WO2007119557A1

WO2007119557A1 - Method of detecting koi herpes virus (khv)

Info

Publication number: WO2007119557A1
Application number: PCT/JP2007/056614
Authority: WO
Inventors: Takashi Aoki; Ikuo Hirono
Original assignee: National University Corporation Tokyo University Of Marine Science And Technology
Priority date: 2006-04-13
Filing date: 2007-03-28
Publication date: 2007-10-25
Also published as: TW200804604A; JPWO2007119557A1; JP5315519B2

Abstract

It is intended to provide: a primer set for detecting Koi herpes virus whereby Koi herpes virus infecting carp can be more accurately and quickly detected and identified; a probe for detecting Koi herpes virus; and a method of detecting Koi herpes virus by using the above-described primer set and probe. By using a primer set for detecting Koi herpes virus (KHV) characterized by having a first DNA primer which contains an oligonucleotide part having at least 10 bases in the base sequence represented by SEQ ID NO:1 and a second DNA primer which contains an oligonucleotide part having at least 10 bases in the base sequence represented by SEQ ID NO:2, Koi herpes virus can be more accurately and quickly detected and identified.

Description

Specification

How to detect koi herpesvirus (KHV)

Technical field

[0001] The present invention relates to a koi herpes virus detection primer set and a koi herpes virus detection probe capable of identifying a pathogen of koi herpes virus (KHV) infecting carp, and a primer set and a probe thereof. The present invention relates to a method for detecting koi herpes virus used. Background art

[0002] Koi herpesvirus disease is a disease caused by koi herpes virus (KHV) and caused by Magyi and Shikigoi. The external symptoms are small carp fading and erosion (soak), which occurs from juveniles to adults, and is a carp disease with a high mortality rate.

[0003] The first occurrence of the koi herpesvirus disease was reported in Israel in May 1998. Later, in the same Israel, two episodes occurred in the fall of that year and the spring of the following year, and approximately 600 tons of carp including the carp for export were killed. Total damage exceeded $ 4 million. Since then, there have been many reports of onset in countries around the world (Israel, UK, Germany, Netherlands, Belgium, USA, Indonesia, Taiwan).

[0004] Even in Japan in 2003, the Ministry of Agriculture, Forestry and Fisheries announced that Koi suspected Koi herpesvirus disease was confirmed in Kasumigaura, Ibaraki Prefecture. Since then, Aomori, Yamanashi, Mie

Outbreaks of koi herpesvirus disease have been reported in Okayama and Amagasaki. The Ministry of Agriculture, Forestry and Fisheries is striving to prevent the spread of this disease, including the identification of infection routes!

[0005] When an infectious disease caused by a virus occurs in a natural farm, identifying the causative agent is very important in preventing, preventing or treating new transmission of the infectious disease. Conventionally, in order to identify general bacteria, viruses, vigor, etc. including fish pathogens, observation of their morphology, biochemical properties, or biochemical properties using immunological techniques has been performed. It was. Recently, with the development of biochemistry and molecular genetics, the pathogen is Identification and detection by chromosomal DNA and RNA, pathogen constituents and pathogen metabolites are now possible. However, these methods have a problem in that they have to take a lot of complicated steps, spending a lot of time, and cannot cope with diseases that are transmitted quickly such as viral diseases.

[0006] In view of such circumstances, recently, a method for identifying pathogens by detecting genes specific to various pathogens has become widespread. This method utilizes the fact that a DNA probe (single-stranded DNA labeled with a labeling compound) made from the gene of the target pathogen is only hybridized with the nucleic acid of the target pathogen. It is. Furthermore, when a method capable of amplifying the target DNA in large quantities in a very short time has been developed, the test sample (disease) can be obtained by using a part of both ends of the base sequence of the determined gene as a primer. It is possible to detect and identify pathogens such as viruses quickly and accurately using the living body tissue containing the active ingredient).

