JP2001516058A - Methods and compositions for dsRNA / dsRNA binding proteins - Google Patents

Abstract

(57) Abstract: A screening method for identifying a compound capable of disrupting the binding of a dsRNA-binding protein or protein complex to dsRNA is disclosed. Methods for treating viral infections using such compounds are also disclosed.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001] The present invention is disclosed on September 12, 1997, which is hereby incorporated by reference in its entirety.
Claim the benefit of U.S. Provisional Application No. 60 / 058,740, filed on Dec.

[0002] A portion of this work was funded by the Defense Advanced Research Projects Agency (grant number N65236-98-1-5400). Accordingly, the United States Government may have certain rights in the invention.

[0003] This application relates to screening methods for identifying compounds that can bind to duplex dsRNA and, in particular, disrupt the binding of a dsRNA binding protein or protein complex to dsRNA. The invention also relates to concatemer compositions of the compounds identified by such screening, and methods of using such compounds to treat disorders and diseases such as viral or viroid infections.

BACKGROUND OF THE INVENTION A number of approaches to regulating gene expression have been proposed and implemented, including regulation at the transcriptional level of DNA and regulation at the translation level of polypeptides. For example, an antisense molecule can target mRNA in an organism utilizing a DNA-specific mRNA synthesis intermediate.

While such antisense and protein-based techniques can be used to regulate gene expression in vitro, small organic molecules are generally considered more desirable for drug development. Such molecules are more likely to cross cell membranes and carry out biological responses in vivo. In addition, because each new mRNA and protein target has a unique folded structure, usually rather intensive drug development efforts require identifying drugs for specific sequences.

[0006] The regulation of gene expression has particular utility in the area of control of viral and viroid infections. Often they use components of the host cell's machinery for replication, but the genetic material of many viruses and viroids is different from that of the host cell and is therefore a possible target for therapeutic control .

For example, RNA viruses are distinguished by having single- or double-stranded RNA as their primary genomic material. However, during replication, an RNA virus must pass through a stage where double-stranded double-stranded RNA (duplex dsRNA) is formed. Duplex dsRNA can be distinguished from RNA found in the host by its content of a standard dsRNA having uninterrupted Watson-Crick base pairs, as discussed below. In addition, some RNA
Viruses (and DNA) have long, well-conserved stem-loop structures, where the stem is an uninterrupted dsRNA. In contrast, host organisms lack long stretches of double-stranded dsRNA; instead, they lack the deficiency of double-stranded RNA, such as that formed from self-folding of single-stranded transcribed RNA. It has only a very short stretch (generally less than about 6-10 base pairs) (Daudna, JA Nature 388: 830-831).
, 1997).

[0008] Interferons (IFNs) are a family of cytokines produced by vertebrate cells in response to viral infections and other cellular stresses. I
Binding of NF to the receptor on the surface of INF-responsive cells triggers a signaling cascade that results in the induction of more than 30 IFN-inducible proteins (Sen GC and Ranshoff RM , Adv.Viru
s Res. 42: 57-63, 1993; Jaramillo M .; L. Et al.,
Cancer Invest. , 13: 327-338, 1995). Interferon-induced proteins include dsRNA-activated protein kinases (
PKR). Activation of PKR by long dsRNA is a key component of the interferon-induced cellular immune response, which is the first line of defense against viral infection in animal hosts. Activation of PKR appears to inhibit viral protein synthesis. PKR appears to bind to dsRNA and eIF-
2. Phosphorylates the α subunit of the transcription factor. Phosphorylated eIF-2 is inactive and protein synthesis in virus-infected cells is shut down (Katze, MG Semin. Virol: 4: 259-26).
8, 1993).

[0009] There are several ways in which the virus neutralizes PKR activation by dsRNA. This demonstrates the ubiquitous presence of dsRNA in virus-infected cells, the characteristics observed for a wide variety of viruses, and the central role that PKR plays in the cellular response to virus injection.

[0010] For example, adenoviruses and Epstein-Barr virus produce RNA molecules, which are competitive inhibitors of the PKR-dsRNA binding reaction. Similarly, vaccinia virus protein K3L and hepatitis C virus protein NS5A act as pseudosubstrates to block PKR-dsRNA interactions. Influenza, vaccinia and reoviruses bind to dsRNA by N
Produces S1, E3L, and sigma3 proteins, respectively. Influenza virus also induces the production of the cellular protein p58, a natural inhibitor of PKR. Poliovirus infection results in PKR proteolysis. Some viruses have developed multiple mechanisms to disrupt PKR activation by dsRNA. For example, the HIV Tat protein reduces PKR expression. HI
VTAR RNA binding proteins bind to PKR and inhibit its kinase activity, and are competitive inhibitors of dsRNA binding (Gale, M .;
Et al., Pharmacol. Ther. 78: 29-46, 1998).

[0011] Undoubtedly, during the course of virus evolution, the virus recruits PKR by dsRNA.
Various effective mechanisms for disrupting the interferon-induced activation of E. coli have been developed. Because of these mechanisms, interferons are not very effective treatments for viral infections. However, interferons in the treatment of viral infections are broad-spectrum antiviral drugs because they recognize dsRNA, an essential feature of many viral replications. There is a need to develop a broad spectrum of drugs that can recognize long dsRNA and inhibit viral replication.

SUMMARY OF THE INVENTION [0012] The relative lack of a longer double-stranded dsRNA target region in a host cell
Compounds that target long stretches of DNA do not exert any mechanism-based toxicity in mammalian cells. Therefore, such compounds are candidates for useful therapeutic agents.

[0013] The present invention encompasses a duplex dsRNA: protein binding assay that is useful for screening libraries of synthetic or natural product compounds obtained chemically or biologically. The compound is a dsRNA to a dsRNA test sequence.
The binding proteins are tested for their ability to alter the binding independent of the base pair sequence. These compounds can inhibit or enhance the binding of dsRNA binding proteins to dsRNA. Using this assay, a new, more potent one or more that delivers a “warhead” that is then effective to modify the target duplex dsRNA and thereby inactivate the target duplex dsRNA Screen for compounds that can be used to construct multiple binding agents.
Such agents may thereby interfere with the replication of the dsRNA by disrupting strand separation and disrupting the binding of essential proteins to the RNA, or by inactivating the dsRNA.

[0014] Apart from replication intermediates, long dsRNAs can also be produced during the transcription of the genomes of several groups of RNA viruses, especially segmented and non-segmented negative-strand RNA viruses and ambisense RNA viruses (Roizman B. et al. & P
alese, P .; Multiplication of viruses: Overview.
Fields Virology, v1 Lippincott-Raven
publishers, Philadelphia, New York, 19
96, 101-111). M from negative strand virus RNA template
The production of RNA results in a long stretch of dsRNA. Thus, dsRNA present in cells infected with the negative strand and the ambisense RNA virus are also useful in the practice of the present invention.

[0015] Double-stranded binders selected using the methods of the present invention are particularly useful as therapeutics for viral and viroid infections. This is because these infectious agents utilize relatively long dsRNA molecules during their life cycle. The assays of the present invention are particularly useful for the discovery and development of small molecule drugs that recognize dsRNA and prevent RNA virus growth with minimal disruption of host cell function. However, the methods and compositions of the present invention are not limited to this purpose. Mammalian and other eukaryotic and prokaryotic cells also contain certain dsRNA regions that may also serve as targets for compounds discovered and constructed according to the present invention.

The present invention generally relates to dsRNA-binding proteins or ds-protein complexes.
The present invention relates to a method for screening and selecting a compound that affects binding independent of a base pair sequence to RNA. In one embodiment, the method involves screening for compounds that disrupt such binding. In a more general embodiment, the invention includes a method for screening for a compound that affects dsRNA function, such as a dsRNA segment involved in cell function. In yet another embodiment, the compounds identified according to the invention are useful for detecting infections in animals and other organisms. As described below, more specific embodiments of the present invention relate to the discovery and construction of compounds that target RNA viruses and viroids.

According to one embodiment of the present invention, the screening method comprises: (a) (i) dsR
Forming a reaction mixture comprising an NA binding protein or protein complex, and (ii) the binding protein can bind independently of the dsRNA base pair sequence; (b) in the presence and absence of the test compound Wherein the level of binding of the dsRNA binding protein to the dsRNA fragment is such that the difference between the binding observed in the presence of the compound and the binding observed in the absence of the compound is greater than or less than a selected value. And (c) altering the binding of the test compound if the level of binding detected is substantially different from the level in the control reaction mixture (in the absence of the test compound). And selecting to obtain. In a related embodiment, the method comprises a compound that selectively binds dsRNA, ie, single-stranded RNA (ssRNA), single-stranded DNA (ssDNA).
), And for identifying compounds that exhibit at least a 2-3 fold higher dsRNA binding affinity for double-stranded DNA (dsDNA).

[0018] In one embodiment, the concentration of the dsRNA binding protein or protein complex present in the assay is an amount sufficient to achieve at least 25% partial saturation, and at least 25% of the dsRNA in the reaction mixture. % Means complexed with the dsRNA binding protein in the absence of the test compound. Alternatively, the amount of RNA binding protein present is sufficient to achieve at least 50% or 75% partial saturation. Preferably, the concentration of the RNA binding protein is present in an amount sufficient to achieve at least 90% partial saturation. Preferably, the compounds of the invention bind to dsRNA in a sequence non-specific manner. Alternatively, the compound may bind to the dsRNA in a sequence-specific manner.

The method may further include testing the toxicity of any of the compounds selected above for mammalian cells as a further screen for useful therapeutic agents.

In a preferred embodiment, the dsRNA fragment used in the assay is about 10-100 base pairs in length, more preferably about 16-50 base pairs in length, and even more preferably 30-50 base pairs in length. Between base pairs. In still other preferred embodiments, the method is used to identify anti-viral compounds. According to this embodiment of the invention, the dsRNA binding protein used in this assay is an EsRNA binding protein.
Like viral origin, such as 3L or Sigma 3 protein. The dsRNA domain of such a protein can also be used. Such a protein (or a domain thereof) can be produced recombinantly by methods known in the art.

According to a further embodiment of the present invention, the dsRNA binding protein also comprises a PK
R, DRAF1, DRAF2, RNAase H, Z-DNA binding protein, L
a (SS-B), TRBP, and cellular proteins such as dsRNA-specific adenosine deaminase.

The level of binding in the assay is determined by directly measuring the formation of a binding complex (protein: dsRNA) or by phosphorylating one or more substrates in a cascade of reactions resulting from the dsRNA binding event. It can be detected by measuring downstream or incidental events. Examples of direct detection include (i) a gel band shift assay, (ii) a scintillation proximity assay, and (iii) a filter binding assay.

Examples of measuring downstream events include the dsRNA-dependent protein kinase cascade where, for example, autophosphorylation of an interferon-induced protein kinase called PKR, or eIF-2 and / or another phosphorylation Phosphorylation of a possible indicator protein occurs when a suitable reagent, including ATP, is present in the reaction mixture. Alternatively, the specific activity of the dsRNA binding protein is
Such activity can be measured when it stimulates or decreases in response to binding. An example of this is the protein kinase-mediated autophosphorylation of PKR or its substrate eIF-2, described above.

In a related embodiment, the invention includes a method of treating a subject or cell infected with an RNA virus. According to this aspect of the invention, a compound selected or formed according to the screening assays of the invention provides a subject with an ability to inhibit such a dsRNA binding protein to the dsRNA region present in the cells of the subject. It is administered in an effective amount. This method, in accordance with the format of the assay for selecting base pair sequence specific compounds discussed herein, in the genome of the virus,
A specific dsRN that the compound can target and for which the compound can be selected
Identifying the A base pair sequence may be included. However, such sequence specificity is not required. Because, in its more general form, the assays of the invention select compounds that recognize duplex dsRNA in a sequence non-specific manner. Here, without being bound to any particular mechanistic theory, the compound is a double-stranded ds
It is believed that it can recognize and bind to the RNA structure. Compounds selected on this basis are particularly useful in combating viral infections of unknown etiology and / or composition.

[0025] Another aspect of the invention includes a method of detecting the presence of a viral agent in a biological sample. A dsRNA binding compound identified by the methods disclosed herein can be used to determine whether a biological sample contains a viral agent. In this embodiment, a virus or viroid agent isolated from a biological sample is tested to determine whether the virus agent binds to a compound identified by these methods. Because these compounds can bind to dsRNA in a sequence independent manner, the presence of an unidentified viral agent in a biological sample can be determined.

Included in the present application is a partial list of viral and viroid pathogens with which the drug selected in this assay may be tested and used. In yet another embodiment, the compound undergoes a cytotoxicity test before it is tested for use in an organism such as a human.

The present invention further includes a method of screening for a compound that can specifically bind to a region of 3-16, 3-8, or more specifically, 3-5 base pairs in a duplex dsRNA. The method comprises the following steps: (a) (i) a test compound;
forming a reaction mixture comprising: i) a dsRNA binding protein or protein complex; and (iii) a double stranded dsRNA fragment containing a region to which the binding protein can bind in the absence of a test compound, wherein: The area is 3
Comprising at least one test sequence of from about 16 (or 3 to 8) base pairs; (b) detecting the level of binding of the dsRNA binding protein to the dsRNA fragment in the mixture; and (c) the mixture comprising: Selecting a test compound as capable of binding to a dsRNA sequence if it exhibits a binding protein binding level for the dsRNA in the mixture that is substantially lower than the level measured in the reaction mixture in the absence of the test compound. including.

In one embodiment, the assays described above may be performed to identify compound-specific binding to a sequence in a dsRNA. Here, the compound is preferably equimolar in a plurality of combinatorial 3-16 (or 3-3) incorporated into the fragment.
8) Added to double stranded dsRNA fragment containing base pair sequence. After binding, bound and unbound dsRNA are separated, for example, by a preparative band-shift mobility gel assay, and the sequence of the unbound dsRNA fragment can be amplified using amplification techniques (eg, PCR) as described herein. ) Is preferably used in an iterative format.

The compound identified by this method can be used to detect or treat a specific RNA virus containing the identified compound-specific sequence.

