CN1278921A - dsRNA/dsRNA-Binding protein methods and compositions - Google Patents

Abstract

Disclosed is a screening method for identifying compounds capable of disrupting binding of a dsRNA-binding protein or protein complex to dsRNA. Also disclosed are methods of treating viral infections using such compounds.

Description

DsRNA/dsRNA is in conjunction with protein process and composition

Reference is incorporated in the application's requirement into, applies for the U.S. Provisional Application No.60/058 on September 12nd, 1997,740 right of priority.

This study portion is provided with funds by the advanced project management board of defence (Defense AdvancedResearch Proiects Administration) (permission N65236-98-1-5400).U.S. government can have certain right in this invention thus.

Invention field

The present invention relates to a kind of screening technique, be used for differentiating and combine with double helix dsRNA, especially can destroy the compound that dsRNA combines with dsRNA in conjunction with albumen or albumen composition.The invention still further relates to thus the concatermer composition of the compound that screening differentiates, and use this compounds for treating dysfunction and as the method for virus or viroid infection and so on disease.

Background of invention

Now propose and implemented many regulatory gene that are used for and expressed, be included in the method that DNA transcriptional level and polypeptide translation skill are regulated.For example, utilize the mRNA synthetic mesophase thing of DNA mediation antisense molecule can be led on the mRNA in the organism.

Although the technology that this antisense reaches based on protein can be used for the expression of control agent alia gene, it has been generally acknowledged that little organic molecule is more suitable for drug development.This quasi-molecule is easier to by cell membrane, and influences biological answer-reply in the body.In addition,, require quite deep drug development to attempt usually, to differentiate directly medicine to distinguished sequence because each new mRNA and protein target all have unique foldable structure.

Be adjusted in control virus and the viroid infection aspect of gene expression have particular utility.Although the component that they often use host cell mechanism is to duplicate, the inhereditary material of many viruses and viroid is different from the inhereditary material of host cell, and thereby is the potential target of controlling for treatment.

For example, RNA viruses is distinguished as its oligogene group material by having strand or double-stranded RNA.But between replicative phase, RNA viruses must be passed through the stage that double helix double-stranded RNA (double helix dsRNA) forms.As described below, double helix dsRNA can tell from the RNA that finds among the hosts, and this is differentiated by its content with standard dsRNA of continual Waston-Crick base-pair.In addition, some RNA (and DNA) virus has long, Bao Shou stem-ring structure fully, and stem wherein is continual dsRNA.On the contrary, host's organism lacks the long sequence of double helix dsRNA; And generation only to have the zero defect double-stranded RNA sequence of very short sequence (being less than the 6-10 base-pair usually), as the RNA self that transcribes at strand folding in (Doudna, J.A.Nature 388:830-831,1997) of formation.

Interferon (IFNs) is a cytokine family, this family by vertebrate to virus infections and other cellularity stress reply generation.INF amplifies with the receptors bind trigger pip cascade on INF responsive cell surface, but it causes (Sen G.C. and Ranshoff R.M., the Adv.Virus Res.42 of inducing more than 30 kinds of IFN-induced proteins; 57-63,1993; JaramilloM.L., et a1., Cancer Invest., 13:327-338,1995).Interferon-induced protein comprises the protein kinase (PKR) that dsRNA-activates.It is a key factor of interferon-induced cellullar immunologic response that PKR is activated by long dsRNA, and it is the first line of defence of viral infection resisting in the animal reservoir.It is synthetic that the activation of PKR presents the inhibition virus protein.PKR presents and combines with dsRNA and the α-subunit of phosphorylation eIF-2 transcription factor.The eIF-2 of phosphorylation is an inactivation, and synthetic be blocked (Katze, M.G.Semin.Virol:4:259-268,1993) of the albumen in the cell of virus infections.

In some modes, virus is passed through among the dsRNA and the activation of PKR.This shows dsRNA ubiquity in the cell of virus infections, and it is the main effect that observed feature and PKR play in the cell response to virus infections in a large amount of various viruses.