[0007] As a primer for virus detection, it simply provides type-specific detection methods for herpesvirus type I and type II, which are large enough to allow chemical synthesis, and that By using DNA primers and probes consisting of base sequences that do not reduce other specificity, HSVI or HSVII infections can be identified with high accuracy, speed, and type-specificity. A nucleic acid that can be used for diagnosing a method that can use the results for diagnosis and treatment (see, for example, Patent Document 1) and human immunodeficiency virus (HIV) infection that causes AIDS. (1) Nucleotide sequences that can be used as primers and probes for amplification and detection of nucleic acids (see, for example, Patent Document 2), and for the early diagnosis of tomato yellow leaf curl, its pathogenic virus, tomato yellow A method for detecting a winding virus (TY LCV) with high sensitivity (for example, refer to Patent Document 3), a nucleic acid primer containing a part of a broad bean Wilt virus RNA or a DNA in which uracil is replaced with thymine in the base sequence, And a method for detecting a broad bean virus using a nucleic acid primer containing a part of a nucleic acid having complementarity with RNA of broad bean virus (see, for example, Patent Document 4).

[0008] In addition, with regard to fish virus detection primers, ribonucleotide reductase inheritance that is preserved among virus species using fish pathogenic viruses such as iridoviruses. After cloning a pathogenic virus gene using a mixed primer designed with a nucleotide sequence corresponding to the amino acid sequence of a highly conserved region in the offspring, the specificity of the obtained DNA in the obtained DNA can be applied to fish disease diagnosis. Highly, a method of rapidly diagnosing a fish pathogenic iridovirus using a mixed primer designed with a nucleotide sequence has been proposed (for example, see Patent Document 5). In addition, a detection method for koi herpesvirus that detects DNA with a length of 292 bp by PCR (for example, see Non-Patent Document 1) has been reported, but problems have been pointed out in terms of detection sensitivity and accuracy. It has been.

Patent Document 1: Japanese Patent Laid-Open No. 5-56800

Patent Document 2: Japanese Patent Publication No. 2001-512701

Patent Document 3: Japanese Patent Application Laid-Open No. 2004-215520

Patent Document 4: Japanese Patent Laid-Open No. 11-313679

Patent Document 5: Japanese Patent Laid-Open No. 7-284399

Non-patent literature l: Yuasa, K. et.al. (2005) Fish Pathology 40 (1): 37-39.

Disclosure of the invention

Problems to be solved by the invention

[0010] Koi herpesvirus disease has a high fatality rate. Koi herpes virus disease has caused enormous damage not only to farmed carp but also to natural carp inhabiting lakes. The development of a possible method is eagerly desired. An object of the present invention is to provide a primer set for detecting koi herpes virus, a probe for detecting koi herpes virus, a probe for detecting koi herpes virus, a primer set for detecting koi herpes virus, a primer set of these, An object of the present invention is to provide a method for detecting koi herpesvirus using a probe.

Means for solving the problem

[0011] In order to solve the above problems, the present inventors have intensively studied, determined the entire base sequences of koi herpesvirus genes in Japan, the United States, Israel, and Indonesia, and at the level of each koi herpesvirus gene. It was confirmed that the homology was about 99% and the homology at the amino acid level was about 100%. Next, among the elucidated all nucleotide sequences, paying attention to the repetitive sequence portion specific to the koi herpesvirus pathogen, the known eukaryotes and viruses differ. Search for a sequence that is assumed to be about 150 to 200 bp and the composition ratio of bases C and G does not exceed about 65%, and is specific for koi herpesvirus genes in Japan, the United States, Israel, and Indonesia. Well conserved! Select two regions described in SEQ ID NOs: 5 and 6, and use a probe for detecting koi herpes virus that targets the covered region using a probe for detecting koi herpes virus. The present inventors have found that koi herpesvirus can be detected and identified more accurately and quickly, and the present invention has been completed.

[0012] That is, the present invention relates to (1) a first DNA primer containing an oligonucleotide part of at least 10 bases in the base sequence shown in SEQ ID NO: 1 in the sequence listing, and SEQ ID NO: 2 in the sequence listing. A primer set for detecting koi herpesvirus (KHV), comprising a second DNA primer containing an oligonucleotide portion of at least 10 bases of the base sequence shown in (2) A first DNA primer containing an oligonucleotide part of at least 10 bases of the base sequence shown in SEQ ID NO: 3 and a first DNA primer containing an oligonucleotide part of at least 10 bases of the base sequence shown in SEQ ID NO: 4 in the sequence listing; A primer set for detection of koi herpesvirus (KHV), characterized by comprising two DNA primers, and (3) the above-mentioned (1) or (2) A detection method for koi herpesvirus (KHV) characterized by amplifying koi herpesvirus (KHV) gene in a test sample using a primer set for detecting herpes virus (KHV), ( 4) A koherpesvirus (KHV) detection probe comprising a labeled oligonucleotide sequence of at least 10 bases of the nucleotide sequence shown in SEQ ID NO: 5 in the sequence listing or its complementary sequence; A probe for detection of koi herpesvirus (KHV), characterized by comprising at least 10 bases of labeled nucleotide sequence of the nucleotide sequence shown in SEQ ID NO: 6 in the sequence listing or its complementary sequence; (6) Incubating the koi herpesvirus (KHV) detection probe according to (4) or (5) above and a test sample under conditions that allow hybridization. The present invention relates to a detection method for koi herpesvirus (KHV).