[0030] In a related aspect, the invention also includes a multimeric RNA binding agent that selectively binds to a dsRNA. Such an agent is a linear concatemer formed by covalently linking at least two dsRNA binding compounds, each of which is selected according to the assay of the present invention. Preferably, none of the compounds are oligonucleotides or peptides; however, they may be linked together by any suitable linker, including but not limited to polysaccharides, peptides or oligonucleotides. According to a preferred embodiment, the composition comprises a dsRNA modifier effective to modify or disrupt dsRNA function.

In still other related embodiments, the present invention provides a method for ranking the ability of a selected compound to bind double-stranded dsDNA, as described herein, as well as ds.
Diagnostic kits and / or compositions using RNA selection and identification methods.

[0032] These and other objects and features of the present invention will become more fully apparent when the following detailed description of the invention is read in conjunction with the accompanying drawings.

DETAILED DESCRIPTION OF THE INVENTION I. Definitions As used herein, the term "small molecule" generally refers to a molecule having a molecular weight of less than about 10,000, most usually less than 1,000. An organic or inorganic compound synthesized biologically or chemically. Small molecules are preferably permeable to cells and are usually not polypeptides or polynucleotides.

As used herein, “polypeptide” refers to a polymer of the twenty naturally occurring amino acids.

As used herein, “polynucleotide” refers to a polymer of five naturally occurring nucleotides: adenosine, cytosine, guanosine, thymidine, and uracil.

As used herein, “concatemer” refers to a small linear assembly that forms a multimeric small molecule. Concatemers useful in the present invention can include small molecules that are covalently linked via one or more polyamide bonds.

As used herein, “duplex dsRNA” refers to mismatches, loops, bumps,
A long stretch (at least 10 base pairs) of canonical dsRNA that exhibits all Watson-Crick base pairing along its length without internal base pairing or the like. Double stranded dsRNA is exemplified by the genomes of many dsRNA viruses. However, small molecule binding sites, whether non-sequence specific or sequence
It can range from -6 base pairs, 7-10 base pairs, or 10-20 base pairs.

“RNA modifier or moiety” refers to a compound that, when contacted with RNA, results in RNA cleavage, or otherwise modifies RNA or renders RNA non-functional. Examples include alkylating agents (eg, nitrogen mustard reagents), reaction-promoting cyclopropyl-functionalized polyheteroaromatic reagents, psoralens, Lewis acid metal chelate complexes, end-dynes, and activated polyvalent metallooxo complexes. But not limited thereto.

The term “contiguous” as used with reference to an area in a dsRNA molecule refers to a region that is separated by as few as zero, but no more than about 20 base pairs.

The term “duplex dsRNA base pair specific binding” refers to a compound that binds to a specific sequence of ribonucleotides in a dsRNA. In contrast, the term "duplex ds
"RNA base pair non-specific binding" and "duplex dsRNA structural binding" refer to RNA
Refers to binding to a duplex dsRNA that does not depend on the presence of a particular sequence within, but rather on the presence of a characteristic secondary or tertiary structure.

The term “duplex dsRNA selective binding” refers to a molecule that has a higher affinity (preferably at least about 2-3 times higher) than the binding of the molecule to either dsDNA, ssDNA, or ssRNA. Refers to the bond between double-stranded dsRNA.
Affinity measurements or approximations can be performed according to methods well known in the art and are exemplified in Example 3 herein.

As used herein, “linkage” generally refers to a protein or small molecule,
A non-covalent association with an NA molecule. Functional binding of a protein to a dsRNA is measured using one or more of a number of known binding assays, including, but not limited to, a gel mobility shift assay.

“On-rate” is defined herein as the amount of multimeric complex formed from a monomeric precursor in a given unit of time.

“Equilibration time” is defined herein as the time required for two molecules to reach a steady state of association and dissociation (eg, an RNA: protein complex).
.

“Off-rate” is defined herein as the amount of multimer complex that dissociates in a given unit of time.

“Dissociation” is the process of stopping two (or more) molecules from interacting or binding with each other: this process usually occurs under specific conditions and at a fixed average rate.

“Half-life” is defined herein as the time required for one-half of an associated complex (eg, an RNA: protein complex) to dissociate.

As used herein, “partially saturating amount” is defined as the concentration at which an RNA binding protein or protein complex binds to at least a certain defined percentage of available dsRNA. The concentration of RNA binding protein required to achieve 50% of the partial saturation, if the concentration of RNA is significantly lower than the value of K _d, a thermodynamic binding constant K _d. To achieve 90% partial saturation, the concentration required is at least 10 times higher than _Kd . Thus, for an RNA binding protein with a k _d of 1 × 10 ⁻⁹ M, to achieve 90% partial saturation, the amount of RNA binding protein required is at least 10 × 1
0 ^-9 M.

A “monomer subunit molecule (or compound)” is a small molecule that binds to a site on double-stranded RNA that spans about 3 to 16 base pairs. These may or may not show sequence-specific binding.

A “dimer molecule (or compound)” is a small molecule consisting of two monomeric subunit molecules chemically covalently linked. Such a molecule binds to a larger binding site than the monomer from which the dimer is made, and usually (but not necessarily) binds the dsRNA with higher affinity.

“Sequence-specific binding” refers to an RNA-binding molecule that exhibits strong RNA sequence preference for a particular base-pair sequence present in completely double-stranded RNA.

A “test sequence” is an RNA sequence that defines or enables RNA to bind to a protein at a cognate binding site. In the context of the present invention, the test sequence is preferably fully embedded within the test duplex dsRNA fragment.

The terms “polymerase chain reaction” and “PCR” refer to a process that amplifies one or more specific nucleic acid sequences. In this process, (i) the oligonucleotide primer that determines the end of the sequence to be amplified is annealed to the single-stranded nucleic acid in the test sample, and (ii) the nucleic acid polymerase is the 3 ′ end of the annealed primer. To create a nucleic acid strand complementary in sequence to the nucleic acid to which the primer has annealed, (iii) the resulting double-stranded nucleic acid is denatured to yield two single-stranded nucleic acids, and (iv) the primer The process of annealing, primer extension, and product denaturation is repeated a sufficient number of times to generate an easily identified and measured amount of sequence defined by the primer. The continuous annealing, extension, and denaturation steps are controlled (usually in a repetitive circulation mode) by varying the temperature of the reaction vessel. Annealing and extension are typically performed between 40 ° C. and 80 ° C., where denaturation is between about 80 ° C. and 100 ° C.
Requires temperatures between 0 and ° C. "Thermal cycler
ler) "(eg, Perkin Elmer Model 9600)
Typically used to control the reaction.

As used herein, the term “polynucleotide” is a polymer molecule having a backbone that supports nucleobases capable of hydrogen bonding to a representative polynucleotide, where the polymer backbone is a polymer A polymer molecule that exhibits bases in a manner that allows such hydrogen bonding in a sequence-specific manner between the molecule and a representative polynucleotide. Such bases are typically inosine, adenosine, guanosine, cytosine, uracil, and thymidine. Polymeric molecules include double- and single-stranded ribonucleic acids (RNA) and deoxyribonucleic acids (DNA),
And may include polymers having backbone modifications such as methylphosphonate linkages.

The term “vector” refers to a nucleotide sequence that can assimilate new nucleic acids and propagate these new sequences in a suitable host. Vectors include, but are not limited to, recombinant plasmids and viruses. Vectors (eg, plasmids or recombinant viruses) containing the nucleic acids of the invention can be carriers (eg, plasmids complexed with proteins, plasmids complexed with lipid-based nucleic acid transduction systems, or other non-viral Carrier system).

The term “polypeptide” as used herein refers to a compound composed of a single chain of naturally occurring 20 amino acid residues linked by peptide bonds. Amino acid residues are referred to herein by their standard one-letter code: A, alanine; C, cysteine; D, aspartic acid; E, glutamic acid; F, phenylalanine; G, glycine; Histidine; I, isoleucine; K, lysine; L
N, asparagine; P, proline; Q, glutamine; R, arginine; S, serine; T, threonine; V, valine; W, tryptophan; Y, tyrosine. As used herein, the term "protein" may be synonymous with the term "polypeptide" or may further refer to a complex of two or more polypeptides. In the context of the present invention, "protein conjugate" refers to a conjugate of proteins, or a protein bound to a single ribonucleotide fragment. The complex can be homomeric or heteromeric. Typically(
Although not necessarily, polypeptides and proteins are preferentially formed from naturally occurring amino acids.

Nucleic acid subunits are referred to herein by their standard base abbreviations; T, thymine; A, adenosine; C, cytosine; G, guanine; U, uracil; Referred to by the common IUPAC abbreviation: W, A or T / U
R, A or G; S, C or G; K: G or T / U (U.S. Patent Act §1.822).

“Base pair sequence-dependent binding” refers to the binding between a dsRNA-binding protein or protein complex and a dsRNA whose binding affinity is independent or substantially independent of the dsRNA sequence.

II. DsRNA: dsRNA Binding Protein Displacement Assay A. Overview of Assays The assays of the present invention use double-stranded RNA (dsRNA) and such dsRNA
The detection of compounds that can break the binding between the binding protein and the binding protein that specifically binds to. In this context, the term “specifically binds” means that such a binding protein preferentially binds to dsRNA as compared to ssRNA, ssDNA, dsDNA, or RNA / DNA hybrid binding. Means Assays are also applied to detect sequence-preferred and / or sequence-specific binding by compounds to particular RNA sequences within a dsRNA test binding nucleotide.

The assay can be used to detect compounds for various therapeutic uses. However, a major of these uses is in the identification of compounds for use as antiviral agents. Because the assay is particularly suitable for double-stranded dsRNA
(A double helix coil, dsRNA greater than about 30 nucleotides in length). That is, many invading viral pathogens contain long stretches of double-stranded RNA complementary during some or all of their life cycles, where most eukaryotic cells, including mammalian cells, It is known that single-stranded self-folding of transcribed RNA produces few stretches longer than a few base pair double-stranded sequence, lacking any deletions (ie, mismatches, bumps, and internal loops). is there. Thus, this assay is particularly useful for selecting antiviral agents that have minimal effect on the cellular machinery of the host cell.

To carry out the assay method of the invention, the test compound generally comprises a selected dsRNA-binding protein or a dsRNA-binding protein derived from a fragment of the dsRNA to which the binding protein binds or which alters the affinity of this binding interaction. Tested for the ability to alter the binding of the protein complex. The compound may inhibit or enhance the binding of the dsRNA binding protein or protein complex to the dsRNA fragment. The level of binding in the presence of the compound is compared to the level measured in the absence of the test compound, and if the level of binding in the presence of the compound is greater than a selected threshold (e.g., One-half or one-third).

[0062] These features of the invention are described in detail herein below and in Example 3. The following sections describe the design and selection of various components that form the basic assay mixture.

B. Components of the Assay The basic binding assay consists of (i) a dsRNA binding protein, (ii) a fragment of a dsRNA to which the binding protein binds in a base pair sequence independent manner, and
iii) test compounds. The reaction is monitored by differential levels of dsRNA binding protein binding in the absence and presence of the test compound.

1. dsRNA Binding Proteins Although a number of dsRNA binding proteins have been isolated and characterized from cellular and viral sources, investigations on these proteins have
A, known dsRNA binding protein, or more specifically, dsRNA
No binding sequence specificity of the binding protein domain (dsRBD) was shown. Furthermore, for at least one class of molecules typed by vaccinia virus E3L and PKR, the binding protein or domain may be somewhat small (even though less than about 10-20 bp), although the individual protein monomers may be somewhat small. Tend to form cooperative binding units, such that two or more protein subunits bind to the sequence of RNA with much higher affinity than any protein monomer or protein domain alone.

The experiments performed in support of the present invention are based on placing a sequence of interest (test sequence) within a defined dsRNA fragment using a single protein type, as described below. Demonstrated that virtually any RNA sequence could be assayed. Small molecules that specifically bind to a test sequence can be detected by a change in the binding characteristics of the protein to a dsRNA fragment containing the sequence, as compared to other dsRNA fragments containing the different test sequence.

In selecting a dsRNA binding protein for use in the present invention, relevant considerations include the following: (i) The protein is preferably ssRNA, dsDNA, or ssDN
A binding or binding to RNA / DNA hybrids, as opposed to ds
Specific for RNA binding.

(Ii) Depending on the assay format, the half-life of the dsRNA: protein complex should be short enough to accomplish the assay in a reasonable amount of time. Drug-mediated destruction of conjugates with very long dissociation times can be difficult to measure. Alternatively, or in addition, the assay may be performed in a "competitive" manner,
Here, competition for binding, rather than displacement of binding, is achieved by simultaneously exposing the test compound and the binding protein to the test dsRNA fragment, or by mixing the test and dsRNA molecules and adding the binding protein a short time later. Measured.

(Iii) The half-life of the complex should be long enough to allow measurement of unbound RNA in a reasonable amount of time. For example, the level of free RNA is
It is dictated by the ratio of the time required to measure NA to the amount of free RNA naturally present due to dissociation of the complex during the measurement time.

In view of the above two considerations, the half-life of practically useful RNA: proteins ranges from about 2 minutes to several days: shorter half-lives are faster or “real”. The "time" detection method can be adapted, and a longer half-life can be accommodated by destabilizing the binding conditions for the assay.

A. Viral dsRNA binding proteins Described in the art are a number of dsRNs from viral sources.
A-binding protein. However, the compounds selected to displace the binding of a particular dsRNA binding protein are not limited to the use of the binding protein against a pathogen source, but are more widely applicable as antiviral agents, and even as cell modulators. It is understood that this is possible.

By way of example, and not limitation, one dsR used in the assays of the invention
The NA binding protein is a vaccinia virus E3L dsRNA binding protein. Another dsRNA binding protein useful in the present invention is human PKR (
hPKR) and mouse PKR (mPKR). In experiments performed in support of the present invention, E3L, hPKR, mPKR, and Staufen dsRN
The A-binding domain was produced recombinantly and purified before use as a component in binding assays, as detailed in Example 1 (Example 2).

