target molecule, the binding molecule interferes with signal detection of the signal generating portion This makes it easy to detect the signal of the signal generating unit. The spacer may be a single-stranded nucleic acid, a double-stranded nucleic acid, an RNA, a DAN, or the like, and may comprise a nucleotide analog such as PNA or a modified nucleotide. The length is not particularly limited as long as it can facilitate signal detection of the signal generating section. Usually, the length will be 20 to 50 bp.

The immobilized region is complementarily bound to one or more immobilized nucleic acid molecules (or immobilized molecules) as described below to further immobilize the signal probe of the present invention to the analytical support as described later, It consists of a sequence of 旣 知. Thus, the immobilization region is composed of a single-stranded nucleic acid having a sequence complementary to the nucleic acid molecule, and the same substrate sequence may be repeated two or more times so that two or more immobilized nucleic acid molecules can be bound. The immobilization region may be an RNA, DNA, or the like as long as it can complementarily bind to the nucleic acid molecule that is fixed, and may include a nucleotide analogue such as PNA or a modified nucleotide, and the length thereof may exhibit sufficient binding strength with the nucleic acid molecule It can be any length as long as it can. Generally, the sequence of the same substrate of 20 to 50 bp in length will be repeated 2 to 20 times.

When both the spacer and the fixed region exist in the signal probe of the present invention, they are connected to the adjacent region in a covalent bond, and the order may be any order, but the fixed region may be adjacent to the signal generation region, 5 ' or 3 ' side. That is, when the fixed region further fixes the signal probe of the present invention to the analytical support, the fixed region must be adjacent to the signal generating region to fix the signal generating region to the analytical support in a linear form or a streched form This is because it facilitates signal detection in the signal generation region.

The signal probe of the present invention can bind to a binding tag on the opposite side of the specific binding region with the target molecule (the opposite side, for example, when the specific binding region with the target molecule is on the 5 'side, means 3' side) .

The binding tag serves to immobilize the signal probe of the present invention through a specific binding with its binding partner to an analytical support coated with a binding partner capable of binding thereto. A representative material of the binding tag that can be used is biotin, and a typical binding partner for this is straptavidin. Streptavidin is a protein of the avidin family of antibiotics isolated from Streptomyces avidinii and has a tetrameric structure and can bind up to four biotin molecules. The binding tag may be a biotin analog such as desthiobiotin or iminobiotin as well as biotin. The binding partner coated on the supporter for analysis may be specifically bound to biotin or the like in addition to streptavidin Such as Avidin, Traptavidin, NeutrAvidin (Thermofisher SCIENTIFIC, USA), which are streptavidin analogues, may be used.

A variety of methods are known in the art for coupling a binding tag to a signal probe of the present invention and are described in a substantial literature (Nucleic Acids Res. 1987 Jun 11; 15 (11): 4513-4534) (Thermofisher SCIENTIFIC, APEXBIO), etc., are commercially available, and various kits (Thermofisher SCIENTIFIC Co., APEXBIO Co., Ltd.) are commercially available have.

In another aspect, the present invention relates to a method for detecting a target molecule in a sample using the above-described signal probe.

Specifically, the detection method of the present invention includes the steps of (a) treating the signal probe with a sample to be analyzed to form a complex of a target molecule and a signal probe in the sample, and (b) detecting a signal probe of the complex .

In the method of the present invention, the sample to be analyzed may be any mixture or solution having a need for detection, which is suspected of containing or containing the target molecule to be detected. The sample can be a biological sample obtained from a human body or an animal, as well as a processed sample having a higher concentration of target molecules by processing such a biological sample. Further, the sample can be a processed sample containing water, food, industrial wastewater, , Toxic factors, and the like. Such samples may include appropriate diluents and buffer solutions. When detecting the presence of bacteria or viruses, they may be bacterial cultures or virus cultures containing a culture medium or a medium.

In the method of the present invention, the sample to be analyzed may preferably be a biological sample obtained from a human body or an animal or a processed sample thereof. The biological sample may be obtained from a human or animal having a need for detection and suspected of containing or containing target molecules to be detected, such as blood, urine, saliva, semen, amniotic fluid, lymph fluid, sputum, Examples of the processed sample include plasma, serum, and a biological sample, a sample having an increased protein concentration using a protein extraction kit, a sample having an increased nucleic acid (DNA or RNA) concentration, a tissue extract, a cell obtained from the tissue, And so on.

Further, in the method of the present invention, the step of forming the signal probe complex with the target molecule in the sample may be performed by using various specific signal probes for the target molecule when the sample contains various target molecules, And it is possible to detect it. As described above, when the area constituting the signal generation region of the signal probe is six as in the following embodiment of the present invention and four different signal generating materials are used for labeling, 16,384 (= 4 ⁶ ) kinds of It is possible to detect different target molecules.

As used herein, the term " detection " means a qualitative analysis of the presence or absence of a target molecule, or even a quantitative analysis of the amount and concentration of a target molecule.

In the method of the present invention, when the target molecule to be detected is a protein, before the step (a), the sample is treated with a nitrocellulose membrane having a high binding affinity for the protein, A step of adsorbing proteins to the nitrocellulose membrane, and a step of removing other molecules such as lipids, nucleic acids, metabolites, and the like other than proteins adsorbed on the nitrocellulose membrane by using an appropriate washing solution as a next step. The cleaning solution may be used by purchasing or using a solution which is widely used in the art, and the cleaning solution includes a surfactant and a salt. Examples of the surfactant include SDS, Tween 20, Tween 40, Tween 60, Tween 80, Triton X-405, Triton X-100, Tetronic 908, Cholesterol PEG 900, Polyoxyethylene Ether W-1, Span 20, Span 40, Span 85 A salt, a salt thereof, a mixture thereof (particularly SSC, SSPE, etc.) may be used as the salt, and the salt may be an acetate, a lactate, a citrate, a phosphate, a nitrate, a sulfate or a chloride salt of lithium, sodium, potassium and ammonium. Was diluted with SSPE solution (0.2M phosphate buffer, pH 7.0, 0.05% Tween 20) containing TBST solution (10 mM Tris-Cl, pH 8.0, 150 mM NaCl, 0.05% Tween 20) , 2.98M NaCl, 20mM EDTA, pH 7.4).

After the washing step, a blocking solution containing an appropriate blocking agent such as bovine serum albumin may be treated to block the protein nonadhesive surface of the nitrocellulose membrane. This blocking step prevents the antibody of the signal probe from adsorbing and degrading the accuracy of detection when the specific binding region with the target molecule is used as a signal probe in order to form a complex of the target molecule and the signal probe, . After the blocking step, the signal probe is processed to form a complex of the signal probe of step (a) and the target molecule. In this case, when the specific binding region with the target molecule is used as a signal probe such as an umbrella which is not an antibody, the blocking step is not necessarily required.

After the signal probe processing, the cleaning step may be performed using the above-described cleaning solution or the like in order to remove the non-specifically coupled signal probe.

(B-1) the nitrocellulose membrane is used to detect a protein as a target molecule, after the complex is formed in the nitrocellulose membrane, the signal probe detection step of the step (b) Separating the signal probe from the complex, and (b-1) detecting the separated signal probe. The step of separating the signal probe from the complex can be accomplished by heating the nitrocellulose membrane to which the complex is bound (heating through a suitable buffer or reaction solution) or by treating the surfactant with heating.

As described above, the signal probe of the present invention has cross-linked double-stranded nucleic acids constituting the signal probe, so that the signal generating region is not lost even when heated, and the signal probe remains stable and does not affect the accuracy of target molecule detection.

Wherein the step (b-1) of detecting the separated signal probe comprises the steps of: (b-1-i) inserting the separated signal probe through a binding tag of the signal probe for analysis in which the binding partner for the binding tag is coated (B-1-ii) detecting a signal of a signal probe immobilized on the support by immobilizing the support on the support by immobilizing the support on the analytical support through specific binding of the binding tag and the binding partner .