[0013] The present invention also relates to (7) DNA having the nucleotide sequence shown in SEQ ID NO: 5 or 6 or a complementary sequence thereof, or (8) one or several nucleotides in the nucleotide sequence shown in SEQ ID NO: 5 or 6. Consisting of a base sequence deleted, substituted, or added, and used as a probe And DNA that can detect koi herpesvirus (KHV) and (9) DNA that has a sequence ability complementary to the nucleotide sequence shown in SEQ ID NO: 5 or 6 under stringent conditions. It also relates to DNA that can detect koi herpesvirus (KHV) when used as a probe.

Brief Description of Drawings

[0014] [Figure 1] Japanese isolate (KHV-J), American isolate (KHV-A), Israel isolate (KHV)

-I) is a graph showing the total length (bp) of the KHV genome and the predicted number of genes.

FIG. 2 is a diagram showing the results of comparing the homology of KHV genomes of Japanese isolates (KHV-J), American isolates (KHV-A), and Israel isolates (KHV-I).

FIG. 3 is a diagram showing the results of electrophoresis of PCR amplification products using the KHV detection primer of the present invention.

FIG. 4 is a diagram showing the results of electrophoresis of PCR amplification products for the amount of KHV genome (six types) using the KHV disease pathogen detection primer of the present invention.

FIG. 5 is a diagram showing the results of electrophoresis of PCR amplification products for DNA of 3 carp pupae infected with KHV using the KHV disease pathogen detection primer of the present invention.

BEST MODE FOR CARRYING OUT THE INVENTION

[0015] As a primer set for detection of koi herpesvirus (KHV) of the present invention, a first DNA primer containing an oligonucleotide portion of at least 10 bases of the base sequence shown in SEQ ID NO: 1 in the sequence listing; A primer set comprising a second DNA primer containing an oligonucleotide part of at least 10 bases of the base sequence shown in SEQ ID NO: 2 in the sequence listing, or of the base sequence shown in SEQ ID NO: 3 in the sequence listing A first DNA primer containing an oligonucleotide portion of at least 10 bases;

The primer set is not particularly limited as long as it is a primer set comprising a second DNA primer containing an oligonucleotide at least 10 nucleotides of the nucleotide sequence shown in SEQ ID NO: 4 in the sequence listing, and for detecting these koi herpes viruses. By using the primer set to amplify the koi herpesvirus gene in the test sample, koi herpesvirus can be detected.

[0016] The first DNA primer containing the oligonucleotide portion of at least 10 bases The second DNA primer is preferably a primer containing an oligonucleotide part of 10 to 50 bases, more preferably an oligonucleotide part of 15 to 30 bases, and more preferably an oligonucleotide part of 20 bases. As a matter of fact, the DNA to be amplified by PCR should be at least one base away!

[0017] The koi herpesvirus (KHV) detection probe of the present invention includes the nucleotide sequence shown in SEQ ID NO: 5 in the sequence listing (the koi herpes virus genome is 7689-7878! 280527-280716 of 190 bp) or a probe having a labeled oligonucleotide portion of at least 10 bases, preferably 20 bases or more of IJ, or shown in SEQ ID NO: 6 in the sequence listing Probes having a labeled nucleotide sequence of at least 10 bases, preferably 20 bases or more, or a complementary sequence thereof (the 165 bp portion of koi herpesvirus genome 15 996-16160 or 288834-288998) or its complementary sequence The probe is not particularly limited as long as it has a pH, and the koi herpesvirus detection probe and the test sample are incubated under conditions where hybridization is possible. By Tosuru, it can be detected by a conventional method Koiheru Bae scan virus.