FIG. 1 shows a schematic of the cloning and construction of dsRNA binding fragments of E3L, hPKR, mPKR, and Staufen. Briefly, PCR fragments encoding the dsRNA binding domains of these proteins were obtained using forward and reverse PCR primers. The forward and reverse PCR primers were selected based on the known sequence of the open reading frame (ORF) and the location of the dsRNA binding domain within the ORF (eg, Ho, CK et al., Virology 217). : 272-284, 1996
). Restriction endonuclease sites (as shown in FIG. 1) were introduced into the primers to facilitate cloning of the PCR fragments. The PCR fragment was ligated with the vector as illustrated and provided expression under the control of an inducible promoter (eg, the tac promoter present in the pGEX-2T vector as shown). After transformation of a suitable host cell line, the dsRNA binding domain is expressed as a fusion protein, which is then used in Examples 2 and 6
Purified by standard methods as detailed in.

[0073] Many other suitable dsRNA binding proteins or fragments thereof from viral sources can be used in the assays of the invention. Virus ds
While it may be advantageous to utilize a dsRNA binding protein from a virus for use in selecting a therapy that is specifically targeted to disrupt RNA-dsRNA binding protein binding, this is not necessarily the case. Not necessary.

For example, the reovirus sigma 3 (σ3) protein has its C-terminal ds consisting of about 85 amino acids from about amino acids 233 to 305 of the 365 residue sequence.
Also shows the dsRNA binding activity present in the RNA binding domain (dsRBD),
It is the major outer capsid component of reovirus virions (Yue, Z. et al., J.
. Virology 70: 3497-3501, 1996). Sigma 3 has been demonstrated to have a stimulatory effect in vitro on the translation of late viral mRNA (Mabrook et al., Biochem. Cell Biol. 73: 137).
-145, 1995). The full-length sigma3 protein was prepared according to published methods (Yue, Z. et al., J. Virology 70, incorporated herein by reference:
3497-3501, 1996) and can be stably expressed in, for example, mammalian (HeLa) cell lines. Modifications of this procedure, as described above, can be used to generate dsRBDs derived from the C-terminal region, which can also be used in the assay methods of the invention.

Non-viral dsRNA binding proteins include, but are not limited to, the 140,000 dalton Z-DNA binding protein from chicken lung (Herbert et al., Nucleic Acids Symp. Se.
r. 33: 16-19, 1995); Saccharomyces cerev.
isaie RNase H1 N-terminal binding domain (Cerritelli,
S. M. , RNA 1: 3,246-259, 1995);
Therefore, La (SS) inhibits dsRNA-activated protein kinase (PKR).
-B) Autoimmune antigens (Xiao, Q. et al., Nucleic Acids Res.
earch, 22: 2512-2518, 1994); TRBP derived from HeLa cells that binds HIV-1 Rev response element RNA (Park, H. et al.
Proc. Natl. Acad. Sci. 91: 4713-7, 1994).
A dsRNA-specific adenosine deaminase derived from the human K88 clone (2
Two forms; one is interferon-inducible and the other is constitutive;
Terson et al., Mol. Cell. Biol. 15 (10): 5376-53
88, 1995); DRAF1 and DRAF2 involved in the transcriptional activation of interferon-stimulated genes in response to adenovirus or dsRNA (Dally,
C. Et al., Mol. Cell. Biol. 13 (6): 3756-3764, 19
93).

B. Test dsRNA Fragments For use in the assays of the present invention, dsRNA fragments are preferably small double stranded RNAs, preferably between about 10 and about 50 nucleotides in length. Is a molecule. The optimal length of a dsRNA fragment is largely determined by the dsRNA binding protein used in the assay. The experiments described below, performed in support of the present invention, provide guidance for optimizing the length of dsRNA fragments used in the assays of the present invention.

To detect sequence-preferred or sequence-specific binding of test compounds, dsRNA
Fragments can be constructed to include one or more variable defined base pair sequences.

[0078] dsRNA can be produced in a number of ways. For example, the complementary strands are individually chemically synthesized in a standard oligonucleotide synthesizer according to well-known methods,
It can then be mixed to effect annealing and form dsRNA. Alternatively, a second strand synthesis process using a primer complementary to the priming site at the 3 'end of the top strand of the test oligonucleotide can be used to generate the dsRNA. Such synthetic oligonucleotides are commonly used at a pre-screening stage to distinguish between sequence-specific and non-sequence-specific RNA binding molecules.

[0079] RNA molecules are also synthesized in an in vitro transcription system in which a hairpin oligoribonucleotide is a DNA template (ie, the linear sequence is
(Including the complement of the stem top strand, the loop sequence, and then the stem bottom). Using this type of strategy, it is possible to synthesize self-annealed dsRNA oligonucleotides, typically 3-8 bp in length, with specific internal test sites. For oligonucleotides with mixed base test sites, the partial hairpin sequence can be transcribed from a DNA template (ie, top strand stem, loop, and part of the bottom strand stem) to allow for annealing and use To prime the synthesis of the remaining stem structure.

Many dsRNA binding proteins contain a long, completely double-stranded RNA and a short dsRNA.
It has the ability to discriminate between RNA and RNA having a defect in its secondary structure.
For example, in experiments performed in support of the present invention, a 30-mer dsRNA was
It is required for efficient binding of the 3L dsRNA binding domain (dsRBD), while binding to shorter molecules (eg, 19-mers) is only detectable at very low, if any, levels. Found (FIG. 4).

Clearly, for hPKR binding to dsRNA, the protein
Binds to RNA in a coordinated manner. This is because the efficiency of binding increases with the size of the RNA. The single dsRNA binding domain of hPKR is
It occupies an approximately 11 base pair site on the dsRNA, equivalent to one turn of the A-form dsRNA. However, binding to such short dsRNAs can only be demonstrated at saturating protein concentrations. The reasonably good binding is the 16 mer dsR
There is a marked increase in binding affinity for RNAs of 22-24 base pairs in length that is observed for NA and can match the PKR dimer. A further increase in binding is observed with longer dsRNA. 30 base pairs gives stronger binding and the dsR
Minimal size for activation of PKR with NA (Manche L. et al.,
Mol. Cell. Biol. 12: 5238-5248, 1992; Schm
edt C.I. J. et al. Mol. Biol. 249: 29-44, 1995; Be.
viracqua P. et al. C. Et al., Biochemistry 35: 9983-
9994, 1996).

FIG. 2 shows the binding of vaccinia virus E3L dsRBD to a radiolabeled 30-mer duplex dsRNA fragment having the sequence of SEQ ID NO: 8 (5 ′ to 3 ′) according to the invention. Binding conditions are described in Example 3 herein, and binding is visualized by autoradiography on a 6% Retardation Gel. As shown, increasing amounts of E3L binding protein in the assay resulted in increased recruitment of the 30-mer dsRNA to the band with higher apparent molecular weight, corresponding to the 30-mer E3L complex at the top of the gel. Under the conditions used, approximate K _d for 4~7nM were calculated with the binding. In contrast, the E3L protein did not bind effectively to ssRNA ( ³² P-labeled 1B) or RNA / DNA hybrids even at concentrations as high as 400 nM (FIG. 3).

Further experiments show that the E3L protein has a minimum size of d for efficient binding.
sRNA fragment was shown to be required. FIG. 4 shows the length of dsRNA (
2 shows the formation of an E3L-dsRNA binding complex as a function of (shown at the top of the gel). From these experiments, it can be seen that the 30-mer E3L binding is about 50-100% greater than the 19-mer.
It was determined to be twice as efficient and the binding of the 22 and 26 mer was only slightly better than the 19 mer.

(C. Test Compounds) Although in theory any compound can be tested in the assays of the present invention, given the therapeutic potential of the compounds identified by this screening assay, some pharmaceutically considerations apply. Things to do can affect the choice of pool of molecules for use in screening. Generally preferred are small molecules having a molecular weight of less than about 10,000, most usually less than about 1,000. The compound is preferably
Neither polypeptides nor polynucleotides are permeable to cells and preferably are susceptible to degradation by endogenous cellular mechanisms. However, the concatemers of the present invention can be linked by amide bonds (peptide bonds). further,
Small molecules generally do not appear to elicit an immune response when injected into a vertebrate, especially a human subject.

Many pharmaceutical companies have large libraries of small molecule compounds, either separate or mixed, that can be screened in the assays of the present invention. A small molecule can be either a biologically or chemically synthesized organic or inorganic compound. A number of commercially available sources (Co
mgenex (Princeton, NJ), Microsource (New
Milford, CT), Brandon Associates (Merr)
imack, NH) and Aldrich (Milwaukee, WI). Libraries of natural compounds derived from plant or animal extracts are available, for example, from Pan Labs (Bothhe
II, WA) and MycoSearch (NC). Such libraries can also be systematically modified to produce known or readily identifiable derivative compounds for testing. In the context of the present invention, in an initial screen, the compounds selected by the screening methods described herein may be chemically modified and further enhanced for enhanced dsRNA binding activity or more desirable pharmacological properties. It is further understood that a choice may be made. Such selected chemically modified compounds will also be selected by the screening assays of the present invention.

C. Capture and Detection Systems 1. General Methods The binding between a dsRNA binding protein and a dsRNA fragment can be determined using any of a number of capture / detection methods known in the art. It can be quantified in a binding assay. One or both of the RNA binding protein or the test polynucleotide fragment is an indicator molecule (eg, a fluorescent dye, a radioisotope, and an enzyme)
Can be used, either directly or indirectly, according to methods well known in the art. In general, a number of suitable methods are described in Howard, G. et al., Which is incorporated herein by reference. C. Et al., Methods in Nonradiact
live Detection (Appleton & Lange, Norwa
lk, CT, 1993).

An exemplary detection system used in experiments performed in support of the present invention is a gel mobility shift (“band shift”, “gel shift”) assay, which method is described in detail in Example 3. Is done. Here, the dsRNA fragment is end-labeled with ³² P and the reaction product is subjected to gel electrophoresis under conditions designed to detect differences in apparent molecular weight. The gel is visualized by autoradiography, and the difference in band formation indicates a correspondingly higher apparent molecular weight.
Proven by the amount of sRNA. The gel was purchased from a commercially available gel scanner (or Sto
rm Phosphoimager, Molecular Devices, M
(Owtain View, CA).

[0088] Other capture and detection methods can include direct, indirect, or competitive formats, and
Affinity capture systems (eg, streptavidin / biotin binding or immunochemical reagents) can be used in which a label or tag for any of the above binding proteins and RNA fragments, or any of these components, is captured. Such assays are used to detect reduced drug induction, as well as increased binding between dsRNA fragments and dsRNA binding proteins present in the assay. The increase in binding
It may exhibit a drug-induced increase in affinity between the two molecules, indicating increased on-rate, decreased off-rate, or both. Drug compounds that exhibit this characteristic may also be useful in gene regulation or drug targeting situations.

One exemplary capture system utilizes a “biotin protection” system. In this case, the biotin molecule is linked to a base at the protein binding site in such a way that the binding of the protein is not broken and biotin is protected from streptavidin if the protein binds to the protein binding site. Displacement of the binding protein by the drug exposes biotin, which then binds to streptavidin. This type of assay is referred to as Scintillation Proximity Asa
Binding was quantified using the y (SPA, Amersham) format. In this case, the radiolabeled ( ³³ P) dsRNA molecule is converted to a scintillant
) Were captured by streptavidinated SPA beads impregnated with The proximity of the radioisotope (eg, ³ H, ³³ P) in the oligonucleotide to the beads causes the beads to scintillate. The signal is a valid DN
A test sequence giving a higher signal indicates the presence of an A-binding molecule; the relative preference for different sequences. This assay was used in a high-throughput screen to screen for dsRNA binding compounds (Examples 7 and 8). The direct nature of the assay allows one to screen a complex pool of sequences. This is because it is possible to see signals above the baseline.

A similar assay format can be set up such that other quenchable small molecule markers (eg, fluorescein) bind to the binding site.

[0091] Filter binding assays may also be applied for use in the present invention.
The setup and analysis of such assays is well known in the art.

Other suitable assays that can be used with the assays of the invention include, but are not limited to: • Indirect SPA capture assays using antibodies • Fluorescence polarization (anisotropic; Chekovich, W. et al. Et al., Nature 375:
254-256, 1995)-Multiplexed mass spectrosco
py) Enzyme-linked immunoassay (ELISA) RNA PCR identification (see below) This assay is also amenable to formatting on a biochip.
This greatly increases both the power and complexity of the sequences that can be examined.
This, as well as many of the methods listed above, can be used to apply the dsRNA binding assays of the invention for high throughput screening.

2. RNA PCR Amplification and Identification The assay described above uses an amplification method (in one embodiment, the polymerase chain reaction (
PCR); Mullis, K .; B. Et al., U.S. Pat. No. 4,683,202; Mu.
llis, K .; B. Et al., U.S. Pat. No. 4,683,195;
CR Protocols, a Guide to Methods and
Applications, Academic Press, Inc. (199
1)) can be coupled to achieve the identification of the most favorable RNA sequence for binding of the test molecule.

In this embodiment of the invention, a dsRNA test fragment containing the following elements is synthesized: (i) a binding site for a dsRNA binding protein (eg, E3L), ie, a screening site; At least one test sequence embedded within a screening site consisting of more base pairs, preferably less than 20 base pairs (most preferably 3 to 8 bases), and (iii) a sequence selected for amplification. Means for isolation (eg, a sufficient number of bases adjacent to the sequence of the test site to serve as a priming site for polymerase chain reaction amplification or a restriction site useful to facilitate cloning).

The priming site can also be used as a primer binding site for a dideoxy sequencing reaction and can include a restriction endonuclease cleavage site to facilitate the cloning operation.

One example of such a test oligonucleotide is shown in FIG. 7A as SEQ ID NO: 1.
You. This includes all possible substitutions of the 3-mer. This type of polynucleotide
Can be subdivided to provide a pooled assay. For example, in the binding sequence
Pooled assay formats that can be used with PCR elucidation are discussed below.
As all possible (4^Three= 64) Trimmer or (4^Four= 256) 4 base pairs
Sequences should be presented at equimolar levels within the pool of test dsRNA fragments
It is. From this example, for the 8 base test sequence, all possible base pair sequences (4 ⁸ = 65,536) is present in equimolar amounts in this assay.