Here, the signal of the signal probe may be a signal generated by the signal generating material labeled on the signal probe, and the signal detecting step of the signal probe may be performed using an appropriate device capable of detecting the signal according to the used signal generating material . Such an apparatus may be a spectrophotometer, a fluorometer, an absorption spectrometer, a luminometer, a chemiluminometer, an actinometer, or the like depending on the characteristics of a signal, When a signal is detected using an Alexa Fluorophore fluorescent substance series or a cyanine fluorescent substance as a generating material, the nCounter digital analyzer (Nanostring technology Inc., USA) used in the following embodiments of the present invention or US Patent No. 8,519,115 (Nicon Eclipse TE2000E) (Perfect Focus, 1.4 NA Plan Apo VC 60X oil-immersion lens (Nikontk, Japan) used in the Examples of the present invention or related articles (Nat Biotechnol. 2008, 26: 317-325) ), anX-cite 120 metal halide light source (Exfo, USA), automated H117 stage (Prior Scientific, UK) and Smart Shutter (Sutter Instrument, USA) . The nCounter digital analyzer and the like enable the detection of a linear order of signal of a specific signal of each signal generation region and the counting and quantification of the target molecule from the sensed signal.

In order to facilitate the detection of such a signal when the order of lines is detected using a nCounter digital analyzer or the like, it is desirable to fix the signal generating region of the signal probe to the analytical support in a linear form or a streched form , Which is a fixed molecule having a single-stranded nucleic acid sequence complementary to the immobilized region of the signal probe and having a binding tag linked to the complementary single-stranded nucleic acid sequence and capable of binding to a binding partner coated on the analytical support Or a fixed nucleic acid molecule) to an analytical support to which a signal probe is immobilized. The binding tag of the fixed molecule may also be biotin or a biotin analogue as described above in connection with the signal probe.

Meanwhile, the analytical support that can be used in the method of the present invention can be used as a binding partner of a signal probe (for example, streptavidin, etc.) for a binding tag can be coated on its surface through covalent bond or noncovalent bond. There are no particular restrictions on materials.

The material may be a plastic, a resin, a polysaccharide, a silica, a functionalized glass, a glass, a glass, a glass, a glass, Modified silicon, carbon, metal, inorganic glasses, membranes, nylons, natural resins, and the like. The material of the polymeric support is selected from the group consisting of polystyrene, polyethylene glycol tetraphthalate, polyvinyl acetate, polyvinyl chloride, polyvinyl pyrrolidone, But are not limited to, polyacrylonitrile, polymethyl methacrylate, polytetrafluoroethylene, butyl rubber, styrenebutadiene rubber, natural rubber, polyethylene, polypropylene polypropylene, polytetrafluoroethylene, polyvinylidene fluoride, polycarbonate, and polymethylpentene. The term " polyvinylidene fluoride "

 Figure 1 shows the major constituents, including signal probes, immobilized molecules, used in the method of the present invention, and the overall process of detecting proteins as target molecules using the nitrocellulose membrane as described above is shown in Figures 2 and 3 In which the specific binding region of the signal probe with the target molecule is an antibody and the case where the antibody is a platemer, respectively.

On the other hand, as shown in FIG. 4 and FIG. 5, the detection method of the target molecule of the present invention may be performed by additionally using a capture probe in addition to the above-described signal probe.

Such a method using the capture probe of the present invention (hereinafter referred to as " capture detection method of the present invention " for convenience) comprises the steps of (a) treating a sample to be analyzed with a signal probe and a capture probe specifically binding to the target molecule, To form a complex of the signal probe and the capture probe together with the molecule and a signal probe containing the complex and not forming a complex with the capture probe, and (b) And detecting the signal probe.

In the capture detection method of the present invention, the capture probe has a region in which the signal probe specifically binds to a site other than the site (i.e. epitope) of the target molecule to which the signal probe specifically binds, and a magnetic particle (or magnetic bead) And a schematic diagram thereof is shown in Fig.

The magnetic particles may be proteins, nucleic acids, cells, or the like in the art as disclosed in U.S. Patent No. 5,665,554, U.S. Patent No. 6,027,945, U.S. Patent No. 7,078,224, Korean Patent Publication No. 2006-0061494, , Bacteria, and the like, and has a size of micron or nano unit (several microns in size, several tens to several hundreds of nanometers in size). The magnetic particles, which have been typically used for separation of biomaterials, are iron oxide magnetic particles, and as such iron oxide magnetic particles, magnetite (Fe ₃ O ₄ ), maghemite (Fe ₂ O ₃ ), and hematite Fe ₂ O ₃ ) have been used. Magnetic particles can be modified with silica, polymer, gold, silver non-magnetic material and can be combined with biomolecule proteins, nucleic acids, etc. to prevent magnetic particle interactions and aggregation in order to be used for separation of biomolecules such as proteins and nucleic acids. Functional groups such as a carboxyl group, an epoxy group, a tosyl group, an amino group, and a siloxane group, or a biotin or a streptavidin-binding substance must be introduced. Magnetic particles having such properties and methods of making them are well known in the art and are described in U.S. Patent Nos. 6,027,945, 6,673,631, 7,183,002, 3,253,638, and 2001-136970 Dynabeads magnetic beads coated with streptavidin (Thermo Fisher Scientific, USA), DYNAL M-270 with a tosyl group introduced therein, DYNAL M-280 (Dynal Biotech ASA, Norway) are commercially available.

In the present invention, the capture probe can be linked to such a magnetic particle by a specific binding region with its target molecule through a covalent bond through a functional group or a noncovalent bond between biotin and streptavidin. The specific binding region of the capture probe with the target molecule is a specific binding region of the signal probe with the target molecule and a specific binding region with the target molecule of the signal probe are recognized And recognizes and binds to a region different from the region where the region is made.

The specific binding region of the capture probe with the target molecule may be an antibody, an excreta, a single-strand nucleic acid as well as a specific binding region of the signal probe, an antigen when the target molecule is an antibody, etc. In the case of a single- Lt; RTI ID = 0.0 > nucleotides. ≪ / RTI >

In the capture detection method of the present invention, the step (a) is performed by processing a signal probe and a capture probe on a sample to be analyzed. In this case, a complex between the target molecule and the signal probe and the capture probe is formed, Complexes, signal probes that do not form complexes, capture probes that do not form complexes, non-target molecules, and the like.

For the detection of the target molecule, the signal probe of the complex in the mixture, which is step (b), should be detected in the next step. The detection of such a signal probe is such that when the mixture is applied to a magnet, the capture probe contains magnetic particles, only a capture probe that does not form a complex with the complex comprising the capture probe is bonded to the magnet. In this process, signal probes or non-target molecules that do not form a complex are removed. In order to effectively remove the signal probe or the non-target molecule that does not form a complex in this process, a step of washing using the appropriate washing solution as described above may be preferable.

 After binding a complex or the like to the magnet, only the signal probe is separated from the complex, which can be done by heating or heating as described above, or by treatment with a surfactant. As described above, since the double-stranded nucleic acids constituting the signal probe are cross-linked to each other, the signal probe maintains a stable state even with heating.

In the capture detection method of the present invention, the detecting of the signal probe in the step (b) includes the steps of: (b-1) applying a magnet to the mixture so that only the capture probe, which is not complexed with the complex, (B-2) separating the signal probe from the complex bound to the magnet, and (b-3) detecting the separated signal probe. .

