KR20220004462A - A dna aptamer specifically biding to covid-19 virus and uses thereof - Google Patents
A dna aptamer specifically biding to covid-19 virus and uses thereof Download PDFInfo
- Publication number
- KR20220004462A KR20220004462A KR1020200082319A KR20200082319A KR20220004462A KR 20220004462 A KR20220004462 A KR 20220004462A KR 1020200082319 A KR1020200082319 A KR 1020200082319A KR 20200082319 A KR20200082319 A KR 20200082319A KR 20220004462 A KR20220004462 A KR 20220004462A
- Authority
- KR
- South Korea
- Prior art keywords
- virus
- aptamer
- corona
- present
- seq
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/20011—Coronaviridae
- C12N2770/20021—Viruses as such, e.g. new isolates, mutants or their genomic sequences
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
- C12Q2525/10—Modifications characterised by
- C12Q2525/205—Aptamer
Abstract
Description
본 발명은 코로나19 바이러스, 구체적으로 코로나19 바이러스 핵 단백질에 특이적으로 결합하는 DNA 압타머 및 이의 용도에 관한 것이다.The present invention relates to a DNA aptamer that specifically binds to the Corona 19 virus, specifically, the Corona 19 virus nuclear protein, and uses thereof.
2019년 12월에 중국 후베이성 우한시에서 바이러스 폐렴 양상의 원인미상 폐렴이 무리 지어 발생하기 시작하였다. 환자의 대부분이 화난 수산 시장을 방문한 이력이 있었고, 중국 당국은 2019년 12월 31일에 원인 미상의 폐렴이 우한시에서 유행하고 있다고 공식 발표하였다. 2020년 1월 7일에 중국 질병예방통제센터는 이 폐렴 환자들로부터 이전에 알려지지 않은 새로운 코로나바이러스를 검출하였고, 1월 11일에 새로운 코로나바이러스의 유전 정보를 전 세계에 공개하였다. 이 바이러스는 severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)로 명명되었으며, 세계보건기구는 이에 의한 질병을 2019년에 발생한 코로나바이러스가 일으키는 질병을 뜻하는 코로나바이러스감염증-19(coronavirus disease 2019, COVID-19)로 명명하였다.In December 2019, pneumonia of unknown cause, a form of viral pneumonia, began to occur in clusters in Wuhan, Hubei Province, China. Most of the patients had a history of visiting the Huanan Fish Market, and on December 31, 2019, Chinese authorities officially announced that pneumonia of unknown cause was prevalent in Wuhan. On January 7, 2020, the Chinese Center for Disease Control and Prevention detected a previously unknown novel coronavirus from patients with this pneumonia, and on January 11, the genetic information of the novel coronavirus was released to the world. This virus has been named severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), and the World Health Organization has identified the disease caused by coronavirus disease 2019 (COVID-19), which refers to a disease caused by a coronavirus that occurred in 2019. COVID-19).
코로나바이러스감염증-19는 감염자의 비말(침방울)이 호흡기나 눈·코·입의 점막으로 침투될 때 전염된다. 감염되면 약 2~14일(추정)의 잠복기를 거친 뒤 발열(37.5도) 및 기침이나 호흡곤란 등 호흡기 증상, 폐렴이 주증상으로 나타나지만 무증상 감염 사례도 드물게 나오고 있다.Coronavirus Infectious Disease-19 is transmitted when droplets (saliva) of an infected person penetrate the respiratory tract or the mucous membranes of the eyes, nose, and mouth. After an incubation period of about 2 to 14 days (estimated) after infection, the main symptoms include fever (37.5 degrees), respiratory symptoms such as cough or shortness of breath, and pneumonia, but asymptomatic infections are rare.
신종 코로나바이러스인 코로나바이러스감염증-19는 현재까지 백신이 없기 때문에 예방 혹은 적절한 치료를 위해 초기 단계에서의 진단이 매우 중요하다.Since there is currently no vaccine for COVID-19, a novel coronavirus, diagnosis at an early stage is very important for prevention or appropriate treatment.
신종코로나 바이러스에는 RNA를 감싸는 뉴클레오캡시드 단백질(Nucleocapsid Protein, NP)이 다수 존재하고, 뉴클레오캡시드 단백질은 바이러스에 다수 존재하며 상대적으로 돌연변이 확률이 적다. 따라서 바이러스 매개 질환 진단 시, 뉴클레오캡시드 단백질을 검출함으로써 높은 민감도 실현 가능하다. 비슷한 유형의 RNA 바이러스인 인플루엔자 바이러스의 경우, 바이러스 돌연변이로 인해 새로운 종이 나오더라도 뉴클레오캡시드 단백질의 구조 및 서열은 크게 다르지 않음이 밝혀졌다.There are many nucleocapsid proteins (NPs) surrounding RNA in the novel coronavirus, and many nucleocapsid proteins exist in viruses, and the probability of mutation is relatively low. Therefore, high sensitivity can be realized by detecting the nucleocapsid protein when diagnosing virus-mediated diseases. In the case of influenza virus, which is a similar type of RNA virus, it has been found that the structure and sequence of the nucleocapsid protein do not differ significantly even if a new species emerges due to virus mutation.
따라서, 최근 COVID-19를 진단하기 위해 다양한 업체 및 국가에서 뉴클레오캡시드 단백질를 바이오마커로 검출하는 LFA 키트를 개발하고 있는 실정이다. Therefore, in order to diagnose COVID-19, various companies and countries are developing LFA kits that detect nucleocapsid protein as a biomarker.
현재의 COVID-19 진단법은 검체에서 바이러스를 분리하고, 검체에서 특이 유전자를 Real-time PCR을 통하여 검출하는 방법이 주로 사용되고 있으며, 이는 무증상 감염자의 경우 진단 검사를 받기 어렵다는 점과, 초기 감염 단계인 환자의 경우 바이러스 분리가 어렵다는 단점이 있다. The current COVID-19 diagnostic method is mainly to isolate the virus from the sample and detect a specific gene in the sample through real-time PCR. In the case of patients, there is a disadvantage in that it is difficult to isolate the virus.
상기 방법 이외에 유전자 검출법, 효소면역측정법, 간접면역항체검출법 등이 사용되고 있으나, 위 진단법들의 경우 바이러스 돌연변이에 취약하며, 다시 개발하게 될 경우 항체 생성 기간 및 스크리닝 과정이 필요하기 때문에 긴 시간이 소요되며, 현재까지 바이러스에 의한 면역반응으로 항체가 생성된다는 연구결과는 신뢰성이 부족하다는 단점이 존재한다. In addition to the above methods, gene detection method, enzyme immunoassay method, indirect immune antibody detection method, etc. are used. However, in the case of the above diagnostic methods, they are vulnerable to virus mutation. Until now, research results that antibodies are generated by an immune response by a virus have a drawback in that they lack reliability.
현재 시판되는 대부분의 제품들은 타겟 특이적인 항체를 이용, 항체 개발 과정이 따로 필요하다. 그러나 항체 개발은 주로 동물실험에 의해 이루어지며 많은 시간과 비용이 소요된다. 이에 따라, 항체의 단점을 보완할 수 있는 '바이오리셉터'로서 압타머를 이용한 진단법들이 많이 연구되고 있다.Most products currently on the market use target-specific antibodies and require a separate antibody development process. However, antibody development is mainly carried out by animal experiments, which takes a lot of time and money. Accordingly, many diagnostic methods using an aptamer as a 'bioreceptor' that can compensate for the shortcomings of the antibody are being studied.
본 발명은 신종코로나바이러스인 코로나19에 존재하는 다수의 뉴클레오캡시도 단백질과 높은 친화성으로 상호작용하는 압타머를 개시하며, 상기 압타머를 이용하는 코로나19 바이러스 검출용 키트, 코로나19 바이러스를 검출하는 방법을 제공한다. The present invention discloses an aptamer that interacts with a number of nucleocapsido proteins present in Corona 19, a novel coronavirus, with high affinity, and a kit for detecting Corona 19 virus using the aptamer, detecting the Corona 19 virus provides a way to
본 발명의 일 구현 예에서는 압타머를 제공한다.One embodiment of the present invention provides an aptamer.
본 발명의 상기 압타머는 코로나19 바이러스의 핵 단백질의 핵 단백질에 특이적으로 결합하고, 76개의 염기서열을 포함한다.The aptamer of the present invention specifically binds to the nuclear protein of the nuclear protein of the Corona 19 virus, and includes 76 nucleotide sequences.
