KR102474286B1 - A dna aptamer specifically biding to severe fever with thrombocytopenia syndrome virus and immunoassay using the aptamer - Google Patents

Abstract

The present invention relates to a DNA aptamer that specifically binds to severe fever with thrombocytopenia syndrome virus and its use, wherein the aptamer selected by the modified Systematic evolution of ligands by exponential enrichment (SELEX) method of the present invention is Server fever with thrombocytopenia syndrome (SFTS) Since the antibody binds to a different site from the viral nuclear protein, it can be applied to various fields such as a sandwich-type biosensor. Furthermore, such aptamers are not only very excellent in stability and sensitivity compared to preparations containing conventional antibodies, but also can be mass-produced in a short time and at low cost by chemical synthesis, and various modifications are easy to increase binding force. Advantages do exist.

Description

Immunoassay method using DNA aptamer and aptamer specifically binding to severe fever with thrombocytopenia syndrome virus

The present invention relates to a DNA aptamer that specifically binds to severe fever with thrombocytopenia syndrome virus and an immunoassay method using the aptamer.

Severe fever with thrombocytopenia syndrome (SFTS) is an infectious disease mediated by a new type of tick, Haemaphysalis longicornis, or Amblyomma testudinarium, which is known to be widespread in Korea. It is caused by infection with Severe Fever with Thrombocytopenia Syndrome Virus (SFTSV), which is mediated by

SFTS was first reported in China in 2009, and the disease and virus were also reported in Japan and Korea in 2012. The main symptoms of SFTS are fever, abdominal pain, nausea, vomiting, thrombocytopenia or leukopenia, etc. In severe cases, multiple organ failure may occur and death may occur. SFTS occurs steadily every year in China, Japan, or Korea, and it is a very high disease with a mortality rate of 6 to 30%, and mainly occurs between spring and summer when mites are active.

The wild host of the severe fever with thrombocytopenia syndrome virus is the rat rat, and in China's major outbreaks, high rates of serum antibodies were found in livestock such as goats, cows, dogs, or chickens, so livestock may act as hosts. However, until now, it is difficult to find a clear host due to the lack of academic evidence for the virus. In addition, although it has been reported that human-to-human infection occurred through bodily fluids of an infected person, early diagnosis is very important because there is no treatment or prevention method that has been proven to effectively treat SFTS to date.

The method of detecting the RNA sequence of severe fever with thrombocytopenia syndrome virus in a human specimen to confirm SFTS infection is known to show high accuracy, but there is difficulty in isolating high-quality viral RNA from the specimen. As another method of diagnosing SFTS, there is a method of measuring the anti-severe fever with thrombocytopenia syndrome virus antibody titer present in the blood. At this time, the titer of the anti-severe fever with thrombocytopenia syndrome virus antibody is mainly measured with an antibody against the nuclear protein of severe fever with thrombocytopenia syndrome virus. However, in the case of such an antibody, the manufacturing process is very long and difficult, and there are limitations in that stability is low.

Accordingly, there is a need for research on new diagnostic molecules for application to sandwich-type biosensors that are highly stable and capable of various modifications and can be used for diagnosis in combination with antibodies.

A new type of immunoassay method for the diagnosis of infectious diseases, known as Immuno-PCR, incorporates PCR with antibodies conjugated to DNA probes for highly sensitive detection of proteins. After binding of the protein target and antibody pair forms a sandwich-type immune complex, the DNA probe linked to the detection antibody is amplified, resulting in higher sensitivity detection than is achieved with conventional immunoassays.

However, this immunoassay still has several drawbacks associated with the use of paired antibodies. First, the antibody production process does not include an additional selection step to reduce the interaction between the two antibodies. Thus, a low signal-to-noise ratio can limit the sensitivity enhancement promoted by probe amplification. In addition, this method still requires antibody screening to select optimally paired antibodies, which slows down the development of new immunoassays. Finally, the synthesis of detection antibodies conjugated with DNA probes requires complex steps including amino modifications to the DNA probes, which can lead to antibody degradation because many chemical reagents are used.

Fischer, Nicholas O et al. "Protein detection via direct enzymatic amplification of short DNA aptamers." Analytical biochemistry vol. 373,1 (2008): 121-8.

One object of the present invention is to provide an aptamer that specifically binds to a nuclear protein of a server fever with thrombocytopenia syndrome (SFTS) virus.

Another object of the present invention is to provide a composition for detecting severe fever with thrombocytopenia syndrome virus comprising the aptamer according to the present invention.

Another object of the present invention is to provide a kit for detecting severe fever with thrombocytopenia syndrome virus comprising the composition for detection of the present invention.

Another object of the present invention is to provide a method for detecting severe fever with thrombocytopenia syndrome virus using the composition for detection.

Another object of the present invention is to provide a heterogeneous sandwich-type immunoassay method using aptamer and nucleic acid amplification technology.

Other objects and advantages of the present invention can be more clearly interpreted by the following description, claims and drawings.

One embodiment of the present invention provides a method for screening aptamers.

The screening method of the present invention includes an antibody immobilization step of immobilizing an antibody specific to a target substance to a support; A first reaction step of adding a target material to the support on which the antibody is immobilized and reacting; A second reaction step in which the aptamer library is added to the support after the first reaction step and reacted; and a first elution step of eluting the aptamer bound to the target material in the second reaction step.

The screening method of the present invention includes an amplification step of amplifying the nucleic acid of the aptamer eluted in the first elution step; a 2-1 reaction step in which the nucleic acid of the amplified aptamer is added to the support where the first reaction step is completed and reacted; and a second elution step of eluting the aptamer bound to the target material in the 2-1 reaction step.

The "aptamer" of the present invention is a molecule that binds to a molecular target with high specificity and affinity comparable to monoclonal antibodies through interactions other than conventional Watson-Crick base pairing, Refers to a single-stranded nucleic acid chain that adopts a specific tertiary structure. The aptamer may be nucleic acid DNA or RNA, preferably single-stranded DNA, but is not limited thereto.

When the aptamer of the present invention is RNA, it can be produced by in vitro transcription of a DNA library using T7 RNA polymerase or a modified T7 RNA polymerase.

"Nucleic acid" as used herein refers to any type of nucleic acid, such as DNA and RNA, and variants thereof, such as peptide nucleic acid (PNA), locked nucleic acid (LNA), and combinations thereof, Modifications of, such as modified nucleotides and the like. The terms "nucleic acid" and "oligonucleotide" and "polynucleotide" are used interchangeably. The nucleic acids can be prepared using recombinant expression systems and optionally purified from natural sources, such as purified, chemically synthesized, or the like. In the case of chemically synthesized molecules, nucleic acids may include nucleoside analogs, such as chemically modified bases or sugars, analogs with backbone modifications, and the like. Base sequences of nucleic acids are shown in the 5'-3' direction unless otherwise indicated.

The "aptamer library" of the present invention includes a plurality of single strand DNA (ssDNA) or RNA having the ability to bind to a target substance, and the aptamer library is composed of different nucleotide sequences. It may include at least one single-stranded DNA base sequence or RNA base sequence selected from the group consisting of:

The aptamer of the present invention may include a chemically modified form. In general, wild-type nucleic acid molecules that do not have chemical modifications are susceptible to degradation by nucleases. Thus, the nucleic acid aptamer of the present invention can introduce any type of chemical modification that imparts resistance to various nucleases known in the art. For example, the chemical modification includes 2'-amino pyrimidine, 2'-fluoro pyrimidine, 2'-O-methyl ribose purine and pyrimidine, and the phosphodiester bond of the backbone is converted to phosphorothio A method of transformation with an ate bond can be performed. In addition, resistance to nucleases can be increased by capping the 3'-end by linking the 3'-end to 3'-3', and renal filtration by attaching PEG (polyethyleneglycol) as a polymer. ) speed can be reduced.

The single-stranded nucleic acid nucleotide sequence of the present invention consists of forward or reverse primer sequences for amplification at both ends, and may consist of 30 to 50 nucleotide sequences in the center of the primer sequence, preferably 35 It may consist of one to 45 base sequences, more preferably 40 base sequences, but is not limited thereto. If the central nucleotide sequence is less than 30 or more than 50, it cannot have the ability to specifically bind to a target substance, or the single-stranded nucleic acid cannot sufficiently form a secondary or tertiary structure.

Hereinafter, with reference to FIG. 2, each step will be described in detail.

antibody immobilization step;

In the antibody immobilization step of the present invention, an antibody specific to a target material is immobilized on a support.

The antibody immobilization step of the present invention is to immobilize an antibody specific to a target material on a support, and through this process, aptamers capable of binding to sites other than the antibody-specific binding site of the target material can be specifically selected. can

The antibody immobilization step of the present invention is to bind uniformly and stably to the surface of the support, except for the antigen-binding site of the antibody capable of binding to the target substance, to be suitable for the type of the support according to a conventional method. Bonding, covalent bonding, van der Waals bonding or plasma grafting methods, or combinations thereof may be used.

The "antibody specific to a target substance" of the present invention is a substance that specifically binds to a target substance to cause an antigen-antibody reaction, and if it can cause an antigen-antibody reaction with the target substance of the present invention, IgG ( Immunoglobulin G), IgA, IgM, IgD and IgE antibodies may all be included. The basic structure of the antibody is a Y-shaped protein, and includes a variable region having a specific amino acid sequence capable of binding to an antigen at the upper two portions of the Y, and a constant region responsible for structural stability and the like.