The step of detecting only the separated signal probe of the step (b-3) may be the same as the method of detecting the protein using the nitrocellulose membrane as described above, wherein the separated signal probe is (b-3-i) (B-3-ii) attaching the binding partner to the analytical support coated with the binding partner for the binding tag through the binding tag, and fixing the binding tag to the analytical support through specific binding of the binding tag and the binding partner; And detecting the signal of the signal probe fixed to the signal probe. The details of the step of fixing the signal probe to the (b-3-i) support for analysis and the step (b-3-ii) of the detection step can be referred to as described in connection with the protein detection method using the nitrocellulose membrane.

In another aspect, the method of detecting a target molecule of the present invention may be performed by additionally using a capture competition molecule in addition to the signal probe, as shown in FIGS. 6 and 7.

(Hereinafter referred to as " competition detection method of the present invention " for the sake of convenience) comprises the steps of (a) treating a sample to be analyzed with a signal probe specifically binding to the target molecule, And (b) detecting a signal probe of the complex in the mixture. The method of claim 1, wherein the signal probe is a complex of a capture competitor molecule and a signal probe.

The mixture may contain, in addition to the complex of the trapping competition molecule and the signal probe, a complex of a target molecule and a signal probe, a signal probe not forming a complex, a competitive molecule not forming a complex, a target molecule not forming a complex, .

In the competition detection method of the present invention, the capture competition molecule has a region in which the signal probe specifically binds to the same site as the site (i.e. epitope) of the target molecule to which the signal probe specifically binds and a structure in which magnetic particles are connected to the region . The capture competitor molecule will generally be the same molecule as the target molecule. The capture competitor molecule will have the same site as the site (i.e., epitope) of the target molecule to which the signal probe specifically binds, so long as it can compete for binding with the signal probe However, Examples of such a similar molecule include a fusion protein of a target protein with another protein (Fc of an antibody).

Capture competitors compete with target molecules for binding to signal probes because they have the same signal probe binding sites as the target molecule, and when the signal probe is processed in the sample at the limit and the capture competitor molecules are quantified and processed, The result of the detection of the molecule can provide information about the target molecule in the sample to be analyzed (i.e., the presence or concentration of the target molecule).

In the above, "the signal probe is processed in the sample at the limit amount" means that the sample is processed to a quantity that can detect both the capture competition molecule and the target molecule, and theoretically, the concentration (quantitative value) Means that the concentration is such that the concentration of the target molecule present in the sample to be analyzed is less than the sum of the estimated concentrations (quantitative values) of the target molecules present in the sample to be analyzed, but the actually processed signal probe is bound to the capture competitor molecule or the target molecule And may be processed above the sum value. However, since it is generally difficult to estimate the concentration of the target molecule in the sample, the limit value of the signal probe will be a concentration that can detect the concentration of the trapping competing molecule below the quantification level.

The detection and quantification of the target molecule in the sample to be analyzed can be carried out by repeating several experiments with different concentrations of the signal probe and the capture competitive molecule under the same detection conditions using the same reaction solution and the like, Can be obtained by creating a standard curve showing the correlation between the concentration of the competing molecule and the treatment concentration. In general, the detection / quantification value of the capture competitor molecule is inversely proportional to the concentration of the target molecule in the sample.

In the competition detection method of the present invention, the step of detecting the signal probe of the complex in the mixture of step (b) may be performed as in the capture detection method of the present invention.

Specifically, (b-1) applying a magnet to the mixture to bind a complex of the capture competent molecule and the signal probe to the magnet, (b-2) separating only the signal probe from the complex bound to the magnet, and b-3) detecting the separated signal probe. If the magnet is applied to the mixture in the step (b-1), the trapping competition molecule that does not form a complex is also bound to the magnet, but it is possible to separate only the signal probe when heating it.

The step of detecting only the separated signal probe in the step (b-3) may include the steps of: (b-3-i) separating the separated signal probe in the same manner as the protein detection method and the capture detection method using the nitrocellulose membrane, (B-3-b) to the analytical support through specific binding of the binding tag and the binding partner by treating the analytical support coated with the binding partner for the binding tag through the binding tag of the signal probe; ii) detecting a signal of the signal probe fixed to the support. The details of the step of fixing the signal probe to the (b-3-i) support for analysis and the step (b-3-ii) of the detection step can be referred to as described in connection with the protein detection method using the nitrocellulose membrane.

As described above, the present invention is based on the finding that a single-stranded nucleic acid constituting a double-stranded nucleic acid is complementarily cross-linked (or covalently bonded) to each other and is stable (unrelated to temperature, pH, salt, ionic strength, A double-stranded nucleic acid signal probe can be provided.

In addition, the present invention relates to a method for detecting a target molecule by using the stable double-stranded nucleic acid signal probe to form a complex with the target molecule, followed by separation of the signal probe from the complex by heating or the like, A method capable of detecting a target molecule can be provided.

Fig. 1 shows the signal probe of the present invention and the main constituents used in the method for detecting a target molecule of the present invention using the signal probe.
FIGS. 2 and 3 are step-by-step illustrations of a method for detecting a protein of the present invention using a nitrocellulose membrane.
FIGS. 4 and 5 are step-by-step illustrations of a method for detecting a target molecule using a capture probe.
FIGS. 6 and 7 are step-by-step illustrations of a method for detecting a target molecule using a capture competition molecule.
8 shows experimental results showing that the signal probe of the present invention retains double-stranded nucleic acid even at a high temperature.
Fig. 9 is a result of electrophoresis of a double-stranded nucleic acid fragment constituting a signal generation region of the signal probe of the present invention or a ligated body thereof.
FIG. 10 is an image obtained by detecting the bacteria using the signal probe of the present invention and measuring the result using a nCounter digital analyzer (Nanostring technology, USA).
11 is a schematic diagram showing that the signal probe of the present invention is imaged in a nCounter digital analyzer (Nanostring technology, USA).
FIG. 12 is a graph showing the results of analyzing two kinds of standard target molecules using the signal probe of the present invention and showing the target molecule amount and the signal value in a logarithmic scale.
FIG. 13 is a graph showing the quantities of target molecules and the signal values as a logarithmic scale on the result of analyzing thirteen kinds of target molecules twice using the signal probe of the present invention.

Hereinafter, the present invention will be described with reference to examples. However, the scope of the present invention is not limited to these embodiments.

Example term

The terms used in the following examples have the following semantic relations with the terms used in other parts of this specification including claims.

The "signal probe" is described or mixed with the "first probe" in the embodiments below, the "signal generating area" is described as a "color indicating barcode" or mixed therewith, and the "signal probe" A specific binding region with a target molecule " is described as a " first probe " or " first ligand "

The "capture probe" is described in the examples below as "second probe" or "capture probe" or mixed therewith, and the "specific binding region with the target molecule" of the "capture probe" Quot; or " second ligand ", or a combination thereof.

Each area labeled with the signal generating material, which constitutes the signal generating region of the signal probe, is described as a " signal tag ".

In addition, " fixed nucleic acid molecule " is described as " fixed molecule " in the examples below or mixed therewith.

≪ Example 1 > Preparation of reagent

1-1. Manufacture of first probe (signal probe)

The first probe combines with the target molecule and functions to generate a signal specific to the target molecule. The structure is a structure in which a signal generating region generating a signal specific to a target molecule is combined with a first probe which is a specific binding region between the target molecule and a structure in which a binding region and a binding tag are additionally added .

1) Manufacture of signal tag

A signal tag refers to a basic constituent unit constituting a signal generation region, and a structure in which a signal generating substance is labeled on a double stranded nucleic acid fragment.

In this experiment, a double-stranded nucleic acid with a signal-generating substance labeled with M13 DNA as a template was synthesized by PCR (Polymerase Chain Reaction) method.

The nucleotide sequence information of M13 DNA, which is the skeleton of the signal tag, was obtained from the GenBank Data System (http: // www.ncbi.nlm.nih.gov) (Accession number NC_003287).