본 발명의 상기 "압타머"란, 종래의 왓슨-크릭(Watson-Crick) 염기 짝짓기 이외의 상호작용을 통해, 단일 클론 항체와 필적하는, 높은 특이성 및 친화도를 가지는 분자 표적에 결합하게 하는, 특이적 3차 구조를 채택한 단일 가닥 핵산 사슬을 의미한다. 상기 압타머는 핵산인 DNA 또는 RNA일 수 있고, 바람직하게는 단일 가닥 DNA일 수 있으나, 이에 제한되는 것은 아니다.The "aptamer" of the present invention, through an interaction other than the conventional Watson-Crick base pairing, to bind to a molecular target with high specificity and affinity, comparable to a monoclonal antibody, It refers to a single-stranded nucleic acid chain adopting a specific tertiary structure. The aptamer may be a nucleic acid, DNA or RNA, preferably single-stranded DNA, but is not limited thereto.
본 발명의 상기 압타머가 RNA인 경우에는, T7 RNA 중합효소 또는 변형된 T7 RNA 중합효소를 이용하여 DNA 라이브러리를 시험관 내(In vitro)에서 전사시킴으로써 생산할 수 있다.When the aptamer of the present invention is RNA, it can be produced by in vitro transcription of a DNA library using T7 RNA polymerase or modified T7 RNA polymerase.
본 발명의 "핵산"이란, 임의의 유형의 핵산, 예컨대 DNA 및 RNA, 및 이의 변이체, 예컨대 펩타이드 핵산(peptide nucleic acid: PNA), 잠긴 핵산(locked nucleic acid: LNA), 및 이들의 조합, 이들의 변형, 예컨대 변형 뉴클레오타이드 등을 의미한다. 용어 "핵산" 및 "올리고뉴클레오타이드" 및 "폴리뉴클레오타이드"는 상호교환되어 사용된다. 상기 핵산은 재조합 발현 시스템을 사용하여 제조되고, 임의로, 정제된, 화학적으로 합성된 기타 등등의 천연 소스로부터 정제될 수 있다. 화학적으로 합성된 분자의 경우에, 핵산은 뉴클레오사이드 유사체, 예컨대 화학적으로 변형된 염기 또는 당, 골격의 변형 등을 가지는 유사체를 포함할 수 있다. 핵산의 염기서열은 달리 표시되지 않은 한 5'-3' 방향으로 표시된다.As used herein, "nucleic acid" means any type of nucleic acid, such as DNA and RNA, and variants thereof, such as peptide nucleic acid (PNA), locked nucleic acid (LNA), and combinations thereof, these of modification, such as modified nucleotides, and the like. The terms “nucleic acid” and “oligonucleotide” and “polynucleotide” are used interchangeably. The nucleic acids may be prepared using recombinant expression systems and, optionally, purified from natural sources such as purified, chemically synthesized and the like. In the case of a chemically synthesized molecule, the nucleic acid may include a nucleoside analogue, such as an analogue having a chemically modified base or sugar, a modification of the backbone, and the like. The base sequence of a nucleic acid is indicated in the 5'-3' direction unless otherwise indicated.
본 발명의 상기 코로나19 바이러스는 유전물질인 RNA를 감싸는 핵산 단백질(Nucleocapsid Protein; NP)가 다수 존재한다. 상기 핵산 단백질은 상대적으로 돌연변이 확률이 적고, 바이러스가 변종되는 경우에도 그 구조 및 서열의 변화가 적기 때문에, 이와 같은 핵산 단백질을 특이적으로 검출함으로써 민감도 및 특이성을 현저하게 높일 수 있다.In the Corona 19 virus of the present invention, there are a number of nucleic acid proteins (Nucleocapsid Protein; NP) surrounding RNA, which is a genetic material. Since the nucleic acid protein has a relatively low mutation probability and the structure and sequence of the nucleic acid are less changed even when a virus is mutated, sensitivity and specificity can be remarkably increased by specifically detecting such a nucleic acid protein.
본 발명의 상기 코로나19 바이러스의 핵산 단백질은 서열번호 1로 표시되는 아미노산 서열로 이루어진 것일 수 있으나, 이에 제한되는 것은 아니다.The nucleic acid protein of the Corona 19 virus of the present invention may consist of the amino acid sequence represented by SEQ ID NO: 1, but is not limited thereto.
본 발명의 상기 압타머는 하기 서열번호 2로 표시되는 염기서열로 이루어진 것일 수 있다. 하기 서열번호 2의 염기서열에서, N은 40개의 정수인 염기서열이고, 상기 염기는 A(아데닌), C(시토신), G(구아닌), 우라실(U) 및 T(티민)으로 구성된 군에서 독립적으로 선택된다:The aptamer of the present invention may consist of a nucleotide sequence represented by SEQ ID NO: 2 below. In the nucleotide sequence of SEQ ID NO: 2, N is a nucleotide sequence that is an integer of 40, and the nucleotides are independent from the group consisting of A (adenine), C (cytosine), G (guanine), uracil (U) and T (thymine). is chosen as:
5'-ATC CAG AGT GAC GCA GCA -[NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN]- TG GAC ACG GTG GCT TAG T-3'(서열번호 2)5'-ATC CAG AGT GAC GCA GCA -[NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN]- TG GAC ACG GTG GCT TAG T-3' (SEQ ID NO: 2)
본 발명의 상기 서열번호 2로 표시되는 염기서열에서, 상기 N은 하기 서열번호 3일 수 있으나, 이에 제한되는 것은 아니다:In the nucleotide sequence represented by SEQ ID NO: 2 of the present invention, N may be the following SEQ ID NO: 3, but is not limited thereto:
AACCCAAGCAAACTACCTCTATACCCTTCGACCTTCATCA (서열번호 3)AACCCAAGCAAACTACCTCTATACCCTTCGACCTTCATCA (SEQ ID NO: 3)
바람직하게는 본 발명의 상기 압타머는 하기 서열번호 4로 표시될 수 있다: Preferably, the aptamer of the present invention may be represented by SEQ ID NO: 4:
5'-ATC CAG AGT GAC GCA GCA AAC CCA AGC AAA CTA CCT CTA TAC CCT TCG ACC TTC ATC ATG GAC ACG GTG GCT TAG T-3'(서열번호 2)5'-ATC CAG AGT GAC GCA GCA AAC CCA AGC AAA CTA CCT CTA TAC CCT TCG ACC TTC ATC ATG GAC ACG GTG GCT TAG T-3' (SEQ ID NO:2)
본 발명의 상기 압타머의 3' 말단 또는 5' 말단에 검출 가능한 표지가 결합할 수 있다. 이와 같은 검출 가능한 표지는 당업계에 알려진 검출 방법에 의해 검출될 수 있는 모이어티로서, 통상의 방법에 따라 압타머의 특정 염기, 특정 구조에 결합될 수 있다.A detectable label may be bound to the 3' end or 5' end of the aptamer of the present invention. Such a detectable label is a moiety that can be detected by a detection method known in the art, and may be bound to a specific base and a specific structure of an aptamer according to a conventional method.
본 발명의 상기 검출 가능한 표지는 예를 들면, 광학적 표지, 전기화학적 표지, 방사성 동위원소로 구성된 군으로부터 선택되는 적어도 하나의 표지일 수 있으나, 이에 제한되는 것은 아니다.The detectable label of the present invention may be, for example, at least one label selected from the group consisting of an optical label, an electrochemical label, and a radioisotope, but is not limited thereto.
본 발명의 상기 광학적 표지는 형광 물질 또는 효소일 수 있다.The optical label of the present invention may be a fluorescent material or an enzyme.
본 발명의 상기 형광 물질은 플로로세인(fluorescein), 비오틴(Biotin), 6-FAM, 로다민, 텍사스 레드(Texas Red), 테트라메틸로다민, 카르복시로다민, 카르복시로타민6G, 카르복시로돌, 카르복 시로다민110, 캐스케이드 블루(Cascade Blue), 캐스케이트 옐로우(Cascade Yellow), 코마린, Cy2(cyanine 2), Cy3(cyanine 3), Cy3.5(cyanine 3.5), Cy5(cyanine 5), Cy5.5(cyanine 5.5), Cy-크롬, 피코에리트린, PerCP(페리디닌 클로로필-a 단백질), PerCP-Cy5.5, JOE(6-카 르복시-4',5'-디클로로-2',7'-디메톡시플루오레신), NED, ROX(5-(및-6)-카르복시-X-로다민), HEX, 루시퍼 옐로 우(Lucifer Yellow), 마리나 블루(Marina Blue), 오레곤 그린(Oregon Green) 488, 오레곤 그린 500, 오레곤 그린 514, 알렉사 플로어, 7-아미노-4-메틸코마린-3-아세트산, 보디피(BODIPY) FL, 보디피 FL-Br 2, 보디피 530/550, 이의 콘쥬게이트화물로 구성된 군으로부터 선택된 적어도 하나일 수 있으나, 이에 제한되는 것은 아니다.The fluorescent material of the present invention is fluorescein, biotin, 6-FAM, rhodamine, Texas Red, tetramethylrhodamine, carboxyrhodamine, carboxyrotamine 6G, carboxyrodol , Carboxyrhodamine 110, Cascade Blue, Cascade Yellow, Comarin, Cy2 (cyanine 2), Cy3 (cyanine 3), Cy3.5 (cyanine 3.5), Cy5 (cyanine 5) , Cy5.5 (cyanine 5.5), Cy-chromium, phycoerythrin, PerCP (peridinine chlorophyll-a protein), PerCP-Cy5.5, JOE (6-carboxy-4',5'-dichloro-2 ',7'-dimethoxyfluorescein), NED, ROX (5-(and-6)-carboxy-X-rhodamine), HEX, Lucifer Yellow, Marina Blue, Oregon Oregon Green 488, Oregon Green 500, Oregon Green 514, Alexa Floor, 7-amino-4-methylcomarin-3-acetic acid, BODIPY FL, BODIPY FL, BODIPY FL-Br 2, BODIPY 530/ 550, may be at least one selected from the group consisting of conjugates thereof, but is not limited thereto.