[0018] The test sample is not particularly limited as long as it is a sample suspected of containing koi herpes virus. For example, it is usually obtained from tissues and blood such as carp era, epidermis, liver, and kidney. A DNA extract extracted by the method can be specifically exemplified.

[0019] The method for detecting koi herpesvirus of the present invention using the koi herpes virus detection primer set of the present invention comprises an amplification process of koi herpes virus gene DNA in a test sample, koi herpes virus gene DN A detection process. In the gene DNA amplification process, the polymerase chain reaction (PCR) method, the loop-mediated 'isothermal' amplification method (LAMP), the isothermal 'and'chimeric'primer-cited amplification method ( ICAN) can be used.

[0020] For example, the PCR method can automatically amplify only the target DNA region up to about 1 million times from a very small amount of DNA (Science, 239: 487-491, 1988). In PCR, a primer for the sense strand (hereinafter sometimes referred to as the first primer) and a primer for the antisense strand (hereinafter sometimes referred to as the second primer) across the DNA region to be amplified. Using various DNA primers, koi herpes will in test samples Gene DNA can be amplified. Each base constituting each of the first primer and the second primer may be modified in any known manner (for example, labeled with piotin or a luminescent substance).

[0021] In the DNA amplification step in PCR, the amplification cycle is repeated using a DNA polymerase, preferably a heat-resistant DNA polymerase, together with the first primer and the second primer. As the thermostable polymerase, it is preferable to use DNA polymerase capable of maintaining activity at a temperature up to 95 ° C., for example, Taq polymerase available from the market. The amounts used of the first primer, the second primer, and the DNA polymerase vary depending on the type of test sample, but can be easily determined as long as the DNA amplification step by the PCR method can be performed. The mixture can optionally contain a buffer (eg, Tris-HCl buffer), a stabilizer (eg, gelatin), or a salt (eg, sodium chloride).

[0022] Amplification conditions when PCR is performed using a mixed solution containing the primer set of the present invention, DNA polymerase and test sample are, for example, DNA denaturation (about 90 to 95 ° C, about 10 seconds to about About 2 minutes), annealing of single-stranded DNA with the first and second primers (about 37-70 ° C, about 30 seconds to about 3 minutes), and DNA synthesis with DNA polymerase (about 65-80 ° C) C for about 30 seconds to about 5 minutes) can be preferably mentioned, and this amplification cycle is preferably repeated 10 to 60 times, particularly 20 to 40 times. In the final cycle, it is preferable to extend the DNA synthesis heating time by DNA polymerase to about 5 to: LO minutes to ensure complete DNA synthesis! /. If koi herpesvirus is present in the test sample, a large amount of koi herpesvirus-derived DNA will be synthesized after the amplification cycle, and this DNA will be detected in the next DNA detection step.

[0023] As the DNA detection step, a method using gel electrophoresis and ethidium bromide staining, a Southern plot hybrid method, a base sequencing method by the dideoxy method, a radioactive labeling method, or the like may be used. it can. In the case of performing gel electrophoresis, for example, submarine type electrophoresis using an agarose gel as a carrier or slab type electrophoresis using acrylamide can be used. Southern plot hybrid method or in situ hybrid method In the case of conducting, a radioactive probe or a non-radioactive probe (for example, an enzyme-labeled probe, a piotinylated probe, a digoxigenated probe, a chemiluminescent substance, or a probe labeled with a fluorescent substance) can be used. Furthermore, when using the base sequence determination method by the dideoxy method, a DNA autosequencer (Applied Biosystems) using a fluorescent label can be used.

[0024] As a combination of the first primer and the second primer used in the amplification step, an oligonucleotide having a base sequence (acagtgtccgacttgtgcga) shown in SEQ ID NO: 1 (hereinafter sometimes referred to as KHV-TNFR-F) In combination with an oligonucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 2 (tggtgc ccacatgtgcgttg) (hereinafter sometimes referred to as KHV—TNFR—R) (hereinafter sometimes referred to as KHV—TNFR primer set) The oligonucleotide having the base sequence shown in No. 3 (gacactgaacatgaacactg) (hereinafter sometimes referred to as KHV-GT-F) and the oligonucleotide having the base sequence shown in SEQ ID No. 4 (gaatccat ccccatcacccg) (hereinafter referred to as KHV-GT) -Sometimes referred to as R) (hereinafter referred to as KHV-GT primer set). It is also possible to use force or two using any force one combination of these alone simultaneously.