For example, adenovirus and Epstein-Barr virus produce the RNA molecule, and it is the competitive inhibitor of PKR-dsRNA association reaction.Similarly, vaccinia virus albumen K3L and hepatitis C virus protein NS5A interact as counterfeit substrate blocking-up PKR-dsRNA.The NS1 that influenza, bovine vaccine and reovirus produce respectively, E3L, and σ 3 albumen combine with dsRNA.Influenza virus also causes the generation of cell protein p58, and it is the natural inhibitor of PKR, and poliovirus infects and causes the PKR proteolysis.Some virus performance mechanism and multiple are destroyed by the activation of dsRNA to PKR.For example, HIV Tat albumen reduces the expression of PKR.HIV TAR rna binding protein combines with PKR, and suppresses its kinase activity, and is a competitive inhibitor (Gale, M., et a1., Pharmacol.Ther.78:29-46,1998) of dsRNA combination.

Significantly, in the virus evolution process, virus has been grown various destructions by the actual mechanism of dsRNA to the activation of interferon-induced PKR.Because these mechanism, interferon has not been to the very effective methods of treatment of virus infections.But in the treatment virus infections, interferon is a broad-spectrum antiviral drug, because its identification dsRNA, dsRNA is the internal characteristics of many virus replications.Be necessary to develop the wide spectrum medicine that to discern long dsRNA and suppress virus replication.

Summary of the invention

The relative shortage of longer double helix dsRNA target region in the host cell makes the unlikely toxicity that causes based on any mechanism of compound of the long sequence of target dsRNA in mammalian cell.Like this compound thereby be the candidate of useful therapeutic agent.

The present invention includes a double helix dsRNA: the protein bound analysis, it is used to screen the storehouse of chemical or biological synthetic or natural products compound of deriving.The change dsRNA of test compounds is in conjunction with the ability that combine that do not rely on base-pair sequence of albumen with the dsRNA cycle tests.Compound can suppress or promote dsRNA combining in conjunction with albumen and dsRNA.This analysis is used for screening compounds, and it is used to make up new subsequently, thereby the preparation of inactivation target double helix dsRNA " bullet " is effectively modified in more effective bond and/or conveying.Thereby said preparation can separate by hindering chain, destroys combining of basic albumen and RNA, or disturbs duplicating of dsRNA by deactivation dsRNA.

Except replicative intermediate, long dsRNA also can produce during the genome of some RNA viruses is transcribed, especially sections and non-segmented negative-strand RNA viruses and ambisense RNA virus (RoizmanB.﹠amp; Palese, P. virus replication summary is seen regional virology, volume 1, Lippinvott-Raver publishing house, Philadelphia, New York, 1996, pp.101-111).From negative strand viruses RNA template, produce mRNA and can produce long dsRNA sequence.Thereby the dsRNA that exists in the cell of minus strand and ambisense RNA virus infections also is useful in enforcement of the present invention.

The double-stranded bond of selecting with method of the present invention is particularly useful for treating virus and viroid infection, and this is because these infectious agent are utilized relatively long dsRNA molecule during its life cycle.Analysis of the present invention is particularly useful for finding and the exploitation small-molecule drug that it can discern the propagation of dsRNA and RNA interfering virus, and bottom line disturbs the host cell function.But non-this purpose that is limited to of the inventive method and composition.Mammal and other eukaryotic and prokaryotic comprise that also some also can be used as the dsRNA zone of the target of the compound of finding and making up according to the present invention.

The present invention relates generally to screen and select to influence the method for the compound that dsRNA combines with the base-pair sequence dependent/non-dependent of dsRNA in conjunction with albumen or albumen composition.In one embodiment, the inventive method relates to the compound that screening destroys combination like this.One more generally in the embodiment, the present invention includes screening influence the compound of dsRNA function as the dsRNA section of participation cell function.In another embodiment, be used to detect infection in animal and other biosome by compounds identified of the present invention.As described below, the present invention more particularly embodiment relates to the compound of finding and making up targeted rna virus and viroid.