본 발명의 상기 효소는 효소결합면역흡착검사(ELISA)에 사용되는 효소일 수 있고, 예를 들면, 알카라인 포스파타제, 홀스레디쉬 페록시다제, 루시퍼라제, 또는 글루코즈 옥시다제일 수 있다. 상기 광학적 표지로 효소를 사용할 경우, 화학 발광 반응을 유도하기 위하여 바람직하게는 화학발광물질로서 루미놀(luminol), 스트렙티비딘(Streptividin), 이소루미놀(isoluminol), 루시퍼린(luciferin), 루시게닌(lucigenin), 3-(2'-Spiroadamantane)-4-methoxy-4-(3''-phosphoryloxy)phenyl-1,2-dioxetane(AMPPD), Disodium 3-(4-methoxyspiro {1,2-dioxetane-3,2'-(5'-chloro)tricyclo[3.3.1.13,7]decan}-4-yl)phenyl phosphate(CSPD) 등일 수 있으나, 이에 제한되는 것은 아니다.The enzyme of the present invention may be an enzyme used in enzyme-linked immunosorbent assay (ELISA), for example, alkaline phosphatase, horseradish peroxidase, luciferase, or glucose oxidase. When an enzyme is used as the optical label, preferably luminol, streptividin, isoluminol, luciferin, lucigenin as a chemiluminescent material to induce a chemiluminescent reaction lucigenin), 3-(2'-Spiroadamantane)-4-methoxy-4-(3''-phosphoryloxy)phenyl-1,2-dioxetane(AMPPD), Disodium 3-(4-methoxyspiro {1,2-dioxetane- 3,2'-(5'-chloro)tricyclo[3.3.1.13,7]decan}-4-yl)phenyl phosphate (CSPD), etc., but is not limited thereto.
본 발명의 상기 광학적 표지란, 적절한 거리에 의하여 이격되어 있는 형광 도너 발색소 및 형광 수용자 발색소를 포함하고 도너의 형광 발광이 수용자에 의하여 억제되어 있는 형광공명에너지전달(fluorescence resonance energy transfer: FRET) 쌍일 수 있다. 도너 발색소는 FAM, TAMRA, VIC, JOE, Cy3, Cy5 및 Texas Red를 포함할 수 있고, 바람직하게는 FAM일 수 있으나, 이에 제한되는 것은 아니다.The optical label of the present invention includes a fluorescence donor chromophore and a fluorescence acceptor chromophore spaced apart by an appropriate distance, and fluorescence resonance energy transfer (FRET) in which the fluorescence of the donor is suppressed by the acceptor. can be a pair. The donor chromophore may include FAM, TAMRA, VIC, JOE, Cy3, Cy5 and Texas Red, preferably FAM, but is not limited thereto.
본 발명의 상기 방사성 동위원소는 예를 들면, 124I, 125I, 111In, 99mTc, 32P 및 35S으로 구성된 군으로부터 선택되는 적어도 하나일 수 있으나, 이에 제한되는 것은 아니다.The radioactive isotope of the present invention may be, for example, at least one selected from the group consisting of 124 I, 125 I, 111 In, 99m Tc, 32 P and 35 S, but is not limited thereto.
본 발명의 상기 “특이적으로 결합”이란, 본 발명의 상기 압타머와 그 표적 단백질인 코로나19 바이러스의 핵 단백질 간의 비공유 물리적 결합을 의미한다. 본 발명의 상기 압타머와 상기 표적 단백질 간의 결합 시에, 해리상수(Kd) 값이 0.1 nM 내지 5 nM일 수 있고, 바람직하게는 0.5 nM 내지 4 nM일 수 있으나, 이에 제한되는 것은 아니다. 0.5 nM 미만 또는 5 nM 초과의 해리상수를 갖는 경우에는 표적 단백질의 검출하기에 용이하지 않을 수 있다. 본 발명의 목적상 상기 압타머는 표적 단백질에 항체가 결합하는 부위 이외의 부위에 결합되기 때문에 다양한 형태의 바이오센서에 적용될 수 있다.The "specific binding" of the present invention means a non-covalent physical binding between the aptamer of the present invention and the nuclear protein of the corona 19 virus, which is its target protein. Upon binding between the aptamer of the present invention and the target protein, the dissociation constant (K d ) value may be 0.1 nM to 5 nM, preferably 0.5 nM to 4 nM, but is not limited thereto. If it has a dissociation constant of less than 0.5 nM or more than 5 nM, it may not be easy to detect the target protein. For the purpose of the present invention, the aptamer can be applied to various types of biosensors because it binds to a site other than the site where the antibody binds to the target protein.
본 발명의 압타머는 이종 샌드위치 구조의 면역분석법에서 검출 프로브(probe)로 사용할 수 있다. The aptamer of the present invention can be used as a detection probe in an immunoassay of a heterogeneous sandwich structure.
본 발명의 상기 압타머의 서열은 하나 이상의 염기가 치환, 결실, 삽입 또는 이들의 조합에 의해 용이하게 변형될 수 있다. 따라서, 본 발명의 상기 서열번호 3 내지 서열번호 5와 높은 상동성을 갖는 염기서열, 예를 들면 상동성이 80% 이상, 90% 이상 또는 95% 이상인 경우의 염기서열로 본 발명의 염기서열에 모두 포함될 수 있다.The sequence of the aptamer of the present invention may be easily modified by substitution, deletion, insertion, or a combination of one or more bases. Therefore, as a nucleotide sequence having high homology with SEQ ID NO: 3 to SEQ ID NO: 5 of the present invention, for example, a nucleotide sequence in the case of 80% or more, 90% or more, or 95% or more homology to the nucleotide sequence of the present invention can all be included.
본 발명의 상기 "상동성"이란, 염기서열과의 유사한 정도를 나타내기 위한 것으로서, 본 발명의 염기서열과 상기와 같은 퍼센트 이상의 동일한 서열을 가지는 서열을 포함한다. 이러한 상동성은 두 서열을 육안으로 비교하여 결정할 수도 있으나, 비교대상이 되는 서열을 나란히 배열하여 상동성 정도를 분석해 주는 생물정보 알고리즘(bioinformatic algorithm)을 사용하여 결정할 수 있다. 상기 두 개의 아미노산 서열 사이의 상동성은 백분율로 표시될 수 있다. 유용한 자동화된 알고리즘은 Wisconsin Genetics Software Package(Genetics Computer Group, Madison, W, USA)의 GAP, BESTFIT, FASTA와 TFASTA 컴퓨터 소프트웨어 모듈에서 이용 가능하다. 상기 모듈에서 자동화된 배열 알고리즘은 Needleman & Wunsch와 Pearson & Lipman과 Smith & Waterman 서열 배열 알고리즘을 포함한다. 다른 유용한 배열에 대한 알고리즘과 상동성 결정은 FASTP, BLAST, BLAST2, PSIBLAST와 CLUSTAL W를 포함하는 소프트웨어에서 자동화될 수 있다.The "homology" of the present invention is intended to indicate a degree of similarity to the nucleotide sequence, and includes a sequence having the same percentage or more as the nucleotide sequence of the present invention. Such homology can be determined by visually comparing two sequences, but can be determined using a bioinformatic algorithm that analyzes the degree of homology by arranging sequences to be compared side by side. The homology between the two amino acid sequences can be expressed as a percentage. Useful automated algorithms are available in the GAP, BESTFIT, FASTA and TFASTA computer software modules of the Wisconsin Genetics Software Package (Genetics Computer Group, Madison, W, USA). Automated sequencing algorithms in the module include Needleman & Wunsch and Pearson & Lipman and Smith & Waterman sequencing algorithms. Algorithms and homology determinations for other useful sequences can be automated in software including FASTP, BLAST, BLAST2, PSIBLAST and CLUSTAL W.