[0025] The KHV-TNFR-F is present in the koi herpesvirus genome 7689-7708 or 2 80527-280546, and the KHV-TNFR-R is the koi herpesvirus genome 7 859-7878! / ヽ280697— 280716 [This is a double strand of J. Using these HV-TNFR primer sets, it is possible to amplify DNA with a nucleotide sequence of 190 bp shown in SEQ ID NO: 5. Can do. In addition, the above KHV-GT-F has the genome of koi herpes innores 15996-16015! / ヽ ίma 288834-288853 [KHV-GT-R is the genome of koi herpesvirus 16141-16160 or It is a complementary strand of the sequence present in 288979-288998. By using these KHV-GT primer sets, a DNA having a base sequence of 165 bp shown in SEQ ID NO: 6 can be amplified. With these HV-TNFR primer sets and KHV-GT primer sets, the 190bp portion of the Coherenovirus virus 7689-7878 or 280527-280716 is the genome 15996-16160! / ヽ ίma 288834-288998 165bp apportionment within a short time Since it can be amplified in large amounts, it is possible to specifically detect the presence of koi herpesvirus gene DNA in the test sample.

[0026] The first primer and the second primer of the present invention can be prepared by a known DNA synthesis method (for example, phosphoramidite method) using an ordinary automatic DNA synthesizer (for example, manufactured by Ablide Biosystems). it can.

[0027] The method for detecting koi herpesvirus of the present invention using the probe for detecting koi herpes virus of the present invention is the method of detecting the koi herpes virus gene DNA in the test sample. A probe for detecting koi herpesvirus can be detected by detecting the labeling substance bound to the probe. From the sample suspected of containing koi herpes virus, A DNA extract extracted by a conventional method can be used as it is. Koi herpesvirus gene DNA amplified by the PCR method can also be used.

[0028] Examples of the labeling substance include enzymes, fluorescent substances, chemiluminescent substances, radioisotopes, piotin, avidin, and the like. Specifically, peroxidase (for example, horseradish peroxidase), anorecalphosphatase, etc. , Β-D galactosidase, glucose oxidase, glucose 6-phosphate dehydrogenase, alcohol dehydrogenase, malate dehydrogenase, percylinase, catalase, apoglucose oxidase, urease, luciferase or acetylcholinesterase Fluorescent substances such as cein isothiocyanate, phycopyriprotein, rare earth metal chelates, dansyl chloride or tetramethylrhodamine isothiocyanate, radioactive isotopes such as ³ H, “C, ¹²⁵ I or ¹³¹ 1, piotin, Examples of vidin or chemiluminescent materials can be given.

[0029] The DNA of the present invention includes a DNA consisting of the base sequence shown in SEQ ID NO: 5 or 6 or a complementary sequence thereof, or the base sequence shown in SEQ ID NO: 5 or 6, lacking one or several bases. A DNA and a string consisting of a deleted, substituted or added nucleotide sequence and capable of detecting koi herpesvirus when used as a probe, or a DNA having a complementary sequence to the nucleotide sequence shown in SEQ ID NO: 5 or 6. DNA that can detect koi herpesvirus when it is hybridized under gentle conditions and used as a probe The above-mentioned “base sequence in which one or several bases are deleted, substituted or added” is not particularly limited, for example, 1 to 20, preferably 1 to 15, more preferably 1 to: LO means a base sequence in which any number of bases, more preferably 1 to 5, is deleted, substituted or added.

[0030] For example, DNA (mutant DNA) consisting of a base sequence in which one or several bases are deleted, substituted or added is known to those skilled in the art such as chemical synthesis, genetic engineering techniques, mutagenesis, etc. It can also be produced by any method. Specifically, the DNA having the nucleotide sequence shown in SEQ ID NO: 5 or 6 can be contacted with a mutagen drug, irradiated with ultraviolet light, genetically engineered, etc. Mutant DNA can be obtained by introducing mutations into these DNAs. Site-specific mutagenesis, one of the genetic engineering methods, is a technique that can introduce a specific mutation at a specific position. Molecular Cloning: A laboratory Mannuai, 3rd Ed., Old Spring Harbor Laboratory, Cold Spring Harbor, NY., 2001. (hereinafter abbreviated as "Molecular Cloning ¾¾3"), Current Protocols in Molecular Biology, Supplement 1-38, John Wiley & Sons (1987-1997), etc. By expressing this mutant DNA using an appropriate expression system, it is possible to obtain a protein having an amino acid sequence ability in which one or several amino acids have been deleted, replaced, or added. .