The "support" of the present invention is a base on which an antibody can be immobilized, and may include anything that can be bound to an amino acid region other than a variable region of an antibody, for example, a nitrocellulose membrane; polyvinilidenflouride (PVDF) membrane; well plates made of polyvinyl resin or polystyrene resin; And it may be at least one selected from the group consisting of slide glass, preferably a well plate, but is not limited thereto.

The well plate of the present invention may be composed of 6-well, 12-well, 24-well, 48-well or 96-well wells, preferably a 96-well plate, but is not limited thereto.

first reaction step;

In the first reaction step of the present invention, the target material is put into the support on which the antibody is immobilized and reacted.

The first reaction step of the present invention is a step of binding the target material to the antibody through an antigen-antibody reaction, and through this process, an aptamer capable of binding to a site other than the antibody-specific binding site of the target material can be specifically selected.

The "target substance" of the present invention is a target substance to which an aptamer specifically binds, and may include any target to which an antigen-antibody reaction may occur, for example, a metal ion, a compound, and a nucleic acid. , It may be at least one selected from the group consisting of proteins, peptides and cells, preferably proteins, but is not limited thereto.

In the first reaction step of the present invention, before the process of reacting the target material and the antibody, a step of reacting with a blocking buffer may be further performed. As such, when the additional reaction is performed with the blocking buffer, the efficiency of selecting an aptamer that specifically binds only to the target substance without binding to the antibody can be remarkably increased.

The "blocking buffer" of the present invention is a buffer containing a blocking material for preventing a non-specific reaction caused by binding of an aptamer to an antibody, wherein the blocking material is a non-specific reaction in which the aptamer and the antibody bind Anything to prevent this may be included, and for example, it may be non-fat-milk or BSA (Bovine Serum albumin), but is not limited thereto.

recovery step;

After the first reaction step of the present invention, adding the aptamer library to the antibody-immobilized support and reacting; and a recovery step of recovering the supernatant containing the aptamer library that did not react with the antibody.

When the recovery step of the present invention is additionally performed, there is an advantage in that noise that may occur in the selection process of aptamers can be very effectively removed by selectively removing aptamers that interact with antibodies other than the target substance. do.

Second reaction step

In the second reaction step of the present invention, the aptamer library is added to the support after the first reaction step is completed and reacted.

The second reaction step of the present invention is a step of allowing the aptamer to bind to the target material, and through this process, it is possible to select an aptamer that specifically binds to the target material.

The "specific binding" of the present invention means a non-covalent physical bond between the aptamer of the present invention and the nuclear protein of its target substance. When binding between the aptamer of the present invention and the target substance, the dissociation constant (K _d ) value may be 0.3 μM to 5 μM, preferably 0.5 μM to 4 μM, but is not limited thereto. In the case of having a dissociation constant of less than 0.5 μM or greater than 5 μM, it may not be easy to detect the target substance.

First elution step

In the second reaction step of the present invention, the aptamer specifically bound to the target material is eluted.

The first elution step of the present invention corresponds to a step of separating the binding between the target material and the aptamer in order to obtain only the aptamer bound to the target material from the aptamer library.

The elution step of the present invention may be any conventional method for separating the binding between the target material and the aptamer, and may be performed by, for example, a centrifugation method, a method of reacting with an acid or base solution, and the like. However, it is not limited thereto.

amplification step; 2-1st reaction step; and a second elution step;

The aptamer selection method of the present invention includes an amplification step of amplifying the nucleic acid of the aptamer eluted in the first elution step; a 2-1 reaction step in which the nucleic acid of the amplified aptamer is added to the support where the first reaction step is completed and reacted; and a second elution step of eluting the aptamer specifically bound to the target material in the 2-1 reaction step.

The amplification step of the present invention; 2-1st reaction step; And the second elution step is a step in which a specific reaction between the target material and the aptamer is performed multiple times, and finally, the specificity of the selected aptamer can be increased.

The "amplification step" of the present invention may be used in any method for amplifying nucleic acids using aptamers, and may be performed through, for example, polymerase chain reaction, but is not limited thereto.

The amplification step of the present invention; 2-1st reaction step; And the second elution step may be repeated 2 to 30 times, preferably 5 to 15 times, more preferably 10 times, but not limited thereto. If the repetition step is less than 2 times, it is not possible to sufficiently increase the specificity of the desired aptamer, and if it is more than 30 times, excessive cost and time may be required.

One embodiment of the present invention provides an aptamer. Specifically, the aptamer is an aptamer selected by the aptamer screening method.

The aptamer of the present invention specifically binds to the nuclear protein of server fever with thrombocytopenia syndrome (SFTS) virus and contains 76 nucleotide sequences.

The server fever with thrombocytopenia syndrome (SFTS) virus of the present invention is a virus that can cause severe fever with thrombocytopenia syndrome when infected, and has a nucleic acid protein (Nucleocapsid Protein; NP) surrounding RNA, which is a genetic material. Many exist. Since the nucleic acid protein has a relatively low mutation probability and little change in structure and sequence even when the virus is mutated, sensitivity and specificity can be remarkably increased by specifically detecting such a nucleic acid protein.

The nucleic acid protein of the severe fever with thrombocytopenia syndrome virus of the present invention may consist of the amino acid sequence represented by SEQ ID NO: 1, but is not limited thereto.

The aptamer of the present invention may consist of the nucleotide sequence represented by SEQ ID NO: 2 below. In the nucleotide sequence of SEQ ID NO: 2, N is a nucleotide sequence of 40 integers, and the base is independent from the group consisting of A (adenine), C (cytosine), G (guanine), uracil (U) and T (thymine). is selected as:

5′-ATC CAG AGT GAC GCA GCA-[NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN]-TG GAC ACG GTG GCT TAG T-3′ (SEQ ID NO: 2)

In the nucleotide sequence represented by SEQ ID NO: 2 of the present invention, the N may be at least one selected from the group consisting of SEQ ID NOs: 3 to 5, but is not limited thereto.

CGACCACAGATTGGAGACTGATAGTGCACGAGCAAGGACA (SEQ ID NO: 3)

TCGGATGGATTGTGGTCGAAGTTGTTTCCGACACTAGTCA (SEQ ID NO: 4)

CACATCGGAGAACAGGCGCACTGTCGGAGGAACCGCAACG (SEQ ID NO: 5)

The aptamer of the present invention may be at least one selected from the group consisting of the nucleotide sequences represented by SEQ ID NOs: 6 to 8, preferably consisting of the nucleotide sequences represented by SEQ ID NO: 8, but is not limited thereto. not;

5′- ATC CAG AGT GAC GCA GCA CGA CCA CAG ATT GGA GAC TGA TAG TGC ACG AGC AAG GAC ATG GAC ACG GTG GCT TAG T -3′ (SEQ ID NO: 6),

5′- ATC CAG AGT GAC GCA GCA TCG GAT GGA TTG TGG TCG AAG TTG TTT CCG ACA CTA GTC ATG GAC ACG GTG GCT TAG T -3′ (SEQ ID NO: 7),

5′- ATC CAG AGT GAC GCA GCA CAC ATC GGA GAA CAG GCG CAC TGT CGG AGG AAC CGC AAC GTG GAC ACG GTG GCT TAG T -3′ (SEQ ID NO: 8).

A detectable label may be bound to the 3' or 5' end of the aptamer of the present invention. Such a detectable label is a moiety that can be detected by a detection method known in the art, and can be bound to a specific base or specific structure of an aptamer according to a conventional method.

The detectable label of the present invention may be, for example, at least one label selected from the group consisting of an optical label, an electrochemical label, and a radioactive isotope, but is not limited thereto.

The optical label of the present invention may be a fluorescent material or an enzyme.

The fluorescent substance of the present invention is fluorescein, biotin, 6-FAM, rhodamine, Texas Red, tetramethylrhodamine, carboxyrhodamine, carboxyrotamine 6G, carboxyrodol , Carboxyrhodamine 110, Cascade Blue, Cascade Yellow, Cormarin, Cy2 (cyanine 2), Cy3 (cyanine 3), Cy3.5 (cyanine 3.5), Cy5 (cyanine 5) , Cy5.5 (cyanine 5.5), Cy-chrome, phycoerythrin, PerCP (peridinine chlorophyll-a protein), PerCP-Cy5.5, JOE (6-carboxy-4',5'-dichloro-2 ',7'-dimethoxyfluorescein), NED, ROX (5-(and-6)-carboxy-X-rhodamine), HEX, Lucifer Yellow, Marina Blue, Oregon Oregon Green 488, Oregon Green 500, Oregon Green 514, Alexa Flor, 7-amino-4-methylcomarin-3-acetic acid, BODIPY FL, Bodipy FL-Br 2, Bodipy 530/ 550, it may be at least one selected from the group consisting of conjugates thereof, but is not limited thereto.

The enzyme of the present invention may be an enzyme used in an enzyme-linked immunosorbent assay (ELISA), and may be, for example, alkaline phosphatase, horseradish peroxidase, luciferase, or glucose oxidase. When an enzyme is used as the optical label, luminol, streptividin, isoluminol, luciferin, lucigenin ( lucigenin), 3-(2'-Spiroadamantane)-4-methoxy-4-(3''-phosphoryloxy)phenyl-1,2-dioxetane (AMPPD), Disodium 3-(4-methoxyspiro {1,2-dioxetane- 3,2'-(5'-chloro)tricyclo[3.3.1.13,7]decan}-4-yl) phenyl phosphate (CSPD), etc., but is not limited thereto.