본 발명의 상기 압타머는 혈청 내 안정성을 증진시키거나 신장 클리어런스(renal clearance)를 조절하기 위하여, 5' 말단, 3' 말단, 중간 또는 양 말단 모두를 변형시킬 수 있다. 상기 변형은 5' 말단, 3' 말단, 그 중간 또는 양 말단에 PEG(polyethylene glycol), idT(inverted deoxythymidine), LNA(Locked Nucleic Acid), 2'-메톡시뉴클레오사이드, 2'-아미노뉴클레오사이드, 2'F-뉴클레오사이드, 아민 링커, 티올 링커, 및 콜레스테롤로 이루어진 군으로부터 선택되는 적어도 하나가 결합되어 변형된 것일 수 있다. The aptamer of the present invention may modify the 5' terminus, the 3' terminus, the middle or both termini in order to enhance serum stability or regulate renal clearance. The modifications include PEG (polyethylene glycol), idT (inverted deoxythymidine), LNA (Locked Nucleic Acid), 2'-methoxynucleoside, 2'-aminonucleo At least one selected from the group consisting of cleoside, 2'F-nucleoside, amine linker, thiol linker, and cholesterol may be bonded and modified.
본 발명의 상기 “idT(inverted deoxythymidine)”란, 일반적으로 뉴클레아제에 대한 내성이 약한 압타머의 뉴클레아제에 의한 분해를 막기 위하여 사용되는 분자 중 하나로서, 핵산 단위체는 앞 단위체의 3'-OH와 다음 단위체의 5'-0H와 결합하여 사슬을 이루지만 idT는 앞 단위체의 3'-OH에 다음 단위체의 3'-OH를 결합하여 3'-OH가 아닌 5'-OH가 노출이 되도록 인위적인 변화를 가함으로써 뉴클레아제의 일종인 3' 엑소뉴클레아제(3' exonuclease)에 의한 분해를 억제하는 효과를 일으키는 분자이다.The "idT (inverted deoxythymidine)" of the present invention is one of molecules used to prevent degradation by nucleases of aptamers, which generally have weak resistance to nucleases, and the nucleic acid unit is 3' of the preceding unit. -OH and 5'-0H of the next unit combine to form a chain, but idT bonds 3'-OH of the next unit to 3'-OH of the preceding unit, so that 5'-OH rather than 3'-OH is exposed It is a molecule that has the effect of inhibiting degradation by 3' exonuclease, a type of nuclease, by artificially changing it as much as possible.
본 발명의 다른 구현 예에서는 코로나19 바이러스 검출용 조성물을 제공한다.Another embodiment of the present invention provides a composition for detecting Corona 19 virus.
본 발명의 상기 검출용 조성물은 본 발명에 따른 상기 압타머를 포함한다.The composition for detection of the present invention includes the aptamer according to the present invention.
본 발명의 검출용 조성물에서, 압타머와 관련된 내용은 상기 압타머에 기재된 바와 동일하여 명세서의 과도한 복잡성을 피하기 위해 생략한다.In the composition for detection of the present invention, the content related to the aptamer is the same as described for the aptamer, and thus is omitted to avoid excessive complexity of the specification.
본 발명의 상기 조성물에 포함될 수 있는 적합한 담체, 부형제 및 희석제의 예로는 락토오스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 비정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유 등을 들 수 있다.Examples of suitable carriers, excipients and diluents that may be included in the composition of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate , cellulose, methyl cellulose, amorphous cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
본 발명의 또 다른 구현 예에서는 코로나19 바이러스 검출용 키트를 제공한다.Another embodiment of the present invention provides a kit for detecting COVID-19 virus.
본 발명의 상기 키트는 상기 검출용 조성물을 포함한다.The kit of the present invention includes the composition for detection.
본 발명의 상기 키트에서, 압타머 및 조성물에 관련된 내용은 상기 압타머 및 조성물에 기재된 바와 동일하여 명세서의 과도한 복잡성을 피하기 위해 생략한다.In the kit of the present invention, the contents related to the aptamer and the composition are the same as those described for the aptamer and the composition, and thus are omitted to avoid excessive complexity of the specification.
본 발명의 상기 키트는 본 발명에 따른 상기 압타머가 고정화되어 있는 기판을 포함하는, 예를 들면 어레이 형태일 수 있다. The kit of the present invention may be, for example, in the form of an array including a substrate on which the aptamer according to the present invention is immobilized.
본 발명의 상기 “어레이”는 복수 개의 특정 분자가 기판상의 일정 부분에 고정화되어 있는 것으로서, 상기 어레이는 기판 및 상기 기판에 형성된 압타머를 포함하는 고정화 영역을 포함할 수 있다. 상기 압타머는 상기 고정화 영역 내에 공유적으로 부착된 것일 수 있다. 상기 압타머는 공유적으로 부착시킬 수 있는 관능기를 갖는 복수의 화합물을 더 포함할 수 있다. 상기 관능기는 상기 압타머를 부착할 수 있도록 하는 것이라면 제한되지 아니하고 모두 사용될 수 있고, 예를 들면, 알데히드, 에폭시, 카르복시 또는 아민기가 될 수 있으며, 상기 화합물은 말단에 알데히드, 에폭시, 카르복시 또는 아민기를 갖는 실록산이 될 수 있으나, 이에 제한되는 것은 아니다. The "array" of the present invention refers to a plurality of specific molecules immobilized on a predetermined portion on a substrate, and the array may include a substrate and an immobilization region including an aptamer formed on the substrate. The aptamer may be covalently attached to the immobilization region. The aptamer may further include a plurality of compounds having a covalently attachable functional group. The functional group is not limited as long as it allows attachment of the aptamer, and any of them may be used, for example, may be an aldehyde, epoxy, carboxy or amine group, and the compound may have an aldehyde, epoxy, carboxy or amine group at the terminal. It may be a siloxane having, but is not limited thereto.
본 발명의 상기 기판의 재질은 예를 들면, 유리, 실리콘, 폴리프로필렌 및 폴리에틸렌과 같은 물질이 사용될 수 있으나, 이에 제한되는 것은 아니다.For the material of the substrate of the present invention, for example, glass, silicon, polypropylene, and polyethylene may be used, but is not limited thereto.
본 발명의 또 다른 구현 예에서는 코로나19 바이러스를 검출하는 방법을 제공한다.Another embodiment of the present invention provides a method for detecting the Corona 19 virus.
본 발명의 상기 방법은 본 발명의 상기 검출용 조성물과 목적하는 개체로부터 분리된 생물학적 시료를 배양하는 단계; 및 상기 검출용 조성물과 코로나19 바이러스의 핵 단백질의 결합 정도를 확인하는 단계;를 포함한다.The method of the present invention comprises the steps of culturing the detection composition of the present invention and a biological sample isolated from a target individual; and confirming the degree of binding between the composition for detection and the nuclear protein of the Corona 19 virus.
본 발명의 상기 검출용 조성물과 중증열성혈소판감수증후군 바이러스의 핵 단백질의 결합 정도가 정상 대조군에 비하여 높은 경우, 코로나19 바이러스에 감염된 것으로 확인하는 단계를 더 포함할 수 있다.When the binding degree of the composition for detection of the present invention and the nuclear protein of the severe fever with thrombocytopenic syndrome virus is higher than that of the normal control, the step of confirming that the virus is infected with the Corona 19 may be further included.
본 발명의 상기 검출하는 방법에서, 압타머 및 조성물에 관련된 내용은 상기 압타머 및 조성물에 기재된 바와 동일하여 명세서의 과도한 복잡성을 피하기 위해 생략한다.In the detecting method of the present invention, the contents related to the aptamer and the composition are the same as those described for the aptamer and the composition, and thus are omitted to avoid excessive complexity of the specification.