[0031] The above-mentioned "base sequence that hybridizes under stringent conditions" means using a nucleic acid such as DNA or RNA as a probe, colony 'hybridization method, plaque hybridization method, Alternatively, it means a base sequence obtained by using the Southern blot hybridization method, etc., specifically, using a filter on which colony or plaque-derived DNA or a fragment of the DNA is immobilized. After performing hybridization at 65 ° C in the presence of 7 to 1.0 M NaC 1, 0.1 to 2 times the SSC solution (the composition of the SSC solution with 1 concentration is 150 mM salt solution) DNA that can be identified can be raised by washing the filter at 65 ° C with sodium chloride (15 mM sodium citrate). Hybridization can be carried out according to the method described in Molecular Cloning 3rd edition.

[0032] That is, under stringent conditions, so-called specific hybrids are formed, This refers to the conditions under which non-specific antibodies and hybrids are not formed. Specifically, there is a condition that DNAs having 50 to 70% or more homology hybridize and DNAs having lower homology do not hybridize to each other. , value is typically Southern hybrida I See 65 ° C is a condition of washingヽof ^{Chillon, IX SSC, 0. 1 0/} 0 SDS, also ί or 0. IX SSC, to 0. 1 ^_0/0 SDS You can list the conditions for the irididation at the salt concentration. For example, DNA that can be hybridized under stringent conditions includes DNA having a certain degree of homology with the base sequence of the DNA used as a probe, for example, 60% or more, preferably 70%. A DNA having a homology of at least%, more preferably at least 80%, further preferably at least 90%, particularly preferably at least 95%, most preferably at least 98% can be suitably exemplified.

[0033] The method for obtaining and preparing the DNA of the present invention is not particularly limited, and the KHV-TNFR primer set and the KHV-GT primer set disclosed in the present specification are prepared, and they are used to produce a koihelpe. Screening the DNA library of the virus (KHV) The target DNA can be isolated from this or prepared by chemical synthesis according to conventional methods.

Hereinafter, the present invention will be described more specifically with reference to examples. However, the technical scope of the present invention is not limited to these examples. The experimental methods were the same as those described in Molecular Cloning 3rd edition, except as otherwise described. Abbreviations are used for the following terms.

CTABZNaCl solution: 10% cetyltrimethylammonium oxalic acid solution containing 0.7M NaCl, Tris: trishydroxymethylaminomethane, trishydrochloric acid: trishydroxymethylaminomethane, pH adjusted with hydrochloric acid , SDS: sodium dodecyl sulfate, EDTA: ethylenediamine tetraacetic acid, TBE buffer: 0.089M bis, 0.089M boric acid, liquid containing 0.002M EDTA, BSA: sushi serum albumin TE: 10 mM Tris-HCl (pH 8.0), ImM EDTA (pH 8.0) -containing solution, dATP: Deoxyadenosine triphosphate, dCTP: Deoxycytosine triphosphate, dGTP: Deoxyguanine triphosphate, dTTP: Deoxythymine triphosphate, Triton X-100: Polyoxyethylene (10) octylphenolatere. Example 1

[0035] KHV isolated from carp in Japan, USA and Israel, namely Japanese isolate (D DBJ accession number; AP008984), American isolate (DDBJ accession number; D Q657948) and Israel isolate (DDBJ The entire genomic sequence of the accession number; DQ 177346) was determined. Figure 1 shows the total length (bp) of these KHV genomes and the predicted number of genes, and Figure 2 shows the results of comparing the homology of these KHV genomes. The following 2 sets of PCR primers were prepared from these KHV genome sequences. In addition, the position of each primer in the genome of the Japanese isolate (KHV-J) is shown.

[0036] 1. KHV—TNFR primer

KHV― TNFR― F: 5 ― acagtgtccgacttgtgcga―

(Genome position: 7689-7708, 280527-280546)

KHV-TNFR— R: 5, — tggtgcccacatgtgcgttg-3,

(Genome position: 7859-7878, 280697-280716)

[0037] The following sequence 190 bp is amplified by the KHV—TNFR primer. The underline indicates the primer sequence.

