KR101384178B1 - Aptamer specific to influenza virus ns1 protein and pharmaceutical composition comprising the same - Google Patents

Abstract

The present invention relates to oligonucleotide aptamers of a specific sequence that inhibits the activity of influenza virus, the causative agent of acute respiratory diseases, and in particular, has a specific affinity for antibodies beyond the non-structural 1 (NS1) protein of influenza viruses. It has the effect of inhibiting the ability of host cell Retinoic acid-inducible gene I (RIG-I) and viral NS1 protein to bind.
The nucleotide molecule of the present invention has a target affinity over the antibody, is significantly smaller in size than the antibody, and can bind with the target molecule with high binding strength. In addition, it is not sensitive to temperature changes and can be regenerated quickly even if denatured.

Description

Aptamer that specifically binds to the NS1 protein of influenza virus, and a pharmaceutical composition comprising the same {APTAMER SPECIFIC TO INFLUENZA VIRUS NS1 PROTEIN AND PHARMACEUTICAL COMPOSITION COMPRISING THE SAME}

The present invention relates to oligonucleotide aptamer of a specific sequence that specifically binds to and inhibits the activity of NS1 protein of Influenza virus, a cause of acute respiratory disease, and more particularly, to a pharmaceutical composition comprising the same. It has a specific affinity for antibodies beyond the non-structural 1 (NS1) protein of Influenza virus, which inhibits the ability of host cell Retinoic acid-inducible gene I (RIG-I) to bind to the viral NS1 protein. Oligonucleotide aptamers of the sequence and pharmaceutical compositions comprising the same.

Influenza is mainly caused by influenza virus type A and is a clinically acute respiratory disease that causes huge damage to humans through the big and small epidemic every year. Antigenic mutations of influenza viruses occur almost every year, and these antigenic mutations continue to cause epidemics of influenza. In particular, the change of Hemagglutinin (HA) or Neuraminidase (NA) among influenza virus genes into completely new HA or NA by genetic recombination is called antigenic stool, and when an antigenic stool occurs, humans have no immunity against this new virus. This can happen.

In order to treat such acute respiratory diseases that may cause pandemic, it is necessary to develop specific inhibitors that can suppress the infection of influenza virus.

Influenza virus is a virus with eight single-stranded (-) sense RNA. It is composed of 16 subtypes of Hemagglutinin (HA) serotypes and 9 subtypes of Neuraminidase (NA) serotypes. It is classified.

 The NS1 protein of influenza is a multifunctional protein that participates in protein-protein and protein-RNA interactions. Its main role is to interfere with the signaling pathway by the RIG-I protein, thereby inhibiting interferon-beta production, thereby avoiding the innate immune response, a defense mechanism of host cells that arises against influenza virus invasion.

RIG-I is known as a protein that induces an innate immune response that induces interferon-beta production by recognizing viral double-stranded RNA or single-stranded RNA having triphosphate at the 5 'end when invasion of the virus occurs. It is now suggested that NS1, which binds to double-stranded RNA, inhibits the binding of double-stranded RNA to RIG-I during viral infection, or inhibits RIG-I activity by NS1 by binding directly to RIG-I. have. Therefore, NS1 protein, which is a multifunctional protein of influenza, has a variety of functions and plays an important role in avoiding innate immunity of host cells, which is a good target for suppressing influenza infection.

In vitro selection strategies can be used to identify single-stranded DNA and RNA ligands (aptamers) using SELEX (systematic evolution of ligands by exponential enrichment), and these DNA and RNA aptamers have high affinity to target proteins. May be employed as the binding complex structure [c. Tierl. L. Gold, Science 249 (1990) 505-510; A.D Ellington, et al., Nature 346 (1990) 818-822]. SELEX is an efficient method for separating high affinity DNA and RNA ligands for proteins, target molecules including organic small molecules [S.D. Jayasena, Clin Chem. 45 (1999) 1628-1650.

In the case of influenza virus Hemagglutinin, DNA aptamer was isolated using SELEX method and could inhibit enzyme activity [Sung Ho Jeon, JBC (2004) 48410-48419]. However, no attempt has been made to isolate affinity nucleic acid aptamers from NS1 proteins of influenza viruses, and there is a need to separate DNA and RNA aptamers as targets that can inhibit or detect influenza virus infection.

An object of the present invention is to provide an oligonucleotide aptamer of a specific sequence that specifically binds to and inhibits the activity of NS1 protein of Influenza virus, which is a cause of acute respiratory disease.

It is another object of the present invention to provide a pharmaceutical composition comprising an oligonucleotide aptamer specifically binding to Non structural 1 (NS1) protein of influenza virus, which is a cause of acute respiratory disease, and a physiologically acceptable carrier. It is done.

It is still another object of the present invention to provide a method for treating and diagnosing infection of an influenza virus using a pharmaceutical composition comprising the oligonucleotide aptamer and a physiologically acceptable carrier.

In order to achieve the above object, the inventors of the present invention have studied DNA oligonucleotides having a specific sequence that specifically binds to Influenza virus / NS1 protein, and SELEX method from a DNA library containing 45 nucleotide random sequence DNA aptamers affinity with NS1 protein were isolated. 15 DNA aptamer candidates having affinity for the protein were isolated from the DNA aptamer library obtained after 15 consecutive rounds of SELEX to confirm affinity for NS1 protein and its potential as an antibody surrogate as described below. .