The DNA fragment (903) was amplified by standard PCR using 1.25 units of Taq Polymerase (Promega, USA) with 0.1 nM of the PCR primer pair (Bioneer, Korea) under the conditions of 100 ng of M13 DNA bp) was prepared

Forward primer (SEQ ID NO: 1): atcaggcgaatccgttattg

Reverse primer (SEQ ID NO: 2): tcggccttgctggtaatatc

According to the standard method provided by the manufacturer, the DNA fragment, which is the PCR product, was amplified by standard PCR using the primer pairs prepared above, three kinds of dNTPs and aminoallyl-dCTP (TriLink, USA) dCTP integrated DNA fragment was prepared.

Restriction enzyme titer sequence Type of adapter Base sequence Serial number Eco RI / Sma I Adapter 5'-AATTCCCCGGG-3 '
3-GGGGCCCp-5 ' SEQ ID NO: 3
SEQ ID NO: 4 Hind III / Not I Adapter 5'-AGCTTGCGGCCGC-3 '
3-ACGCCGGCGp-5 ' SEQ ID NO: 5
SEQ ID NO: 6 Xho I / Pst I Adapter 5'-TCGAGCTGCAGG-3 '
3-CGACGTCCp-5 ' SEQ ID NO: 7
SEQ ID NO: 8 Sal I / Bam HI Adapter 5'-TCGACGGATCC-3 '
3-GCCTAGGp-5 ' SEQ ID NO: 9
SEQ ID NO: 10

Restriction enzymes which can not cleave the PCR products were selected by preparing restriction enzyme maps of the PCR products, and the adapters of the above Table 1 were purchased (Gene Link, USA) .

The adapter was ligated to the PCR product incorporating the aminoallyl-dCTP according to the manufacturer's standard method to have the following structure.

First domain: 5'-Blunt end-DNA fragment-Eco R1 / Sma I adapter-3 '

Second domain: 5'-Eco RI / Sma I adapter-DNA fragment-Sal I / Bam HIadaptor-3 '

Third domain: 5'-Sal I / Bam HI adapter-DNA fragment-Hind III / Not Iadaptor-3 '

Fourth domain: 5'-HindIII / Not Iadaptor-DNA fragment-XhoI / Pst1adaptor-3 '

Fifth domain: 5'-Xho I / Pst1adaptor-DNA fragment-Sal I / Bam HIadaptor-3 '

6th domain: 5'-Sal I / Bam HIadaptor-DNA fragment-3 '

Specifically, 1 uL of 5 unit / uL T4 ligase (NEB, USA) was added to a mixed solution of 19 uL consisting of the 3 nmol adapter and 0.3 nmol PCR product, and the resulting reaction The product was purified with DNA & Precipitation Solutions Pack (Gene Link, USA), and the adapter was attached and the aminoallyl-dCTP The integrated DNA fragment was obtained, treated with the restriction enzyme, purified again and harvested.

Alexa 488, Alexa 594, Alexa 647 (Invitrogen, USA) and Cy3 (GE Healthcare, USA) were prepared as the N-hydroxysuccinimide (NHS) -ester (ester)

According to the standard method provided by the manufacturer, 16-20 .mu.g of DNA fragments to which the adapter was attached and amino-allyl dCTP incorporated were dissolved in 20 .mu.l of sterilized distilled water for each domain, and then 12 .mu.L of label solution (25 mg Of NaHCO ₃ dissolved in 1 mL of sterilized distilled water) was added to prepare a reaction solution. Next, the signal generating material was dissolved in DMSO to a final concentration of 30 ug / L to prepare a signal generating material solution. Subsequently, the reaction solution was divided into 4 tubes in an amount of 5 uL, and one kind of the above-mentioned 2 uL of the signal generating material solution was added thereto, followed by reaction at room temperature for 1 hour.

The DNA fragment was labeled with a signal generating substance and purified with a QIAquick PCR Purification Kit (QIAGEN, USA) to obtain a DNA fragment to which the adapter was attached and a signal generating substance was labeled.

Thus, four kinds of signal tags of double-stranded DNA fragment in which each of the four types of signal generating materials were labeled for each domain were produced and referred to as " H signal tag " for convenience.

2) Covalent bond induction and validation

The prepared 1 mg of H signal tag was dissolved in 1 mL of reaction buffer (10 mM Tris (pH 7.0), 200 mM NaCl). The solution was added to 0.3 umol 8-methoxypsoralen (8-MOP; Sigma, USA) dissolved in the same volume of 95% ethanol and reacted for 1 hour in the dark state. Was injected for 3 hours with UV light 365 nm wavelength (4 W) in the reaction led to the covalent bond between the base pairs of the H signal tag chain (A. Arabzadeh et al., International Journal of Pharmaceutics 237 (2002) 47 ~ 55) .

A chloroform of 4 times volume was added to the reaction solution, and the supernatant from which unreacted psoralen was removed by the extraction process was harvested. 5 M NaCl was added to the harvest to a final concentration of 0.2 M, and 3-fold volume of ethanol was added to harvest the c-tagged H signal tag. The covalent bond-derived H signal tag thus obtained was referred to as " C signal tag " for convenience.

H signal tag and the corresponding C signal tag were measured at 260 nm with UV-1800 (Shimadzu Corp., Japan) while raising the temperature to 0.5 ° C to 95 ° C as shown in FIG.

The H signal tag was converted to single stranded nucleic acid by dissociation of the double stranded nucleic acid with increasing temperature and was present as a single stranded nucleic acid at 95 ° C with a Tm of about 85 ° C. On the other hand, the C signal tag retains the double stranded nucleic acid even at 95 ° C.

3) Manufacture of color indicating barcode which is a signal generating area

A color-coded barcode, which is a signal generation region, was manufactured using the C signal tag manufactured as follows.

First, one kind selected from the four types of first domain signal tags was divided into four tubes, and the final concentrations of 10 ug / mL were added to each tube. Four kinds of second domain signal tags were added to each tube in a final concentration of 10 ug / mL (50 mM Tris-HCl, 10 mM MgCl 2, 1 mM ATP, 10 mM DTT, pH 7.5) in a final volume of 100 L of T4 ligase. The remaining three types of the first domain signal tag are also processed in the same manner as described above to mix the four types of the first domain signal tag and the second domain signal tag, , 2-domain mixed solution.

Similarly, one kind selected from the four kinds of third domain signal tags was divided into four tubes, and the final concentration of 10 ug / mL was added to each tube. Four kinds of fourth domain signal tags were added to each tube in a final concentration of 10 ug / (50 mM Tris-HCl, 10 mM MgCl 2, 1 mM ATP, 10 mM DTT, pH 7.5) in a final volume of 100 L of T4 ligase. The remaining three types of the third domain signal tag are also processed in the same manner as described above to mix the four types of the third domain signal tag and the fourth domain signal tag, , 4-domain mixed solution.

Likewise, one kind selected from four kinds of fifth domain signal tags was divided into four tubes, and the final concentration of 10 ug / mL was added to each tube. Four kinds of sixth domain signal tags were added to each tube in a final concentration of 10 ug / (50 mM Tris-HCl, 10 mM MgCl 2, 1 mM ATP, 10 mM DTT, pH 7.5) in a final volume of 100 L of T4 ligase. The remaining three types of the fifth domain signal tag were also processed in the same manner as described above to mix the four kinds of the fifth domain signal tag and the fourth domain signal tag, , 6-domain mixed solution.

Sixteen tubes of the first and second domain mixed solution, 16 tubes of the mixed solution of the third and fourth domain, and 16 tubes of the mixed solution of the fifth and sixth domains were completed in the same manner as described above.