According to an embodiment of the present invention, screening technique may further comprise the steps: (a) form a reaction mixture, its by (ⅰ) dsRNA in conjunction with albumen or albumen composition, (ⅱ) in conjunction with albumen can not rely on the dsRNA base-pair sequence with it the dsRNA of combination form; (b) based on existing and not existing the diversity ratio set point value of the combination that observes under the situation of test compounds big or little, detecting is having or is not having under the situation of test compounds, and dsRNA is in conjunction with the combine level of albumen with the dsRNA fragment; (c) if detecting in conjunction with the middle institute of level and control reaction potpourri (no test compounds) of detecting shows different, owing to it can change in conjunction with selecting this test compounds.In a related embodiment, the method is used to differentiate optionally the compound in conjunction with dsRNA, and promptly this compound presents in conjunction with dsRNA than in conjunction with single stranded RNA (ssRNA), and the high at least 2-3 of compatibility of single stranded DNA (ssDNA) and double-stranded DNA (dsDNA) doubly.

In one embodiment, the dsRNA-that exists in the analysis is the amount that is enough to reach at least 25% saturated mark in conjunction with the concentration of albumen or albumen composition, and to combine albumen compound with dsRNA not having under the test compounds situation to mean in the reaction mixture at least 25% dsRNA.Perhaps, the amount of rna binding protein is enough to reach at least 50% or 75% saturated mark.Preferably, the concentration of rna binding protein is the amount that is enough to reach at least 90% saturated mark, and preferably, compound of the present invention combines with dsRNA in the non-specific mode of sequence.Compound perhaps of the present invention can the sequence-specific mode combine with dsRNA.

This method also further comprises any compound that test as above selects toxicity to mammalian cell, and the further useful therapeutic agent of screening.

In an embodiment preferred, the about 10-100 base-pair of the dsRNA fragment length that is used to analyze, preferably approximately 16-50 base-pair, more preferably 30-50 base-pair.

In a more preferred embodiment, the inventive method is used to differentiate antiviral compound.According to this embodiment of the present invention, the dsRNA that is used to analyze is a viral origin in conjunction with albumen, as E3L or σ 3 albumen.This albumen (or its domain) can produce according to the means known in the art reorganization.

According to another embodiment of the present invention, dsRNA also can be cell protein such as PKR in conjunction with albumen, and DRAF1, DRAF2, RNAase H, Z-DNA be in conjunction with albumen, La (SS-B), TRBP, and dsRNA-specificity adenosine deaminase.

In the analysis in conjunction with level can by directly measure in conjunction with compound (albumen: formation dsRNA), or measure downstream or attached incident, as being detected in the phosphorylation of generation one or more substrate in the cascade reaction of dsRNA binding events.Directly the example that detects comprises the displacement analysis of (ⅰ) gel band, (ⅱ) scintillation proximity assay, (ⅲ) filter-binding assay.

The example of measuring downstream events comprises the protein kinase cascade that relies on dsRNA, wherein, for example when having suitable reagent such as ATP in the reaction mixture, finger is made the automatic phosphorylation of the interferon-induced protein kinase of PKR, but or the phosphorylation of eIF-2 and/or another kind phosphorylation indicator protein generation.Perhaps, can measure the protein-bonded specific activity of dsRNA, wherein should activity to being stimulated in the replying of combination or being reduced.Example about this is the above-mentioned protein kinase mediated automatic phosphorylation of PKR or its substrate eIF-2.

In an embodiment of being correlated with, the present invention includes a kind of the treatment with the individuality of picornavirus infection or the method for cell.According to this aspect of the invention, will analyze the compound of selecting or forming, be applied to individuality in conjunction with the regional effective dose that combines of described dsRNA that exists in albumen and the individual cells to suppress dsRNA according to screening according to the present invention.The method can comprise differentiates a specificity dsRNA base-pair sequence in this viral genome, and it is the target of compound, and it can be according to the analysis mode of selection base-pair sequence specific compound as herein described and selected.But this sequence-specific is nonessential, because in common mode more, analytic approach of the present invention selects to discern in the non-specific mode of sequence the compound of double helix dsRNA.At this, be not limited to any special mechanism theory, it is believed that compound can be discerned and in conjunction with double helix dsRNA structure.The compound of Xuan Zeing especially can be used for resisting the infection of the virus of unknown aetology and/or composition on this basis.

Another aspect of the present invention comprises the method that whether virokine exists in a kind of detection of biological sample.The dsRNA binding compounds of being differentiated by the method for this paper announcement can be used for determining whether biological sample contains virokine.In this embodiment, separate from the virus or the viroid factor of biological sample detected to determine whether virokine combines with the compound of being differentiated by these methods.Because these compounds can non-dependence sequence mode combine with dsRNA, thereby can measure whether unidentified virokine exists in the biological sample.