The inventors of the present invention studied RNA oligonucleotides that specifically bind to Influenza virus / NS1 protein by the above method, and RNA aptamers affinity with NS1 protein using SELEX method from RNA library containing 40 nucleotide random sequence. Was separated. Six RNA aptamer candidates having affinity for the protein were isolated from the RNA aptamer library obtained after 15 consecutive rounds of SELEX to confirm affinity for the NS1 protein as described below.

Therefore, the present invention is characterized by an oligonucleotide aptamer having a sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 3 that specifically binds to influenza virus / NS1 protein.

Oligonucleotide molecules of the present invention can be used as a sensor, for example, an electrochemical sensor that reacts in response to the degree of electron transfer that appears before and after the binding between the aptamer and the target molecule, an optical method through fluorescence measurement of fluorescent materials, etc. Sensor, the mass spectrometry aptamer sensors can be used to analyze and measure the difference in mass appearing before and after binding to the target material. Aptamers are small molecule oligonucleotides that bind to target molecules very tightly and specifically, and thus are effective in the diagnosis and treatment of diseases.

In addition, since the oligonucleotide molecule of the present invention is much smaller in size than the antibody and can bind to the target molecule with high binding strength, the oligonucleotide molecule has a target affinity higher than that of the antibody, and is not sensitive to temperature change and is rapidly regenerated even if denatured. This has the advantage of being possible.

On the other hand, the present invention is characterized by providing a pharmaceutical composition having a specific binding to the influenza virus containing the oligonucleotide and its complementary sequence as an active ingredient. The oligonucleotides of the present invention may be provided to the subject as such or as part of a pharmaceutical composition in admixture with a pharmaceutically acceptable carrier.

As used herein, "pharmaceutical composition" means a preparation of one or more active ingredients described herein with other chemical ingredients such as physiologically compatible carriers and excipients. As used herein, "active ingredient" means an agent that has a biological effect. By "physiologically acceptable carrier" and "pharmaceutically acceptable carrier" is meant a carrier or diluent that does not cause severe irritation to the organism and does not destroy the properties and bioactivity of the administered compound. Suspending agents, coloring matters, perfumes and the like may be used. In the case of injections, buffers, preservatives, anhydrous agents, solubilizers, isotonic agents, stabilizers and the like may be used. The formulation of the pharmaceutical composition of the present invention may be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above. For example, in the case of oral administration, it may be prepared in the form of tablets, troches, capsules, elylsir, sessions, syrups, wafers, etc., and in the case of injections, may be prepared in unit dosage ampoules or multiple dosage forms. Other pharmaceutical compositions of the present invention may be prepared according to techniques commonly used in the form of various formulations. The pharmaceutical composition of the present invention is administered to humans and animals orally or parenterally intravenously, subcutaneously, intranasally or intraperitoneally. Parenteral administration includes injection and drip methods such as subcutaneous injection, intramuscular injection and intravenous injection. In addition, microparticles such as microcapsules or cationic lipids can be used as pharmaceutically acceptable carriers of this aspect of the invention.

Since the pharmaceutical composition specifically binds to influenza virus NS1 protein, the pharmaceutical composition may be used as a sensor capable of detecting NS1 protein of influenza virus. In addition, the pharmaceutical composition comprising the oligonucleotide molecule of the present invention can be used as a sensor for detecting a subject exposed or exposed to a virus, and can be used for the treatment and diagnosis of a viral infection.

In addition, an expression vector may be prepared to express the oligonucleotide of the present invention in E. coli cells which have been temporarily or stably modified. Such a technique is easy for those skilled in the art, and detailed description thereof will be omitted.

The DNA and RNA of the present invention can be produced by polymerase chain reaction or synthesis of polymerase enzymes, and this technique is easy for those skilled in the art, and detailed description thereof will be omitted.

The DNA and RNA of the present invention may comprise one or more polymerized nucleotides. It may include modifications to the phosphate-sugar backbone or nucleotides. For example, phosphodiester bonds of natural nucleic acids can be modified to include at least one amine or biotin molecule.

Isolation of DNA aptamer candidates, affinity for the NS1 protein, and the potential for use as antibody replacements were also confirmed.

One. Abtamer  Candidate Isolation

To find DNA and RNA with high affinity for the influenza virus NS1 protein, a library pool was prepared comprising a random core sequence of 45 nucleotides for DNA and 40 nucleotides for RNA with defined regions. Affinity DNA and RNA were isolated from the library pool via the SELEX procedure (FIG. 1A). As of round 8, the protein concentration reacting with the DNA and RNA libraries was continuously reduced to react with higher specificity and binding affinity for the NS1 protein. To have a degree. DNA and RNA libraries were selected in vitro in 15 consecutive rounds. In the case of the DNA library, it was confirmed by Sandwich ELISA that specificity and binding affinity increased as rounds were added from round 11 (FIG. 1B). The isolated DNA library was amplified by polymerase chain reaction (PCR). The resulting DNAs were cloned. RNA libraries were cloned by amplification by polymerase chain reaction (PCR) after conversion to DNA via reverse transcription. Sequences of 15 subclone single stranded DNA aptamers and 6 subclone RNA aptamer candidates were determined. The sequence of the various nucleic acids identified was predicted secondary by the MFold program. [M. Zuker, Computer prediction of RNA structure, Methods Enzymol. 180 (1989) 262-288. The predicted secondary structure of all nucleic acid aptamers has several stem-loop structures as in (FIGS. 2A, 3A, 3B).