The tubes selected from the 16 tubes of the first and second domain mixed solutions, the tubes selected from the 16 tubes of the third and fourth domain mixed solution, and the tubes selected from the 16 tubes of the fifth and sixth domain mixed solution were mixed at the same concentration, The reaction mixture was treated with 5 uL of 5 unit / uL T4 ligase (NEB Co., USA) for 12 hours, and 4,096 final structures, in which six domain signal tags were continuously arranged in a row, (16 x 16 x 16 = 4 ⁶ ) signal generation regions were produced, which were referred to as " color indication barcodes " for convenience.

An image obtained by electrophoresis of the reaction product of each reaction step is shown in FIG.

The color-indicating barcode thus obtained is composed of six signal tags (double-stranded nucleic acid fragments labeled with a signal generating substance) arranged in a line, each signal tag has four types of fluorescent substances (Alexa dye 3 and Cy3) And generates a unique detection signal according to a linear order of each signal. When the probe is connected to a specific binding region with a target molecule as a first probe as described below, a total of 4,096 (16 x 16 x 16 = 4 ⁶ ) target molecules can be distinguished. These color indicating bar codes form spots of 300 nm in size and are imaged by an epi-fluorescent microscope (US 8,519,115 B2; Nat Biotechnol. 2008 Mar; 26 (3): 293-4).

4) Manufacture of probe

A first probe is a construct for recognizing and binding a target molecule and detecting a target molecule by generating a unique signal. The first probe is a structure in which a first probe, which is a specific binding region with a target molecule, to be.

The first probe was prepared by dividing into a non-fixed type and a fixed type according to the presence or absence of a binding substance (biotin or the like) with a support. As the first probe, a single strand nucleic acid for detecting nucleic acid, an antibody for detecting protein, Respectively.

(1) Non-fixed first probe

The unfixed first probe was prepared with the structure of 5'-hue bar code-spacer-first probe-3 '. Herein and in the following, 5 'and 3' are used to denote the direction or order of the arrangement of such nucleic acids when a nucleic acid such as a color indicating barcode, a spacer, etc., is used as a component of the probe.

As the spacer, a single stranded nucleic acid of the following sequence was custom-made and used.

Spacer sequence: 5'-AGAAGCGCAGAGCTTGGGCGCAGAACAC-3 '

(1) the first probe is a single-stranded nucleic acid,

An unfixed first probe using single stranded nucleic acid as the first probe was prepared as follows. First, a single-stranded nucleic acid, a 5'-spacer-first probe-3'structure was prepared (Integrated DNA Technologies, USA). Next, 48 μL of a reaction solution (50 mM Tris-HCl, 10 mM MgCl 2, 10 mM MgCl 2, and 10 mM MgCl 2) containing 10 μl of the 5'-spacer-first probe- 1 mM ATP, 10 mM DTT, pH 7.5) was added with 2 uL of 5 unit / uL T4 ligase (NEB, USA) to prepare a non-immobilized first probe for nucleic acid detection.

(2) Manufacture of non-immobilized first probe in which the first probe is an antibody

An unfixed first probe using an antibody with the first probe was prepared as follows. First, the addition reaction to the antibody (-SH group obtained by reducing the disulfide bond of the antibody using DTT) was performed according to the protocol of the Thunder-Link oligo conjugation system (Innova Biosciences, UK) Antibody. Specifically, 100 μl of the antibody at a concentration of 1 mg / ml was added to an Antibody Activation Reagent tube provided by the manufacturer, and reacted at room temperature for 1 hour to prepare an activated antibody to which a reactive group was added. A spacer of the single-stranded nucleic acid with the following reactive group (NH ₂ ), 5'-spacer -NH ₂ was custom made (Integrated DNA Technologies, USA). Then, the above-mentioned activated antibody and the spacer having the reactive group were reacted in N-succinimidyl-S-acetyl-thioacetate solution to prepare a 5'-spacer-antibody-3 'structure. Finally, 48 μL of a reaction solution (50 mM Tris-HCl, 10 mM MgCl 2, 1 μL) containing 10 μL of 5'-spacer-antibody-3'structures at a concentration of 1 mg / mM ATP, 10 mM DTT, pH 7.5) was added with 2 uL of 5 unit / uL T4 ligase (NEB, USA) to prepare a non-immobilized first probe for detection of proteins and the like.

③ Manufacture of non-fixed first probe with first probe as platamer

An unfixed first probe using an abutmenter as a first probe was prepared as follows. First, a 5'-spacer-abtamer-3 'structure was prepared by ordering it (Integrated DNA Technologies, USA). 10 ul of the 5'-spacer-abramarater-3 'construct at a concentration of 1 mg / ml and 48 uL of a reaction solution (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP, 10 mM DTT, pH 7.5) was added with 2 uL of 5 unit / uL T4 ligase (NEB, USA) to prepare a non-immobilized first probe for nucleic acid detection.

(2) Fixed first probe

The immobilized first probe was prepared with a 5'-first probe-spacer-immobilized region-color indicating barcode-biotin-3 'structure. Here, the immobilization region is composed of a repetition sequence of a known sequence, and a fixed molecule (that is, a fixed nucleic acid molecule) including a complementary sequence to the immobilization region is complementarily combined and used to fix the first probe to the support.

The single-stranded nucleic acid of the following sequence was used as the immobilization region.

Fixed region: 5 '- (GCCACAGCACCTTGGTGCGTAGGATCTG) ₁₀ -3'

Here, 10 means an integer number of repeats of the above sequence.

The first probe is a single stranded nucleic acid,

A fixed first probe using a single-stranded nucleic acid as the first probe was prepared as follows. First, a 5'-spacer-fixed region-3 'structure of single stranded nucleic acid was prepared by custom manufacturing (Integrated DNA Technologies, USA). The 5'-hue indicator-biotin-3 'structure was prepared using the Thermo Scientific Biotin 3 End DNA Labeling Kit (Thermo Scientific, USA) for the addition of biotin to the next hue bar code. Specifically, 100 μl of a color-indicating barcode at a concentration of 1 mg / ml and 45 μl of 5 uL of Biotin-11-UTP (Biotin-11-Uridine-5'-triphosphate) uL terminal deoxynucleotidyl transferase (TdT) was added to the reaction solution (50 mM Potassium Acetate, 20 mM Tris-acetate, 10 mM Magnesium Acetate, pH 7.9) 45 uL of a mixture of 10 ul of 5'-spacer-fixed-region -3'structures at a concentration of 1 mg / ml and 10 ul of 5'-hue indicator-biotin-3'structures at a concentration of 1 mg / ml 2 uL of 5 unit / uL T4 ligase (NEB, USA) was added to the reaction solution (50 mM Potassium Acetate, 20 mM Tris-acetate, 10 mM Magnesium Acetate, pH 7.9) - Fixed area - Color indication barcode - Biotin-3 'structure was prepared and purified. Finally, the above prepared purified construct at a concentration of 1 mg / ml was incubated with 10 ul and 1 mg / ml 2 uL of 5 units / uL T4 ligase (NEB, USA) was added to 45 uL of the reaction solution (50 mM Potassium Acetate, 20 mM Tris-acetate, 10 mM Magnesium Acetate, pH 7.9) Linking reaction was carried out to prepare a fixed first probe in which the first probe as the 5'-first probe-spacer-fixing region-hue indicator-biotin-3 'was a single-stranded nucleic acid.