The optical label of the present invention includes a fluorescent donor chromophore and a fluorescent acceptor chromophore separated by an appropriate distance, and fluorescence resonance energy transfer (FRET) in which the fluorescence emission of the donor is suppressed by the acceptor. can be a pair The donor chromogen may include FAM, TAMRA, VIC, JOE, Cy3, Cy5, and Texas Red, preferably FAM, but is not limited thereto.

The radioactive isotope of the present invention may be, for example, at least one selected from the group consisting of ¹²⁴ I, ¹²⁵ I, ¹¹¹ In, ^99m Tc, ³² P and ³⁵ S, but is not limited thereto.

The "specific binding" of the present invention means a non-covalent physical bond between the aptamer and its target protein, the nuclear protein of severe fever with thrombocytopenia syndrome virus. When binding between the aptamer of the present invention and the target protein, the dissociation constant (K _d ) value may be 0.3 μM to 5 μM, preferably 0.5 μM to 4 μM, but is not limited thereto. In the case of having a dissociation constant of less than 0.5 μM or greater than 5 μM, it may not be easy to detect the target protein. For the purposes of the present invention, since the aptamer binds to a target protein at a site other than an antibody binding site, it can be applied to various types of biosensors.

The sequence of the aptamer of the present invention can be easily modified by substitution, deletion, insertion, or a combination of one or more bases. Therefore, a nucleotide sequence having high homology with SEQ ID NO: 3 to SEQ ID NO: 5 of the present invention, for example, a nucleotide sequence having a homology of 80% or more, 90% or more, or 95% or more, is suitable for the nucleotide sequence of the present invention. All can be included.

The "homology" of the present invention is intended to indicate the degree of similarity with the nucleotide sequence, and includes a sequence having the same percentage or more as the nucleotide sequence of the present invention. Such homology can be determined by visually comparing the two sequences, but it can be determined using a bioinformatic algorithm that analyzes the degree of homology by arranging the sequences to be compared side by side. The homology between the two amino acid sequences can be expressed as a percentage. Useful automated algorithms are available in the GAP, BESTFIT, FASTA and TFASTA computer software modules of the Wisconsin Genetics Software Package (Genetics Computer Group, Madison, W, USA). Alignment algorithms automated in the module include Needleman & Wunsch, Pearson & Lipman, and Smith & Waterman sequence alignment algorithms. Algorithms and homology determinations for other useful alignments can be automated in software including FASTP, BLAST, BLAST2, PSIBLAST and CLUSTAL W.

The aptamer of the present invention may be modified at the 5' end, the 3' end, the middle, or both ends in order to improve serum stability or regulate renal clearance. The modification is PEG (polyethylene glycol), idT (inverted deoxythymidine), LNA (Locked Nucleic Acid), 2'-methoxynucleoside, 2'-aminonucleoside at the 5' end, 3' end, middle or both ends thereof It may be modified by combining at least one selected from the group consisting of cleosides, 2'F-nucleosides, amine linkers, thiol linkers, and cholesterol.

The “idT (inverted deoxythymidine)” of the present invention is one of the molecules used to prevent degradation by nucleases of aptamers, which are generally weak in nuclease resistance, and the nucleic acid unit is 3 of the preceding unit. '-OH and the 5'-0H of the next unit combine to form a chain, but idT binds the 3'-OH of the next unit to the 3'-OH of the previous unit to expose 5'-OH, not 3'-OH It is a molecule that induces the effect of suppressing degradation by 3' exonuclease, a type of nuclease, by artificially changing it to be.

Another embodiment of the present invention provides a composition for detecting severe fever with thrombocytopenia syndrome virus.

The detection composition of the present invention includes the aptamer according to the present invention.

In the composition for detection of the present invention, the contents related to the aptamer are the same as those described for the aptamer, and thus are omitted to avoid excessive complexity of the specification.

Examples of suitable carriers, excipients and diluents that may be included in the composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginates, gelatin, calcium phosphate, calcium silicate. , cellulose, methyl cellulose, amorphous cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil.

Another embodiment of the present invention provides a kit for detecting severe fever with thrombocytopenia syndrome virus.

The kit of the present invention includes the composition for detection.

In the kit of the present invention, the contents related to the aptamer and the composition are the same as those described in the aptamer and the composition, and thus are omitted to avoid excessive complexity of the specification.

The kit of the present invention includes a substrate on which the aptamer according to the present invention is immobilized, for example, may be in the form of an array.

The “array” of the present invention is a plurality of specific molecules immobilized on a certain portion of a substrate, and the array may include a substrate and an immobilized region including aptamers formed on the substrate. The aptamer may be covalently attached within the immobilization region. The aptamer may further include a plurality of compounds having a covalently attachable functional group. The functional group may be used without limitation as long as it enables attachment of the aptamer, and may be, for example, an aldehyde, epoxy, carboxy or amine group, and the compound has an aldehyde, epoxy, carboxy or amine group at the terminal. It may be a siloxane having, but is not limited thereto.

The material of the substrate of the present invention may be, for example, materials such as glass, silicon, polypropylene and polyethylene, but is not limited thereto.

Another embodiment of the present invention provides a method for detecting severe fever with thrombocytopenia syndrome virus.

The method of the present invention comprises the steps of culturing the detection composition of the present invention and a biological detection sample separated from a target subject; and confirming the binding degree of the composition for detection and the nuclear protein of severe fever with thrombocytopenia syndrome virus.

When the binding degree of the composition for detection of the present invention and the nuclear protein of the severe fever with thrombocytopenia syndrome virus is higher than that of the normal control group, a step of confirming that the composition is infected with the severe fever with thrombocytopenia syndrome virus may be further included.

In the detection method of the present invention, the contents related to the aptamer and the composition are the same as those described in the aptamer and the composition, and thus are omitted to avoid excessive complexity of the specification.

"Sample" or "detection sample" of the present invention means any material, biological fluid, tissue or cell obtained from or derived from an individual, for example, whole blood, leukocytes, peripheral blood mononuclear cells, leukocyte buffy coat, blood (including plasma and serum), sputum, tears, mucus, saliva (nasal washes), nasal aspirates, breath, urine, semen, saliva, peritoneal washings, pelvic fluids, cysts Cystic fluid, meningeal fluid, amniotic fluid, glandular fluid, pancreatic fluid, lymph fluid, pleural fluid, nipple aspirate , bronchial aspirate, synovial fluid, joint aspirate, organ secretions, cells, cell extract, or cerebrospinal fluid. It may be, but is not limited thereto.

According to another embodiment of the present invention, an immunoassay method using an aptamer is provided, and the immunoassay method includes mixing an aptamer that specifically binds to a target substance to be detected and a detection sample; Forming a complex of an aptamer-target material-binding material by reacting the mixture with a binding material fixed to a support and specifically binding to the target material; and amplifying the aptamer. .

The aptamer is preferably an aptamer selected by the aptamer selection method disclosed herein.

Specifically, the immunoassay method using the aptamer uses the aptamer selected by the aptamer selection method, and the immunoassay method using the aptamer selected by the aptamer selection method specifically binds to the target substance to be detected. mixing the aptamer selected by the aptamer screening method and the detection sample; Forming a complex of an aptamer-target material-binding material by reacting the mixture with a binding material fixed to a support and specifically binding to the target material; and amplifying the aptamer. .

The aptamer screening method includes a binding material immobilization step of immobilizing a binding material specific to a target material to a support; A first reaction step in which a target material is added to a support on which the binding material is immobilized and reacted; A second reaction step in which the aptamer library is added to the support after the first reaction step and reacted; and a first elution step of eluting the aptamer bound to the target material in the second reaction step. The aptamer screening method may further include adding a blocking buffer and reacting the blocking material with the binding material prior to the immobilization step.

This is to prevent a non-specific reaction caused by binding of the aptamer and the binding material during the immunoassay, and aptamers that specifically bind only to the target material can be efficiently selected by the blocking step.

The aptamer selection method of the present invention includes an amplification step of amplifying the nucleic acid of the aptamer eluted in the first elution step; a 2-1 reaction step in which the nucleic acid of the amplified aptamer is added to the support where the first reaction step is completed and reacted; and a second elution step of eluting the aptamer bound to the target material in the 2-1 reaction step.

In addition, after the second reaction step, a recovery step of recovering the supernatant containing the aptamer library that has not reacted with the binding material; may be further included.

the amplification step; 2-1st reaction step; And the second elution step may be repeated 2 to 30 times, 2 to 20 times, or 1 to 10 times in turn.

The present inventors provide a new disease diagnosis system based on recombinase polymerase amplification (RPA) using a heterogeneous sandwich (H-sandwich) DNA aptamer; This method was named H-sandwich RPA.

DNA aptamers used as detection probes for target substances were selected by the aptamer screening method of the present invention, which does not require an additional pair-screening step, and they bind to a binding material, such as an antibody, in the form of a heterogeneous sandwich. Binds to another part of the target substance to be detected, for example, an antigen. In addition, it is preferable that the aptamer specifically binds only to the target substance to be detected without interaction with the binding substance, for example, binding.

In the complex of the aptamer-target substance-binding substance, the aptamer bound to the target substance is amplified into double-stranded DNA by an amplification reaction, and binds to an intercalating dye to generate a fluorescence signal at a specific wavelength. The intensity of the fluorescence signal generated varies depending on the amount of amplified DNA, and the presence or absence of an antigen can be determined through a relative fluorescence intensity value.