2. Affinity test of DNA aptamer candidates with NS1 protein

The affinity between the abundant and selected 15 DNA aptamer candidates obtained from SELEX round # 15 and NS1 protein was tested by ELISA (Enzyme-Linked ImmunoSorbent Assay). After fixing a biotin-attached aptamer candidate on a streptavidin-covered 96-well plate, the GST-tagged NS1 protein was reacted at various concentrations, and then the GST antibody conjugated with mustard peroxidase (HRP) was reacted. . When the 3,3 ', 5,5'-tetramethylbenzidine solution was added, the degree of discoloration was confirmed by absorbance at 450 nm to identify the sequence having the highest binding force. As a result, the absorbance at 450 nm on the y-axis and the concentration of NS1 protein added to the x-axis were set to confirm the tendency for interaction with the aptamer (FIG. 2B). Kd values of 15 aptamer candidates After obtaining the aptamer (aptamer 1) having the lowest Kd value could be identified. (FIG. 2A) As a result of confirming affinity through ELISA experiment, candidate 1 of 15 aptamer candidates was NS1 protein. It was an aptamer having a Kd value of a few nM and was used as an antibody substitute.

The sequence of DNA aptamer candidate 1 is

GCAATGGTACGGTACTTCC GCGGTCCGGGGTGGGTGGGTGGTGGGGGGTGCGGGGGGGCGGCCG CAAAAGTGCACGCTACTTTGCTAA.

GCGGTCCGGGGTGGGTGGGTGGTGGGGGGTGCGGGGGGGCGGCCG represents the random core sequence of 45 nucleotides in the sequence of the DNA aptamer candidate substance No. 1.

The Kd value of DNA aptamer 1 confirmed a Kd value of about 18.91 nM, indicating that the sequence had a high binding affinity with the NS1 protein among 15 DNA aptamer candidates.

3. Affinity test of RNA aptamer candidate with NS1 protein

The affinity of the NS1 protein with the abundant and selected six RNA aptamer candidates obtained in SELEX round # 15 was tested by ELISA. Various reactions were performed according to the type and concentration of GST tagged NS1 and aptamer candidates, and then immobilized on a glutathione-covered 96-well plate, using a combination of NS1 antibody and mustard peroxidase (HRP). I was. When 1 mg / ml (100 μl / well) of ols-phenylenediamine solution was added, the degree of discoloration was confirmed by absorbance at 492 nm, thereby confirming the binding force between NS1 and RNA aptamer. As a result, the degree of inhibition on the y-axis and the concentration of the aptamer candidate added to the x-axis were set to confirm the tendency for interaction with the NS1 protein (FIG. 3C). The Kd values of the six aptamer candidates After the determination, two aptamers (aptamers 2 and 3) having the lowest Kd values could be identified. (FIGS. 3A and B) As a result of confirming affinity through ELISA experiments, 2 of 6 aptamer candidates were identified. , Candidate 3 was confirmed to be an aptamer having a NS1 protein and a Kd value of several nM.

The sequence of candidate RNA aptamer 2 is

GGGUUCACUGCAGACUUGACGAAGCUU ACUACUGUACGUCAUUAAGUAUUACUAGGAUGGAAUUCGU AAUGGAUCCACAUCUACGAAUUC.

ACUACUGUACGUCAUUAAGUAUUACUAGGAUGGAAUUCGU represents a random core sequence of 40 nucleotides in the sequence of RNA aptamer candidate.

The sequence of RNA aptamer candidate 3 is

GGGUUCACUGCAGACUUGACGAAGCUU ACUAUUGUACUUCAUUAAGUAUUACUACGAUGGAAUUCGU AAUGGAUCCACAUCUACGAAUUC.

In the sequence of the RNA aptamer candidate 3

ACUAUUGUACUUCAUUAAGUAUUACUACGAUGGAAUUCGU represents a random core sequence of 40 nucleotides.

For RNA aptamer 2, Kd was about 5.15 nM, and Kd was about 1.89 nM, and it was confirmed that the sequence has high binding affinity with the NS1 protein among 6 RNA aptamer candidates.

4. Validation of DNA aptamer as an antibody replacement

The inventors applied a Western blot method to find out whether the found aptamer can be used as an antibody surrogate. As in the conventional Western blot method, the amount of NS1 protein was varied and electrophoresed with 10% SDS-PAGE, and then transferred to the PVDF membrane. After reacting DNA aptamer 1 with 5'-biotin as a substitute for antibody, streptavidin was mixed with mustard peroxidase (HRP).

As the amount of NS1 protein is gradually increased as shown in Figure 4, it was confirmed that the adhesion degree of DNA aptamer 1 increases in proportion to the protein amount. These results confirmed that DNA aptamer No. 1 can be used as an antibody substitute for NS1.