본 발명의 상기 생물학적 시료는 개체로부터 얻어지거나 개체로부터 유래된 임의의 물질, 생물학적 체액, 조직 또는 세포를 의미하는 것으로, 예를 들면, 전혈(whole blood), 백혈구(leukocytes), 말초혈액 단핵 세포(peripheral blood mononuclear cells), 백혈구 연층(buffy coat), 혈장(plasma) 및 혈청(serum)을 포함하는) 혈액, 객담(sputum), 눈물(tears), 점액(mucus), 세비액(nasal washes), 비강 흡인물(nasal aspirate), 호흡(breath), 소변(urine), 정액(semen), 침(saliva), 복강 세척액(peritoneal washings), 골반 내 유체액(pelvic fluids), 낭종액(cystic fluid), 뇌척수막 액(meningeal fluid), 양수(amniotic fluid), 선액(glandular fluid), 췌장액(pancreatic fluid), 림프액(lymph fluid), 흉수(pleural fluid), 유두 흡인물(nipple aspirate), 기관지 흡인물(bronchial aspirate), 활액(synovial fluid), 관절 흡인물(joint aspirate), 기관 분비물(organ secretions), 세포(cell), 세포 추출물(cell extract) 또는 뇌척수액(cerebrospinal fluid)을 포함할 수 있으나, 이에 제한되는 것은 아니다.The biological sample of the present invention refers to any material, biological fluid, tissue or cell obtained from or derived from an individual, for example, whole blood, leukocytes, peripheral blood mononuclear cells ( peripheral blood mononuclear cells, blood including buffy coat, plasma and serum), sputum, tears, mucus, nasal washes, nasal aspirate, breath, urine, semen, saliva, peritoneal washings, pelvic fluids, cystic fluid , meningeal fluid, amniotic fluid, glandular fluid, pancreatic fluid, lymph fluid, pleural fluid, nipple aspirate, bronchial aspirate ( bronchial aspirate, synovial fluid, joint aspirate, organ secretions, cells, cell extract or cerebrospinal fluid, but are limited thereto it is not going to be
본 발명의 압타머는 코로나19 바이러스 핵 단백질에 항체가 결합되는 부분 이외의 다른 부위에 결합되기 때문에, 샌드위치 형태의 바이오센서와 같은 다양한 분야에 적용 가능하다. 나아가, 이와 같은 압타머는 기존의 항체를 포함하는 제제와 비교하여 안정성 및 민감도가 매우 우수할 뿐만 아니라, 화학적 합성 방법으로 단시간에 적은 비용으로 대량 생산이 가능하고, 결합력을 높이기 위해 다양한 변형이 용이하다는 장점이 존재한다.Since the aptamer of the present invention binds to a site other than the portion to which the antibody is bound to the corona 19 virus nuclear protein, it is applicable to various fields such as a sandwich type biosensor. Furthermore, such an aptamer is not only superior in stability and sensitivity compared to a formulation containing an existing antibody, but also can be mass-produced in a short time and at low cost by a chemical synthesis method, and various modifications are easy to increase binding strength. Advantages exist.
도 1은 본 발명의 일 실시예에 따른 변형된 SELEX 방법의 각 단계의 모식도를 나타낸 것이다.
도 2는 본 발명의 일 실시예에 따른 변형된 SELEX 방법에 따라 선별된 압타머의 표적 결합력을 확인한 결과를 그래프로 나타낸 것이다.1 shows a schematic diagram of each step of the modified SELEX method according to an embodiment of the present invention.
2 is a graph showing the results of confirming the target binding force of the aptamer selected according to the modified SELEX method according to an embodiment of the present invention.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .
<준비예 1> 단일 가닥 DNA 압타머(ssDNA) 라이브러리 디자인<Preparation Example 1> Single-stranded DNA aptamer (ssDNA) library design
압타머의 선별 방법에서, 초기 라운드에서는 무작위로 40개의 염기 서열에 해당하는 핵심 서열을 포함하고 있는 ssDNA 올리고 뉴클레오티드 라이브러리(서열번호 2: 5'- ATC CAG AGT GAC GCA GCA [핵심서열; (N X 40)] TG GAC ACG GTG GCT TAG T -3')를 사용하였다. 본 연구에서 사용된 모든 올리고뉴클레오티드는 Integrated DNA Technologies Inc. (Coralville, IA, USA)로부터 구입하였다. 이때, 상기 ssDNA 라이브러리를 결합 완충액 (50 mM 트리스-염산, pH 7.4, 100 mM NaCl, 5 mM KCl, 1 mM MgCl2)에 넣고, 90℃에서 5 분간 가열함으로써 변성시킨 뒤, 0.01 % Tween 20으로 세척하고, 바로 얼음상에서 10분 동안 냉각시키는 과정을 수행한 뒤에 사용하였다.In the selection method for aptamers, in the initial round, an ssDNA oligonucleotide library (SEQ ID NO: 2: 5'- ATC CAG AGT GAC GCA GCA [core sequence; (NX 40) )] TG GAC ACG GTG GCT TAG T -3') was used. All oligonucleotides used in this study were obtained from Integrated DNA Technologies Inc. (Coralville, IA, USA). At this time, the ssDNA library was put in a binding buffer (50 mM Tris-hydrochloric acid, pH 7.4, 100 mM NaCl, 5 mM KCl, 1 mM MgCl 2 ), denatured by heating at 90° C. for 5 minutes, and then with 0.01% Tween 20 It was used after washing and cooling on ice for 10 minutes.
<준비예 2> 코로나19 바이러스 핵 단백질<Preparation Example 2> Corona 19 virus nuclear protein
코로나19 바이러스 핵 단백질(서열번호 1)은 Sino Biological(Cat.no: 40588-V08B)에서 구매하였다.Corona 19 virus nuclear protein (SEQ ID NO: 1) was purchased from Sino Biological (Cat.no: 40588-V08B).
[서열번호 1][SEQ ID NO: 1]
MSDNGPQNQR NAPRITFGGP SDSTGSNQNG ERSGARSKQR RPQGLPNNTA SWFTALTQHG KEDLKFPRGQ GVPINTNSSP DDQIGYYRRA TRRIRGGDGK MKDLSPRWYF YYLGTGPEAG LPYGANKDGI IWVATEGALN TPKDHIGTRN PANNAAIVLQ LPQGTTLPKG FYAEGSRGGS QASSRSSSRS RNSSRNSTPG SSRGTSPARM AGNGGDAALA LLLLDRLNQL ESKMSGKGQQ QQGQTVTKKS AAEASKKPRQ KRTATKAYNV TQAFGRRGPE QTQGNFGDQE LIRQGTDYKH WPQIAQFAPS ASAFFGMSRI GMEVTPSGTW LTYTGAIKLD DKDPNFKDQV ILLNKHIDAY KTFPPTEPKK DKKKKADETQ ALPQRQKKQQ TVTLLPAADL DDFSKQLQQS MSSADSTQAMSDNGPQNQR NAPRITFGGP SDSTGSNQNG ERSGARSKQR RPQGLPNNTA SWFTALTQHG KEDLKFPRGQ GVPINTNSSP DDQIGYYRRA TRRIRGGDGK MKDLSPRWYF YYLGTGPEAG LPYGANKDGI IWVATEGALN TPKDHIGTRN PANNAAIVLQ LPQGTTLPKG FYAEGSRGGS QASSRSSSRS RNSSRNSTPG SSRGTSPARM AGNGGDAALA LLLLDRLNQL ESKMSGKGQQ QQGQTVTKKS AAEASKKPRQ KRTATKAYNV TQAFGRRGPE QTQGNFGDQE LIRQGTDYKH WPQIAQFAPS ASAFFGMSRI GMEVTPSGTW LTYTGAIKLD DKDPNFKDQV ILLNKHIDAY KTFPPTEPKK DKKKKADETQ ALPQRQKKQQ TVTLLPAADL DDFSKQLQQS MSSADSTQA
<실시예 1> 압타머의 선별<Example 1> Selection of aptamers
(1) 압타머의 선별 방법의 각 단계(1) Each step of the aptamer screening method
도 1에 도시된 바와 같이, 본 발명의 압타머의 선별 방법을 수행하여, 코로나19 바이러스에 특이적으로 결합할 수 있는 압타머를 선별하였다. 구체적으로, 변형된 압타머의 선별 방법은 다음과 같다.As shown in FIG. 1 , the aptamer selection method of the present invention was performed to select an aptamer capable of specifically binding to the Corona 19 virus. Specifically, the selection method of the modified aptamer is as follows.
1) 항체 고정화 및 차단 단계 1) Antibody immobilization and blocking step
항체 고정화 단계: 상기 서열번호 1로 표시되는 아미노산 서열에 특이적으로 결합하는 항체를 pH 9.5, 0.1M 카르보네이트 완충액(carbonate buffer)에 희석한 뒤에 96웰 플레이트에 넣고 4℃에서 밤새도록 반응시켜, 상기 항체를 96웰 플레이트에 코팅시켰다. Antibody immobilization step: After diluting the antibody that specifically binds to the amino acid sequence shown in SEQ ID NO: 1 in pH 9.5, 0.1M carbonate buffer, put it in a 96-well plate and react at 4°C overnight , The antibody was coated in a 96-well plate.
차단 단계; 이후, 코팅된 플레이트에 200 ㎕의 세척 완충액(0.01%의 트윈(Tween)이 포함된 PBS(Potassium phosphate buffer)을 넣고 세척하였다. 상기 세척이 완료된 플레이트에 1% BSA(Bovine serum albumin)을 넣고 실온에서 1시간 동안 반응시킴으로써, ssDNA가 항체와 결합하여 나타날 수 있는 비 특이적인 결합 반응을 차단하였다. blocking step; Thereafter, 200 μl of washing buffer (PBS (Potassium phosphate buffer) containing 0.01% Tween) was added to the coated plate and washed. 1% BSA (Bovine serum albumin) was added to the washed plate, and then room temperature By reacting for 1 hour at , non-specific binding reactions that may occur when ssDNA binds to the antibody were blocked.