In addition, since only DNA aptamers can be amplified using two different bioreceptors, it has high sensitivity and specificity and can easily determine the presence or absence of a target substance in an actual human sample without a matrix effect. .

Therefore, the application of H-sandwich RPA for the detection of disease biomarkers present in trace amounts in the body can be utilized as a simple and ultra-sensitive biosensor and analysis tool.

A specific embodiment (H-sandwich RPA) of the immunoassay method of the present invention is schematically shown in FIG. 6 .

After pre-incubation of a target substance (eg antigen) and an aptamer specific to the target substance, it reacts with a binding substance (eg capture antibody) immobilized on the well. In the presence of a target substance, a complex (eg, immune complex) of a heterogeneous sandwich structure composed of an aptamer-target substance-binding substance (aptamer-antigen-antibody) is formed.

In order to induce a DNA aptamer amplification reaction (e.g., RPA reaction) and detect the resulting fluorescence signal, a reaction solution mixture is prepared with appropriate concentrations of primers, reagents, and DNA intercalating dye, and then isothermally reacted at °C for 20 minutes.

The dsDNA generated through the DNA aptamer amplification reaction induces a fluorescence signal by binding to the insertion dye at a specific wavelength, and as a result, a difference in fluorescence signal occurs depending on the amount of aptamer bound to the target material, and the target in the sample The presence or absence of a substance can be detected.

The binding material may be selected from the group consisting of antibodies, antigens, nucleic acids, aptamers, haptens, antigen proteins, DNA, RNA binding proteins, cationic polymers, and mixtures thereof, and is specific to the target material to be detected. Any material that binds can be used.

The cationic polymer is chitosan, glycol chitosan, protamine, polylysine, polyarginine, polyamidoamine (PAMAM), polyethylenimine, dex It may be selected from the group consisting of dextran, hyaluronic acid, albumin, polymer polyethyleneimine (PEI), polyamine, polyvinylamine (PVAm), and mixtures thereof.

It is preferable to use the binding material (eg, antibody) used in the aptamer selection method as the binding material. That is, the binding material and the aptamer preferably have different binding sites to the target material. The binding material used in the aptamer selection method has the advantage of not requiring a separate pairing selection process and excellent sensitivity because the binding site to the target material is different from the binding site to the aptamer target material.

If a binding substance not used in the aptamer screening method is used in the immunoassay method of the present invention, pair screening is required to determine whether the selected aptamer binds to the binding substance. This is to minimize the signal-to-noise generated when the aptamer binds to the binding material.

Such validation procedures can be performed using a variety of published experimental methods, e.g., electrophoretic mobility shift validation (EMSAs), titration calorimetry, near-scintillation validation, sedimentation equilibrium validation using analytical ultracentrifugation (e.g., www .cores.utah.edu/interaction), fluorescence polarization assay, fluorescence anisotropy assay, fluorescence intensity assay, fluorescence resonance energy transfer (FRET) assay, nitrocellulose filter binding assay, ELISAs, ELONAs (see, eg, U.S. Patent No. 5,789,163), RIAs, or equilibrium dialysis assays.

However, since such a verification procedure requires extra effort and time, it is preferable to use the binding material used in the aptamer screening method of the present invention and the aptamer selected by the screening method in the immunoassay method.

In another embodiment of the present invention, the step of removing the aptamer that did not form a complex after the complex formation step may be further included, or the step of adding an amplification reagent before the step of amplifying the aptamer can include more.

Therefore, the immunoassay method of the present invention includes mixing a detection sample and an aptamer selected by the aptamer selection method that specifically binds to a target substance to be detected; Forming a complex of an aptamer-target substance-binding substance by reacting the mixture with a binding substance fixed to a support and specifically binding to the target substance; removing the aptamer that failed to form a complex; Adding an amplification reagent and amplifying the aptamer may be included.

The step of removing the aptamer is to prevent the amplification of the aptamer that did not form a complex of the aptamer-target substance-binding substance in the washing step by the amplification step.

The amplification reagent is a reagent for amplifying the aptamer, and may include a primer that specifically binds to a specific aptamer, a dNTP, a reaction buffer, a recombinant enzyme, and an insertion dye that is inserted into the amplified dsDNA and exhibits a fluorescent signal.

"Primer" is an oligonucleotide, a short sequence of nucleotides, that is specifically attached to the complementary position of the opposite strand of the target DNA aptamer to initiate gene amplification. , The primers can be set arbitrarily in the aptamer screening method of the present invention. Therefore, the aptamer selected by the aptamer selection method of the present invention includes primer sequences for aptamer amplification at both ends and 30 to 50 core sequences in the center. The core sequence includes a sequence that specifically binds to a target substance.

The primers preferably include different primer sequences for each target material, which is to detect different target materials in one sample.

The reaction buffer may include a magnesium salt, preferably magnesium acetate or magnesium chloride, as a PCR buffer, but is not limited thereto.

The recombinase may be of prokaryotic, viral or eukaryotic origin. Exemplary recombinases include RecA and UvsX (eg, RecA protein or UvsX protein obtained from any species), and fragments or mutants thereof, and combinations thereof. The RecA and UvsX proteins can be obtained from any species. RecA and UvsX fragments or mutant proteins can also be produced using available RecA and UvsS proteins and nucleic acid sequences, and molecular biology techniques. Exemplary UvsX proteins include myoviridae phage, e.g., T4, T2, T6, Rb69, Aeh1, KVP40, Acinetobacter phage 133, Aeromonas phage 65, Cyanopha P-SSM2, cyanophage PSSM4, cyanophage S-PM2, Rb14, Rb32, Aeromonas phage 25, Vibrio phage nt-1, phi1, Rb16, Rb43, Phage 31, phage 44RR2.8t , Rb49, phage Rb3, and phage LZ2. Other exemplary recombinase proteins include archaebacterial RADA and RADB proteins and eukaryotic (e.g., plants, mammals, and fungi) Rad51 proteins (e.g., RAD51, RAD51B, RAD51C, RAD51D, DMC1, XRCC2, XRCC3, and recA).

The intercalating dye is a detectable label for the detection of amplification products and is also called an intercalator. It does not bind to single-stranded DNA (ssDNA) and DNA is synthesized (extension) after primer binding (annealing) When it binds to the formed double-stranded DNA (dsDNA), it emits fluorescence. Therefore, the amplification product can be quantified only when the fluorescence of the intercalator fluorescent substance is measured in the annealing or DNA synthesis step.

The intercalating dye is EvaGreen, exa Fluor 350, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, Cy2, Cy3.18, Cy3.5, Cy3, Cy5.18, Cy5.5, Cy5, Cy7, Oregon Green, Oregon Green 488-X, Oregon Green 488, Oregon Green 500, Oregon Green 514, SYTO SYTO 11, SYTO 12, SYTO 13, SYTO 14, SYTO 15, SYTO 16, SYTO 17, SYTO 18, SYTO 20, SYTO 21, SYTO 22, SYTO 23, SYTO 24, SYTO 25, SYTO 40, SYTO 41, SYTO 42, SYTO 43, SYTO 44, SYTO 45, SYTO 59, SYTO 60, SYTO 61, SYTO 62, SYTO 63, SYTO 64, SYTO 80, SYTO 81, SYTO 82, SYTO 83, SYTO 84, SYTO 85, SYTOX Blue, SYTOX Green , SYTOX Orange, SYBR Green, YO-PRO-1, YO-PRO-3, YOYO-1, YOYO-3 may be selected from the group consisting of thiazole orange or ethidium bromide, , but not limited thereto.

In the step of amplifying the aptamer, known DNA amplification methods including PCR and real-time PCR amplification methods can be used, but isothermal amplification is used to detect selective nucleic acids with high sensitivity in a short time for molecular diagnosis. Preference is given to using reactions.

The isothermal amplification reaction is HDA (Helicase-Dependent Amplification), RPA (Recombinase Polymerase Amplification), RCA (Rolling Circle Amplification), LAMP (Loop mediated isothermal amplification), NASBA (Nucleic Acid Sequence-Based Amplification), TMA (Transcription Mediated Amplification) , SMART (Signal Mediated Amplification of RNA Technology), SDA (Strand Displacement Amplification), IMDA (Isothermal Multiple Displacement Amplification), SPIA (Single Primer Isothermal Amplification), and cHDA (Circular Helicase Dependent Amplification). It may be performed by a method, preferably performed by a method of RPA (Recombinase Polymerase Amplification).

As a result of experiments performed by the conventional PCR amplification method and the isothermal amplification method under the same conditions, the present inventors confirmed that the isothermal amplification method emitted stronger fluorescence signals than the conventional PCR amplification method (FIG. 8). It is believed that this is because the high reaction temperature of the conventional PCR amplification method affects the detection efficiency of the intercalating dye.

In another embodiment of the present invention, the step of measuring fluorescence may be further included after the step of amplifying the aptamer. The fluorescence measuring step is to check whether the aptamer is amplified. An intercalating dye can be bound to the amplified dsDNA of the aptamer, and fluorescence of a specific wavelength emitted by the intercalating dye is measured to determine the aptamer's amplification. amplification can be checked. Since the wavelengths of fluorescence emitted by each intercalating dye are different, it is preferable to measure the fluorescence of a specific wavelength emitted from the intercalating dyes listed above.

In this example, EvaGreen was used as an intercalating dye, and fluorescence signals were measured at wavelengths of λabs/λem = 500/530 nm. However, the measurement wavelength may vary depending on the intercalation dye added to the amplification reagent.