The oligonucleotide aptamer of the present invention is an electrochemical sensor that reacts in response to the degree of electron transfer that occurs before and after the aptamer and the target molecule, and an optical sensor through fluorescence measurement such as a fluorescent substance, and a target substance. It can be used as aptamer sensors for influenza virus of the mass spectrometry to analyze and measure the difference in mass appearing before and after.

The nucleotide molecule of the present invention has a target affinity over the antibody, is significantly smaller in size than the antibody, and can bind with the target molecule with high binding strength. In addition, it is not sensitive to temperature changes, and even if it is denatured, it can be quickly regenerated.

In addition, the pharmaceutical composition comprising the oligonucleotide aptamer of the present invention as an active ingredient can be used as a sensor for detecting a subject exposed or exposed to a virus, and can be used for the treatment and diagnosis of a viral infection.

1 is an in-bit selection process,
(A) is a nucleic acid library sequence for in vitro selection of a nucleic acid aptamer for NS1 protein, wherein the DNA library contains 45 random nucleotides and is formed by the lambda-nuclease terminal hydrolase of the DNA template, and the RNA library is 40 It contains random nucleotides and is formed by in vitro transcription of a DNA template. Nucleic acid library sequences and in vitro selection processes.
(B) is a diagram showing the affinity of the single-stranded DNA library and NS1 protein as the round of in vitro selection increased (column 1: column without library, column 2: 0 round, column 3: 11 round, column 4: 12 round). , Row 5: 13 round, row 6: 14 round, row 7: 15 round)
2 is a DNA aptamer obtained through in vitro selection,
(A) is the secondary structure of the candidate substance (# 1) which is considered to have the highest affinity with NS1 among the 15 identified DNA aptamers (the secondary structure is predicted using the MFOLD program).
(B) is a graph showing the binding affinity between the NS1 protein and biotin-attached single-stranded DNA aptamer candidates as described in Example, and performing reverse ELISA.
3 is an RNA aptamer obtained through in vitro selection,
(A) is the secondary structure of candidate substance (# 2) which is considered to have high affinity with NS1 among the six identified RNA aptamers (the secondary structure is predicted using the MFOLD program).
(B) is the secondary structure of the candidate substance (# 3) which is considered to have high affinity with NS1 among the six identified RNA aptamers (the secondary structure is predicted using the MFOLD program).
(C) is a graph showing the result obtained by performing a Competitive ELISA as described in the Examples for binding affinity between NS1 protein and RNA aptamer candidates (solid line is candidate number 2 aptamer, dotted line is number 3). Aptamer candidate)
(D) is a graph showing the results obtained by performing the Sandwich ELISA as described in the Examples for binding affinity between the NS1 protein and RNA aptamer candidates (solid line 2 candidates, dotted line 3 times). Aptamer candidate)
4 is a diagram showing the principle of NS1 protein analysis using a modified Western blotting method using a single-stranded DNA aptamer, the Western blotting reaction is the amount of purified NS1 protein (1 column: 0 ㎍) or several Electrophoresis was performed at concentrations (rows 2-7: 0.05 μg, 0.1 μg, 0.5 μg, 1.0 μg, 2.0 μg, 5.0 μg), followed by binding using the synthesized 5'-biotin-attached No. 1 aptamer. This is a photograph of the reaction (the thickness of the line increases as the concentration of NS1 protein increases).
5 is a diagram showing the principle of NS1 protein analysis by ELISA method using a single strand of DNA aptamer,
(A) shows purified various GST-tagged NS1 proteins (rows 1-7, rows: radish, 1-230 amino acids (full length), 2-73 amino acids (known to bind RNA well), 72-230 amino acids, One amino acid mutation of NS1 (changes 41st amino acid K to A), two amino acids mutation of NS1 (changes 38th amino acid R to A 41st amino acid K to A), or GST protein (column 8) The binding site was confirmed by reacting DNA aptamer.
(B) reacts GIG-tagged NS1 protein and various concentrations of aptamer with RIG-I reacted with poly I: C to affect the interaction of NS1 and RIG-I with increasing aptamer concentration. Confirmed. (We found that NS1 and RIG-I interaction decreased with increasing aptamer concentration.)
Figure 6 confirmed the degree of aptamer involvement in the interaction of RIG-I and NS1 protein in Mammalian cells by reporter assay.
(A) The expression level of NF-κB was determined according to the presence or absence of NS1 protein and aptamer in 293T cells. (When NS1 is expressed in 293T cells, NF-κB expression decreases, confirming that NF-κB is induced again as the aptamer concentration increases.)
(B) The expression level of NF-κB according to the presence or absence of NS1 protein and aptamer was confirmed in 293T cells expressing RIG-I. (When NS1 is induced in 293T cells expressing RIG-I, the expression level of NF-κB decreases and NF-κB is induced again as the aptamer concentration increases.)

Hereinafter, the present invention will be described in more detail with reference to examples.