1-1) 회수 단계; 1-1) recovery step;
상기 1) 단계에서, 상기 서열번호 1로 표시되는 아미노산 서열 이외의 단백질과 ssDNA 간의 비특이적인 결합 가능성을 줄이기 위하여, 상기 ssDNA 라이브러리가 포함된 완충액을 상기 BSA를 이용하여 차단된 플레이트에 넣고 30분 동안 배양한 뒤, 항체와 결합되지 않은 ssDNA 라이브러리만이 포함된 상등액(이하, '상등액'이라 함)을 얻는 회수 단계를 추가적으로 수행하였다.In step 1), in order to reduce the possibility of non-specific binding between ssDNA and a protein other than the amino acid sequence shown in SEQ ID NO: 1, the buffer containing the ssDNA library is placed on a plate blocked using the BSA, and for 30 minutes After incubation, a recovery step was additionally performed to obtain a supernatant (hereinafter, referred to as 'supernatant') containing only the ssDNA library not bound to the antibody.
2) 제1 반응 단계; 항원-항체 반응 2) a first reaction step; antigen-antibody reaction
상기 1) 단계에서 항체 고정화 및 차단이 완료된 플레이트에 1 ㎍/mL의 농도로 PBS에 희석된 상기 실시예 1의 단백질 넣고 실온에서 2시간 동안 배양하였다.The protein of Example 1 diluted in PBS at a concentration of 1 μg/mL was added to the plate on which the antibody immobilization and blocking were completed in step 1), and incubated at room temperature for 2 hours.
3) 제2 반응 단계; ssDNA 라이브러리와 결합 단계 3) a second reaction step; ssDNA library and binding steps
상기 제1 반응 단계가 완료된 플레이트에 상기 1-1)의 상등액을 넣고 실온에서 1시간 동안 반응시킨 뒤에 200 ㎕의 세척 완충액을 이용하여 5회 세척하였다.The supernatant of 1-1) was added to the plate on which the first reaction step was completed, and after reacting at room temperature for 1 hour, it was washed 5 times using 200 μl of wash buffer.
4) 제1 용출 단계; ssDNA 용출 및 증폭 단계 4) a first elution step; ssDNA elution and amplification steps
상기 2) 단계에서 세척이 완료된 플레이트에 결합 완충액을 첨가하고, 80℃에서 10분 동안 반응시켜 상기 실시예 1의 단백질에 결합된 ssDNA를 용출시켰다.Binding buffer was added to the plate washed in step 2), and reacted at 80° C. for 10 minutes to elute the ssDNA bound to the protein of Example 1.
5) 증폭 단계; 제2-1 반응 단계; 및 제2 용출 단계 5) amplification step; 2-1 reaction step; and a second elution step.
상기 4) 제1 용출 단계의 상기 ssDNA 용출액을 PCR 정제 키트를 사용하여 제조사에서 제공하는 방법에 따라 정제한 뒤, 정제된 ssDNA를 30 ㎕의 멸균수에 용해시켰다. 상기 정제된 ssDNA에 1 μM의 프라이머쌍, 2.5 mM dNTP 혼합물 및 1.2 U의 Pfu 폴리머라제를 혼합하여 최종 볼륨이 50 ㎕가 되도록 한 뒤에 중합효소연쇄반응을 수행하여 증폭된 ssDNA를 수득하였다. 이때, 중합효소연쇄반응의 경우, 95℃에서 5분; 95℃에서 30초; 57℃에서 20초; 72℃에서 20초의 조건으로 25 사이클만큼 수행하였으며, 마지막 연장은 72℃에서 5분의 조건으로 수행하였다.4) The ssDNA eluate of the first elution step was purified using a PCR purification kit according to the method provided by the manufacturer, and then the purified ssDNA was dissolved in 30 μl of sterile water. The purified ssDNA was mixed with 1 μM of a primer pair, 2.5 mM dNTP mixture, and 1.2 U of Pfu polymerase to make a final volume of 50 μl, and then polymerase chain reaction was performed to obtain amplified ssDNA. At this time, in the case of polymerase chain reaction, 5 minutes at 95 ℃; 30 seconds at 95°C; 20 seconds at 57°C; 25 cycles were performed at 72° C. for 20 seconds, and the last extension was performed at 72° C. for 5 minutes.
그런 다음, 상기 증폭된 ssDNA를 상기 '3) 제2 반응 단계'와 동일한 방법으로 제2-1 반응 단계를 수행하고, 상기 '4) 제1 용출 단계'와 동일한 방법으로 제2 용출 단계를 수행하였으며, 상기 증폭 단계; 제2-1 반응 단계 및 제2 용출 단계는 최소 10번 이상 진행하였다. 이와 같은 과정을 통해 최종적으로 3개의 ssDNA 서열을 선별하였다.Then, the amplified ssDNA is subjected to reaction step 2-1 in the same manner as in '3) second reaction step', and a second elution step in the same manner as in '4) first elution step'. and the amplification step; The reaction step 2-1 and the second elution step were performed at least 10 times. Through this process, three ssDNA sequences were finally selected.
(2) ssDNA 서열 분석(2) ssDNA sequence analysis
상기 방법에 의하여 선별된 7종의 상기 ssDNA 서열을 상기 방법과 동일한 중합효소연쇄반응을 통해 증폭시킨 뒤, 증폭된 산물을 pETHis6 TEVLIC 클로닝 벡터(Addgene, 미국)에 각각 삽입하였다. 이후, 상기 벡터를 E. Coli DH5α에 형질전환시킨 뒤, 형질전환체로부터 증폭된 플라스미드를 분리하여 DNA 서열 분석을 수행하였다. 여기서, DNA 서열 분석을 마크로젠(한국)에서 수행하였으며, ssDNA인 압타머의 2차 구조를 Zuker 알고리즘에 기초한 Mfold 프로그램을 사용하여 예측하였다.The seven types of ssDNA sequences selected by the above method were amplified through the same polymerase chain reaction as in the above method, and then the amplified products were inserted into the pETHis6 TEVLIC cloning vector (Addgene, USA), respectively. Then, after transforming the vector into E. Coli DH5α, the amplified plasmid was isolated from the transformant and DNA sequence analysis was performed. Here, DNA sequence analysis was performed in Macrogen (Korea), and the secondary structure of the aptamer, which is ssDNA, was predicted using the Mfold program based on the Zuker algorithm.
그 결과 선별된 압타머는 서열번호 2의 5'- ATC CAG AGT GAC GCA GCA -[핵심 서열; (N X 40)]- TG GAC ACG GTG GCT TAG T -3'의 염기서열을 가지며, 핵심 서열은 하기 [표 1]에 기재된 것과 같았다.As a result, the selected aptamer is 5'-ATC CAG AGT GAC GCA GCA-[core sequence of SEQ ID NO: 2; (N X 40)]- TG GAC ACG GTG GCT TAG T -3' has the nucleotide sequence, and the core sequence is as described in [Table 1] below.
<< 실시예Example 2> 선별된 2> selected 압타머의aptamer 표적 결합력 확인 Confirmation of target avidity
Direct ELONA를 수행하여 상기 압타머와 표적 간의 결합력을 확인하였다. 96 웰 플레이트에 2 ug/mL (45 nM) 의 NP를 코팅한 후, 상기 실시예 1의 압타머의 5' 끝단에 biotin을 라벨링한 각 후보군들을 0 내지 1000 nM의 농도로 플레이트에 넣고 1시간 동안 실온에서 배양하였다. 이후, 1 ug/mL의 STA-HRP를 넣고 30분간 반응시킨 뒤 TMB substrate를 추가하여 20분 뒤 650 nm의 파장에서 흡광도를 측정하였다 (Cytation 5.0 Plate Reader, Biotek / Gen5 버전 2.09.1). y축의 흡광도 값은 농도가 증가되는 x축에 대해 플롯팅 한 뒤에 포화 원-사이트 (saturation one-site) 피팅 모델을 이용하여 해리 상수(Kd)를 측정하고, 그 결과를 [표 2] 및 도 2에 나타내었다.Direct ELONA was performed to confirm the binding force between the aptamer and the target. After coating 2 ug/mL (45 nM) of NP in a 96-well plate, each candidate group labeled with biotin at the 5' end of the aptamer of Example 1 was put on the plate at a concentration of 0 to 1000 nM, and 1 hour incubated at room temperature for After that, 1 ug/mL of STA-HRP was added and reacted for 30 minutes. After 20 minutes by adding a TMB substrate, absorbance was measured at a wavelength of 650 nm (Cytation 5.0 Plate Reader, Biotek / Gen5 version 2.09.1). After the absorbance value on the y-axis is plotted on the x-axis with increasing concentration, the dissociation constant (K d ) is measured using a saturation one-site fitting model, and the results are presented in [Table 2] and 2 is shown.