In a specific embodiment of the present invention, the concentration of the binding material is 0.1 to 100 ng/mL, the concentration of the aptamer is 0.01 to 10 pM, and the step of amplifying the aptamer may be performed for 8 to 30 minutes. , but is not limited thereto.

The concentration of the binding material may be 0.1 to 100 ng/mL, preferably 0.1 to 10 ng/mL, and according to the experimental example of the present invention, the highest relative fluorescence intensity is obtained when 1 ng/mL is used. was

The concentration of the aptamer may be 0.01 to 10 pM, preferably 0.1 to 10 pM, and according to the experimental example of the present invention, the highest relative fluorescence intensity was shown when 1 pM was used.

The insertion dye is preferably used at a concentration obtained by diluting the concentration of the stock solution by 20 to 40 times.

Preferably, the amplification step of the aptamer is performed for 8 to 30 minutes, 8 to 20 minutes, 8 to 15 minutes, or 8 to 10 minutes. According to the experimental example of the present invention, the fluorescence signal increased rapidly from 8 to 10 minutes, and the reaction time was saturated at 15 minutes.

The minimum detection limit (LOD) of the immunoassay method using the aptamer is 1 fg/mL or more than 1 fg/mL, the lowest detection limit compared to various known immunoassay methods. (LOD).

Since the aptamer selected by the aptamer screening method of the present invention binds to a site different from that to which the antibody binds to the nuclear protein of the server fever with thrombocytopenia syndrome (SFTS) virus, it can be used with a sandwich-type biosensor. It can be applied in various fields such as Furthermore, such aptamers are not only very excellent in stability and sensitivity compared to preparations containing conventional antibodies, but also can be mass-produced in a short time and at low cost by chemical synthesis, and various modifications are easy to increase binding force. Advantages do exist.

In addition, the immunoassay method using the aptamer selected by the aptamer screening method of the present invention selectively amplifies only the aptamer bound to the target material in the heterogeneous sandwich structure and detects the relative fluorescence signal, thereby sensitively and rapidly detecting the target material. There are possible advantages.

1 shows the result of confirming the size of purified server fever with thrombocytopenia syndrome (SFTS) virus nuclear protein according to an embodiment of the present invention through SDS-PAGE.
Figure 2 shows a schematic diagram of each step of the modified SELEX method according to an embodiment of the present invention.
3 A to C are graphs showing the results of confirming the target binding ability of the aptamer selected according to the modified SELEX method according to an embodiment of the present invention.
Figure 4 shows the results of confirming the binding specificity to severe fever with thrombocytopenia syndrome virus nuclear protein according to an embodiment of the present invention.
5A and B show the result of confirming the binding force of aptamer according to the nuclear protein concentration of severe fever with thrombocytopenia syndrome virus according to an embodiment of the present invention.
Figure 6 schematically shows the principle of the immunoassay method (H-sandwich RPA) using the aptamer selected by the aptamer selection method of the present invention, and the sample containing the antigen and the aptamer is immobilized with the capture antibody pre-incubated in wells. Aptamers bound to the antigen are amplified during the RPA reaction and detected by the intercalating dye.
Figure 7 is a graph showing the optimization results of factors influencing the immunoassay method (H-sandwich RPA) using the selected aptamer, (A) the concentration of the coating antibody used to prepare the immobilized well, (B) The concentration of aptamer reacting with the antigen, (C) the concentration of the intercalating dye and (D) the relative fluorescence intensity saturation during the RPA reaction, the concentrations of influenza A NP and aptamer were set to 0.5 pg/mL and 1 pM, respectively.
8 shows the intercalating dye efficiency under various amplification conditions (A) relative fluorescence intensity through amplification reactions (a: conventional PCR (30 cycles), b: RPA, c: H-sandwich RPA ( NP and aptamer are 0.5 pg/mL and 1 pM, respectively), (B) gel shift images under each amplification reaction (OFF: no aptamer or NP, ON: aptamer 1 pM, NP).
Figure 9 shows the results of measuring the target concentration using an immunoassay method (H-sandwich RPA) using selected aptamers, (A) influenza A NP, (B) influenza B NP, (C) HIV-1 p24, (D) Ebola NP, (E) SARS-Cov-2 NP. Each antigen ranges in concentration from 0.001 to 10 pg/mL.
Figure 10 is a graph showing the specificity of H-sandwich RPA based on target-aptamer specificity, (A) cross-reactivity between influenza A NP and influenza B NP (blue bar: influenza A NP-specific aptamer 1 pM, influenza A and B NPs were applied at 1 and 10 pg/mL respectively, green bar: influenza B NP-specific aptamer 1 pM, influenza A and B NPs at 10 and 1 pg/mL respectively), (B) p24 and Ebola NPs (orange bar: p24-specific aptamer 1 pM, p24 and Ebola NP were applied at 1 and 10 pg/mL, respectively; pink bar: Ebola NP-specific aptamer 1 pM, p24 and Ebola NP , where 10 and 1 pg/mL were applied, respectively).

Hereinafter, the present invention will be described in more detail through examples. These examples are only for explaining the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

<Example 1> Aptamer screening method

1. Single-stranded DNA aptamer (ssDNA) library design

In the aptamer selection method, in the initial round, an ssDNA oligonucleotide library (SEQ ID NO: 2: 5'- ATC CAG AGT GAC GCA GCA [core sequence; (NX 40 )] TG GAC ACG GTG GCT TAG T -3') was used. All oligonucleotides used in this study were from Integrated DNA Technologies Inc. (Coralville, IA, USA). At this time, the ssDNA library was put into a binding buffer (50 mM Tris-HCl, pH 7.4, 100 mM NaCl, 5 mM KCl, 1 mM MgCl ₂ ), denatured by heating at 90 ° C. for 5 minutes, and then 0.01% Tween ) 20, and used immediately after cooling on ice for 10 minutes.

2. Expression and purification of viral nuclear protein for server fever with thrombocytopenia syndrome (SFTS)

A nucleotide sequence encoding a protein consisting of the amino acid sequence represented by SEQ ID NO: 1 was amplified through a polymerase chain reaction (PCR) to obtain a PCR product. Then, after inserting the PCR product into the pET28a expression vector, it was E. Coli . After transformation (Transformaion) in BL21, it was shaken at 37 ℃. When the OD ₆₀₀ value of the shaking culture solution reached 0.6, it was treated with 1 mM IPTG (Isoprophyl-bD-thiogalactopyranoside), and cultured overnight at 25°C to induce protein expression. Thereafter, ultrasound was applied to the transformant to destroy the cells, and the protein represented by SEQ ID NO: 1 was obtained from the cell lysate.

As shown in FIG. 1, as a result of performing SDS-PAGE on the isolated protein according to a conventional method, server fever with thrombocytopenia syndrome (hereinafter, a protein consisting of the amino acid sequence represented by SEQ ID NO: 1) was obtained. , referred to as 'SFTS'). It was confirmed that the nuclear protein of the virus was obtained.

3. Selection method of aptamer

(1) Each step of the aptamer screening method

As shown in FIG. 2, by performing the aptamer screening method of the present invention, aptamers capable of specifically binding to the SFTS virus were selected. Specifically, a method for selecting a modified aptamer is as follows.

1) Antibody immobilization and blocking step

Antibody immobilization step: After diluting the antibody specifically binding to the amino acid sequence represented by SEQ ID NO: 1 in 0.1M carbonate buffer (pH 9.5), it was placed in a 96-well plate and reacted overnight at 4 ° C. , the antibody was coated on a 96-well plate.

blocking step; Thereafter, 200 μl of washing buffer (Potassium phosphate buffer (PBS) containing 0.01% Tween) was added to the coated plate and washed. 1% BSA (Bovine serum albumin) was added to the washed plate and room temperature By reacting for 1 hour at , a non-specific binding reaction that may occur when ssDNA binds to an antibody was blocked.

1-1) recovery step;

In step 1), in order to reduce the possibility of non-specific binding between proteins other than the amino acid sequence represented by SEQ ID NO: 1 and ssDNA, the buffer containing the ssDNA library was placed in a plate blocked using the BSA for 30 minutes After culturing, a recovery step was additionally performed to obtain a supernatant (hereinafter referred to as 'supernatant') containing only the ssDNA library not bound to the antibody.

2) a first reaction step; antigen-antibody reaction

The protein of Example 1 diluted in PBS at a concentration of 1 μg/mL was added to the plate where the antibody was immobilized and blocked in step 1), and incubated at room temperature for 2 hours.

3) a second reaction step; Combination step with ssDNA library

After the first reaction step was completed, the supernatant of 1-1) was added to the plate, reacted at room temperature for 1 hour, and then washed 5 times with 200 μl of washing buffer.

4) first elution step; ssDNA elution and amplification steps

Binding buffer was added to the plate washed in step 2) and reacted at 80° C. for 10 minutes to elute ssDNA bound to the protein of Example 1.

5) amplification step; a third reaction step; and a second elution step

The ssDNA eluate in step 4) of the first elution was purified using a PCR purification kit according to the method provided by the manufacturer, and then the purified ssDNA was dissolved in 30 μl of sterile water. The purified ssDNA was mixed with 1 μM of primer pair, 2.5 mM dNTP mixture, and 1.2 U of Pfu polymerase to make a final volume of 50 μl, followed by polymerase chain reaction to obtain amplified ssDNA. At this time, in the case of polymerase chain reaction, 5 minutes at 95 ℃; 30 seconds at 95°C; 20 seconds at 57°C; 25 cycles were performed at 72°C for 20 seconds, and the final extension was performed at 72°C for 5 minutes.