Example 1: Purification and Expression of GST-Tagged Influenza Virus NS1 Protein

In order to attach the GST-tag to the N-terminus of the target protein H5N1 influenza virus NS1 protein, NS1 gene was inserted into pGEX-4T-1 vector and recombined. The prepared protein expression plasmid was transformed into Escherichia coli BL21 (DE3) competent cells. Cells were grown at 37 ° C. until the light density ₆₀₀ was 0.6, and then 0.5 mM of isopropyl 1-thio-D-galactoside (IPTG) was added, followed by induction of protein expression at 18 ° C. for 16 hours. E. coli expressing the protein was dissolved in an ultrasonic grinder, and centrifuged at 12000 rpm for 20 minutes to obtain a supernatant to obtain a water-soluble protein extract. The protein extract was purified with NS1 protein using GST affinity chromatography, DEAE ion exchange column. Protein fractions were determined by 10% SDS-PAGE and the fractions were frozen at −80 ° C. after addition of 20% glycerol for long term storage. The concentration of the prepared H5N1 influenza virus NS1 protein was measured using an absorbance at 280 nm (absorption coefficient: 66,725 M ^-1 cm ^-1 ).

Example 2: Preparation of Random DNA Libraries

To find a single-stranded DNA aptamer that specifically binds to H5N1 influenza virus NS1 protein, a 88-base DNA library with 45 random sequences was prepared first. The 45 random sequences were theoretically designed to construct a library with about 4 ⁴⁵ different sequences. A PCR process is used to amplify the DNA library, wherein the DNA template is a reverse primer comprising a primary primer (5'- FAM -GCAATGTACGGTACTTCC-3 ') containing a fluorescent FAM (underlined sequence) and a phosphoric acid (underlined sequence) (5'- Phosphate- TTAGCAAAGTAGCGTGCACTTTTG-3 ') was prepared by 25 cycles of amplification of single stranded DNA. The amplified DNA was hydrolyzed into single strands through 37 ° C., 3 hours reaction of lambda-nucleic acid terminal hydrolase purified by phenol-chloroform extraction and ethanol precipitation and recognizing the phosphate sequence of double stranded DNA 5 ′. The resulting single stranded DNA was gel-purified and identified with 10% denaturation gel and the sequence was 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3 ', where N45 is the same mole of A, G, C, and T represents a random core sequence of 45 nucleotides inserted.

Example 3: Preparation of Random RNA Libraries

RNA libraries used for in vitro selection were prepared by in vitro transcription using a 109 bp DNA template containing 40 random nucleotides and a T7 RNA polymerase. The DNA template contains a positive primer (5'-GA TAATACGACTCACTATA GGGTTCACTGCAGACTTGACGAA-3 ') and a reverse primer (5'-GAATTCGTAGATGTGGATCCATT-3') containing a T7 promoter (underlined sequence) and a restriction site for in vitro transcription and cloning purposes. Was prepared by amplification of 25 cycles of single stranded DNA. The amplified DNA was purified by phenol-chloroform extraction and ethanol precipitation and transcribed into T7 RNA polymerase by the T7 promoter sequence of the DNA template. The resulting RNA was gel-purified with 10% urea-modified gel. The resulting RNA sequence is (5'-GGGUUCACUGCAGACUUGACGAAGCUU-N40-AAUGGAUCCACAUCUACGAAUUC-3 '), where N40 represents a random core sequence of 40 nucleotides with the same moles of A, G, C, and U inserted at each position.

Example  4: DNA  And RNA Abtamer's  Select by bit

In vitro selection was performed with the purified GST-tagged NS1 protein and the resulting single stranded DNA library. First, 5 μg of single stranded DNA library was denatured at 95 ° C. for 10 minutes and restored for 10 minutes on ice. Binding buffer, the DNA library (50 mM Tris-HCl; pH 8.0, 150 mM NaCl, 1.5 mM MgCl 2, 2 mM dithiothreitol (DTT) and 1% (w / v) BSA ) put in a 100 μl glutathione agarose beads 100 μl was added and shaken at room temperature before incubation for 30 minutes. By centrifugation, the DNA-bead complex was precipitated and the supernatant was taken from the DNAs that had non-specific binding activity to glutathione beads. 2 μg of GST-tagged NS1 protein was added to 100 μl of the cleared supernatant and incubated at room temperature for 30 minutes. Again, 100 μl of glutathione agarose beads were added and incubated for 30 minutes. Then, the supernatant was removed after centrifugation to remove DNA molecules not bound to the protein, and the precipitate was washed five times with 500 μl of binding buffer. NS1 complexed with DNA was isolated from glutathione beads by eluting with elution buffer (binding buffer component + 10 mM glutathion). Only DNA was recovered by phenol-chloroform extraction and ethanol precipitation from the DNAs bound to the protein. The recovered DNAs were amplified by PCR with Taq DNA polymerase, and double-stranded DNA was converted to single-strand using lambda-nuclease hydrolase and used in the next round of selection. The procedure for selecting only DNAs bound to 2 μg of NS1 protein was repeated seven times, and then the protein amount was lowered from the eighth step to further compound the DNA binding environment; 1 μg (rounds 8-9), 0.5 μg (rounds 11-11), 0.25 μg (rounds 12-13), 0.125 μg (rounds 14-15). In the same manner as above, 15 rounds of in vitro selection were performed with RNA libraries instead of DNA libraries to obtain affinity RNA libraries. The recovered RNAs were converted to DNA using Improm-II ^™ Reverse Transcriptase (Promega), PCR amplified with Taq DNA polymerase, and transcribed to RNA using T7 RNA polymerase and used for the next round of selection.