상기 결과를 통해 본 발명에 따라 선별된 압타머는 2.324 nM의 해리 상수를 나타내므로, 코로나19 바이러스 핵 단백질에 대하여 상기 압타머의 결합 친화도가 매우 우수한 것을 알 수 있다.From the above results, it can be seen that the aptamer selected according to the present invention exhibits a dissociation constant of 2.324 nM, so that the binding affinity of the aptamer to the corona 19 virus nuclear protein is very excellent.
<110> Gwangju Institute of Science and Technology <120> A DNA APTAMER SPECIFICALLY BIDING TO COVID-19 VIRUS AND USES THEREOF <130> GPn-0022 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 419 <212> PRT <213> Unknown <220> <223> COVID-19 VIRUS NP <400> 1 Met Ser Asp Asn Gly Pro Gln Asn Gln Arg Asn Ala Pro Arg Ile Thr 1 5 10 15 Phe Gly Gly Pro Ser Asp Ser Thr Gly Ser Asn Gln Asn Gly Glu Arg 20 25 30 Ser Gly Ala Arg Ser Lys Gln Arg Arg Pro Gln Gly Leu Pro Asn Asn 35 40 45 Thr Ala Ser Trp Phe Thr Ala Leu Thr Gln His Gly Lys Glu Asp Leu 50 55 60 Lys Phe Pro Arg Gly Gln Gly Val Pro Ile Asn Thr Asn Ser Ser Pro 65 70 75 80 Asp Asp Gln Ile Gly Tyr Tyr Arg Arg Ala Thr Arg Arg Ile Arg Gly 85 90 95 Gly Asp Gly Lys Met Lys Asp Leu Ser Pro Arg Trp Tyr Phe Tyr Tyr 100 105 110 Leu Gly Thr Gly Pro Glu Ala Gly Leu Pro Tyr Gly Ala Asn Lys Asp 115 120 125 Gly Ile Ile Trp Val Ala Thr Glu Gly Ala Leu Asn Thr Pro Lys Asp 130 135 140 His Ile Gly Thr Arg Asn Pro Ala Asn Asn Ala Ala Ile Val Leu Gln 145 150 155 160 Leu Pro Gln Gly Thr Thr Leu Pro Lys Gly Phe Tyr Ala Glu Gly Ser 165 170 175 Arg Gly Gly Ser Gln Ala Ser Ser Arg Ser Ser Ser Arg Ser Arg Asn 180 185 190 Ser Ser Arg Asn Ser Thr Pro Gly Ser Ser Arg Gly Thr Ser Pro Ala 195 200 205 Arg Met Ala Gly Asn Gly Gly Asp Ala Ala Leu Ala Leu Leu Leu Leu 210 215 220 Asp Arg Leu Asn Gln Leu Glu Ser Lys Met Ser Gly Lys Gly Gln Gln 225 230 235 240 Gln Gln Gly Gln Thr Val Thr Lys Lys Ser Ala Ala Glu Ala Ser Lys 245 250 255 Lys Pro Arg Gln Lys Arg Thr Ala Thr Lys Ala Tyr Asn Val Thr Gln 260 265 270 Ala Phe Gly Arg Arg Gly Pro Glu Gln Thr Gln Gly Asn Phe Gly Asp 275 280 285 Gln Glu Leu Ile Arg Gln Gly Thr Asp Tyr Lys His Trp Pro Gln Ile 290 295 300 Ala Gln Phe Ala Pro Ser Ala Ser Ala Phe Phe Gly Met Ser Arg Ile 305 310 315 320 Gly Met Glu Val Thr Pro Ser Gly Thr Trp Leu Thr Tyr Thr Gly Ala 325 330 335 Ile Lys Leu Asp Asp Lys Asp Pro Asn Phe Lys Asp Gln Val Ile Leu 340 345 350 Leu Asn Lys His Ile Asp Ala Tyr Lys Thr Phe Pro Pro Thr Glu Pro 355 360 365 Lys Lys Asp Lys Lys Lys Lys Ala Asp Glu Thr Gln Ala Leu Pro Gln 370 375 380 Arg Gln Lys Lys Gln Gln Thr Val Thr Leu Leu Pro Ala Ala Asp Leu 385 390 395 400 Asp Asp Phe Ser Lys Gln Leu Gln Gln Ser Met Ser Ser Ala Asp Ser 405 410 415 Thr Gln Ala <210> 2 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Nucleic acid construct) <220> <221> misc_feature <222> (19)..(58) <223> each n is A, T, U, G or C <400> 2 atccagagtg acgcagcann nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnntg 60 gacacggtgg cttagt 76 <210> 3 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> APTAMER CORE SEQUENCE <400> 3 aacccaagca aactacctct atacccttcg accttcatca 40 <210> 4 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> COVID-19 VIRUS NP APTAMER FULL SEQUENCE <400> 4 atccagagtg acgcagcaaa cccaagcaaa ctacctctat acccttcgac cttcatcatg 60 gacacggtgg cttagt 76 <110> Gwangju Institute of Science and Technology <120> A DNA APTAMER SPECIFICALLY BIDING TO COVID-19 VIRUS AND USES THEREOF <130> GPn-0022 <160> 4 <170> KoPatentIn 3.0 <210> 1 <211> 419 <212> PRT <213> Unknown <220> <223> COVID-19 VIRUS NP <400> 1 Met Ser Asp Asn Gly Pro Gln Asn Gln Arg Asn Ala Pro Arg Ile Thr 1 5 10 15 Phe Gly Gly Pro Ser Asp Ser Thr Gly Ser Asn Gln Asn Gly Glu Arg 20 25 30 Ser Gly Ala Arg Ser Lys Gln Arg Arg Pro Gln Gly Leu Pro Asn Asn 35 40 45 Thr Ala Ser Trp Phe Thr Ala Leu Thr Gln His Gly Lys Glu Asp Leu 50 55 60 Lys Phe Pro Arg Gly Gln Gly Val Pro Ile Asn Thr Asn Ser Ser Pro 65 70 75 80 Asp Asp Gln Ile Gly Tyr Tyr Arg Arg Ala Thr Arg Arg Ile Arg Gly 85 90 95 Gly Asp Gly Lys Met Lys Asp Leu Ser Pro Arg Trp Tyr Phe Tyr Tyr 100 105 110 Leu Gly Thr Gly Pro Glu Ala Gly Leu Pro Tyr Gly Ala Asn Lys Asp 115 120 125 Gly Ile Ile Trp Val Ala Thr Glu Gly Ala Leu Asn Thr Pro Lys Asp 130 135 140 His Ile Gly Thr Arg Asn Pro Ala Asn Asn Ala Ala Ile Val Leu Gln 145 150 155 160 Leu Pro Gln Gly Thr Thr Leu Pro Lys Gly Phe Tyr Ala Glu Gly Ser 165 170 175 Arg Gly Gly Ser Gln Ala Ser Ser Arg Ser Ser Ser Arg Ser Arg Asn 180 185 190 Ser Ser Arg Asn Ser Thr Pro Gly Ser Ser Arg Gly Thr Ser Pro Ala 195 200 205 Arg Met Ala Gly Asn Gly Gly Asp Ala Ala Leu Ala Leu Leu Leu Leu 210 215 220 Asp Arg Leu Asn Gln Leu Glu Ser Lys Met Ser Gly Lys Gly Gln Gln 225 230 235 240 Gln Gln Gly Gln Thr Val Thr Lys Lys Ser Ala Ala Glu Ala Ser Lys 245 250 255 Lys Pro Arg Gln Lys Arg Thr Ala Thr Lys Ala Tyr Asn Val Thr Gln 260 265 270 Ala Phe Gly Arg Arg Gly Pro Glu Gln Thr Gln Gly Asn Phe Gly Asp 275 280 285 Gln Glu Leu Ile Arg Gln Gly Thr Asp Tyr Lys His Trp Pro Gln Ile 290 295 300 Ala Gln Phe Ala Pro Ser Ala Ser Ala Phe Phe Gly Met Ser Arg Ile 305 310 315 320 Gly Met Glu Val Thr Pro Ser Gly Thr Trp Leu Thr Tyr Thr Gly Ala 325 330 335 Ile Lys Leu Asp Asp Lys Asp Pro Asn Phe Lys Asp Gln Val Ile Leu 340 345 350 Leu Asn Lys His Ile Asp Ala Tyr Lys Thr Phe Pro Pro Thr Glu Pro 355 360 365 Lys Lys Asp Lys Lys Lys Lys Ala Asp Glu Thr Gln Ala Leu Pro Gln 370 375 380 Arg Gln Lys Lys Gln Gln Thr Val Thr Leu Leu Pro Ala Ala Asp Leu 385 390 395 400 Asp Asp Phe Ser Lys Gln Leu Gln Gln Ser Met Ser Ser Ala Asp Ser 405 410 415 Thr Gln Ala <210> 2 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> Synthetic (Nucleic acid construct) <220> <221> misc_feature <222> (19)..(58) <223> each n is A, T, U, G or C <400> 2 atccagagtg acgcagcann nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnntg 60 gacacggtgg cttagt 76 <210> 3 <211> 40 <212> DNA <213> Artificial Sequence <220> <223> APTAMER CORE SEQUENCE <400> 3 aacccaagca aactacctct atacccttcg accttcatca 40 <210> 4 <211> 76 <212> DNA <213> Artificial Sequence <220> <223> COVID-19 VIRUS NP APTAMER FULL SEQUENCE <400> 4 atccagagtg acgcagcaaa cccaagcaaa ctacctctat acccttcgac cttcatcatg 60 gacacggtgg cttagt 76
Claims (8)
하기 서열번호 2의 염기서열로 이루어지며,
5＇-ATC CAG AGT GAC GCA GCA - [N]40 - TG GAC ACG GTG GCT TAG T- 3＇ (서열번호 2)
상기 N은 하기 서열번호 3으로 이루어진 압타머,
AACCCAAGCAAACTACCTCTATACCCTTCGACCTTCATCA (서열번호 3).