(2) Production of fixed first probe, in which the first probe is an antibody

A fixed first probe using an antibody with a first probe was prepared as follows. First, 5'-color indication bar code-biotin-3 'structure and the reactive group (SH group) is the added antibody was prepared in the same manner as described above, the single-stranded nucleic acid with a reactive group (NH ₂₎ 5'-NH _{The 2} -spacer-immobilized region-3 'construct was custom designed (Integrated DNA Technologies, USA). Then, 45 μL of a reaction solution (50 mM (50 mM)) was added to 100 μl of the NH ₂ -spacer-fixed region construct at a concentration of 1 mg / ml and 100 μl of the 5'-hue indicator-biotin- Potassium Acetate, 20 mM Tris-acetate , 10 mM Magnesium Acetate, pH 7.9) to was added to 5unit / uL T4 ligase (US, NEB Co.) 2uL by performing a ligation reaction, NH ₂ - spacer-fixed area-color indication A barcode-biotin-3 ' structure was prepared. Then, the above-described antibody and the construct were reacted at room temperature for 12 to 24 hours. Conjugate Clean Up Reagent (Innova Biosciences, UK) was added to the reaction mixture for 10 minutes, Centrifugation was carried out. This Conjugate Clean Up Reagent addition reaction and centrifugation were carried out twice to obtain a purified first 5'-first probe-spacer-fixed region-hue indicator-biotin-3 ' Probe.

③ Manufacture of fixed first probe with first probe as platamer

An unfixed first probe using an abutmenter as a first probe was prepared as follows. First, the 5'-hue indicator-barbit-biotin-3 'structure was prepared in the same manner as above, and single stranded nucleic acid of 5'-Aptamer-spacer-fixed region-3' , United States of America). 45 uL of a mixture of 100 uL of the 5'-hue indicator-biotin-3 'construct at a concentration of 1 mg / ml and 100 uL of the 5'-Aptamer-spacer- To the reaction solution, 5 μl / uL T4 ligase (50 mM Potassium Acetate, 20 mM Tris-acetate, 10 mM Magnesium Acetate, pH 7.9) (2 uL) Probe-spacer-fixed region-color indicating barcode-biotin-3 'was a platamer.

1-2. Manufacture of second probe and capture competition molecule

The second probe is prepared by binding a magnetic bead with a second probe, which is a specific binding region with a target molecule and a substance for harvest (harvesting material), with a capture probe or a capture probe, and the competitive molecule is a target molecule Competitive target molecule analogs) and magnetic beads as harvest materials.

1) Preparation of a second probe, wherein the second probe is a single-stranded nucleic acid or an ellipsoid

The second probe, a single-stranded nucleic acid or a second probe, which is an extramammary, was prepared by using biotin and streptavidin as intermediates in a second probe. Second, the reaction of adding biotin to a single nucleic acid or aptamer prepared in advance in the same manner as above was carried out using a Thermo Scientific Biotin 3 End DNA Labeling Kit (Thermo Scientific, USA) . Specifically, 45 μL of a reaction solution (50 mM Potassium Acetate, 20 mM Tris (1 mM)) was added to 100 μl of the construct at a concentration of 1 mg / ml and 5 μL of Biotin-11- -acetate, 10 mM Magnesium Acetate, pH 7.9), and reacted at 37 ° C for 1 hour with addition of 5 uL of 1.5 U / uL terminal deoxynucleotidyl transferase (TdT). Next, 50 ng / L of the 5'-second probe-biotin-3 'prepared above was added to 5 μg / L streptavidin coated magnetic beads (Streptavidin-coupled Dynabeads, Dynal Biotech ASA, Norway) And reacted with a continuous rotation according to the manufacturer's protocol to prepare a second probe having a single-stranded nucleic acid linked to the magnetic bead as a second probe.

2) Preparation of a second probe whose second probe is an antibody

The second probe, in which the second probe is an antibody, is prepared by binding magnetic beads directly to the antibody as a harvest material. First, Tosylactivated magnetic beads (M-280 Tosylactivated magnetic beads, Dynal Biotech ASA, Norway) with 100 μg of antibody and 5 mg of Tosyl group were dissolved in buffer solution (0.1 M borate buffer, pH 9.5) And reacted at room temperature for 48 hours. Antibody-bound magnetic beads were separated using a magnet through a tosyl group, and unbound antibody was removed by washing the beads with the same buffer solution. The magnetic beads (hereinafter referred to as capture probes) to which the molecules were bound were reacted at 37 ° C for 4 hours with 0.1% BSA (Bovine Serum Albumin, Sigma, USA) solution to inactivate tosyl groups not bound to molecules . After several washes, magnetic beads were mixed with buffer solution (0.1 M PBS, pH 7.4) and stored at 4 ° C.

3) Production of capture competitor molecules in which the competing molecule is a single-stranded nucleic acid

The capture competitor molecule, in which the competing molecule is a single-stranded nucleic acid, is used for nucleic acid detection as a target molecule, which is prepared in the same manner as the preparation of the second probe, wherein the second probe is a single-stranded nucleic acid or an extramammary.

4) Production of capture competitor molecules in which the competing molecule is a protein

The capture competition molecule, in which the competing molecule is a protein, is used for protein detection as a target molecule, which is prepared in the same manner as the preparation of the second probe, wherein the second probe is a single-stranded nucleic acid or an extramammary. Here, the competitive molecule used the same protein as the target protein.

1-3. Production of fixed molecules

The immobilized molecule was prepared by preparing a single-stranded nucleic acid having a base sequence complementary to the repeating sequence constituting the immobilization region of the first probe and biotin-labeled at the 5 'end (Integrated DNA Technologies, USA).

Example 2 Detection of Bacteria

Escherichia coli, Salmonella, Listeria and Staphylococcus, representative food poisoning bacteria, were detected using the antibody of Table 2 and the fixed first probe prepared by using aptamer of Table 3 as the first probe (ligand).

An antibody that binds to the surface molecule of food poisoning bacteria Antibody type Catalog number Supply company E. coli / Anti-E. 꼬 antibody ab25823 Abcam Company Listeria / Anti-Listeria Antibody 01-90-95 KPL Company Salmonella CSA-1 / Anti-Salmonella CSA-1 Antibody 01-91-99 KPL Company

The nucleotide sequence of the tympanic membrane binding to the surface molecule of food poisoning bacteria Food poisoning bacteria The base sequence (5 '- > 3') Serial Number Remarks E. coli
(E.Coli) CGCAGUUUGC GCGCGUUCCA AGUUCUCUCA UCACGGAAUA SEQ ID NO: 13 Korean Patent No. 10-0730359 ACACUGCGUG CUUACGACUU CUGGUCCCAU CAUUCGGCUA SEQ ID NO: 14 AGUUCGAUGA GGGUGACACC GCCAGGAGUG UUUGCUAGAC SEQ ID NO: 15 Salmonella typhimurium AGGTCTGTAGGTCTGCGGGGCGTGG SEQ ID NO: 16 Korean Patent No. 10-1459547 CAGCCAGGATGGGAGGTCTGTAGGTCTGCGGGGCGTGG SEQ ID NO: 17 Staphylococcus aureus GCAATGGTACGGTACTTCCGGGCTGGCCAGATCAGACCCCGGATGATCATCCTTGTGAGAACCACAAAAGTGCACGCTACTTTGCTAA SEQ ID NO: 18 Aptagen

The reaction solution contained 10 mM PBS buffer (137 mM NaCl, 10 mM Phosphate, 2.7 mM KCl pH 7.4) in the case of the antibody ligand, and a celex buffer (20 mM Tris-Cl buffer, pH 7.6 contained 100 mM NaCl, ₂ mM MgCl 2, was used as a _{5 mM KCl, 1 mM CaCl 2} and 0.02% Tween). The reaction solution contained 0.05 to 0.2% (w / v) of sodium azide for inhibiting bacterial growth, and 0.1 to 0.3% (w / v) of bovine serum albumin for inhibiting nonspecific binding. The reaction was carried out at a temperature of 20 to 30 占 폚.

Bacterial-containing samples (70 μl) were mixed with 15 μl of biotin-conjugated first probe and reacted for 30 minutes with shaking. 20 μl of the reaction solution was treated on streptavidin-coated glass slides (Nanocs, USA), and the glass slides were washed three times with a washing solution containing 0.1 × SSPE and 0.1% tween-20 to bind with bacteria The first probe which was not or did not specifically bind was removed. The spots in which the presence signal of the bacteria present in the complex formed by covering the cover slip and the first probe in association with the bacteria were detected using a nCounter digital analyzer (Nanostring technology, USA) And is shown in Fig.