AC ATGTGGGC ACC A-3

[0038] 2. KHV—GT primer

ir V― Gl―: 5 ― gacactgaacatgaacactg― 3

(Genome position: 15996- 16015, 288834-288853)

KiriV— l—: 5 ― gaatccatccccatcacccg― 3

(Genome position: 16141-16160, 288979-288998)

[0039] The following sequence 165 bp is amplified by the KHV-GT primer. The underline indicates the primer sequence. GGAATAATACTTACGGGTGATGGGGATGGATTC 3 '

[0040] Genomic DNA extraction of KHV was performed according to Molecular Cloning 3rd edition. The extracted DNA was dialyzed against TE buffer.

Example 2

[0041] Position of KHV genome 7689 force et al. The above KHV-TNF R-F, which is the 7708th sequence, is used as an upstream primer, and KHV-TNFR-R, which is the complementary strand of the sequence from 7859 to 7878, is also used. The target DNA was amplified by PCR using the downstream primer and the KHV genome as a saddle, and the nucleotide sequence of the obtained DNA was confirmed. For amplification, Taq DNA polymerase manufactured by Takara and the 10-fold concentrated reaction solution and 10-fold concentrated dNTP solution attached to the enzyme were used so as to achieve a 1-fold concentration. The reaction solution was adjusted to 50 microliters. This solution was subjected to an automatic temperature controller, and PCR was carried out using the above-mentioned PCR primers and a KHV genome as a saddle. PCR conditions were 30 cycles at 95 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 30 seconds.

[0042] After completion of the PCR reaction, the molecular weight of the amplified DNA fragment was measured by performing electrophoresis for 1 hour at 80 mA in TBE buffer using a 0.8% agarose gel. The detection and molecular weight of the amplified DNA fragment were measured as relative mobility with respect to a commercially available lOObp ladder. The DNA fragment was detected by staining agarose gel in TBE buffer containing bromide zyme (: g / mL) and then observing fluorescence under ultraviolet irradiation.

[0043] The base sequence of the obtained DNA fragment was determined by the dideoxy method using the aforementioned thermostable DNA synthase. As a result, as shown in SEQ ID NO: 5 in the sequence listing, a DNA fragment having a base sequence length of 190 bp was obtained.

Example 3

[0044] KHV disease pathogen genome position KHV — GT—F, a sequence present from positions 15996 to 16015, and KH V -GT-R, a complementary chain of the sequences present from positions 16141 to 16160, as upstream primers To determine the species of KHV disease pathogens The gene was amplified by PCR, and the base sequence of the obtained DNA was determined. Thereafter, the same procedure as in Example 1 was performed to obtain a DNA fragment having a base sequence length of 165 bp described in SEQ ID NO: 6 in the Sequence Listing.

Example 4

[0045] The base sequences of the two types of DNA fragments obtained in Examples 2 and 3 were compared by computer analysis software (SDC software) to see if they matched part of the base sequence of the KHV genome. . At the same time, a database on gene sequences (http: 〃 www.ncbi.nih.gov/index.html) is accessed to determine whether or not there are eukaryotes and viruses that have the same parts as these base sequences! A comparative analysis was also performed using computer analysis software (SDC software).

[0046] As a result, it was confirmed that the base sequences of the obtained DNA fragments were all present in the KHV genome, and even in the search results in the database, eukaryotics having the same base sequence portion as these DNA fragments were found. It was found that organisms and viruses did not exist. From the above, it can be said that both of the obtained two kinds of DNA fragments having a length of 190 bp and 165 bp are DNA sequences that specifically detect KHV.

Example 5

[0047] KHV genomes isolated in Japan C, USA (Α), Israel (Is), and Indonesia (In) using the primers used in Examples 2 and 3 and the previously reported primers for KHV detection PCR was performed using the 铸 type to examine whether the target DNA region could be amplified. Preparation of PCR reagents, test conditions, and electrophoresis conditions were all the same as in Example 2. As a previously reported primer for KHV detection, Correctea Sph 1-5 primer set in Table 1 of Non-Patent Document 1 was used.

[0048] Fig. 1 shows the results of electrophoresis of the PCR amplification products. In each of the primers used in Examples 2 and 3, each of the KHVs having different separation areas, like the existing primers, formed distinct DNA bands in the molecular weight portions determined on electrophoresis, and their genomes were used. The presence of

Example 6

[0049] Primers used in Example 2 and Example 3, and previously reported primer for KHV detection PCR was performed on KHV genomes isolated in Japan, and the detection sensitivity of KHV by each primer set was compared. Each PCR was performed in the same manner as in Example 2. For KHV genome, the amount of KHV genomic DNA mixed in each reaction solution was adjusted to 6 types: 100 ng, 10 ng, lng, 100 pg, lOpg, and lpg. Attempts to amplify the species-determining gene.