Then, the amplified ssDNA is subjected to the 2-1 reaction step in the same manner as in '3) the second reaction step', and the second elution step is performed in the same manner as in '4) the first elution step' And, the amplification step; The 2-1 reaction step and the second elution step were performed at least 10 times. Through this process, three ssDNA sequences were finally selected.

(2) ssDNA sequence analysis

The three ssDNA sequences selected in [2-1] were amplified through the same polymerase chain reaction as in [2-1], and then the amplified products were inserted into the pETHis6 TEVLIC cloning vector (Addgene, USA), respectively. did Thereafter, the vector was transformed into E. coli DH5α, and the amplified plasmid was isolated from the transformant and subjected to DNA sequencing. Here, DNA sequence analysis was performed by Macrogen (Korea), and the secondary structure of aptamer, which is ssDNA, was predicted using the Mfold program based on the Zuker algorithm.

As a result, the selected aptamer is the 5'- ATC CAG AGT GAC GCA GCA of SEQ ID NO: 2 - [core sequence; (N X 40)] - TG GAC ACG GTG GCT TAG T -3 ', and the core sequence was as shown in Table 1 below.

name sequence number core sequence Aptamer 1 SEQ ID NO: 3 CGACCACAGATTGGAGACTGATAGTGCACGAGCAAGGACA Aptamer 2 SEQ ID NO: 4 TCGGATGGATTGTGGTCGAAGTTGTTTCCGACACTAGTCA Aptamer 3 SEQ ID NO: 5 CACATCGGAGAACAGGCGCACTGTCGGAGGAACCGCAACG

At the end of the sequence of the three selected aptamers, a fluorescent substance (FAM) (hereinafter, in the case of FAM-labeled aptamers, ' FAM-aptamer 1', 'FAM-aptamer 2' and 'FAM-aptamer 3') or biotin were labeled according to a conventional method.

4. Confirmation of the target binding ability of the selected aptamer

After coating the FAM-aptamer (20 nM) of Example 2 on a 384-well flat-bottom plate, the target protein (NP) of Example 1 was added to the plate at a concentration of 0 to 25 μM and then 5 After shaking for 30 minutes, it was incubated at room temperature for 30 minutes. Then, the intensity of its expression at an excitation wavelength of 480 nm and an emission wavelength of 535 nm was measured using a Cytation 5.0 Plate Reader (BioTek) and Gen5 version 2.09.1, and the anisotropy value was plotted against the X-axis with increasing concentration. After that, the dissociation constant (K _d ) was measured using a saturation one-site fitting model, and the results are shown in A to C of FIG. 3 .

As shown in A to C of FIG. 3, in the case of FAM-aptamer 1, the dissociation constant was 3.9 μM, in the case of FAM-aptamer 2, the dissociation constant was 1.8 μM, and in the case of FAM-aptamer 3, the dissociation constant was 0.8. was found to be μM.

From the above results, it can be seen that the three aptamers selected according to the present invention have excellent binding affinity, although there is a difference in degree, and in particular, in the case of FAM-aptamer 3, the binding affinity is very excellent. Furthermore, it can be seen from these results that the modified SELEX method according to the present invention is very effective in selecting excellent aptamers.

5. Confirmation of Antigen Specificity of Selected Aptamers

Serum containing other types of Hanta virus (Hanta) or Influenza A virus (InfA), which are similar in structure to the nuclear protein of SFTS, serum containing the nuclear protein of SFTS (SFTS), and serum mixed with both ( Mix) into a 96-well plate coated with biotin-labeled aptamer-3 (hereinafter, referred to as 'biotin-aptamer 3'), and additionally added streptavidin to which HRP is bound. After reacting, color change was confirmed, and the results are shown in FIG. 4 .

In addition, target detection was confirmed by applying the biotin-aptamer 3 to a conventional liposome-based colorimetric sensor platform, and the results are shown in A and B of FIG. 5 .

As shown in FIG. 4, the absorbance was 0.1 (a.u.) in the serum containing only the hanta virus or influenza A virus, which has a similar structure to the nuclear protein of SFTS, whereas in the serum mixed with the serum containing the nuclear protein of SFTS, It was confirmed that the absorbance was 0.7 (a.u.).

In addition, as shown in FIG. 5, it was confirmed that as the concentration of the target protein increased, not only the intensity of the color developed, but also the absorbance also increased in a concentration-dependent manner.

Through the above results, the aptamer according to the present invention has a binding specificity that can specifically bind only to the nuclear protein of SFTS, and as the degree of binding varies depending on the concentration of the target protein, the target protein present in serum is desired. It can be seen that the concentration can be measured with high sensitivity.

<Example 2> Immunoassay using selected aptamers

1. Target-specific aptamer selection

The present inventors commercially purchased influenza A NP, influenza B NP, HIV-1 p24 protein, Ebola NP, and SARS-Cov-2 NP, and obtained aptamers having binding specificity to each protein by the method of Example 1. It was selected, and the sequence of the selected aptamer is shown in [Table 2]. Sequences marked in bold in the following [Table 2] are sequences to which primers bind in the aptamer amplification step, and were prepared as different sequences for each aptamer.

protein sequence number aptamer sequence Influenza A NP SEQ ID NO: 6 5' TAG GGA AGA GAA GGA CAT ATG AT G GCG TAC GGG GAT GAG GTG ATC GTA GTG GG T TGA CTA GTA CAT GAC CAC TTG A 3' Influenza B NP SEQ ID NO: 7 5' ATT ATG GCG TTT GCA GCG TTC TGG TT G GTG GTG GTG ATA GGT GGG GGG AAG GAG GGT ATC TTG TTG GTG AGG TAA CGG CT 3' HIV-1 p24 protein SEQ ID NO: 8 5' AGA TAC TGC CAT TCA TTG CAT C GA GCA CGC GAC TGA TGA GGA TGG TCT AGT AGC TGG GGT CGA GTA CTA AGC TAT GTG TCG A 3' Ebola NP SEQ ID NO: 9 5' GAT GTG AGT GAC GTG GAT CGA G CG GAT GTG AAG GCT GAA AGT GGC TTT GGG CGG TCG TAA GT G TCA CAG AGC ATG CAA CAA GAC C 3' SARS-CoV-2 NPs SEQ ID NO: 10 5' ATC CAG AGT GAC GCA GCA AAC CCA AGC AAA CTA CCT CTA TAC CCT TCG ACC TTC ATC A TG GAC ACG GTG GCT TAG T 3'

2. Heterogeneous sandwich immunoassay using selected aptamers

The present inventors investigated the detection efficiency of H-sandwich RPA by detecting various concentration ranges of 5 model target proteins using the selected aptamer (FIG. 6).

Anti-target antibodies (1 ng/mL) in 0.1 M carbonate buffer (pH 9.6) were immobilized in 96-well microplates overnight at 4°C. Coated wells were washed 3 times with PBS-T and blocked with 1% BSA (w/w). Various concentrations of the recombinant target protein and aptamer (1 pM) were pre-incubated for 30 minutes at room temperature. For clinical sample analysis, a binding buffer containing 2% Triton™ X-100 was used as an assay diluent to lyse the virus. The target protein-aptamer mixture was loaded onto the coated wells and incubated at room temperature for 45 minutes with gentle shaking. RPA solution containing primers, dNTPs, reaction buffer, and magnesium acetate (MgOAc) was added to the H-sandwich complex containing antibody-antigen-aptamer to induce isothermal amplification, and intercalating dye to facilitate fluorescence signal detection. (0.5 × EvaGreen®) was added to the wells and incubated for 20 minutes at 37°C. Fluorescence signals were then measured at an excitation wavelength of 500 nm with an emission wavelength of 530 nm. The fluorescence intensity of the reaction without the target protein was used as a negative control (Ic), and the fluorescence signal after the RPA reaction with the target protein was recorded as the fluorescence intensity (I). Normalized ratios of fluorescence intensities were calculated using the difference in signal values as:

Relative fluorescence intensity or ΔI = (I-Ic)/Ic.

3. Optimization of the heterologous sandwich immunoassay method

H-sandwich RPA was applied to optimize the conditions of factors affecting detection efficiency to detect model targets (Fig. 7A-D).

(1) Concentration of antibody and aptamer

First, the detection efficiency according to the concentration of the capture antibody immobilized in the well and the concentration of the aptamer was investigated. The concentration of capture antibody and aptamer is one of the main factors of H-sandwich RPA, because an appropriate concentration of antibody must be immobilized on the well to capture the antigen and amplify only the aptamer bound to the antigen through the RPA reaction. .

As shown in FIG. 7A, the antibody was fixed at a concentration of 0.1 to 100 ng/mL, and 1 ng/mL of antibody was added in a situation where 1 pM aptamer and 0.5 pg/mL of influenza A NP reacted. showed the highest relative fluorescence intensity.

Next, the concentration conditions of the aptamer reacting with the antigen were investigated (FIG. 7B).

Influenza A NP 0.5 pg/mL was used, and experiments were performed under aptamer conditions of 0.01 to 10 pM, which is 1 to 1000 times the antigen concentration. The highest relative fluorescence intensity was observed at 1 pM aptamer, which was 100 times the antigen concentration.

Therefore, subsequent experiments were performed under the conditions of 1 ng/mL of coating antibody and 1 pM of aptamer.