For any single stranded test polynucleotide pool, the single stranded molecule anneals to the primer and the bottom strand is synthesized enzymatically by a primer extension reaction. One advantage of using the assay / amplification PCR cycling embodiment of the present invention is that in this embodiment it is convenient to work with larger test sequences. This protocol is particularly suitable for determining the maximum affinity binding sequence, but not for determining the rank of binding of all test sequences; As described above.

(3. d to determine binding in a mixed pool of test oligonucleotides)
Use of sRNA Binding Assay Using a double-stranded test RNA fragment, a basic assay is performed: typically without the use of a radioactive detection system, essentially as described below (Part D). This assay system can use any of a number of RNA: protein combinations.
One exemplary combination is the dsRNA binding domain (dRBD) of the E3L protein in combination with a dsRNA molecule, as described in Example 3.

In this embodiment of the invention, as described in Example 3, a pool of test oligonucleotides in the reaction mixture (eg, a test dsRNA polynucleotide fragment embedded with 256 four base pair test sequences, , This test sequence is expressed on an equimolar level within the above oligonucleotide pool).
Is added. Candidate compounds bind to the test sequence to form an E3L RNA
: Tested for the ability to differentially disrupt the binding of protein complexes. After addition of a test molecule (eg, a compound from a combinatorial library, fermentation broth or mold extract), the assay mixture is incubated for a desired time. The dsRNA binding protein complex is then separated from unbound dsRNA by any of a number of means known in the art. One convenient separation and characterization method is a preparative band-shift gel assay, in which dsRNA polynucleotide fragments are end-labeled by radioactivity, and the mixture is electrophoresed through a non-denaturing gel, which is then electrophoresed. , Protein bound and unbound ds
Autoradiography is performed to visualize the RNA fragments.
Alternatively, the assay mixture can be separated by chromatography, for example, HPLC.

In one embodiment of this assay, unbound dsRNA is amplified using polymerase chain reaction (PCR) technology. An aliquot of the resulting PCR amplified material is cycled again by the RNA: protein binding assay and then again PCR amplified to detect and identify sequences from which proteins are displaced during the binding assay. These isolation and reaction steps are repeated several times, each with the following filtrate. After each PCR amplification, a portion of the PCR amplified material is retained for sequencing analysis. The result of repeated cycling through the assay / amplification process is that the test oligonucleotide sequence to be amplified contains the test sequence, which is a preferred binding site for the test molecule. Throughout the next round of assay / amplification, these oligonucleotides gradually increased the percentage of amplified RN
Amplified to represent the total population of A molecules.

In summary, an augmented PCR strategy that is suitable in combination with the screening assays of the present invention is a “repeated format” that includes the following steps: Start with a synthetic pool of single-stranded RNA containing the sequence randomized drug test region sequence. 2. Single-stranded RNA is copied using RNA primers, NTPs, and RNA-dependent RNA polymerase activity to create double-stranded RNA. 3. The binding and selection assays of the invention are used to separate RNA: protein complexes from free RNA. This can be done by a native gel-mobility shift protocol. 4. The minimal detectable amount of protein-bound RNA (ie, end-labeled with a radioisotope) is replaced with the RNA-binding test compound (ie, by titration). 5. Amplify the drug-substituted RNA using PCR. The double-stranded DNA PCR product is sequenced to search for a consensus sequence at the test site. 6. A double-stranded DNA is transcribed and a pool is prepared for screening the selected single-stranded RNA. 7. If necessary, repeat steps 1 to 6 to obtain a substance sufficient for detection.

[0102] In addition to PCR, the unbound dsRNA fraction can be amplified by other methods as well. For example, the RNA present in the filtrate may be in a selected vector (eg, a phage vector (eg, based on λ), or a standard cloning vector (eg, based on pBR322- or pUC-)). To the corresponding DNA molecule that has been cloned. The cloned sequence is then transformed into an appropriate host organism (eg, a bacterium or yeast) in which the selected vector can replicate. The transformed host organism is cultured, and the vector containing the cloned sequence is simultaneously amplified. The vector was then constructed using standard procedures (Maniatis et al .; Sam).
Brook et al .; Ausbel et al.). Typically, the cloned sequence originally obtained from the RNA filtrate is obtained from the vector by restriction endonuclease digestion and size fractionation (eg, electrophoretic separation of digestion products,
Subsequent electroelution of the cloned sequence of interest) (Ausbel et al.). These isolated and amplified test oligonucleotide sequences can then be recycled through the next round of assay / amplification as described above.

In another embodiment, oligonucleotide sequences present in the original RNA filtrate can be isolated, sequenced, and amplified by in vitro synthesis of a copy of the oligonucleotide.

Sequencing of amplified DNA. Samples from each cycle are sequenced using an automated sequencer according to methods well known in the art, for example, using radiolabeled primers and dideoxy sequencing methods or standard chemical methods. If the amplified sequences are not sufficiently separated to obtain unambiguous sequence information, the resulting cDNA is further purified and sequenced.

[0105] An alternative embodiment eliminates the dsRNA amplification step. In this embodiment, the assay mixture comprises an oligonucleotide pool and a dsRNA binding protein. The test compound is incubated and then separated, for example, using HPLC. Commercial HPLC systems can provide very high separations. The HPLC fraction of the assay mixture can be analyzed by mass spectrometry. Fragmentation patterns obtained from mass spectrometry identify suitable binding sequences for the test compound.

4. Measuring Downstream Factor Modification Another way to assess binding is to determine the biological events that can be activated in a dsRNA when it is introduced into a eukaryotic host cell. Use cascade.
FIG. 8 shows a diagram of a dsRNA-activated protein kinase (PKR) cascade that is responsive to dsRNA in mammalian cells. As shown, upon binding to dsRNA, PKR undergoes autophosphorylation, where it can be present in the mixture or added to the mixture, as shown in the figure. -2
And / or phosphorylates other substrates, including other phosphorylatable indicator PKR protein substrates. Phosphorylation of eIF-2 results in reduced protein synthesis. Thus, interference with dsRNA binding to PKR, as shown, can be measured at many steps in the pathway if the reaction mixture also contains various components and reagents, such as ATP--shown in the figure. So, for example, PKR, e
Level of phosphorylation of IF-2 or indicator protein, or level of protein synthesis ---.

D. Assay Conditions 1. Basal Assay Conditions The claimed assay provides a method for identifying compounds that can disrupt the binding of a dsRNA binding protein or protein complex to dsRNA. Briefly, a test compound, as described above, is mixed with a dsRNA binding protein in the presence of a fragment of the dsRNA to which the dsRNA binding protein binds. d
The level of binding between the sRNA fragment and the binding protein is measured in the presence of the compound and compared to the level of binding in the absence of the compound. If the level of binding is substantially reduced in the presence of the agent, the test compound is a dsRNA: dsRN
It is believed that A-binding protein binding can be broken. Alternatively, this assay
By simply monitoring the reaction for increased levels of binding in the presence of the compound, it can be used to detect compounds that increase the binding of the dsRNA binding protein to dsRNA. In the context of the present invention, the term "substantially" or "significantly" as used in the context of binding level indicates that there is a statistically significant difference between the test and the reference binding level. Statistical significance can be measured by any of a variety of methods known in the art, as long as the method is appropriate for use in this assay format.

In experiments performed in support of the present invention and described in detail in Example 3, a 30-mer RNA polynucleotide was S ′ at ³² P using γ- ³² P ATP.
End-labeled. ^{The 32} P-labeled and unlabeled oligonucleotides were annealed to generate double-stranded 30-mer RNA. In a parallel experiment, the 30-mer RNA was annealed to a complementary DNA molecule to generate a double-stranded 30-mer RNA / DNA hybrid. For other experiments, 19-mer, 22-mer and 26-mer RNA duplex molecules were similarly generated.

Recombinant E3L protein (1-4) produced as described in Examples 1 and 2
00 nM) was added to the reaction mixture containing 0.2 nM RNA or RNA / DNA hybrid in the presence of the appropriate double-stranded RNA (or RNA / DNA hybrid) fragment. After a reaction time of 30 minutes at room temperature, the samples were loaded on a 6% retardation gel; the gel was processed and subjected to autoradiography. Detection of binding was monitored by recording and quantifying the location of radiolabeled RNA in the gel.

The results of experiments comparing the ability of E3L to bind double-stranded 30-mer RNA oligonucleotides are discussed above in comparison to the lack of binding to ssRNA or RNA / DNA hybrids. The advantage of E3L over ribonucleotides consisting of at least 30 base pairs is also described.

2. Compound Testing for Effect in Assay FIG. 5 (AD) shows a schematic diagram of the dsRNA binding assay. Where d
The sRNA binding protein is shown to bind the 30 mer. Here, it is understood that the structure shown as a binding protein can be a single protein or a protein complex composed of two or more protein subunits. FIG. 5B shows a schematic diagram in which a drug or test compound binds to a central portion of a 30-mer dsRNA molecule, thereby inhibiting the ability of the dsRNA-binding protein to bind to the 30-mer. According to one hypothesis (which should not be construed as limiting the invention in any way), the presence of a compound in the middle of a dsRNA produces the equivalent of two 15-mers. Since binding of the binding protein to smaller molecules was previously found to be significantly reduced (see FIG. 4), binding of this fragment or the depicted 10-mer fragment (FIG. 5C) Is correspondingly lower. FIG. 5D illustrates the situation where the drug binds near the end of the dsRNA fragment. This construct is generally considered undesirable in the context of the present assay. This is because binding to terminal regions may not be sufficient to measurably displace or break binding of the protein to the polynucleotide sequence.

In experiments performed in support of the present invention, ethidium bromide, a known intercalating agent, was added to a reaction mixture containing a 30-mer dsRNA oligonucleotide, incubated for 30 minutes, and then incubated with E3L. Was added and the reaction mixture was incubated for an additional 30 minutes at room temperature. Samples were analyzed by gel retardation experiments as described above.

FIGS. 6A and 6B show the results of these experiments. Ethidium bromide is 10
At concentrations above μM, binding of E3L to dsRNA could be prevented (FIG. 6A). If the gel also contained 3 μM ethidium bromide, the lower concentration (3.3 μM) was used.
M) was effective in reducing binding (FIG. 6B). These results suggest that the actual K _d is well below 3 μM. The results of this experiment were similar whether ethidium bromide was added to the reaction mixture before or after incubation with E3L. In addition to providing information on the binding properties of ethidium bromide, this experiment also serves as an exemplary example that can be used to assess binding affinity for dsRNA or other polynucleotides.

In another experiment described herein, the RNA binding protein, staufen (
(Staufen), E3L, mPKR, and hPKR were incubated with 30 polynucleotide long duplex dsRNA. FIG. 12 shows that all four proteins bound dsRNA with high affinity. hPKR bound with the highest affinity. Next, as shown in FIG. 14, known RNA-binding drugs were tested for their effect on hPKR binding to double-stranded dsRNA. When these drugs were tested, as expected, neomycin had the highest affinity for dsRN.
A.

This assay was then used to screen a biased library of new compounds to identify compounds that bind to dsRNA and displace hPKR. Of the 144 screened compounds, nine were able to bind to dsRNA and displace hPKR.

The experiments described above show that, according to the present invention, certain compounds may have a dsRNA binding protein d
The types of results obtained when they are found to prevent binding to sRNA are illustrated. It is understood that additional toxicity testing may be required for the compound to be a viable drug candidate. For example, the toxicity of a compound selected as described above can be achieved in a mammalian cell system, wherein the compound does not non-selectively bind to other forms of the polynucleotide endogenous to the host cell; Or else, in the absence of dsRNA, ensure that the metabolism of the cell is impaired.

3. Testing for Binding to Specific RNA Sequences All possible combinations for a specific binding site of a given length are theoretically combined in a single dsRNA polynucleotide with a defined sequence. It will be understood that the For example, 3-for nucleotide binding sites, 34 can be incorporated into the mer dsRNA sequences, 4 ³ = possible combinations of 64 are present (Figure 7A). An example of such a sequence is shown in FIG. 7A, where all possible 3-mers are shown on either the “+” or “−” strand. For the purposes of screening assays, the 34-mer sequence can be split between several oligonucleotides. For example, the oligonucleotide can be split almost evenly between two oligonucleotides, each having a unique set of 3-nucleotide binding sites. Lateral sequences are provided to ensure sufficient size for the dsRNA to bind. Figures 7F and 7G show two oligonucleotides with side sequences that together provide all 64 possible combinations for a 3-nucleotide binding site. The 7F oligonucleotide was biotin-labeled and used in a scintillation proximity assay. This 32-mer ring contains all 64 possible combinations of non-overlapping 3-mer sequences. The duplex oligonucleotide of FIG. 7A can be viewed as a 32-mer ring for ease of analysis.
When the duplex is viewed as a 32-mer ring, all 64 of the 3 nucleotides
Any two or more oligonucleotides that together provide a possible combination of can be identified.

Similarly, all possible 4 ⁴ = 256 4-nucleotide binding sites can be accommodated in eight oligonucleotides (FIG. 11). In another embodiment, FIG.
As shown in C, more than one binding site per oligonucleotide can be introduced. In this case, the 34-mer sequence can be split between more than two oligonucleotides. For example, a 34-mer sequence can be split between four nucleotides, each carrying two copies of about 25% of the 34-mer sequence (FIG. 7C).
The nucleotide sequence in one of the copies in each oligonucleotide can be rearranged to facilitate accurate annealing of the oligonucleotide strand. To conduct binding sequence specificity studies of this compound, the 34-mer sequence
It can be divided among more oligonucleotides, each carrying a single (FIG. 7D) or multiple (FIG. 7E) portion of the 34-nucleotide sequence.

The initial screening of compounds (preliminary screening) involves a number of binding sites (
For example, this can be done using oligonucleotides incorporating the polynucleotides shown in FIGS. 7B and 7C). Subsequent characterization of the sequence specificity of the compounds was performed using oligonucleotides similar to those shown in FIGS. 7D and E (designed as a subset of nucleotide binding sites that bind to a particular compound in a preliminary screening step). Done. Simultaneous RT-PCR studies can be performed to establish the identity of the binding site of the dsRNA sequence-specific compound.