What list in the application is the part of virus and viroid disease substance, and the medicine of selecting in the analysis at it can detected and application.In another embodiment, tested and be used for biosome, before the people, this compound will carry out toxotest.

The present invention also comprise a kind of screening can with 3-16 among the double helix dsRNA, the method for 3-8 or the compound that combines with 3-5 base-pair zone base specific more specifically.The method comprises: (a) form a reaction mixture, comprise (ⅰ) test compounds, (ⅱ) dsRNA is in conjunction with albumen or albumen composition, (ⅲ) double helix dsRNA fragment, it is included under the situation that does not have test compounds in conjunction with the albumen zone of combination with it, and wherein the cycle tests that at least one is made up of the individual base-pair of about 3-16 (or 3-8) is contained in this zone; (b) detect in the potpourri dsRNA in conjunction with the combine level of albumen with the dsRNA fragment; (c) if obviously lower with the level that combines of dsRNA in the potpourri,, it selects this test compounds owing to combining with the dsRNA sequence than institute's survey level in the reaction mixture of no test compounds in conjunction with albumen.

In one embodiment, above-mentioned analysis can be used for differentiating with the compound specificity of sequence among the dsRNA and combines.At this, compound is added in the double helix dsRNA fragment, described fragment preferably contains the individual base-pair sequence of many combination 3-16 (or 3-8) that mixes in the fragment with equimolar amounts.After combination, separating and combining and unconjugated dsRNA, as separating by preparation band displacement animal migration gel analysis, and with amplification technique such as PCR, iteration form discriminating preferred as described herein is not in conjunction with the dsRNA fragments sequence.

The compound of method discriminating can be used for detecting or treating the specific RNA virus of the compound specificity sequence that contains discriminating thus.

In a related aspect, the present invention also comprises polymer RNA bond, itself and dsRNA selective binding.So preparation is by covalently bound at least two kinds of dsRNA binding compounds, and every kind of analysis all according to the present invention is selected, and the linear concatermer that forms.Preferably, this compound promptly is not that oligonucleotides neither peptide; But they can by any suitable connector for example but non-polysaccharide, peptide or the oligonucleotides of being limited to link together.According to embodiment preferred, this composition comprises the dsRNA dressing agent, and it revises or destroy the dsRNA function effectively.

In another relevant embodiment, the present invention includes and estimate the method for selected compound in conjunction with the ability of double helix dsRNA, and the diagnostic kit that adopts dsRNA selection described herein and discrimination method and/or composition.

These and other aspect of the present invention and feature will be clearer by reading following detailed content and accompanying drawing.

The accompanying drawing summary

Fig. 1 illustrate express as with the Staufen of the fusion of GST, E3L, the clone of the plasmid vector of the dsRNA binding structural domain (dsRBDs) of mPKR and hPKR albumen and make up graphic.

Fig. 2 is the computer generated image figure that E3L and the gel autoradiography that combines of radiolabeled 30-mer dsRNA are shown.

Fig. 3 A and 3B are for illustrating E3L and dsRNA, the computer generated image figure of the gel autoradiography of SSRNA and the combination of RNA/DNA hybrid molecule.

Fig. 4 is for illustrating E3L in conjunction with 19-, 22-, and the computer generated image figure of the gel autoradiography of 26-and 30-mer dsRNA fragment, wherein E3L concentration is 67nM, 12nM and 2nM.

Fig. 5 A-5D illustrate dsRNA in conjunction with albumen combine with the dsRNA fragment graphic.

Fig. 6 A-6B is ethidium bromide (EtBr) that various concentration are shown in ordinary gel (A) and contains the computer generated image figure of the gel autoradiography of the competition effect that on the gel of 3.3 μ M EtBr E3L is combined with dsRNA (30mer).

It is graphic that Fig. 7 A-7G illustrates various dsRNA construction of the present invention, comprises the 34-merdsRNA shown in SEQ ID NO:1 (7A) of the possible conversion that shows all tripolymer structures.

Fig. 8 illustrates the protein kinase PKR cascade that depends on dsRNA of cell incident.

Fig. 9 (A-C) illustrates the scintillation proximity assay of application streptavidin-SPA pearl and biotin labeled dsRNA.