(2) Concentration of intercalating dye

And, by examining the intercalation dye dilution ratio, the concentration of the dye showing the highest relative fluorescence intensity value in the on-off state of the antigen was determined. The reacted antigen concentration is 0.5 pg/mL and the aptamer used is 1 pM.

Insert dye was diluted 0.05, 0.1, 0.5 and 1X from the 20X stock and the measured fluorescence signal is shown in Figure 7C.

The fluorescence intensity increased with higher dilution ratios, and the highest relative fluorescence intensity was shown when 0.5X intercalating dye was added.

Therefore, the dilution ratio of the intercalating dye in further experiments was set to 0.5X.

(3) Saturation time of fluorescence intensity

Finally, we investigated the saturation time of the fluorescence intensity generated by the intercalating dye during the RPA reaction.

As shown in Fig. 7D, the fluorescence signal increased rapidly from 8 to 10 min, and the reaction time saturated at 15 min. In general, the RPA reaction shows some time and fluorescence signal intensity deviations depending on the enzyme working efficiency, and to compensate for this, 20 minutes, the recommended condition of the RPA kit, was selected.

(4) Aptamer amplification method

In addition, the dsDNA detection efficiency of the intercalating dye used in the present study was confirmed.

Normal PCR, solution RPA, and H-sandwich RPA were performed to determine whether the intercalating dye added to the amplification reaction exhibited increased fluorescence intensity with dsDNA generated by the amplification process. The amounts of primers, aptamers and other reagents used in each amplification reaction were the same, normal PCR was performed in 30 cycles, and the RPA reaction time at 37°C was 20 minutes.

The primers used in the amplification reaction are shown in bold in [Table 2], and specifically, in the case of forward primers, they are identical to the sequences shown in bold in [Table 2], and in the case of reverse primers, [Table 2]. 2] has a sequence complementary to the bold sequence.

As shown in FIG. 8, the difference in fluorescence signal before and after amplification occurred in each method, and the relative fluorescence intensity was the highest in solution RPA, but it was not significantly different from H-sandwich RPA. In each case, the amplified DNA was confirmed through gel electrophoresis, and a band difference according to the presence or absence of the antigen was clearly observed in H-sandwich RPA (FIG. 8B).

In normal PCR, high amplification reaction temperature may affect the detection efficiency of the intercalating dye, and since H-sandwich RPA amplifies the aptamer on the immune complex bound to the well, we speculate that the on-off difference is evident on the gel.

4. Effect of the immunoassay method under optimal conditions

In order to investigate the effect of the immunoassay method of the present invention applying optimized conditions, fluorescence signals were measured after RPA reaction using model targets and target-specific aptamers in various concentration ranges.

After the capture antibody of each target was immobilized in the well, the premixed antigen and aptamer were loaded into the well and cultured to form an immune complex. After the construction of the heterologous sandwich immune complex (antibody-antigen-aptamer), unbound aptamers were removed through sufficient washing steps. Thereafter, primers, RPA reagent and intercalating dye were added to the wells and incubated at 37° C. for 20 minutes to induce RPA reactions and the fluorescence signals generated from the amplified aptamers were measured.

As shown in FIG. 9, the fluorescence signal of influenza A virus NP was detected at a concentration of 1 fg/mL, which was confirmed by observing a band corresponding to the aptamer length on an agarose gel.

In the same procedure as described above, the present inventors also used the detection method of the present invention to detect other virus-related antigens, including influenza B virus NP, p24 of HIV-1 virus, Ebola virus NP, and SARS-Cov-2 NP, respectively, in the same concentration range. applied for detection.

In addition to the fluorescence intensity measurement, gel bands were observed in the concentration range of 1 and 10 fg/mL (not shown), and the relative fluorescence intensity value at the limit of detection concentration was less than 0.5 (FIGS. 9 B-E). As a result of comparing the relative fluorescence intensity of each target with the gel electrophoresis image, no band was observed in the control (no target antigen) and concentration groups with a fluorescence signal of less than 0.5.

5. Possibility of crossover according to interfering temperament

Next, we investigated the crossover potential of the H-sandwich RPA platform according to the presence of an interfering substance.

Relative fluorescence intensities were measured in influenza A and B virus NPs or mixtures of p24 and Ebola virus NPs and human fluids according to the use of each target-specific aptamer (FIG. 10). The relative fluorescence intensity is based on the fluorescence signal detected after performing the experiment by the above-mentioned method in each well divided into groups including 10-fold diluted human nasal fluid, target, non-target, and target and non-target mixture. was calculated by

The relative fluorescence intensity of each group was calibrated using the fluorescence intensity of the control well (Ic). When using aptamers specific for influenza A NPs (blue bars), the target was influenza A NP (1 pg/mL) and the off-target was influenza B NP (10 pg/mL). When influenza B NP-specific aptamers are used (pink bars), the target is influenza B NP (1 pg/mL) and the non-target is influenza A NP (10 pg/mL).

As shown in Fig. 10A, high relative fluorescence intensity was observed in the presence of the target despite 10-fold higher off-target concentrations, and there was little matrix effect in diluted nasal fluid containing non-specific DNA and proteins. When p24 and Ebola NP-specific aptamers were used as detection probes in 10-fold diluted serum, target, non-target and mixture, respectively, high relative fluorescence intensities were also shown for the presence of target (FIG. 10B).

These results prove that H-sandwich RPA has high selectivity and sensitivity due to its high signal-to-noise ratio. The immunoassay method of the present invention can maximize selectivity by using a target-specific capture antibody and an aptamer and amplifying only the DNA aptamer in the formed heterologous sandwich immune complex. This characteristic of the proposed method distinguishes it from conventional immunoassays with a low signal-to-noise ratio using the same two bioreceptors.

6. Comparison with various immunoassay methods

We compared our H-sandwich RPA with various immunoassay methods.

detection method target LOD multiple detection PCR using short DNA aptamers thrombin 2pM not possible Sandwich ELISA using DNA encapsulated liposomes protective antigen 4.1 ng/mL possible Photoelectrochemical immunoassay using DNA labeling HIV-1 p24 10 ng/mL not possible H-sandwich RPA using DNA aptamers virus-associated proteins ~1 fg/mL possible

Referring to [Table 3], the H-sandwich RPA immunoassay method is capable of multiple detection and exhibits the lowest limit of detection (LOD) compared to other immunoassays. Therefore, the immunoassay method of the present invention has the advantage of being able to detect the target substance present at a low concentration of 1 fg/mL by detecting the relative fluorescence signal by selectively amplifying only the aptamer bound to the target substance in the heterogeneous sandwich structure.

<Conclusion>

The inventors have developed a highly sensitive immunoassay method for the detection of protein biomarkers based on the integration of RPA and immunoassay. The present inventors also newly selected DNA aptamers specific to HIV-1 p24, Ebola virus NP, and SARS-Cov-2 NP by the aptamer screening method of the present invention. Unlike immuno-PCR using capture and detection antibody pairs, H-sandwich RPA does not require antibody pair screening because it uses DNA aptamers that bind to antibody-antigen complexes in the form of an H-sandwich. H-sandwich RPA has the advantage of high sensitivity and specificity due to the rapid amplification of aptamers bound to the target through the RPA reaction. Through application of the proposed immunoassay method and optimization of various reagents, we observed low detection limits for H-sandwich RPA with detection of atomolar concentration levels of the model target protein. This method showed higher detection efficiency for influenza-infected patient samples than commercial ELISA and LFA kits. Unlike conventional PCR-based amplification methods that can only be applied to nucleic acids, the present inventor's approach enables high-sensitivity detection of protein biomarkers in well plates. Therefore, our results suggest that H-sandwich RPA can be universally applied to various targets through appropriate selection of biomarker-specific aptamers.

In a prior literature, Fischer, Nicholas O et al., after immobilizing an anti-protein antibody or a biotinylated protein target on magnetic beads, binding it to an aptamer, and then amplifying the bound aptamer through PCR, technology is starting. However, in the prior art, this is separated using magnetic beads and then transferred to a tube to proceed with the amplification reaction, whereas the present invention is differentiated in that it is possible to combine, amplify, and detect aptamers on one plate, and target-specific aptamer It can be said that there is a difference from the prior art in that multiplex PCR-based detection is possible by using different methods.