III. DsRNA Binding Agents A. Small Concatemer dsRNA Binding Agents According to an important feature of the invention, the above screening assays can be used to identify: (i) against dsRNA Or a compound that binds with relatively high affinity (eg, K _d is greater than micromolar), thereby inhibiting binding of the binding protein to RNA, or A compound that binds or (iii) specifically binds to a dsRNA structure without sequence specificity. In accordance with the present invention, both sequence-specific and non-specific compounds can be used to form concatameric agents with enhanced specificity for dsRNA. That is, the agent may be formed from only sequence non-specific compounds, only sequence specific compounds, or a combination thereof. Both types of compounds can be identified using the screening assays described herein, and based on their characteristics, inventoryed such that a custom concatameric duplex dsRNA binder can be formed. obtain.

More specifically, in accordance with this aspect, the present invention describes and encompasses dsRNA binding agents that bind with dsRNA sequence specificity, as well as dsRNA binding agents that bind non-sequence-specifically. Can be understood. Such an agent is designed as follows using information from the binding assay. Target dsR
If an NA molecule is identified (by selection of a particular virus whose genome is known to be regulated by a dsRNA binding protein), the sequence of this RNA genome, or a portion thereof, can be identified. Using a library of compounds defined by screening in the assays described in the previous section,
Concatemers of one or more small dsRNA binding compounds are designed. One or more of the compounds may be selected for their ability to bind with sequence selectivity for a particular 3-16, or preferably 3-8 base pair sequence, which may also be found in the target genome. The second compound is selected to bind to a contiguous or nearby region (within about 20 bases) of the viral genome, and the second compound is coupled to a suitable ligation chemistry (polynucleotide, as described below). The first compound is linked to the first compound using a linkage including, but not limited to, the use of a linker, a peptide linker, a polysaccharide spacer, and the like.

Alternatively, in accordance with an important aspect of the invention, the concatemers may be formed from compounds that bind sequence-specifically to dsRNA. Such combinations are particularly useful in combating unknown etiologies and / or identifiable infectious agents. More preferably, the agent consists of a mixture of sequence-specific and sequence non-specific molecules.

The resulting agent is preferably a linear, non-oligonucleotide concatemer formed by the covalent bond of the first and second compounds. As described above, at least one compound in this concatemer has a target ds
One may choose to provide base specific binding to a 3-8 base pair region in the RNA. Other compounds selected to form a concatemer may exhibit sequence non-specific binding or sequence-specific (base-specific) binding.

As noted above, an advantage of using at least one concatemer subunit that exhibits sequence non-specific binding is that it may extend the range of organisms that can be targeted by the agent. Such broad-spectrum agents are particularly important in combating viral pathogens having unknown and / or highly mutated genomic sequences (eg, influenza viruses).

The advantages over this concatemer approach to producing antiviral agents reside in part in the following analyses. That is, any particular RNA binding small molecule screened in the assay may recognize only 2-4 base pair sites. Even though this recognition is very specific, the molecule can be toxic to host cells. This is because mammalian cells generally do not have long stretches of double-stranded RNA, but short stretches are present, for example, in the hairpin region of transfer RNA (tRNA). However, the potential toxicity of RNA binding drugs can be greatly reduced by making dimers, trimers or multimers with these compounds. This is because such concatameric agents bind to longer, possibly viral, regions.

In addition, from a theoretical consideration of the free energy change associated with the binding of the drug to the dsRNA, the intrinsic binding constant of the dimer should be the square of the binding constant of the monomer. The trimerization should theoretically result in a binding affinity that is the cube of the affinity of the homomonomer subunit or the product of the affinity of the heteromonomer subunit, but as high as 10 ^-12 M in DNA systems. (Laugaa et al., Biochemistry 23: 1336, 1985).

As a hypothetical example, if drug X, a relatively weak dsRNA binding drug, which binds to a 4 bp site with an affinity of 2 × 10 ⁻⁵ M, dimerizes, then Bis X drugs theoretically recognize an 8 bp site with an affinity of 4 × 10 ⁻¹⁰ M. The difference in affinity between monomer X and the bis X form is 200,000-fold.

There are two direct problems with dimerization (or multimerization) of moderately toxic monomeric drugs. First, the concentration of drug required is reduced due to the higher affinity, so that even relatively toxic molecules can be used as drugs. Secondly, toxicity depends on genomic and / or transcript or ribosomal RNA.
Longer dsR as it appears to be related to the average number of drug molecules bound to
Toxicity decreases as specificity for the NA domain increases with increasing binding site length. Nevertheless, it is preferred to test the compounds in a cytotoxicity assay before selecting them as possible therapeutics.

In this context, it is appropriate to point out that the screening method of the present invention creates a “bank” of compounds with a high likelihood of combination as a dsRNA binding agent. If 50-100 dsRNA binding monomer ligands are found,
This implies the possibility of binding 250-500 high affinity sites and 1000-2500 medium high affinity sites. Thus, the probability of finding a large number of high affinity drug binding sites that match medically important target sites is good. In addition, heterodimeric drugs may have RNs of 8 bp or more, depending on the specificity for the potential drug.
A Can be designed to fit a target site.

As described above, once the sequence preference of a large number of molecules is known, that information can be used to generate oligomer molecules or substantially higher sequence specificities and substantially higher binding affinities. Concatamers (homopolymers or heteropolymers) can be designed. For example, if the dsRNA binding molecule X binds to the 4 bp sequence 5′-ACGU-3 ′ / 5′-ACGU-3 ′ with an equilibrium affinity constant of 2 × 10 ⁻⁵ M, it is a dimer of X X ² is an equilibrium affinity constant of (2 × 10 ⁻⁵ M) ² = 4 × 10 ⁻¹⁰ M, and this sequence 5′-ACGUACGU-3 ′ / 5′-ACGU
Binds to ACGU-3 (SEQ ID NO: 2). The ds-linked dimer molecule X ₂ recognizes an 8 bp sequence, which confers higher sequence specificity, with a theoretically 200,000-fold higher binding affinity than RNA-binding monomer X.

The same argument can be extended to the trimer molecule: X ₃ , the trimer of X, has a theoretical equilibrium affinity constant of 8 × 10 ⁻¹⁵ M and a 12 bp sequence 5′-ACGUACGU
ACGU-3 '/ 5'-Binds to ACGUACGUACGU-3 (SEQ ID NO: 3). RNA binding polymers constructed using the above approach can be homopolymers or heteropolymers of the parent compound or oligomeric compounds consisting of mixed subunits of the parent compound. Homopolymers are molecules constructed using two or more subunits of the same monomeric RNA binding molecule. Heteropolymers are
A molecule constructed using two or more subunits of different monomeric RNA binding molecules. Oligomeric compounds are constructed from mixed pieces of the parent compound and can be heteromeric or homomeric.

The RNA binding subunits can be chemically linked to form a heteropolymer or a homopolymer. This subunit contains dystamycin.
cin) can be linked directly to each other as in a family of molecules, or their subunits can be linked using spacer-molecules (eg, carbon chains or peptide bonds). Subunit binding depends on the chemical nature of the subunit. Appropriate binding reactions can be determined for any two subunit molecules from the chemical literature. The choice of subunit is guided by the sequence to be targeted and is described in Section VI. Data is stored via the method described in Section B.

B. dsRNA-Modifying Reagents According to an important feature of the invention, for some applications, as described above, the binding agent binds to or is in close proximity to the dsRNA. In some cases, it may be desirable for the concatameric agent to have additional chemical reactivity that chemically alters the dsRNA (to all other molecules in the cell or tissue). Here, the dimer / multimer portion of the concatameric molecule directs binding to dsRNA as described above. The reactive portion of the molecule does not necessarily contribute to binding to RNA. This reactive moiety is preferably attached to a linear multimeric concatemer using a linker strategy similar to that for making dimers / multimers as described above. According to this embodiment of the invention, the irreversible chemical modification of the dsRNA is designed to effectively interfere with some important or essential functions of the dsRNA, and thus its normal function (
(Eg, viral replication).

There are a number of reactive chemistries that can be used to construct such molecules. Without excluding others, some preferred embodiments include: (1) a covalent modification (ie, a nitrogen mustard reagent or a pre-reactive chilopropyl-functionalized polyheteroester). Alkylation of guanine bases with aromatic reagents), (2) intrachain crosslinking (ie, with psoralen), (3) transesterification cleavage (ie, with Lewis acid metal chelate complexes), and (4) other activities Cleavage by species (ie, ene-diyne; activated polyvalent metal oxo complex). An advantage of molecules formed according to this aspect of the invention is that they provide enhanced functions or reactions than can be achieved by dimer / multimer alone binding.

IV. Utility The RNA: protein assays of the present invention were designed to screen for compounds that bind to a sufficient range of RNA sequences, varying in length and complexity. RNA binding molecules discovered by this assay have potential utility as either molecular reagents, therapeutics, or therapeutic precursors. Sequence specific or sequence non-specific dsRNA binding molecules are potentially powerful therapeutics for essentially any disease or condition involving dsRNA. Examples of test sequences for this assay include: a) binding sequences for factors involved in the maintenance or growth of infectious agents, especially viruses, bacteria, yeast and other fungi, b) specific viral genes And c) sequences involved in the replication of rapidly proliferating cells.

The molecules identified by this assay may be particularly valuable as lead compounds for the development of cognate species with either different specificities or different affinities.

One advantage of the present invention is that the assay may be directed toward binding activity directed against dsRNA in general (eg, compounds specific for dsRNA structure or non-specific for dsRNA sequences) or specific dsRNA sequences. Binding activity (d
sRNA sequence-specific compounds). One category of target sequences includes sequences present in medically or agriculturally important pathogens (viruses or viroids, respectively).

[0138] This assay also provides molecules that exhibit favorable sequence preferential binding to determine the sequence with the highest binding affinity and / or to determine the relative affinity between a number of different sequences. Can be used to screen for There is utility in taking any approach to detect and / or design new therapeutic agents.

A part forming the present invention is also a method of treating or preventing a viral or viroid infection. Such methods generally involve subjecting an infected or at-risk subject to screening, according to the screening methods described herein.
Administering a selected, dsRNA binding compound or concatemer formed from the compound. As mentioned above, many viruses, including unknown or mutated viruses of unknown genomic sequence, can be treated using these methods, but viruses or viroids with known ssRNA or dsRNA genomes are also useful. , Can be treated as described in the following sections.

A. Drugs (Factors): Target Organisms Compounds discovered using the assay methods described in connection with the present invention, and concatameric compounds constructed in accordance with the present invention, may be used for reasons described above. Particularly suitable for use in combating diseases having a viral etiology. There are few effective viral therapeutics currently available. In addition, with the accumulation of sequence data for all biological systems (including viral, cellular, and pathogen genomes (including bacteria, fungi, eukaryotic parasites, etc.), the number of target sites for dsRNA binding Will greatly increase in the future.

There are a number of methods for identifying medically relevant target sequences for dsRNA binding drugs, including but not limited to: First, medically important target sequences are found in pathogens of the living world, especially viral pathogens. Second, a target region of the pathogen is identified, for example, in the viral ssRNA or dsRNA sequence. Specific target sequences that affect the expression or activity of the genomic RNA molecule are identified (eg, sites involved in viral replication).

As mentioned above, RNA viruses are particularly susceptible to the antiviral methods and compositions described herein. Table I lists a number of potential target virulence factors. This includes human, animal and plant pathogens.

[0143]

[Table 1] B. Methods for Treating Viral Infections As described above, the compounds discovered according to the screening methods of the present invention include R
It is particularly useful in preventing and / or treating viral infections caused by NA viruses (viruses having ssRNA or dsRNA as genome).

In accordance with this aspect of the invention, the putative viral pathogen may or may not be tested to determine its genomic sequence. Compounds that are either specific (if determined) or non-specific (if not determined) to bind to a particular base pair sequence found in the genome are searched for and selected. Is done.

An important aspect of the present invention is a broad spectrum antiviral drug. Since long stretches of dsRNA occur only in virus-infected cells, dsRNA
Compounds that bind with base pair sequence non-specificity to are useful as broad spectrum antiviral agents.

Concatemers are formed from test dsRNA binding reagents, optionally with any combination of sequence-specific and / or sequence-nonspecific molecules. The compound binds to the 3-16 or 3-8 base pair region. In this context, the term "adjacent" means within about 20 base pairs of each other.

The concatemer is then formed from two binding molecule subunits.
After appropriate cell and animal toxicity testing, the compounds are formulated into appropriate pharmaceutical excipients and subjected to regulatory testing. Suitable excipients, doses and dosing schedules and embodiments will vary according to the type and size of the compound forming the concatemer. Such a determination is well within the skill of the art given the composition of the concatemer. The subject is then treated with a therapeutically effective amount of a concatemer (or a single binding agent).

All references and patents specifically cited in this application are herein incorporated by reference.
It is incorporated by reference in its entirety, and specifically as to the context in which they are cited.

The following examples illustrate the invention but are not intended to be limiting in any way.

EXAMPLES Example 1 Cloning and Expression of the dsRNA Binding Domain of E3L, Staufen, hPKR, mPKR A number of dsRNA binding proteins have been described in the literature (Burd C. et al.
G. FIG. Et al., Science 265: 615-621, 1994). Because different proteins can vary considerably in their activity, solubility, yield, stability, and other factors that affect the performance of the assay, we expressed some RNA binding proteins.