Example 5 ssDNA of NS1 Protein and In vitro Selection Using ELISA Round stars  Interaction analysis

As the in vitro selection process proceeded, the interaction was confirmed by ELISA (Enzyme-Linked ImmunoSorbent Assay) to select the library with the most affinity with NS1 protein. In order to attach biotin to each round library of selected DNA, PCR amplification was carried out using a primer (5'- Biotin -GCAATGTACGGTACTTCC-3) containing biotin (underlined sequence), and a single reaction was carried out through the reaction of lambda-nuclease hydrolase. Got into strands. The ELISA procedure first washed the glutathione-covered 96-well plate (Pierce) four times with 1x PBST (phosphate buffered saline containing 0.1% Tween-20) and then purified n-tagged NS1 protein 100 nM. (100 μl / well) was reacted by shaking at 100 rpm at room temperature for 1 hour. After washing the plate 4 times with PBST again, the blocking buffer in which 5% bovine serum albumin (BSA) is dissolved in PBST was performed at room temperature for one hour to remove nonspecific binding. The plate was washed again, and the rounded DNA library with 5'-biotin was denatured at 90 ° C. for 10 minutes and immediately restored to ice for 10 minutes, and then injected into the plate at a concentration of 100 nM (100 μl / well). The reaction was carried out for 1 hour. After washing the plate again, the amount of streptavidin and PBS conjugated with mustard peroxidase (HRP) for detecting biotin was 1: 10000 (100 μl / well) and reacted at room temperature for 1 hour. After washing the plate again, the addition of 1 mg / ml (100 μl / well) of ols-phenylenediamine solution started discoloration and the reaction was terminated by the addition of 2.5 N sulfuric acid. The absorbance was measured at 492 nm using a TRIAD microplate reader (Dynex Technologies, VA, USA). The 15th round of single-stranded DNA was confirmed to have the highest affinity with NS1. DNA was amplified by PCR and cloned into linearized pGEM T easy vector (promega) to obtain 15 DNA aptamer candidates. Similarly, the RNA library was converted to DNA by reverse transcription, and then amplified by PCR and cloned into the pGEM T easy vector to obtain six RNA aptamer candidates. After subcloning and transformation into E. coli DH5α, the plasmid DNA was isolated from individual clones and analyzed for nucleic acid sequences. Secondary structures of 15 DNA aptamers and 6 RNA aptamer candidates selected were predicted by the MFOLD program based on the Zuker algorithm [M. Zuker, Computer prediction of RNA strcture, Methods Enzymol. 180 (1989) 262-288.

Example 6 Analysis of Interaction of NS1 with Biotin Attached ssDNA by Reverse ELISA

After fixing the most affinity aptamer, reverse ELISA (Enzyme-Linked ImmunoSorbent Assay) was performed to measure affinity with the NS1 protein. In order to attach biotin to the aptamer candidate of DNA, PCR was amplified using a primer (5'- Biotin -GCAATGTACGGTACTTCC-3) containing a biotin (underlined sequence), and a single reaction was carried out through the reaction of lambda-nucleic acid terminal hydrolase. Got into strands. The ELISA procedure first washed the streptavidin-covered 96-well plate 4 times with 1x PBST (phosphate buffered saline containing 0.1% Tween-20) and then removed the 5'-biotin-attached DNA aptamer candidate. After 10 minutes denaturation at 90 ℃ and immediately restoring to ice for 10 minutes was injected into the plate at a concentration of 100 nM (100 μl / well) and reacted by shaking at 100 rpm for 1 hour at room temperature. After washing the plate 4 times with PBST again, the blocking buffer in which 5% bovine serum albumin (BSA) is dissolved in PBST was performed at room temperature for one hour to remove nonspecific binding. The plate was washed again and the purified GST-tagged NS1 protein was reacted at room temperature for 1 hour at various concentrations (100 μl / well). After washing the plate again, the amount of GST antibody (Santa cruz) and PBS complexed with mustard peroxidase (HRP) was 1: 1000 (100 μl / well) and reacted at room temperature for 1 hour. After washing the plate again, discoloration started when 100 μl / well of 3,3 ', 5,5'-tetramethylbenzidine solution was added and the reaction was terminated by addition of 0.5 N sulfuric acid. The absorbance was measured at 450 nm using a TRIAD microplate reader (Dynex Technologies, VA, USA).