[0050] Fig. 2 shows an electrophoresis photograph of the PCR amplification product. Both the primers used in Examples 2 and 3 have the ability to form a clear DNA band in the molecular weight part determined by electrophoresis, as in the case of existing primers. With the previously reported primers, the KHV genome can be detected below the amount of lOOpg. In contrast, none of the primers in the present invention revealed a distinct band due to PCR-amplified DNA with the KHV genome lOpg. That is, it has been clarified that all of the primers obtained in the present invention have a detection sensitivity of KHV genome 100 times that of the previously reported primers, and greatly improve the diagnosis technique of KHV disease. Example 7

[0051] Using the primers used in Example 2 and Example 3 and the previously reported KHV detection primer, PCR was performed on the DNA extracted from the repulsive force of three caries infected with KHV. KHV was detected with each primer set. For control, KHV genomic DNA isolated in Japan was used. Each PCR was performed in the same manner as in Example 2. Koi's repulsive DNA is extracted from the “Fish DNA—Molecular Genetic Approach” Chapter 2 Gene Analysis (Ikuo Kanno); Hoshiseisha Koseikaku (issued June 10, 1997) It was performed by the method described in 1.

[0052] Fig. 5 shows the results of electrophoresis of the PCR amplification products. In each of the primers used in Examples 2 and 3, a distinct DNA band specific to KHV was formed on electrophoresis, and a non-specific DNA band was not formed. On the other hand, in the previously reported primer, non-specific DNA bands were formed in addition to KHV-specific DNA bands in the DNA of 3 carp pupae infected with KHV. That is, it has been clarified that the primers obtained in the present invention have excellent detection accuracy of the KHV genome and greatly improve the diagnostic technology for KHV disease compared to the previously reported primers. It was.

Industrial applicability By using the koi herpes virus detection probe of the present invention, the koi herpes virus gene can be detected with high sensitivity, high accuracy and speed.

Claims

The scope of the claims

[1] A first DNA primer containing at least a 10-nucleotide oligonucleotide portion of the base sequence shown in SEQ ID NO: 1 in the sequence listing, and an oligo of at least 10 bases in the base sequence shown in SEQ ID NO: 2 in the sequence listing Primer set for detection of koi herpesvirus (KHV), characterized by comprising a second DNA primer containing a nucleotide moiety

[2] A first DNA primer containing an oligonucleotide portion of at least 10 bases of the base sequence shown in SEQ ID NO: 3 in the sequence listing, and an oligo of at least 10 bases in the base sequence shown in SEQ ID NO: 4 in the sequence listing Primer set for detection of koi herpesvirus (KHV), characterized by comprising a second DNA primer containing a nucleotide moiety

[3] A koiherpes virus (KHV) gene in a test sample is amplified using the koi herpesvirus (KHV) detection primer set according to claim 1 or 2. Virus (KHV) detection method.

[4] A koi herpesvirus (K) characterized by comprising at least a 10-base labeled oligonucleotide sequence of the nucleotide sequence shown in SEQ ID NO: 5 in the sequence listing or its complementary sequence

HV) Probe for detection.

[5] A probe for koi herpesvirus (KHV) detection, comprising a labeled oligonucleotide sequence having at least 10 bases of the nucleotide sequence shown in SEQ ID NO: 6 in the sequence listing or its complementary sequence.

[6] Koi herpes virus-less (KHV) detection probe according to claim 4 and test sample are incubated under conditions allowing hybridization, koi herpes virus (KHV) detection method.

[7] A DNA having the nucleotide sequence shown in SEQ ID NO: 5 or 6 or its complementary sequence.

[8] In the base sequence shown in SEQ ID NO: 5 or 6, when one or several bases are deleted, substituted, or added, the base sequence becomes a koi herpes virus (KHV DNA that can detect).

[9] DNA and stringin having sequence ability complementary to the nucleotide sequence shown in SEQ ID NO: 5 or 6 DNA that can detect koi herpesvirus (KHV) when hybridized under certain conditions and used as a probe.