Vaccinia virus E3L, Drosophila melanogaste
r stauffen, and the human and mouse PKR proteins are dsRN
It has a similar domain that recognizes A. Articles disclosing the RNA binding domains of these proteins are described in St. Provided by Johnston et al. (St.
Johnston et al., Proc. Natl. Acad. Sci. USA 89:
10979-10983, 1992). The dsRNA binding domain (dsRBD) of these proteins is described in E. coli. E. coli expressed as a glutathione S-transferase (GST) fusion (FIG. 1) (Chang H.-W. and Jacobs BL., Virology 194: 537-547, 19).
Burd C. 93; And Dreyfuss G. , Science 265
: 615-621, 1995). DNA fragments encoding the dsRBD of these proteins were obtained by PCR. E3L dsRBD was prepared according to Example 2.
Vaccinia virus DNA was used as a template, as described in. Staufen dsRBD was obtained using dsRBD3 plasmid DNA containing staufen dsRBD as template (St. Jo).
hnston, D .; Proc. Natl. Acad. Sci. USA 89
: 10979-10983, 1992; St. Johnston, D .; Et Ce
11 66: 51-63, 1991). Human and mouse PKR dsRBD were obtained using human and mouse cDNA and the Advantage cDNA PCR kit. PCR was performed according to the manufacturer's instructions.

The following DNA oligonucleotides were used as primers in a PCR reaction. Underline restriction endonuclease sites:

[0153]

Embedded image pGEX-2T E.P. The PCR fragment was cloned using the E. coli plasmid expression vector. The vector is Schistosoma j
The glutathione-binding portion of aponicum glutathione S transferase (GST) is contained under the control of a strong chimeric tac promoter (Smith, D
. B. Et al., Gene 67: 31-40, 1998). PCR fragment to G
Cloning was performed in frame with the GST open reading frame instead of the ST portion, and dsRBD was expressed as a GST carboxy terminal fusion. For this purpose, the hPKR and mPKR PCR fragments were
I and EcoRV restriction endonucleases and BamHI / Sm
Cloned into the aI digestion vector. The Staufen PCR fragment was cut with BglII and EcoRI restriction nucleases and BAMHI
/ EcoRI digested into pGEX-2T vector. The cloning was performed using T4 DNA ligase as follows.

The plasmid and insert DNA were mixed at a ratio of 1:10 and mixed with T4 DNA ligase overnight at 10 ° C., 50 mM Tris-HCl pH 7.5, 7 mM
Ligation in MgCl ₂ , 1 mM DTT, 1 mM ATP, 1 μg DNA, and 50 U / ml enzyme. Using the ligation mixture, E. coli according to the manufacturer's instructions. coli (Epicurian Coli XL1-Blue supercompetent cells, Statagene, La Jolla, Calif.). Positive colonies were isolated on plates containing 100 μg / ml ampicillin,
The Wizard ™ miniprep DNA purification system (Promega, M
adison, WI). The purified plasmid is
The presence of the correct insert was checked using restriction endonuclease analysis.

DsRBD of E3L, staufen, hPKR, and mPKR proteins
Expressing E. E. coli strains were cultured essentially as described for strains having the pGEX-2T vector or derivative thereof (Smith and Jo).
hnson, Gene 67:31, 1988). E. FIG. overnight culture of E. coli strain in 600 ml LB medium containing 100 mkg / ml ampicillin:
10 and a controlled environment incubator shaker (New B
runr Scientific, Edison, NJ)
The cells were cultured at 30 to 33 ° C. while shaking at pm. Cells were purified from IPTG (isopropyl-β-thiogalactosidase; GibcoBRL, Gaithersburg).
g, MD) was grown for 1 hour before adding to a concentration of 0.2 mM and harvested after an additional 5 hours. Samples of cells were taken before and after introduction. Cells were centrifuged at 5000 rpm for 2 minutes in an Eppendorf microcentrifuge, resuspended in the initial volume of PBS, and centrifuged again under the same conditions. The cell pellet was washed with 1 × sample buffer (0.25 M Tris-HCl, pH
6.8, 20% Glycerol, 0.1% bromophenol blue, 2.
Resuspend in 5% β-mercaptoethanol, 5% SDS) and 100
Incubated at 5 ° C for 5 minutes. 6-20% Tris-Gly
Separated by SDS-PAGE on cine gel (Novex, San Diego, CA) according to the manufacturer's instructions. Bands corresponding to the 37 kD protein (GST-staufen and GST-E3L fusion protein (3
5 kD) was detected in the induced cells but not in the non-induced cells.

Similarly, bands corresponding to the 47 KD and 50 KD proteins were expressed in the induced E. coli. E. coli GST-mPKR and GST-hPKR were detected in whole cell lysates but not in lysates of uninduced cells.

GST-E3L, GST-stauf with respective duplex binding domains
en, GST-mPKR, and GST-hPKR fusion proteins
3L, staufen, mPKR, and hPKR.

Example 2 Purification of E3L, staufen, mPKR, and hPKR Cell cultures generated as described in Example 1 were pelleted and
Resuspended in a 1: 100 culture volume of becco PBS (GibcoBRL, Gaithersburg, MD). Cells are placed on Braun-Sonic 2 on ice.
Destroyed by sonication for 4 × 30 seconds at maximum output of low switch of 000 sonicators. Triton X-100 (Sigma, St. Louis, MO) was added to a 1% concentration and the lysate was added at 19,000 rpm at 5 ° C for 30 minutes.
For centrifugation in a JA-20 rotor. Some E3L and stuffe
The n protein was found in the supernatant and was named "PBS fraction". Most of the E3L and staufen proteins remained in the pellet. mPKR and hP
Both KRs are predominantly soluble and substantially all hPKR and mP
Most of the KR was found in the supernatant.

The E3L present in the pellet was replaced with 0.5M NaCl-40 mM Tris-H.
Recovered by extraction with Cl pH 7.5 for 1.5-2 hours at room temperature. The soluble and insoluble fractions were centrifuged at room temperature for 30 minutes at 19000 rpm
m in a JA-20 rotor. The E3L collected from the supernatant was added to “pH
7.5 fractions ". The pellet was washed with 0.5M NaCl-Tris-HC.
Further extraction at pH 8.0 was followed by centrifugation. The supernatant was washed with “pH 8.0
Fraction ". Further extraction of E3L protein from the pellet could be achieved at a more basic pH, for example, with 40 mM carbonate buffer (pH 9.5).

The E3L pH 7.5 and pH 8.0 fractions were diluted 1: 2 with water, and the diluted fractions and the PBS fraction were incubated for 1 hour at 4 ° C. with Glutathione S.
epharose 4B beads (Pharmacia Biotech, Swe
den) at 1/20 volume. Beads were added to buffer 20 of each fraction.
X 3 volumes and the E3L protein was eluted from the beads with 5 mM reduced glutathione-50 mM Tris-HCl, pH 8.0. E obtained in the eluate
The 3L protein was essentially pure. Fractions containing E3L protein were pooled and 100 volumes of 0.5 M NaCl-40 mM tris-HC
1, pH 8.0, 2 mM dithiothreitol
, 0.1% Triton-X-100, 20% glycerol. No difference in E3L dsRNA binding activity was detected in the fractions (
Data not shown). The resulting protein preparation was aliquoted and frozen at -80 <0> C.

The Staufen, mPKR, and hPKR supernatant fractions were incubated for 1 hour at 4 ° C.
/ 20 volumes of Glutathione Sepharose 4B beads (Ph
armacia Biotech, Sweden). The beads are washed three times with a 20 × volume of PBS buffer, and the protein is washed from the beads with 5 mM reduced glutathione-50 mM Tris-HCl, pH 8.0.
Eluted at 0.

The hPKR and mPKR proteins obtained in the eluate were essentially pure, as shown by polyacrylamide gel electrophoresis, and stau
fen was about 50% pure. pooling the fractions containing staufen,
And 100 volumes of 0.5 M NaCl, 40 mM tris-HCl, pH 8
. 0, 2 mM dithiothreitol, 0.1%
Dialysis was performed against Triton-X-100, 25% Glycerol. m
Fractions containing PKR or hPKR were combined with 100 volumes of 0.1 M NaCl,
0 mM tris-HCl, pH 8, 2 mM dithiothreitol (Dithithreitol)
threitol), 0.1% Triton X-100, 20% Glyc
Dialysis was performed against erol. Aliquot the resulting protein preparation to -8
Stored at 0 ° C.

Example 3 RNA Binding Assay E3L binds to double-stranded RNA but not to ssRNA or RNA / DNA hybrids (Kiong and Shuman, Virology)
217: 227, 1996; see FIG. 3). RNA oligonucleotides for E3L-RNA binding experiments were purchased from Cruchem Inc. Dulles
, VA.

[0164]

Embedded image A 30 mer DNA oligonucleotide 1TD having the same sequence as RNA oligonucleotide 1T was obtained from Keystone Laboratories, Inc.
. , Redwood City, CA. 1TD 5'GCTGGGGT
TCTTGCGGGTGGCTCGTGCTTTCG-3 ′ (SEQ ID NO: 10) Oligonucleotide 1B was converted to γ- ³² P ATP (Amersham, Arlington,
on Heights, IL) with T4 polynucleotide kinase (New E).
ngland Biolabs, Bexbury, MA) according to the manufacturer's instructions. ³² P-labeled 1B and unlabeled oligonucleotides 1T, 19T, 22T, or 26T were combined with 700 nM of ³² P-labeled 1B and 800 nM of unlabeled 1T, 1TD, 19T, 22T, or 26T, 15 mM.
Tris-HCl, pH 7.5, 400 mM NaCl, 2.5 mM EDT
Annealed in the reaction mixture containing A. The sample was cooled slowly from 70 ° C. to room temperature in 2 hours. Annealing of the 1T and 1B oligonucleotides produced a fully duplex 30-mer RNA. Annealing of the 1TD and 1B oligonucleotides generated a fully duplex 30-mer RNA / DNA hybrid. Annealing of 19T, 22T, and 26T with 1B results in RNA of 19, 22, and 26 base pairs of complete duplex RNA structure, and is further referred to as 19, 22, and 26 mer.

The binding of E3L to the oligonucleotide was determined by 0.2 nM RNA or RNA /
DNA hybrid, 50 mM Tris-HCl pH 8.0, 1 mM ED
The reaction was performed in a reaction mixture containing TA, 40 mM NaCl, 0.1% Triton X-100, 5% glycerol, 2 mM Dithiothreitol, and 1-400 nM E3L protein. The reaction was allowed to proceed for 30 minutes at room temperature, after which 70% glycerol was added to a 15% concentration and the sample was added to a 6% Retardation Gel.
s (Novex, San Diego, CA). The gel
Novex XCe filled with 0.5 × TBE buffer at 100 v for 0-45 minutes
It was run at ll ^TM Mini-Cell, dried using SGD-40 gel dryer (Savant Instruments, Inc., Far
Mingdale, N.M. Y. ). Run the gel overnight with Scientific Image
ng film (Eastman Kodak Co., NY).

E3L was able to bind to the duplex 30-mer RNA dsRNA fragment polynucleotide (SEQ ID NO: 6) with a Kd of about 4-12 nM (FIG. 2), whereas 40
Even high concentrations of 0 nM did not bind effectively to ssRNA ( ³² P-labeled 1B) or RNA / DNA hybrids (FIG. 3). Apart from the E3L binding of RNA being strictly duplex-structure specific, it also requires a minimum size dsRNA structure for efficient binding. The 30-mer E3L binding is about 5 more than the 19-mer.
0-100 fold more efficient, and the binding of the 22- and 26-mers is 19-
It was only slightly better than the mer (Figure 4).

Example 4 Testing of Compounds for Effect on dsRNA: dsRNA Binding Protein Binding Ethidium bromide was added to a reaction mixture containing a 30-mer dsRNA oligonucleotide as described in Example 2, Min, then E3L was added, and the reaction mixture was incubated for another 30 min at room temperature. Samples were analyzed as described above by gel retardation experiments. Ethidium bromide binds E3L to dsRNA at 10 μM
Could be inhibited at concentrations higher than (FIG. 6A). Even at a lower concentration of 3.3 μM, the gel was efficient when it contained ethidium bromide (FIG. 6B). This indicates that the actual K _d is well below 3 mM. The results of the experiment were similar regardless of whether ethidium bromide was added to the reaction mixture before or after incubation with E3L (data not shown).

Example 5 Preparation of dsRNA for Initial Gel-Based HTS Assay dsRNA Prepared Using Synthetic Oligonucleotides and Molecular Biology Techniques
Can be used in the assays described herein. Synthetic complementary ribooligonucleotides are preferably 15 to 30 bases in length and can be annealed to produce dsRNA for the experiment. Depending on the type of assay, the oligonucleotide may or may not be modified at certain positions with a biotin, chromophore, or quencher group. Synthetic oligonucleotides are generally used in a preliminary screening step to detect dsRNA binding molecules and to distinguish between sequence specific and sequence non-specific RNA binding molecules. RNA molecules are also synthesized in an in vitro transcription system where the hairpin oligoribonucleotide is
Synthesized from the NA template (ie, the linear sequence includes the top strand of the stem, the loop sequence, and then the bottom complement of the stem). Using this type of strategy, self-annealing d with a specific internal 4 bp test site
This allows the synthesis of sRNA oligonucleotides. For oligonucleotides with mixed base test sites, the partial hairpin sequence is transcribed from the DNA template (ie, top strand stem, loop, and part of the bottom strand stem) to allow annealing and synthesis of the remaining stem structure Used to prime. This strategy allows for the synthesis of mixed perfectly complementary test sequences, and also facilitates radiolabeling if required for the assay protocol used. Certain methods for providing the above synthetic paradigm are well known in the art (eg, Ausubel, FM, et al., Current Pro).
tocols in Molecular Biology, John Wil
eye & Sons, Media, PA).

Example 6 Scintillation Proximity Assay The Scintillation Proximity Assay (SPA) is a well-known assay (eg, US Pat. Nos. 4,382,074 and 4,271,139, herein incorporated by reference). Which is incorporated by reference)). In this assay, the spatial proximity of the radiolabeled atoms determines the scintillation of the coated beads, as shown in FIG. When a radioactive atom decays, it emits particles (eg, electrons) smaller than the atom. The distance these particles travel through water is limited and depends on the nature of the radioactive atoms. Radioactive atoms (eg, ³³ P)
When in close proximity to SPA beads containing scintillant, electrons can reach the beads and stimulate the scintillant to emit light. However, if the radioactive atom is away from the bead, the electrons will not reach the bead and will not emit light. Thus, radioactive molecules proximate the bead can be distinguished from molecules remote from the bead. SPA technology has been successfully applied to the analysis of enzyme catalysis, DNA-protein and protein-protein interactions, receptor binding, radioimmunoassay, uptake of compounds by cells and their metabolism, screening for DNA-binding drugs. . However, analysis of RNA-protein interactions or screening for dsDNA binding drugs (VIRIA SPA) is a novel application of SPA.