Having described specific parts of the present invention in detail above, it is clear that these specific descriptions are only preferred embodiments for those skilled in the art, and the scope of the present invention is not limited thereto. Accordingly, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

<110> Gwangju Institute of Science and Technology <120> A DNA APTAMER SPECIFICALLY BIDING TO SEVERE FEVER WITH THROMBOCYTOPENIA SYNDROME VIRUS AND AND IMMUNOASSAY USING THE APTAMER <130> Pn-2019-0085 <160> 13 <170> KoPatentIn 3.0 <210> 1 <211> 245 <212> PRT <213> artificial sequence <220> <223> Severe fever with thrombocytopenia virus N protein <400> 1 Met Ser Glu Trp Ser Arg Ile Ala Val Glu Phe Gly Glu Gln Gln Leu 1 5 10 15 Asn Leu Thr Glu Leu Glu Asp Phe Ala Arg Glu Leu Ala Tyr Glu Gly 20 25 30 Leu Asp Pro Ala Leu Ile Ile Lys Lys Leu Lys Glu Thr Gly Gly Asp 35 40 45 Asp Trp Val Lys Asp Thr Lys Phe Ile Ile Val Phe Ala Leu Thr Arg 50 55 60 Gly Asn Lys Ile Val Lys Ala Ser Gly Lys Met Ser Asn Ser Gly Ser 65 70 75 80 Lys Arg Leu Met Ala Leu Gln Glu Lys Tyr Gly Leu Val Glu Arg Ala 85 90 95 Glu Thr Arg Leu Ser Ile Thr Pro Val Arg Val Ala Gln Ser Leu Pro 100 105 110 Thr Trp Thr Cys Ala Ala Ala Ala Ala Leu Lys Glu Tyr Leu Pro Val 115 120 125 Gly Pro Ala Val Met Asn Leu Lys Val Glu Asn Tyr Pro Pro Glu Met 130 135 140 Met Cys Met Ala Phe Gly Ser Leu Ile Pro Thr Ala Gly Val Ser Glu 145 150 155 160 Ala Thr Thr Lys Thr Leu Met Glu Ala Tyr Ser Leu Trp Gln Asp Ala 165 170 175 Phe Thr Lys Thr Ile Asn Val Lys Met Arg Gly Ala Ser Lys Thr Glu 180 185 190 Val Tyr Asn Ser Phe Arg Asp Pro Leu His Ala Ala Val Asn Ser Val 195 200 205 Phe Phe Pro Asn Asp Val Arg Val Lys Trp Leu Lys Ala Lys Gly Ile 210 215 220 Leu Gly Pro Asp Gly Val Pro Ser Arg Ala Ala Glu Val Ala Ala Ala 225 230 235 240 Ala Tyr Arg Asn Leu 245 <210> 2 <211> 76 <212> DNA <213> artificial sequence <220> <223> Synthetic (nucleic acid construct) <220> <221> misc_feature <222> (19)..(58) <223> each n is A, T, U, G or C <400> 2 atccagagtg acgcagcann nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnntg 60 gacacggtgg cttagt 76 <210> 3 <211> 40 <212> DNA <213> artificial sequence <220> <223> aptamer core sequence <400> 3 cgaccacaga ttggagactg atagtgcacg agcaaggaca 40 <210> 4 <211> 40 <212> DNA <213> artificial sequence <220> <223> aptamer core sequence <400> 4 tcggatggat tgtggtcgaa gttgtttccg acactagtca 40 <210> 5 <211> 40 <212> DNA <213> artificial sequence <220> <223> aptamer core sequence <400> 5 cacatcggag aacaggcgca ctgtcggagg aaccgcaacg 40 <210> 6 <211> 76 <212> DNA <213> artificial sequence <220> <223> Severe fever with thrombocytopenia virus NP aptamer 1 full sequence <400> 6 atccagagtg acgcagcacg accacagatt ggagactgat agtgcacgag caaggacatg 60 gacacggtgg cttagt 76 <210> 7 <211> 76 <212> DNA <213> artificial sequence <220> <223> Severe fever with thrombocytopenia virus NP aptamer 2 full sequence <400> 7 atccagagtg acgcagcatc ggatggattg tggtcgaagt tgtttccgac actagtcatg 60 gacacggtgg cttagt 76 <210> 8 <211> 76 <212> DNA <213> artificial sequence <220> <223> Severe fever with thrombocytopenia virus NP aptamer 3 full sequence <400> 8 atccagagtg acgcagcaca catcggagaa caggcgcact gtcggaggaa ccgcaacgtg 60 gacacggtgg cttagt 76 <210> 9 <211> 76 <212> DNA <213> artificial sequence <220> <223> Influenza A NP aptamer <400> 9 tagggaagag aaggacatat gatggcgtac ggggatgagg tgatcgtagt gggttgacta 60 gtacatgacc acttga 76 <210> 10 <211> 80 <212> DNA <213> artificial sequence <220> <223> Influenza B NP aptamer <400> 10 attatggcgt ttgcagcgtt ctggttggtg gtggtgatag gtgggggggaa ggaggggtatc 60 ttgttggtga ggtaacggct 80 <210> 11 <211> 82 <212> DNA <213> artificial sequence <220> <223> human immunodeficiency virus (HIV) p24 aptamer <400> 11 agatactgcc attcattgca tcgagcacgc gactgatgag gatggtctag tagctggggt 60 cgagtactaa gctatgtgtc ga 82 <210> 12 <211> 85 <212> DNA <213> artificial sequence <220> <223> Ebola NP aptamer <400> 12 gatgtgagtg acgtggatcg agcggatgtg aaggctgaaa gtggctttgg gcggtcgtaa 60 gtgtcacaga gcatgcaaca agacc 85 <210> 13 <211> 76 <212> DNA <213> artificial sequence <220> <223> SARS-CoV-2 NP aptamer <400> 13 atccagagtg acgcagcaaa cccaagcaaa ctacctctat acccttcgac cttcatcatg 60 gacacggtgg cttagt 76

Claims (22)

It specifically binds to the nuclear protein of the server fever with thrombocytopenia syndrome (SFTS) virus,
It consists of the nucleotide sequence of SEQ ID NO: 2,
5'-ATC CAG AGT GAC GCA GCA -[N]40- TG GAC ACG GTG GCT TAG T- 3' (SEQ ID NO: 2)
Wherein N is at least one selected from the group consisting of SEQ ID NOs: 3 to 5, an aptamer.
According to claim 1,
The nuclear protein of the severe fever with thrombocytopenia syndrome virus is composed of the amino acid sequence represented by SEQ ID NO: 1, an aptamer.
According to claim 1,
A detectable label is bound to the 3' or 5' end of the aptamer, and the detectable label is at least one selected from the group consisting of an optical label, an electrochemical label, and a radioactive isotope.
According to claim 1,
The aptamer has a dissociation constant (K _d ) value when bound to the nuclear protein of the severe fever with thrombocytopenia syndrome virus of 0.3 μM to 5 μM, the aptamer.
A composition for detecting severe fever with thrombocytopenia syndrome virus comprising the aptamer of any one of claims 1 to 4.
A kit for detecting severe fever with thrombocytopenia syndrome virus comprising the composition for detection of claim 5.
Mixing an aptamer that specifically binds to a target substance to be detected and a detection sample;
Forming a complex of an aptamer-target substance-binding substance by reacting the mixture with a binding substance fixed to a support and specifically binding to the target substance; And
Amplifying the aptamer,
The aptamer is
An antibody immobilization step of immobilizing an antibody specific to a target material to a support;
A first reaction step of adding a target material to the support on which the antibody is immobilized and reacting;
A second reaction step in which the aptamer library of SEQ ID NO: 2 is added to the support after the first reaction step is completed and reacted;
5′-ATC CAG AGT GAC GCA GCA-[N]40-TG GAC ACG GTG GCT TAG T-3′ (SEQ ID NO: 2); and
A first elution step of eluting the aptamer specifically bound to the target material in the second reaction step.
delete According to claim 7,
an amplification step of amplifying the nucleic acid of the aptamer eluted in the first elution step;
a 2-1 reaction step in which the nucleic acid of the amplified aptamer is added to the support where the first reaction step is completed and reacted; and
The immunoassay method further comprising a second elution step of eluting the aptamer specifically bound to the target material in the 2-1 reaction step.
According to claim 7,
The amplification step is an immunoassay method performed through a polymerase chain reaction.
According to claim 7,
the amplification step; 2-1st reaction step; and the second elution step is sequentially repeated 2 to 30 times.
According to claim 7,
After the first reaction step, adding the aptamer library to the antibody-immobilized support and reacting; and
The immunoassay method further comprising a recovery step of recovering the supernatant containing the aptamer library that did not react with the antibody.
According to claim 7,
The immunoassay method further comprising the step of removing the aptamer that failed to form a complex after the complex formation step.
According to claim 7,
The immunoassay method further comprising adding an amplification reagent prior to amplifying the aptamer.
According to claim 7,
The immunoassay method further comprising the step of measuring fluorescence after the step of amplifying the aptamer.
According to claim 7,
The binding material is any one or more selected from the group consisting of antibodies, antigens, nucleic acids, aptamers, haptens, antigen proteins, DNA, RNA binding proteins and cationic polymers.
According to claim 7,
The amplification reagent comprises a primer, a dNTP, a reaction buffer, a recombinase, and an intercalating dye that is inserted into the amplified dsDNA and exhibits a fluorescent signal.
According to claim 7,
The step of amplifying the aptamer is Helicase-Dependent Amplification (HDA), Recombinase Polymerase Amplification (RPA), Rolling Circle Amplification (RCA), Loop mediated isothermal amplification (LAMP), Nucleic Acid Sequence-Based Amplification (NASBA), Transcription (TMA) Mediated Amplification), SMART (Signal Mediated Amplification of RNA Technology), SDA (Strand Displacement Amplification), IMDA (Isothermal Multiple Displacement Amplification), SPIA (Single Primer Isothermal Amplification), and cHDA (Circular Helicase Dependent Amplification). An immunoassay method performed by one isothermal amplification method.
According to claim 7,
Immunoassay method wherein the concentration of the binding material is 0.1 to 100 ng/mL.
According to claim 7,
The immunoassay method in which the concentration of the aptamer is 0.01 to 10 pM.
According to claim 7,
The step of amplifying the aptamer is an immunoassay method performed for 8 to 30 minutes.
The method of any one of claims 7 and 9 to 21,
The minimum limit of detection (LOD) of the method is an immunoassay method in which the concentration of the target substance contained in the sample is 1 fg / mL or more.

Images