Figure 10 illustrates all 256 kinds 10 kinds of oligonucleotides (30-mer) that may make up that the long oligonucleotides of 4 nucleotide is provided together, and these 10 kinds of oligomer are derived from comprising 256 kinds of continuous sequences that may make up.

Figure 11 illustrates a kind of oligonucleotides of being shown in Figure 10 ³³The p end mark, biotinylation reaches the annealing with complementary oligonucleotide.

Figure 12 illustrates and uses Staufen, E3L, and mPKR and hPKR are as the SPA biotin protectiveness result of experiment of rna binding protein.It is described that these the results are shown in embodiment 6.

Figure 13 illustrates the SPA result of the RNA binding compounds of using hPKR and indicating, and it is described that these the results are shown in embodiment 6.

Figure 14 illustrates the result of screening noval chemical compound from the chemical library of combination.Figure 14 A illustrates screening 44 serial 1a compound (compd A 2-12, B2-12, C2-12, results D2-12).Figure 14 B illustrates the result of screening 54 serial 1b compounds (compd A 2-12, B2-12, C2-12, D2-12 and E2-11).It is described that these the results are shown in embodiment 7.

Figure 15 is depicted as whether earlier detection compound B5 (1a flat board) combines with the polynucleotide that indicate and fluorescence/quencher analysis result of carrying out, as described in embodiment 8.

Detailed Description Of The Invention:

I. definition

Term used herein " little molecule " refers to the organic or inorganic compound that biological or chemical is synthetic, and its molecular weight is usually less than 10,000, more typically less than 1,000. Little molecule preferably can penetratingly be crossed cell, and is not polypeptide or polynucleotides usually.

Term used herein " polypeptide " refers to the amino acid whose polymer of 20 natural generations.

Term used herein " polynucleotides " refers to adenosine, the polymer of the nucleotides of 5 kinds of natural generations of cytimidine, guanosine, thymidine and uracil.

Term used herein " concatermer " refers to that micromolecular linear assembling is to form the little molecule of polymer. The used concatermer of the present invention can comprise the little molecule that connects by one or more polyamide bond covalent bond.

" double helix dsRNA " used herein refers to the long-chain (at least 10 base-pairs) of standard dsRNA, and its total length is the Watson-Crick base-pair and does not have mispairing, ring, projection, inherent base pairing etc. Double helix dsRNA by the genome of many dsRNA viruses by illustration. But micromolecular binding site no matter sequence is non-specific or sequence-specific, can be crossed over 3-6 base-pair, 7-10 base-pair, or 10-20 base-pair.

" RNA dressing agent or component " refers to a compound, when its contact during RNA, affects the RNA cracking or otherwise modifies it or make it lose function. For example but the non-alkylating agent that is limited to, such as the sub-reagent of mustargen, functionalized poly-different aromatic agent, psoralen, the Lewis acid and metalchelated compound, ene-dynes of cyclopropyl before the reaction, and the high-valency metal of activation-oxygen base complex.

In dsRNA molecule field, used term " adjacent " refers to by short as 0, but is no more than the zone that about 20 base-pairs separate.

Term " double helix dsRNA base-pair specific binding " refers to the compound that the specific sequence of ribonucleotide is combined in dsRNA. On the contrary, term " double helix dsRNA base-pair non-specific binding " reaches " the structural combination of double helix dsRNA " and refers to not rely on the existence of special sequence among the RNA, but presents the existence that depends on characteristic secondary or tertiary structure and be combined with double helix dsRNA.

Term " double helix dsRNA selective binding " refers to that binding affinity is higher than between molecule and the double helix dsRNA (preferably at least high about 2-3 doubly) molecule and dsDNA, ssDNA, or the binding affinity of ssRNA. According to well known method, and the method for illustration can be carried out compatibility mensuration or estimation among this paper embodiment 3.

" combination " used herein is often referred to the non-covalent association of protein or little molecule and RNA molecule. With one or more known binding analysis, comprise but the non-gel mobility shift assay that is limited to is measured protein and is combined with the function of dsRNA.

Herein " in conjunction with than " (on-rate) refer in the given unit interval of institute the amount of the multimeric complexes that from the monomer whose precursor, forms.