When streptavidin SPA beads are mixed with ³³ P-labeled biotinylated dsRNA oligonucleotide, biotin-streptavidin interaction results in binding of the oligonucleotide to the bead. Upon binding, the ³³ P atom is placed in close proximity to the bead, and the electrons generated during ³³ P decay reach the scintillant in the bead. This results in the emission of a photon, which can be measured using a scintillation counter. However, biotin-streptavidin interaction can be sterically prevented if the protein binds to the dsRNA oligonucleotide prior to incubation with its beads (biotin protected) (
(FIG. 9B). When a dsRNA drug capable of binding to a dsRNA is introduced into the reaction mixture, the drug containing the dsRNA and the dsRNA binding protein will have its dsRNA
The RNA binding protein is eliminated from the oligonucleotide. Biotin is then made available for interaction with streptavidin and photon emission is restored (FIG. 9C).

SPA can not only be used for the detection of dsRNA binding drugs, but also to what extent these drugs can be used in any other form of nucleic acid (eg, ssRNA, ssDN
A or dsDNA, RNA / DNA hybrids, nucleic acid hairpins, bulges, and nucleic acids of any form, structure, size, or conformation). Can be done.

[0172] In one embodiment, a cold nucleic competitor (eg, DNA) is introduced together with the ³³ P-labeled dsRNA in the reaction mixture. Introduction of DNA
If the dsRNA-binding drug does not bind to DNA, it does not affect the observed signal as compared to a control without DNA. A dsRNA binding protein (eg, E3L or PKR) does not bind to nucleic acids other than long dsRNA. However, the signal is reduced if the drug can bind to both RNA and DNA, especially if DNA is present in excess relative to RNA.

[0173] SPA can also be used to establish whether two or more drugs compete with the same or overlapping binding sites on dsRNA. Data on where the drug binds to the dsRNA can be obtained if at least one binding site for the competing drug is well established.

SPA beads are commercially available from Amersham Pharmacia Biotech and are constructed to bind specific molecules. Streptavidin-coated SPA beads capable of binding biotinylated RNA oligonucleotides are used in one embodiment. However, other types of SPA beads that can bind to dsRNA binding proteins, such as beads coated with an anti-GST antibody or Protein A, can also be used in different modifications of SPA. Binding of the RNA nucleotides to the beads is accomplished by binding the GST moiety (GST-coated S
PA beads) directly or GST or PKR specific antibodies (protein A
(Coated beads). Non-biotinylated RNA oligonucleotides can be used in these cases.

[0175] Biotinylated RNA oligonucleotides are commercially available from Cruchem. The oligonucleotide is preferably close to, but not limited to, 30 nucleotides in length. Longer and shorter RNAs can also be used. Any sequence of the oligonucleotide can be used to meet specific requirements. For example, for sequence specificity studies, all possible 3-nucleotide sequences can be split between two 34-mer dsRNA oligonucleotides (FIG. 7), and all four nucleotide sequences are 10 30-mer oligonucleotides (See FIG. 1)
1). During synthesis, one or more biotin moieties can be attached anywhere within the oligonucleotide via the dU moiety using spacers of various sizes. In a preferred embodiment, the biotin moiety binds to a spacer near the middle of the 30-mer nucleotide (eg, position 12) and hybridizes with the complementary oligonucleotide as shown in FIG. Complementary RNA oligonucleotides can be synthesized and hybridized to biotinylated oligonucleotides. Complementary oligonucleotide or biotinylated oligonucleotide or both,
γ ³³ P ATP (Amersham) and polynucleotide kinase (eg, T4 polynucleotide kinase, New England Biolabs)
Can be used prior to hybridization to end-label with ³³ P. Labeling is
It can be performed under well-known conditions.

DsRNA binding motifs (eg, Drosophila melanaga)
dsRNA-binding proteins with Ster Staufen, vaccinia virus E3L, and human or mouse PKR) can be used in this assay. The dsRNA-binding portions of these proteins were converted to Es as described in Example 1.
. In E. coli, it was expressed as a fusion with glutathione S-transferase (GST) (FIG. 1).

Biotin Protection Experiments To estimate the performance of E3L, staufen, mPKR, and hPKR in SPA, they were compared in biotin protection experiments. Upon binding of the dsRNA binding protein to the biotinylated dsRNA, R
The biotin of NA is predicted to sterically hinder the binding of the beads to streptavidin (biotin protection). This can be detected by a decrease in the signal emitted from the beads (FIG. 9B). Different proteins are expected to have different biotin protection activities and may show complete or incomplete protection at different protein concentrations.

A biotinylated ³³ P-labeled 30-mer dsRNA oligonucleotide was used in this experiment (FIG. 11). Top and bottom stranded RNA oligonucleotides were synthesized at Cruchem (Dulles, VA), one of which was biotinylated. T4 polynucleotide kinase, which mediates the transfer of ³³ P phosphate from ³³ PγATP to the 5 ′ end of the RNA oligonucleotide, catalyzes the ³³ P end labeling of the RNA oligonucleotide. ³³ PγATP was generated by Amersham.
T4 polynucleotide kinase is available from New England Biolabs (
Beverly, MA). Labeling was performed according to the manufacturer's instructions for T4 polynucleotide kinase. The top or bottom strand (or both) can be labeled with ³³ P, but typically only the biotinylated RNA oligonucleotide was labeled. Typically, 2 μl of 50,000 nM RNA
Oligonucleotides (Cruachem), 2.5 μl 10 × T4 polynucleotide kinase buffer (New England Biolabs), 15 μl
Γ ³³ P ATP (10 mCi / ml), 10 μl H ₂ O, and 3 μl T4 polynucleotide kinase (10,000 U / ml) were combined to a final volume of 50 μl. The reaction mixture was incubated at 37 ° C. for 30 minutes and 50 μl of 2
The reaction was stopped by adding 5 mM EDTA. G-25 according to manufacturer's instructions
The ³³ P-labeled oligonucleotide was purified from other components in the reaction mixture by gel filtration on a spin column (5 Prime-3 Prime, Boulder, CO). The complementary RNA oligonucleotide was prepared at a concentration of 400-500 nM using an annealing buffer (15 mM tris-HCl (pH 7.5), 40 mM
NaCl, 2.5 mM EDTA). 65-7
Heat to 0 ° C. and slowly cool to room temperature over 2-5 hours. The resulting ³³ P-labeled dsRNA oligonucleotide was diluted to a concentration of 2 nM, aliquoted, and stored at -80 ° C.

Reaction mixtures were prepared for biotin protection experiments. This mixture contains 0.25
nM ³³ P-labeled biotinylated dsRNA 30-mer oligonucleotide, 50 mM
tris-HCl (pH 8.0), 1 mM EDTA, 40 mM NaCl,
Included 0.1% Triton X-100, 5% glycerol, 2 mM dithiothreitol, and 0-280 nM dsRNA binding protein. The reaction was set up in a 96-well Wallac plate (200 μl / well). The reaction mixture was incubated at room temperature for 1.5 hours, after which 50 μg / well of S
Add treptavidin SPA PVT beads (Amersham),
The incubation was then continued for another 15 minutes. The plate was sealed and the beads were pelleted at the bottom of the well by centrifugation at 1000 g for 3 minutes. Counts were performed using a Wallac plate reader. hPKR was more active than other proteins in biotin protection experiments. Almost completely protected at 0.4-1.2 nM concentration. 0.7 nM for further screening experiments
The hPKR concentration was chosen. Other proteins are less active and for almost complete protection,
mPKR required a concentration of 10 nM and E3L required a concentration of 31-93 nM.
Staufen was found to be the least active of the proteins evaluated. This is because this protein was not enough for complete biotin protection even at 280 nM concentration (FIG. 12).

As shown in FIG. 12, all four DNA binding proteins could prevent the interaction of biotinylated dsRNA with streptavidin beads. hPKR had the highest affinity for dsRNA and was most effective at protecting biotin. At a concentration of 0.4 nM, hPKR is essentially all dsRN
A prevented it from interacting with the beads. Therefore, hPKR was used in high-throughput screening of candidate drugs as described in Example 7.

Next, it was demonstrated that a drug that binds to dsRNA was used to replace a drug that binds to dsRNA with an RNA-binding protein. As described above, this drug binding displaces the RNA binding protein and results in increased photon emission.

The following compounds were screened in this experiment: bekanamycin sulfate (
Sigma), ribidomycin A sulfate (Sigma), neomycin sulfate (S
igma), tobramycin (Fluka), gentamicin sulfate (Fluka)
), Netropsin (Sigma), 21x (dimer of Netropsin), ethidium bromide (Sigma), acridine orange (Sigma)
a), Distamycin A (Sigma).

Compounds were added to RNA binding buffer (RBB) (50 mM tris-HCl (pH
8.0) 1 mM EDTA, 40 mM NaCl, 0.1% Triton
X-100, 5% glycerol, 2 mM dithiothreitol). Compounds were added to the reaction mixture in a 96-well plate. The reaction mixture contains 0.2 nM ³³ P-labeled biotinylated dsRNA oligonucleotide in RBB and 0.6
It contained nM hPKR. Serial dilutions of the compounds were made. The resulting volume of the reaction mixture was 200 μl. The reaction was incubated at room temperature for 90 minutes. Then, 10 μl of streptavidin SPA beads in RBB (Amer
sham) was added to a final concentration of 50 μg / well and the incubation continued for a further 20 minutes. The plate was centrifuged at 700 rpm for 2.5 minutes to precipitate the beads, and the microbeta trilux (EG & G Wal
lac) Scintillation was counted from the bottom of the well using a counter.

The results obtained in SPA corresponded well with published (obtained by different methods) data on binding of compounds to dsRNA. Compounds known to bind strongly to dsRNA (eg, intercalators and neomycin) showed better binding in SPA than weaker dsRNA binders (
(FIG. 13). SPA is a reliable method that can detect even small differences in the binding of compounds to dsRNA. For example, (dsRNA-drug) versus (ds
RNA) As determined in melting experiments, there is a difference of less than 1 ° C. between the melting temperature caused by lividomycin (ΔTm = 15.2 ° C.) and the melting temperature caused by bekanamycin (ΔTm = 14.3 ° C.). is there. This means
Shows that libidomycin is a slightly stronger dsRNA binder than bekanamycin (Biochemistry 36: 11402-11407, 199).
7). Similarly, ribidomycin has a slightly higher affinity than bekanamycin, and as shown in FIG. 13, the drug neomycin (ΔTm = 24.7 ° C.)
It is the strongest binder shown by PA. As expected, the DNA binding molecules distamycin and netropsin showed the weakest binding in SPA.

Compounds that bind to both strands of dsDNA or dsRNA are expected to stabilize the DNA or RNA duplex by providing additional interaction between both strands. The stronger the compound binds to dsRNA or dsDNA, the higher the temperature required to melt the duplex. Thus, binding of a compound to a double-stranded nucleic acid is routinely measured by thermal denaturation (Wilson
W. D. Et al., Biochemistry 32: 4098-4104, 199.
3; McConnaughie A. W. J. et al. Med. Chem. 37: 1
063-1069, 1994; Chen Q. et al. Et al., Biochemistry
36: 11402-11407, 1997).

Example 7 High Throughput Screening of Combinatorial Libraries to Identify dsRNA Binding Compounds A library of compounds designed to bind double-stranded nucleic acids was designed and synthesized. To date, about 200 new compounds have been synthesized. These compounds were screened in gel band shift assays, SPA, and fluorescence / quenching assays. Twelve of the 144 compounds assayed to date bound dsRNA. Table 2 below summarizes the% R values for the 12 hits.

[0187] The strongest SPA hits were also positive in gel shift, with weaker SPA hits clearly below the sensitivity of gel shift. FIG.
Shows some of the data obtained by. The x-axis (% R) shows the relative counts obtained when the compound is present in the assay divided by the counts obtained when no compound is present. The% R value indicates the fold increase in photon emission when the compound is present. Therefore, a high value of% R indicates that the compound
Indicates that it is strongly replaced.

Screening of compounds in SPA was performed by placing compounds in DMSO at approximately 10 m.
The procedure was essentially as described in Example 6, except that it was dissolved at a concentration of M. 0.
2 μM concentration of ³³ P-labeled biotinylated dsRNA 30 mer and 0.7 nM concentration of h
Compound DMS was added to 200 μl reaction mixture at 0.05 mM concentration containing PKR.
O solution was added. Reaction mixtures in 96 wells were incubated and processed as described in Example 6. The results were processed using the Microsoft Excel program. Here, the% R parameter was calculated (FIG. 14).
). Compounds that produced a signal that was statistically greater than the background were considered "hits" (Figure 15). As shown in FIG. 14, 9 hits (from 8 to 170 hits)
% R). The% R values for all 12 hits were definitely above background. Even for the weakest hits in Series 1a with as low a% R, the T-test values were statistically significant: A
5-0.006, C10-0.0002.

[0189] These compounds were also screened for gel shift. Gel shift was performed essentially as described in Example 3, except that 0.7 nM concentration of hPKR was used instead of E3L. Screening was performed at two concentrations (1 mM
And 0.2 mM) of the compound. The three compounds B4, B5, and B6, the strongest hits in SPA, were also detected in gel shift.
Compounds B4 and B5 were comparable in activity to the potent dsRNA binding antibiotic neomacine. On the other hand, compound B6 was considerably weaker. Gel shift data is SPA
The data correlated well (even with SPA data, compound B6 was much weaker than compounds B4 and B5).