Example 7: Analysis of interaction of NS1 with ssRNA by Competitive ELISA

In order to select the affinity having the highest affinity among six RNA aptamer candidates obtained through the in vitro selection process with NS1 protein, the interaction was confirmed by the Competitive ELISA. In order to obtain candidate RNA aptamers, RNA cloned DNAs were obtained by PCR amplification and T7 RNA polymerase. The ELISA procedure first denatured RNA aptamer candidates at 90 ° C. for 10 minutes and immediately restored to ice for 10 minutes. The concentration of RNA aptamer was varied and reacted with 100 nM (100 μl / well) of GST-tagged NS1 protein at 100 rpm for 1 hour at room temperature. Thereafter, the glutathione-covered 96-well plate (Pierce) was washed four times with 1x PBST (phosphate buffered saline containing 0.1% Tween-20), and the reacted NS1-aptamer complex was injected for 1 hour at room temperature. Reacted. After washing the plate 4 times with PBST again, the blocking buffer in which 5% bovine serum albumin (BSA) is dissolved in PBST was performed at room temperature for one hour to remove nonspecific binding. After washing the plate again, the amount of NS1 antibody (Santa Cruz) and PBS 1: 1: 1000 (100 μl / well) was reacted at room temperature for 1 hour. After washing the plate again, the amount of the second antibody (Santa Cruz) and PBS combined with mustard peroxidase (HRP) detecting the NS1 antibody was 1: 1000 (100 μl / well) for 1 hour at room temperature. Reacted. After washing the plate again, 1 mg / ml (100 μl / well) of ols-phenylenediamine solution was added to start discoloration and the reaction was terminated by the addition of 2.5 N sulfuric acid. The absorbance was measured at 492 nm using a TRIAD microplate reader (Dynex Technologies, VA, USA).

Example 8 : Sandwich ELISA Through NS1 and Biotin  Attached ssRNA Analyze interaction

The interaction of NS1 protein and in vitro selection was confirmed by Sandwich ELISA to select high affinity aptamers from six RNA aptamer candidates. To obtain RNA aptamer candidates, DNA cloned TA was obtained by PCR amplification and T7 RNA polymerase to obtain RNA aptamer candidates. Then, biotin was attached to the 3 ′ terminal using dUTP-terminal transferase. The ELISA procedure first washed the glutathione-covered 96-well plate (Pierce) four times with 1 × PBST (phosphate buffered saline containing 0.1% Tween-20) and then purified 100 g of the purified GST-tagged NS1 protein. 100 μl / well) was reacted by shaking at 100 rpm at room temperature for 1 hour. After washing the plate 4 times with PBST again, the blocking buffer in which 5% bovine serum albumin (BSA) is dissolved in PBST was performed at room temperature for one hour to remove nonspecific binding. The plate was washed again, and the RNA aptamer candidate with 3′-biotin was denatured at 90 ° C. for 10 minutes and immediately restored to ice for 10 minutes, and then injected into the plate at various concentrations (100 μl / well). Reaction was time. After washing the plate again, the amount of streptavidin (Pierce) and PBS combined with mustard peroxidase (HRP) for detecting biotin was reacted at room temperature for 1 hour at 1: 10000 (100 μl / well). . After washing the plate again, discoloration started when 100 μl / well of 3,3 ', 5,5'-tetramethylbenzidine solution was added and the reaction was terminated by addition of 0.5 N sulfuric acid. The absorbance was measured at 450 nm using a TRIAD microplate reader (Dynex Technologies, VA, USA) to confirm the binding force of the aptamer.

Example  9: as an antibody substitute Abtammer  Used Western Blot Method

Western blot experiments were performed to determine the degree of ability of the most affinity DNA aptamer to substitute for antibodies. The amount of purified NS1 was varied to 0 μg , 0.05 μg , 0.1 μg , 0.5 μg , 1.0 μg , 2.0 μg , 5.0 μg and electrophoresed with 10% SDS-PAGE. The protein in the gel was transferred to the PVDF membrane in a 100 V, 2 hour reaction. Thereafter, a blocking buffer in which 5% bovine serum albumin (BSA) was dissolved in PBST was used to react for 12 hours at 4 ° C. to fill nonspecific binding sites. The membrane was washed four times with PBST for 15 minutes, and then reacted with the membrane at room temperature for 1 hour at a concentration of 500 pg / μl of 5'-biotin-attached aptamer in 5 ml of PBST. After washing the membrane again, the reaction was shaken at 60 rpm for 1 hour at 200 pg / μl of streptavidin complexed with mustard peroxidase (HRP) to detect the aptamer bound to the membrane. The membrane was washed again and visualized by addition of enhanced chemiluminescence solution [Enhanced chemiluminescence] and exposure to LAS 4000. It can be seen that as the NS1 concentration increases, the thickness of the line increases.

Example 10 : NS1  On protein Abtammer  Identify the site of binding

Sandwich ELISA experiments were performed to determine where the single strand of DNA aptamer binds to the GST-tagged NS1 protein. First, NS1 1-230 amino acids (full length), 2-73 amino acids (known to bind well with RNA), 72-230 amino acids, one mutation of NS1 (changing the 41st amino acid K to A), amino acids of NS1 Various GST-tagged NS1 and GST proteins were purified, including two mutations (38 amino acid R to A and 41 amino acid K to A). The ELISA procedure washes glutathione-covered 96-well plates (Pierce) four times with 1x PBST (phosphate buffered saline containing 0.1% Tween-20) and then purified various GST-tagged NS1 proteins or GST proteins. The reaction was stirred at 100 rpm at room temperature for 1 hour at a concentration of 100 nM (100 μl / well). After washing the plate 4 times with PBST again, the blocking buffer in which 5% bovine serum albumin (BSA) is dissolved in PBST was performed at room temperature for one hour to remove nonspecific binding. The plate was washed again, and the DNA aptamer candidate with 5′-biotin was denatured at 90 ° C. for 10 minutes and immediately restored to ice for 10 minutes, and then injected into the plate at various concentrations (100 μl / well). Reaction was time. After washing the plate again, the amount of streptavidin and PBS conjugated with mustard peroxidase (HRP) for detecting biotin was 1: 10000 (100 µl / well) and reacted at room temperature for 1 hour. After washing the plate again, discoloration started upon addition of 100 μl / well of 3,3 ′, 5,5′-tetramethylbenzidine solution and the reaction was terminated by addition of 0.5 N sulfuric acid. The absorbance was measured at 450 nm using a TRIAD microplate reader (Dynex Technologies, VA, USA).