It specifically binds to the nuclear protein of the Corona 19 virus,
It consists of the nucleotide sequence of SEQ ID NO: 2,
5'-ATC CAG AGT GAC GCA GCA - [N] 40 - TG GAC ACG GTG GCT TAG T-3' (SEQ ID NO: 2)
Wherein N is an aptamer consisting of SEQ ID NO: 3,
AACCCAAGCAAACTACCTCTATACCCTTCGACCTTCATCA (SEQ ID NO: 3).
상기 코로나19 바이러스의 핵 단백질은 서열번호 1로 표시되는 아미노산 서열로 이루어진 압타머.
According to claim 1,
The nuclear protein of the Corona 19 virus is an aptamer consisting of the amino acid sequence represented by SEQ ID NO: 1.
상기 압타머의 3' 말단 또는 5' 말단에 검출 가능한 표지가 결합된 압타머.
According to claim 1,
An aptamer having a detectable label bound to the 3' end or 5' end of the aptamer.
상기 검출 가능한 표지는 광학적 표지, 전기화학적 표지, 방사성 동위원소로 구성된 군으로부터 선택되는 적어도 하나인 압타머.
4. The method of claim 3,
The detectable label is at least one selected from the group consisting of an optical label, an electrochemical label, and a radioactive isotope.
A composition for detecting Corona 19 virus comprising the aptamer of any one of claims 1 to 4.
A kit for detecting Corona 19 virus comprising the composition for detection of claim 5.
상기 검출용 조성물과 코로나19 바이러스의 핵 단백질의 결합 정도를 확인하는 단계;를 포함하는 코로나19 바이러스를 검출하는 방법.
culturing the composition for detection of claim 5 and a biological sample isolated from a target individual; and
Confirming the degree of binding of the composition for detection and the nuclear protein of the Corona 19 virus; Method for detecting Corona 19 virus comprising a.
상기 검출용 조성물과 코로나19 바이러스의 핵 단백질의 결합 정도가 정상 대조군에 비하여 높은 경우, 코로나19 바이러스에 감염된 것으로 확인하는 단계를 더 포함하는, 코로나19 바이러스를 검출하는 방법.8. The method of claim 7,
When the binding degree of the composition for detection and the nuclear protein of the Corona 19 virus is higher than that of the normal control, the method of detecting the Corona 19 virus further comprising the step of confirming that the composition is infected with the Corona 19 virus.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020200082319A KR20220004462A (en) | 2020-07-03 | 2020-07-03 | A dna aptamer specifically biding to covid-19 virus and uses thereof |
| PCT/KR2021/007417 WO2022005048A1 (en) | 2020-07-03 | 2021-06-14 | Dna aptamer specifically binding to covid-19 virus and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020200082319A KR20220004462A (en) | 2020-07-03 | 2020-07-03 | A dna aptamer specifically biding to covid-19 virus and uses thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| KR20220004462A true KR20220004462A (en) | 2022-01-11 |
Family
ID=79316494
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| KR1020200082319A KR20220004462A (en) | 2020-07-03 | 2020-07-03 | A dna aptamer specifically biding to covid-19 virus and uses thereof |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR20220004462A (en) |
| WO (1) | WO2022005048A1 (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114814215B (en) * | 2022-06-30 | 2022-10-18 | 中国科学院基础医学与肿瘤研究所(筹) | Pathogenic microorganism detection test paper strip based on aptamer latex particles |
| CN114807151B (en) * | 2022-06-30 | 2022-10-14 | 中国科学院基础医学与肿瘤研究所(筹) | Polynucleotide aptamer for detecting pathogenic microorganisms and combination thereof |
| CN115838728B (en) * | 2022-07-12 | 2023-10-03 | 中国科学院基础医学与肿瘤研究所(筹) | In vitro screening method for novel coronavirus full-length nucleocapsid protein DNA aptamer |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102113078B1 (en) | 2019-07-05 | 2020-05-20 | 광주과학기술원 | A screening method of aptamer |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101291737B1 (en) * | 2011-06-17 | 2013-07-31 | 국민대학교산학협력단 | Aptamer specific to Severe Acute Respiratory Syndrome (SARS)-Coronavirus nucleocapsid and pharmaceutical composition comprising the same |
| CA2895847C (en) * | 2012-12-19 | 2019-01-08 | Caris Science, Inc. | Compositions and methods for aptamer screening |
-
2020
- 2020-07-03 KR KR1020200082319A patent/KR20220004462A/en unknown
-
2021
- 2021-06-14 WO PCT/KR2021/007417 patent/WO2022005048A1/en active Application Filing
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR102113078B1 (en) | 2019-07-05 | 2020-05-20 | 광주과학기술원 | A screening method of aptamer |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2022005048A1 (en) | 2022-01-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2022005048A1 (en) | Dna aptamer specifically binding to covid-19 virus and use thereof | |
| CN111693712A (en) | Method for detecting new coronavirus SARS-CoV-2N protein by adopting aptamer | |
| US7595163B2 (en) | Method for detecting SARS coronavirus | |
| RU2663724C2 (en) | Methods for determining patient's susceptibility to nosocomial infection and predicting development of a septic syndrome | |
| US20230228751A1 (en) | Aptamers against sars-cov-2 | |
| KR101291737B1 (en) | Aptamer specific to Severe Acute Respiratory Syndrome (SARS)-Coronavirus nucleocapsid and pharmaceutical composition comprising the same | |
| KR102113078B1 (en) | A screening method of aptamer | |
| CN113718045A (en) | DNA fragment, primer, probe and kit for detecting 4 kinds of Bordetella pertussis and specifically detecting Bordetella pertussis and application | |
| US20090246754A1 (en) | Optimized probes and primers and methods of using same for the detection and quantitation of bk virus | |
| WO2021112559A1 (en) | Method for obtaining profile of target molecule population of sample | |
| KR101384178B1 (en) | Aptamer specific to influenza virus ns1 protein and pharmaceutical composition comprising the same | |
| KR102474286B1 (en) | A dna aptamer specifically biding to severe fever with thrombocytopenia syndrome virus and immunoassay using the aptamer | |
| US20220112499A1 (en) | Aptamers against imatinib | |
| US20220049258A1 (en) | Aptamer against irinotecan | |
| CN114317546B (en) | Aptamer for detecting EVD68 virus, kit and application | |
| WO2022265362A1 (en) | Method for acquiring profile of target protein molecule population of sample by using aptamer | |
| US20110014598A1 (en) | Optimized probes and primers and method of using same for the detection of herpes simplex virus | |
| US11732267B2 (en) | Nucleic acid aptamer for influenza virus and detection of influenza virus | |
| KR20220016769A (en) | Severe acute respiratory syndrome coronavirus 2 specific aptamer and use thereof | |
| KR20210131898A (en) | Method for detecting influenza virus using aptamer | |
| KR20230161067A (en) | Nucleic acid aptamer specifically binding to SARS-CoV-2 and uses thereof | |
| CN116829737A (en) | Methods of identifying subjects at increased risk of coronavirus infection and treatment thereof | |
| KR20220106500A (en) | 4 types of biomarker compositions for diagnosis of exacerbation of chronic obstructive pulmonary disease | |
| KR20220020461A (en) | A composition for diagnosing COVID-19 | |
| Mostafa et al. | Current Trends of SARS-CoV-2 and its New Variants Diagnostics in Different Body Fluids: Surface Antigen, Antibody, Nucleic Acid, and RNA Sequencing Detection Techniques |