To investigate dsRNA structure, the specificity of binding of Series 1a compounds B4, B5 and B6 was also characterized by direct monitoring of binding to dsRNA and ssRNA. 1 mM of each compound was added to 0.2 nM dsN for 1 hour at room temperature.
Incubated with RA (24-mer) or ssRNA (30-mer).
The reaction mixture was loaded on a 6% RNA delay gel and Storm phosp
Processing was performed using hoimager. All three compounds are dsRN
A bound to the dsRNA as observed by the shift in mobility of A. Although there was no significant shift of ssRNA by B5 and B6, direct binding of compound B4 to ssRNA was observed. This indicates specificity for dsRNA.

[0191]

[Table 2] Example 8 Fluorescence / Quenching Assay Fluorescence resonance energy transition (FRET) to identify dsRNA binding compounds
) Based assays have been developed. FRET is a phenomenon in which a fluorescent photon is detectably transferred from one fluorescent molecule to another. In most FRET reactions, the first dye is excited with light of a given wavelength (excitation maximum). Light emitted from the first dye is typically efficiently transitioned to the second dye due to the significant overlap between the emission spectrum of the first dye and the excitation light spectrum of the second dye. . Second
Dyes absorb photons emitted from the first dye and emit lower energy fluorescent photons at longer wavelengths.

Another type of commonly used FRET pair is a donor / quencher dye pair. In this interaction, the transition energy from the first dye to the second dye is not emitted as a second light emission, but instead is thermally dissipated into the system. Thus, the close proximity of the "quenching" dye and the fluorescent dye causes a significant decrease in the fluorescence emitted by the system. Dabcyl
A sign that is becoming increasingly popular as a "universal" quenching part. This is because it effectively quenches the fluorescence of many different fluorophores.

Binding of a ligand to a double-stranded nucleic acid stabilizes DNA or RNA in double-stranded or helical form. In the past, DNA or R
Binding of almost all ligands to NA has been shown to cause an increase in Tm. (In very few known examples, ligands that bind to, and thus stabilize, single-stranded DNA were found.) In the early 1950's, salts were shown to increase the Tm of DNA. Since then, the binding of polyamines, small molecule drugs, peptides and proteins has all been shown to cause an increase in Tm upon binding to nucleic acids.

The FRET assay utilizes short, end-labeled, complementary “indicator oligonucleotides” that are single-stranded under standard assay conditions. Ligand binding drives the formation of a stable duplex structure in some of these indicator oligonucleotides. In the duplex conformation, the quenching dye dabsyl is placed in close proximity to the fluorescent dye (such as fluorescein) in these "indicator oligonucleotides", causing a sharp decrease in fluorescence.
Thus, binding of a ligand to that particular "indicator oligo" causes a decrease in fluorescence.

This assay is the subject of a co-pending application US Patent Application No. (assigned to its assignee). The application for this sharing (US Patent Application No.
No.) is incorporated herein by reference in its entirety.

This assay was used in combination with gel SPA and band shift assays to screen for biased chemical libraries. B to dsRNA
The specificity of the binding of 5 was confirmed in a fluorescence quenching competition assay. In the competition assay, unlabeled dsRNA or ssRNA was added at increasing concentrations to the assay mixture. If the drug can bind to any of these unlabeled oligos, F / QR
The quenching effect observed after binding of this drug to NA is reduced. A new assay format was tested using ribidomycin, which is known to bind specifically to dsRNA but not to dsDNA; dsRNA and dsDNA were used as competitors. Only dsRNA was able to return the fluorescent signal to its original level. This indicates that this assay format is a specific competition assay.

Next, to determine the priority of binding to different forms of nucleic acids, the B5
Fluorescence / quenching competition experiments were performed with the compounds. In these experiments, binding of B5 to fluorescein / dabsyl-labeled dsRNA was determined by dsDNA, ssRN
Competition with A and DNA / RNA hybrids was successful. For compound B5, it is shown that compound B5 binds preferentially to dsRNA. The following oligonucleotides were used in this assay: 24mer 24DB, 5'-d (TT
ATTCTGTCGTG CTGGTTTTATTC); 24mer 24DT, 5 '
-D (GAATAAACCAGCACGACAGAATAA); 24mer 24J
, 5'-r (GAAUAAACCAGCACGACAGAAUAA); 24-mer 24JB, 5'-r (UUAUUCUGUCGUGCUGUGUUUAUC);
14-mer Vir51, 5'-r (FCUAGAUCCUGAACUU) and 9-mer Vir55, 5'-r (CAGAUCUAGQ), F represents fluorescein and Q represents dabsyl.

The dsRNA (24J + 24JB), dsDNA (24DT + 24DB) and DNA / RNA hybrid (24JB + 24DT) were converted to 10 mM HEPES.
(PH 7.5) 100 μm in 1 mM EDTA and 10 mM NaCl
M final concentration of each oligonucleotide was mixed and the mixture was brought to 80 ° C. for 5 minutes.
Made by heating for 1 minute and slowly cooling to room temperature for 3 hours.

Direct monitoring of drug binding was performed by adding 25 nM Vir51 and 40 nM Vir55 to each drug to a total volume of 200 μl.
The concentration of the drug used is shown in the description in the figure. For competition experiments, the competitor nucleic acid dsRN
A, dsDNA, DNA / RNA hybrid, and ssRNA (24JB)
Was added to two different concentrations (0.5 μM and 1 μM) of the Vir51 / Vir55 mixture and immediately added to each concentration of drug, and the relative fluorescence was measured. All experiments were performed with 10 mM HEPES (pH 7.5), 1 mM E
Performed in a buffer solution containing DTA and 10 mM NaCl. Cytofluo
Measurements were made immediately after mixing using an r Fluorescence Reader, Multiwell Plate Reader Series 4000 (Perseptive Biosystems). The excitation light was 485 with a bandwidth of 20 and the emission was 530 with a bandwidth of 25 and a gain of 70. 10 μM B5, dsDNA
Only dsRNA, not sRNA or DNA / RNA hybrid, was able to return the signal quenched by B5 to its original level. This means that dsDNA, ss
FIG. 15 shows the preference of B5 binding to dsRNA over RNA and DNA / RNA hybrids (see FIGS. 15A-D). These results are consistent with those obtained in SPA and gel shift assays.

Although the invention has been described with respect to particular methods and embodiments, it is understood that various modifications and changes can be made without departing from the invention.

[Sequence list]

[Brief description of the drawings]

FIG. 1 shows the d of Staufen, E3L, mPKR, and hPKR proteins.
1 shows a schematic diagram of the cloning and construction of a plasmid vector for expression of the sRNA binding domain (dsRBD) as a fusion protein with GST.

FIG. 2 shows a computer generated image of an autoradiograph of a gel showing binding of E3L to radiolabeled 30-mer dsRNA.

FIGS. 3A and 3B show computer generated autoradiographs of gels showing the binding of E3L to dsRNA, ssRNA, and RNA / DNA hybrid molecules.

FIG. 4 shows E3L binding 19-, 22-, 26-, and 30-mer dsRNA fragments, where E3L was present at 67 nM, 12 nM, and 2 nM concentrations as indicated. 1 shows a computer generated image of an autoradiograph of a gel.

FIGS. 5A-5D show schematics of the binding of dsRNA binding proteins to dsRNA fragments.

FIGS. 6A-6B show planar gel (A) and 3.3 μM ethidium bromide (E).
Figure 5 shows computer generated images of autoradiographs of gels showing competition with EBr at various concentrations for E3L binding to dsRNA (30 mer) on gels containing (tBr).

FIGS. 7A-7G show various dsRs according to the invention, including a 34 mer showing all possible permutations of the trimer structure, such as SEQ ID NO: 1 (7A).
1 shows a schematic diagram of the NA construct.

FIG. 8 shows a schematic representation of the dsRNA-dependent protein kinase PKR cascade of cellular events.

FIG. 9 (A-C) shows streptavidin-SPA beads and biotin-labeled d
1 shows a schematic diagram of a scintillation proximity assay using sRNA.

FIG. 10 shows 10 oligonucleotides (30 mer) that together provide all 256 possible combinations of oligonucleotides 4 nucleotides in length. Ten oligomers were derived from one contiguous sequence containing 256 possible combinations.

FIG. 11 shows ³³ P end labeling, biotinylation, and annealing to an oligonucleotide complementary to one of the oligonucleotides shown in FIG.

FIG. 12 shows the results of a SPA biotin protection experiment using Staufen, E3L, mPKR, and hPKR as RNA binding proteins. These results are described in Example 6.

FIG. 13 shows the results of SPA using hPKR and the indicated RNA binding compounds. The results are described in Example 6.

FIG. 14 shows the results of screening new compounds from combinatorial chemical libraries. FIG. 14A shows 44 series 1a compounds (compounds A2-1).
2, B2 to 12, C2 to 12, and D2 to 12). FIG. 14B shows 54 series 1b compounds (compounds A2-12, B2-12
, C2-12, D2-12, and E2-11). The results are described in Example 7.

FIG. 15 shows a fluorescence / quench assay performed to determine whether compound B5 (Plate 1a) binds preferentially to the indicated polynucleotides as described in Example 8. The results are shown.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) G01N 33/50 G01N 33/68 33/68 A61K 37/02 (81) Designated country EP (AT, BE, CH) , CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN) , GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, SD, SZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, CU, CZ, DE, DK, EE, E , FI, GB, GE, GH, GM, HR, HU, ID, IL, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, UA, UG, UZ, VN , YU, ZW (72) Inventor Bruce, Thomas Wayne United States of America California 92009, Carlsbad, Shera Waters Drive 6880 (72) Inventor Edwards, Cynthia A. United States of America 94025, Menlo Park, Oakley Avenue 2021 (72) Inventor Fly, Kirk E. United States California 94303, Palo Alto, Ross Road 2604 (72) Inventor Thulin, Lisa M. A. The United States California 94065, Redwood City, Heisutin Holdings Shore Lane 250 F-term (reference) 2G045 AA35 BB10 BB14 BB20 BB50 BB51 DA13 DA14 FB01 FB02 FB03 FB09 GC15 4B063 QA01 QA13 QA18 QQ42 QQ52 QQ79 QQ91 QR33 QR62 QS02 QS25 4C084 AA17 CA62 ZB332 4H045 AA30 BA10 BA54 DA01 EA28 FA71

Claims (20)

[Claims] 1. A method for screening a small molecule capable of altering the binding of a dsRNA binding protein, protein complex or fragment thereof to a base pair independent of the base pair sequence to the dsRNA fragment, comprising: (a) (i) the dsRNA A binding protein or protein complex, and (i
i) a double-stranded dsR in which the binding protein binds independently of the dsRNA base pair sequence
Forming a reaction mixture containing the NA fragment; (b) binding a small molecule to the double-stranded dsRNA fragment; (c) in the presence and absence of the small molecule, the d of the dsRNA binding protein.
detecting the level of binding to the sRNA fragment; (d) comparing the binding observed in step (c); (e) binding observed in the presence of the small molecule and the absence of the small molecule. Selecting the small molecule if the difference from the binding observed below is greater than a selected value. 2. The small molecule is at least about 2-3 times higher in binding affinity of the small molecule to a polynucleotide selected from the group consisting of single-stranded RNA, single-stranded DNA, and double-stranded DNA. 2. The method of claim 1, wherein said method is selected when said small molecule binds with affinity to a dsRNA. 3. The method of claim 1, wherein the concentration of the RNA binding protein or protein complex is present in an amount effective to form a complex with at least 50% of the dsRNA in the absence of the small molecule. The described method. 4. The method of claim 1, wherein said double-stranded dsRNA fragment is between about 10-100 base pairs in length. 5. The method of claim 4, wherein said double-stranded dsRNA fragment is between about 16 and 50 base pairs in length. 6. The method of claim 5, wherein said double-stranded dsRNA fragment is between about 30 and 50 base pairs in length. 7. The method of claim 1, wherein said double-stranded dsRNA binding protein is a viral replication intermediate, for use in identifying candidate antiviral small molecules. 8. The method of claim 1, wherein said double-stranded dsRNA fragment is a stem / loop stem. 9. The method according to claim 9, wherein the double-stranded dsRNA-binding protein is PKR, DRAF.
1, DRAF2, RNAase H, Z-DNA binding protein, La (SS-B
2.) The method of claim 1, wherein the cell protein is selected from the group consisting of: a), TRBP, and dsRNA-specific adenosine deaminase. 10. The method of claim 9, wherein said binding protein is PKR. 11. The ds of the RNA binding protein or protein complex
2. The method of claim 1, wherein binding to RNA is detected by a gel band shift assay. 12. The ds of the RNA binding protein or protein complex
2. The binding to RNA is detected by a scintillation proximity assay.
The method described in. 13. The ds of the RNA binding protein or protein complex
2. The method of claim 1, wherein binding to RNA is detected by a filter binding assay. 14. The method of claim 1, wherein the binding to the small dsRNA is independent of the base pair sequence. 15. A method for selecting a small molecule for use in treating a subject infected with an RNA virus, comprising:
A method comprising performing the method of any one of the preceding claims. 16. The method of claim 15, wherein the small molecule comprises a concatemer of at least two subunits, each of which comprises: (a) (i) the dsRNA binding protein or protein complex; (I
i) a double-stranded dsR in which the binding protein binds independently of the dsRNA base pair sequence
Forming a reaction mixture comprising the NA fragment; (b) detecting the level of binding of the dsRNA binding protein to the dsRNA fragment in the dsRNA fragment in the presence and absence of the small molecule; (c) ) Comparing the binding observed in step (b); (d) the difference between the binding observed in the presence of the small molecule and the binding observed in the absence of the small molecule was selected. Selecting the small molecule if greater than the value. 17. At least a first and a second dsRNA binding small molecule, each of which is formed by covalently binding a small molecule selected by steps (a)-(e) of claim 1. Multimeric dsR comprising a linear concatemer
NA binder. 18. The at least one dsRNA-binding small dsRNA
18. The dsRNA binding agent of claim 17, wherein binding to is independent of the base pair sequence. 19. The dsRNA-binding agent according to claim 17, wherein the binding of each of the dsRNA-binding small molecules to dsRNA is independent of the base pair sequence. 20. The RNA binding agent of claim 17, further comprising an RNA modifying agent or an RNA cleaving agent covalently linked to one of the dsRNA binding small molecules.