" equilibration time " refer at this that two kinds of molecules reach and associate and the stable state required time that dissociates, such as RNA: protein complex.

" ratio dissociates " (off-rate) refer in this article the amount of multimeric complexes of given unit interval internal disintegration.

" dissociating " is a process, and wherein two kinds of (or more) molecules stop to interact or combination, and this process takes place with fixing average ratio under special condition usually.

" half-life " refers to the compound that associates at this, such as RNA: half of the protein complex required time that dissociates.

" saturated mark " used herein refers to rna binding protein or albumen composition and certain limits the concentration that the suitable dsRNA that utilizes of mark is combined at least. For reaching 50% saturated mark, the desired concn of rna binding protein is thermodynamics binding constant K_dIf RNA concentration is starkly lower than K_dValue. For reaching 90% saturated mark, desired concn compares K_dAt least high 10 times. Therefore, for K_dBe 1 * 10^-9The rna binding protein of M, for reaching 90% saturated mark, the amount of required rna binding protein is at least 10 * 10^-9M。

" monomer sub-unit molecule (or compound) " is the little molecule of being combined in the site on the double-stranded RNA of crossing over about 3-16 base-pair. They can present or not present the sequence-specific combination.

The little molecule that " dimer molecule (or compound) " is made up of the monomer sub-unit molecule of two covalent chemical bondings. And the monomer that produces it compares and big binding site is combined for this molecule, and common but nonessentially be combined with dsRNA with high-affinity more.

" sequence-specific in conjunction with " refers to that the RNA binding molecule presents matching the strong RNA sequence preference of the specificity base-pair sequence that exists in the double-stranded RNA fully.

" cycle tests " is to limit or be allowed to RNA sequence at the related binding site of rna binding protein combination. From context of the present invention, cycle tests preferably is embedded in the test double helix dsRNA fragment fully.

Term " polymerase chain reaction " reaches " PCR " refer to increase method of one or more specific nucleic acid sequence, wherein (ⅰ) determines single-chain nucleic acid annealing in the Oligonucleolide primers of sequence end to be amplified and the specimen, (ⅱ) nucleic acid polymerase extends 3 ' end of the primer of annealing, be complementary to anneal the with it nucleic acid chains of nucleic acid of primer to produce sequence, (ⅲ) with the sex change of gained double-strandednucleic acid to produce two single-chain nucleic acids, (ⅳ) with primer annealing, primer extension, and the program of product sex change repeats enough number of times, the sequence that is limited by primer that be easy to differentiate with generation and measured quantity.Annealing successively, extension and denaturing step are controlled by the temperature variation of reaction vessel, carry out in the repetitive cycling mode usually.Annealing and extension are typically carried out between 40-80 ℃, and sex change requires temperature approximately between 80-100 ℃." thermal cycler " typically is used for conditioned reaction as Perkin Elmer 9600 types.

Term used herein " polynucleotide " refer to have support can with the multimeric molecule of the hydrogen-bonded nucleic acid base main chain of typical polynucleotide, wherein the polymer main chain shows base in the mode of sequence-specific mode bonding to allow this hydrogen bond between multimeric molecule and typical polynucleotide.Base like this is inosine typically, adenosine, guanosine, cytimidine, uracil and thymidine.Multimeric molecule comprises two and singlestranded RNA (RNA) and DNA (deoxyribonucleic acid) (DNA), also can comprise the polymkeric substance with backbone modifications such as methylphosphonic acid key.

Term " carrier " refers to a nucleotide sequence, and it can assimilate novel nucleic acids, and in suitable hosts those new sequences is bred.Carrier comprises but non-recombinant plasmid and the virus of being limited to.The carrier (as plasmid or recombinant virus) that comprises nucleic acid of the present invention can be in carrier, as the plasmid compound with protein, and based on the compound plasmid of the nucleic acid transduction system of lipid, or other non-virus carrier system.