Example  11: Abtammer RIG -I protein and NS1  Determining Involvement in Protein Interactions

Experiments were conducted to determine the degree of aptamer involvement when the NS1 protein interacts with the RIG-I protein. First, His-tagged RIG-I protein was isolated and purified purely. For ELISA, 100 nM of RIG-I protein and 10 ng / μl of poly I: C were reacted at 37 ° C. for 1 hour, washed 4 times with 1 × PBST (phosphate buffered saline containing 0.1% Tween-20) and covered with nickel. Binding to Jean 96-well plate (Pierce). After washing the plate 4 times with PBST again, the blocking buffer in which 5% bovine serum albumin (BSA) is dissolved in PBST was performed at room temperature for one hour to remove nonspecific binding. The plate was washed again and the DNA aptamer candidate with 5′-biotin was denatured at 90 ° C. for 10 minutes and immediately restored to ice for 10 minutes. After the reaction, the plate was injected (100 μl / well) and reacted at room temperature for 1 hour. After washing the plate again, the reaction was conducted at room temperature for 1 hour with the amount of GST antibody conjugated with mustard peroxidase (HRP) to detect GST-tagged NS1 protein and PBS 1: 1000 (100 µl / well). After washing the plate again, discoloration began upon addition of 100 μl / well of 3,3 ′, 5,5′-tetramethylbenzidine solution and the reaction was terminated by addition of 0.5 N sulfuric acid. The absorbance was measured at 450 nm using a TRIAD microplate reader (Dynex Technologies, VA, USA). This confirmed the effect of aptamer on the interaction of NS1 protein and RIG-I protein.

Example  12: Mammalian cell In RIG -I protein and NS1  DNA to protein interaction Abtammer  Degree of involvement repoter assay Confirm with

The day before transfection, 293T cells were laid in 100Φ dish to 4 × 10 ⁶ cells. 150 ng of Firefly luciferase DNA (p4 × κB) and 50 ng of Renilla luciferase DNA (pGL) were transfected with fugene HD (roche) reagent. After 24 hours, cells were removed from a 100Φ dish and placed in a 24 well plate to be 3 × 10 ³ for each well. After 24 hours, various concentrations of DNA aptamer and 0.8 μg of pcDNA6 myc / his NS1 gene were transfected with lipofectamine (invitrogen). After 6 hours, NF-κB was induced by changing to medium containing 1% polyI: C. After 48 hours, cells were lysed using 100 μl of Passive lysis buffer (promega), and 20 μl was taken and transferred to 96 well plates. When the Dual-Luciferase reagent (promega) was added, the degree of NF-κB gene expression was confirmed by measuring the color development with a luminometer. In addition, the degree of expression of the NF-κB gene was confirmed by experimenting with 293T cells expressing RIG-I instead of 293T cells in the same manner as above.

In the above description of the preferred embodiment of the present invention, those skilled in the art will be able to perform various modifications without departing from the gist of the present invention, and such modifications are within the protection scope of the present invention. The protection scope of the present invention should be construed as described in the claims.

Attach an electronic file to a sequence list

Claims (10)

An oligonucleotide aptamer having a sequence of SEQ ID NO: 1 that specifically binds to Non structural 1 (NS1) protein of influenza virus. The method of claim 1,
The oligonucleotide aptamer is an oligonucleotide aptamer, characterized in that the sensor for a non structural 1 (NS1) protein of influenza virus. The method of claim 1,
The oligonucleotide aptamer is an oligonucleotide aptamer, characterized in that used as an antibody substitute for influenza virus. The method of claim 1,
The oligonucleotide aptamer is an oligonucleotide aptamer, characterized in that it inhibits the ability of the host cell Retinoic acid-inducible gene I (RIG-I) and influenza virus NS1 protein to bind. delete A pharmaceutical composition for acute respiratory syndrome containing an oligonucleotide aptamer of SEQ ID NO: 1 that specifically binds to the NS1 protein of an influenza virus as an active ingredient. The method according to claim 6,
The pharmaceutical composition is a pharmaceutical composition for acute respiratory syndrome, characterized in that it further comprises a pharmaceutically acceptable carrier and excipients. The method according to claim 6,
The pharmaceutical composition is a pharmaceutical composition for acute respiratory syndrome, characterized in that used as a sensor for detecting a subject exposed or exposed to influenza virus. The method according to claim 6,
The pharmaceutical composition is a pharmaceutical composition for acute respiratory syndrome, characterized in that used for the treatment and diagnosis of influenza virus infection.
delete

Images