Example 3: Nucleic acid and protein detection

3-1. Nucleic acid detection reaction

For the nucleic acid detection, a fixed first probe including a first probe of the single-strand nucleic acid of Table 4 below and a second probe including a second probe of the single-stranded nucleic acid of Table 4 below were used, β-actin, IL17 and IL17R mRNA as target molecules. Single-stranded nucleic acids of β-actin, IL17 and IL17R mRNA of Table 4 below were custom-made and used for the preparation of the first probe and the second probe (Bioneer, Korea). The nucleotide sequence information of the target molecules β-actin, IL17 and IL17R mRNA can be obtained from the GenBank data system (http: // www.ncbi.nlm.nih.gov) (the accession number of IL17 is NM_002190, And Accession number of IL17RA: NM_014339).

The probe sequence for the target mRNA Kinds The first probe 5'-3 ' The second probe 5'-3 ' β-actin mRNA gggcgacgaggcccagagcaagaga
(SEQ ID NO: 19) ggcatcctcaccctgaagtacccca
(SEQ ID NO: 20) IL17 mRNA ccctcaggaaccctcatccttcaaa
(SEQ ID NO: 21) gacagcctcatttcggactaaactc
(SEQ ID NO: 22) IL17RA mRNA ggagcagaagcctcccagccactag
(SEQ ID NO: 23) ccttttgggctcagtctctccaata
(SEQ ID NO: 24)

A sample of human cartilage tissue (Promocell, Germany) was used. First, the target molecule mRNA was isolated from the sample using AllPrep DNA / RNA / Protein Mini kit (Qiagen, USA). Specifically, the cartilage tissue was dissolved in the buffer provided in the manufacturer according to the manufacturer's protocol, and the dissolved sample was treated on the column and centrifuged to bind the RNA to the column membrane. RNA isolation in the column membrane was performed by washing the column with the RNA, extracting the RNA from the membrane, and harvesting the RNA by centrifugation.

The first probe-target mRNA-second probe complex was induced by mixing 200 ng / uL of the first probe and 200 ng / uL of the second probe with 100 ng / uL of total RNA and mixing by shaking. The hybridization reaction was carried out at 65 ° C in a reaction solution containing 0.5 M NaHPO ₄ , 7% SDS (sodium dodecyl sulfate) and 1 mM EDTA. The following reaction solution was applied to the magnet to induce immobilization of the complex on the magnet by the magnetic beads of the second probe, and then washed with the washing solution to remove the unbound first probe and non-target RNA. The washing was performed once at 68 ° C using 0.1X SSC / 0.1% SDS, once at 42 ° C using 0.2X SSC / 0.1% SDS at 48 ° C using standard saline citrate / Three times.

A solution containing 0.1X SSPE and 0.1% tween-20 was applied to the magnet to which the first probe-target mRNA-second probe complex was bound and heated at 95 ° C for 5 minutes to induce separation of the first probe in the complex After that, the supernatant containing the first probe was harvested.

After the supernatant was harvested, the first probe was immobilized on a cover slip coated with streptavidin according to the manufacturer's protocol using a nCounter digital analyzer (Nanostring technology, USA) using a nCounter digital analyzer The detected spots were imaged and detected and quantified.

Specifically, 1 uL of a 1: 5,000 dilution of 0.1% Tetraspeck fluorescence microsphere solution (Invitrogen, USA) was added to 3 uL of the harvested supernatant to prepare an assay sample, and the assay sample was treated with streptavidin Was loaded into the fluid device of the analyzer equipped with the coated cover slip (Optichem, Accelr8 Technology Corporation), so that the biotin of the first probe and the streptavidin of the cover slip were coupled to the cover slip of the first probe Binding. After induction of this binding, the surface was washed once with 90 μL of 1 × TAE solution, and 40 μL of 1 × TAE solution was further treated to allow the first probe to be stretched, followed by 160 V / cm for 1 minute Respectively. The first probe was further immobilized on the surface by introducing 60 nL of 500 nM fixed molecule into the expanded first probe to induce complementary binding to the immobilization region containing the repetitive sequence of the first probe. During this immobilization process, the current was maintained for 5 minutes. After the immobilization, the TAE solution was removed, and the image was prepared by adding SlowFade reagent (Invitrogen), which is an antiphotobleaching reagent for photographing. After preparing for imaging, four images were obtained at four different excitation wavelengths (480, 545, 580, 622) corresponding to the four fluorescent materials through the camera of the analyzer. The obtained four images were combined (spatial clustering) to obtain an image of the first probe as shown in the schematic diagram of FIG. Imaging procedure The resolution of the analyzer was set to 600 FOV (field of view). Data was downloaded from the analyzer and analyzed on Excel in accordance with the analytical instructions provided by the manufacturer. The data normalized the reference material and the target molecule in the sample using the positive control control standard curve initially provided. The normalized values were obtained by performing averaging over the whole of the target molecule values using the values of the reference materials contained in the sample. Quantitative values of the target molecules were calculated by averaging the results of three repeated analysis.

 Using the above analyzer, quantitative results were obtained for the target molecule, mRNA, by molecular count analysis. The results obtained were similar to RT-PCR results for the target mRNA.

3-2. Protein detection reaction

3-2-1. Protein detection reaction using only the first probe

The detection reaction was performed on the target molecules shown in Table 5 below using only the immobilized first probe containing the polyclonal antibody of Table 5 as the first probe for the target molecule. The overall process of this protein detection reaction can be seen in Figures 2 and 3.

Target molecule and its antibody Target molecule / antibody Catalog number manufacturer NGF / NGF Anti-NGF / NGFβ antibody OKBB00229 Aviva Systems Biology Amyloid beta (A4) Precursor Protein (APP) Anti-Amyloid beta (A4) Precursor Protein (APP) antibody ab12266 Abcam  (Tau) / Anti- (Tau) antibody T6402 SIGMA phospho-Tau (pSer400) / Anti-phospho-Tau (pSer400) antibody T1700 SIGMA C Reactive Protein (CRP) / Anti-C Reactive Protein (CRP) antibody ab99995 abcam TGF alpha / Anti-TGF alpha antibody ab9585 abcam IL1 beta / Anti-IL1 beta antibody ab2105 abcam Serum Amyloid A / Anti-Serum Amyloid A antibody ab200584 abcam p53 / p53 Antibody (DO-7) MA5-12557 abcam CEACAM5 / CEACAM5 Polyclonal Antibody MBS170144 BioSource Alpha Fetoprotein (Alpha-Fetoprotein) (N-Term) ABIN356914 Biocompare E. coli Enoyl-ACP Reductase / Anti-E. coli Enoyl-ACP Reductase antibody Sino Biological Inc. China Phototropin 1 / Anti-Phototropin 1 antibody Cosmo Bio Co. Ltd. Japan

First, a solution containing 100 μg / ml of the target molecule of Table 5 was prepared using 10 mM PBS buffer (137 mM NaCl, 10 mM Phosphate, 2.7 mM KCl pH 7.4), and the solution was diluted stepwise The final concentration of biomolecules was 1,000 pg / mL, 100 pg / mL, 10 pg / mL, 0.1 pg / mL, and 0 pg / mL. Analytical Mixed Samples were prepared by mixing the diluted solutions of 13 different biomolecules at various concentrations.

The immobilized first probe solution was prepared so as to contain the first probe at a concentration of 200 ng / ul using 10 mM PBS buffer (137 mM NaCl, 10 mM Phosphate, 2.7 mM KCl pH 7.4).