Term used herein " polypeptide " refers to the compound be made up of the strand of 20 natural amino acid residues that connect with peptide bond.This paper amino acid residue is with its standard single-letter mark " A, alanine; C, halfcystine; D, aspartic acid; E, glutamic acid; F, phenylalanine; G, glycocoll; H, histidine; I, isoleucine; K, lysine; L, leucine; M, methionine; N, asparagine; P, proline; Q, glutamine; R, arginine; S, serine; T, threonine; V, valine; W, tryptophane; Y, tyrosine.Term " protein " can with term " polypeptide " synonym, or can refer to the compound of two or more polypeptide in addition.In conjunction with the context of the invention, " protein complex " refers to the compound of one or more protein of combining with monokaryon ribotide fragment.This compound can be homology or allos.Usually, but utterly non-, polypeptide and protein mainly are that amino acid by natural generation forms.

This paper represents nucleic acid subunit with its standard base (SB) disjunction mark note: the T thymine; The A adenosine; The C cytimidine; The G guanine; The U uracil; But with standard I UPAC abbreviation representative change location; W, A or T/U; R, A or G; S, C or G; K:G or T/U (37CFR § 1.822).

" do not rely on the combination of base-pair sequence " and refer to dsRNA-in conjunction with combining between albumen or albumen composition and dsRNA, its binding affinity does not rely on or does not rely on basically the dsRNA sequence.

II .dsRNA:dsRNA is in conjunction with the albumen substitutability analysis

A. analyze summary

Analysis of the present invention relates to detection can destroy the double-stranded RNA (dsRNA) and the compound in conjunction with combination between the albumen of specificity combination with it.At this, term " specificity combination " means this and preferentially combines with dsRNA in conjunction with albumen, but not and ssRNA, ssDNA, dsRNA, or the preferential combination of RNA/DNA crossbred.This analyzes also suitable detection compound and combines with the sequence preference and/or the sequence-specific of special RNA sequence among the dsRNA.

This analysis can be used for detecting the various compounds that are used for the treatment of.But the most important thing is to differentiate purposes in these purposes as the compound of antivirotic, this is because this analyzes and to select to destroy and the combining of double helix dsRNA especially, double helix dsRNA is the dsRNA that length surpasses about 30 nucleotide, and it is curled into the double helix configuration.Be that known many intrusion viral pathogens are during its some or all life cycle, the long section sequence that contains complementary double-stranded RNA, and at most of eukaryotics, comprise in the mammalian cell the longer sequence of several base-pairs double-stranded sequences of length of the no any defective of self folding seldom generation (being mispairing, projection and interior ring) of the RNA single strand of transcribing.Therefore this analysis is particularly useful for the cell mechanism influence minimum antivirotic of selection to host cell.

For carrying out analytical approach of the present invention, generally to test the compound of surveying change selected dsRNA in conjunction with albumen or albumen composition with combine the albumen ability of the combination of the dsRNA fragment of combination with it, or change the ability of the compatibility of this binding interactions.Compound can suppress or strengthen dsRNA combining in conjunction with albumen or albumen composition and dsRNA fragment.Do not exist time institute's survey level to compare in conjunction with level with there being this test compounds in the time of will having compound to exist, if the limit that is higher than selection in conjunction with level when having this compound to exist is then selected this compound as only 1/2 or 1/3.

These characteristics of the present invention elaborate in following and embodiment 3, and following chapters and sections are set forth the design and the selection of the various components that form the fundamental analysis potpourri.

B. the component of Fen Xiing

Basic binding analysis comprises a reaction mixture, its by (ⅰ) dsRNA in conjunction with albumen, (ⅱ) in conjunction with albumen with the non-base-pair sequence mode dsRNA fragment of combination with it, (ⅲ) test compounds of depending on.Monitor this and be reflected at or do not have under the situation of test compounds, the protein-bonded difference of dsRNA is in conjunction with level.

1, dsRNA is in conjunction with albumen

Although many dsRNA isolate and identify from cell or viral source in conjunction with albumen, but the research to these protein does not disclose known dsRNA in conjunction with albumen, or more particularly, dsRNA is in conjunction with the sequence-specific that combine of protein structure domain (dsRBD) with dsRNA.In addition, for at least one quasi-molecule, particularly vaccinia virus E3L and PKR, although independent protein monomer can be very little (crossing over less than about 10-20bp), but be tending towards forming the cooperation bonding unit in conjunction with albumen or domain, the compatibility that two or more protein subunit like this combines with the RNA sequence is than any protein monomers or protein domain height.