Nitrocellulose membrane discs were placed in the reaction solution containing the above analytical sample and allowed to react for 30 minutes with shaking to allow the proteins in the sample to be adsorbed on the membrane. The disk was washed with 150 uL of 0.1X SSPE / 0.1% Tween-20 solution and incubated in blocking solution [washing solution with 2% (w / v) Bovine Serum Albumin (BSA)]. 70 μl of immobilized first probe solution for each target molecule was added and reacted with shaking for 1 hour to induce complex formation between the target molecule and the first probe. The disc was washed three times with the addition of 150 uL of 0.1X SSPE / 0.1% Tween-20 solution to the disc to remove the excess probe that did not form the next complex and the first probe that formed the nonspecific complex.

To separate and harvest the first probe from the washed disc, 0.1X SSPE / 0.1% tween-20 solution was added to the washed disc and heated at 95 ° C for 5 minutes to induce separation of the first probe from the complex , The supernatant containing the first probe was harvested.

After the supernatant was harvested, the nCounter digital analyzer (Nanostring technology, USA) was used as a molecular coagulation analyzer in the same manner as in Example 3-1, Tabivine was fixed on a coated cover slip and the fixed spot was imaged and detected and quantified.

3-2-2. Protein detection reaction using the first probe and the second probe (capture detection reaction)

As in the case of the fixed first probe comprising the polyclonal antibody of Table 5 as the first probe for the target molecule, the polyclonal antibody of Table 5 was used as the second probe for each target molecule 2 probe was used to perform the detection reaction on the target molecule of Table 5. [ The overall process of this protein detection reaction can be seen in Figures 4 and 5.

The analytical sample was prepared in the same manner as in Example 4-1. To 25 μl of the assay sample, 70 μl of the fixed first probe solution and 70 μl of the second probe solution for each target molecule were mixed and reacted for 1 hour while shaking to induce complex formation between the first probe-target molecule-second probe Respectively. The next reaction solution was treated with a magnet to induce immobilization of the complex on the magnet by magnetic beads of the second probe, and then washed with a washing solution to remove unbound first probe and non-target molecules. The washing was carried out three times using 150 uL of 0.1X SSPE / 0.1% tween-20 solution.

Next, the magnet with the complex bonded thereto was treated with a solution of 0.1X SSPE / 0.1% tween-20 and heated at 95 ° C for 5 minutes to induce the separation of the first probe from the complex, and then the supernatant containing the first probe Were harvested.

After the supernatant was harvested, the nCounter digital analyzer (Nanostring technology, USA) was used as a molecular coagulation analyzer in the same manner as in Example 3-1, Tabivine was fixed on a coated cover slip and the fixed spot was imaged and detected and quantified.

Table 6 shows the results of the quantification.

The actual and analytical concentration of the target molecule in the prepared mixed sample Target molecule Serial number Actual Amount (pg / mL) Amount of measurement (pg / mL) NGF / NGF One 12.0 12.5 Amyloid beta (A4) Precursor Protein (APP) 2 1.0 0.8 Tau 3 1.0 0.8 phospho-Tau (pSer400) 4 0.2 0.2 C Reactive Protein (CRP) 5 130 125.5 TGF alpha 6 6.0 6.2 IL1 beta / Anti-IL1 beta antibody 7 40.0 38.1 Serum Amyloid A 8 5.0 5.0 p53 9 2.5 2.5 CEACAM5 10 2.0 1.9 alpha Fetoprotein 11 0.5 0.6 E. coli Enoyl-ACP Reductase 12 80.0 81.9 Phototropin 1 13 10.0 9.5

Mock comparisons consisting of two kinds of reference materials (E. coli Enoyl-ACP Reductase, Phototropin 1) and three controls containing the reference material and containing other target molecules were analyzed. Mock comparisons made of standard materials were used to normalize the data with differences in standard concentration curve creation and reaction, purification and collection efficiencies. The linearity, dynamic range and reproducibility of the standard material are examined and shown in FIG. FIG. 12 shows the result of measurement (reference value) of the control signal (count) 0.1 pg / mL for each analysis and 100 pg / mL. The analysis also showed that the linear regression coefficient of concentration versus count was linear with ≥0.989 logos in log of 0.1 or more of concentration.

The results of the normalization of 13 biomolecules of Table 6 are shown in logarithmic scale in FIG. 13, and the deviation of the signals is 0.7 to 35.4.

3-2-3. Protein detection reaction using first probe and capture competitor molecule (competition detection reaction)

The detection reaction of the target molecule of Table 5 was performed using the first probe having the antibody of Table 6 as the first probe and the capture competition molecule using the proteins of Table 5 as competitive molecules Respectively. The overall process of this protein detection reaction can be seen in Figures 6 and 7.

The analytical sample was prepared in the same manner as in Example 4-1. To 25 μl of the analytical sample, 70 μl of the immobilized first probe solution for each target molecule and 70 μl of the capture competent molecule (30 μg / μl), which had been previously quantified, were mixed and reacted for 1 hour with shaking to obtain the first probe- And the first probe-capture competition molecule. Next, the reaction solution is treated with a magnet to induce immobilization of the complex on the magnet by the magnetic beads of the trapping competitive molecule, and then washed with the washing solution to remove unbound first probe, other target molecules other than the target molecule, - The target molecule was removed and only the complex between the first probe-capture competition molecule was harvested. The washing was carried out three times using 150 uL of 0.1X SSPE / 0.1% tween-20 solution.

Next, the first probe-trap competitive molecule-coupled magnet was treated with 0.1X SSPE / 0.1% tween-20 solution and heated at 95 ° C for 5 minutes to induce separation of the first probe from the complex, Were harvested.

After the supernatant was harvested, the nCounter digital analyzer (Nanostring technology, USA) was used as a molecular coagulation analyzer in the same manner as in Example 3-1, Tabivine was fixed on a coated cover slip and the fixed spot was imaged and detected and quantified. From the quantification results of the capture competitor molecules thus obtained, quantitative results of the target molecules were obtained using a standard curve.

Claims (10)

(i) a region specifically binding to the target molecule and
(ii) a signal generating region bound to a specific binding region with the target molecule,
The signal generating region is a double-stranded nucleic acid that is complementarily crosslinked to each other, and the double-stranded nucleic acid is labeled with the same signal-generating substance or a signal unique to the target molecule in which two or more regions labeled with different signal- A double-stranded nucleic acid signal probe,
Wherein the target molecule can be detected by detecting only the separated signal probe by separating from the complex by heating after formation of a complex with the target molecule for detection of the target molecule.
The method according to claim 1,
Characterized in that said at least two regions are labeled with a signal generating material whose one or more regions generate a different signal than the remaining region
Signal probe.
The method according to claim 1,
Wherein the double-stranded nucleic acid as the signal-generating region is a complete double-stranded nucleic acid or a partial double-stranded nucleic acid
Signal probe.
The method according to claim 1,
Wherein the specific binding region with the target molecule is a single-stranded nucleic acid, an antibody, an antigen, or an umbrella
Signal probe.
The method according to claim 1,
Wherein the signal generating material is at least two kinds of fluorescent materials having different colors
Signal probe.
The method according to claim 1,
Characterized in that the immobilization region is connected adjacent to the signal generation region in known sequence
Signal probe.
The method according to claim 1,
Wherein the fixed region is further connected adjacent to the signal generation region with a known sequence,
Characterized in that the known sequence is repeated twice
Signal probe.
The method according to claim 1,
And a spacer is included between the signal-generating region and the specific binding region with the target molecule.
Signal probe.
The method according to claim 1,
And a binding tag is connected to the specific binding site opposite to the target molecule.
Signal probe.
The method according to claim 1,
A binding tag is connected to the opposite side of the specific binding region with the target molecule,
Wherein the binding tag is a biotin or a biotin analogue
Signal probe.

Images