The test of supporting the present invention to carry out shows that the simple protein type almost can be used for analyzing any RNA sequence, and it is by carrying out in the dsRNA fragment of corresponding sequence (cycle tests) being inserted qualification, and is as described below.By protein and the dsRNA fragment that contains this sequence and compared, can detect micromolecule with the cycle tests specific bond with the feature that combines of other dsRNA fragment that contains different cycle testss.

When selecting to be used for dsRNA of the present invention, need to consider following related matters in conjunction with albumen:

(ⅰ) protein preferably with the dsRNA specific bond, and not with ssRNA, dsDNA, or ssDNA combination, or may combine with the RNA/DNA crossbred.

(ⅱ) depend on analytical model, dsRNA: the half life period of protein complex should enough lack, and finishes this analysis between in due course.Destruction with medicine mediation of the compound of growing very much the time of dissociating is difficult to measure.Perhaps or in addition, the mode of can " competing " is analyzed, and wherein tests the dsRNA fragment by being exposed to simultaneously with test compounds and in conjunction with albumen, or passes through test molecule and dsRNA molecular mixing, add at once subsequently in conjunction with albumen and measure in conjunction with competition, rather than in conjunction with displacement.

(ⅲ) half life period of compound is answered long enough, in reasonable time, to measure unconjugated RNA, for example, the level of free RNA is by measuring free RNA required time with during minute, because the ratio between the amount of the free RNA of the natural generation of complex dissociation shows.

In view of above-mentioned two considerations, practical RNA: the protein half life period can be by faster or the adjusting of " in real time " detection method than short-half-life in about 2 minutes～several days scopes, than the long half-lift can be by making regulating of analysis in conjunction with conditional instability.

A. viral dsRNA is in conjunction with albumen

Described in the prior art some derived from the dsRNA of virus in conjunction with albumen.But recognize that the going of selection replaced specific dsRNA and be not limited to be used for the cause of disease source of resistive connection hop protein in conjunction with protein bound compound, and can more be widely used as antivirotic, even cell modulator.

For example but non-being limited to, being used for a dsRNA that the present invention analyzes in conjunction with albumen, is that vaccinia virus E3L dsRNA is in conjunction with albumen.Being used for other dsRNA of the present invention is people PKR (hPKR) and mouse PKR (mPKR) in conjunction with albumen.In supporting the test that the present invention carries out, E3L, hPKR, the dsRNA binding structural domain of mPKR and Staufen are that reorganization produces, and as described in embodiment 1, and are being purified (embodiment 2) as before the component of binding analysis.

Fig. 1 illustrates E3L, hPKR, the clone of the dsRNA binding fragment of mPKR and Staufen and make up graphic.Briefly, application is based on the known array of open reading frame (ORF) and the regioselective forward and the inverse PCR primer of the interior dsRNA binding structural domain of ORF, can obtain to encode these protein d sRNA binding structural domain the PCR fragment (for example, Ho, C.K., et al., Virology 217:272-284,1996).Restriction endonuclease sites (seeing that Fig. 1 shows) is imported in the primer, to promote the clone of PCR fragment.As shown in the figure, the PCR fragment is connected with carrier to be provided at the expression (as the tac promoter in the pGEX-2T carrier) under the inducible promoters control.After transforming appropriate host cell system, the dsRNA binding structural domain is expressed as fusion, is purified through standard method then, as described in embodiment 2 and 6.

Can be used for the present invention's analysis in conjunction with albumen or its fragment derived from some other suitable dsRNA of virus.Be used to select special directed break virus dsRNA-dsRNA in conjunction with albumen between during the therapeutic agent of combination, best but nonessential utilization derived from the dsRNA of virus in conjunction with albumen.

For example, reovirus σ 3 albumen are main shell body components of reovirus particle, it also presents dsRNA in conjunction with activity, having its about 85 amino acid by about 233～305 amino acids of 365 residue sequence of dsRNA binding structural domain (dsRBD) at its C-end forms, (Yue, Z., et al., J.Virology 70:3497-3501,1996).σ 3 shown to late period virus mRNA translation stimulated in vitro effect (Mabrouk, etal., Biochem.Cell Biol.73:137-145,1995) is arranged.Total length σ 3 albumen can be cloned and stably express, as expressing in mammal (HeLa) clone according to the method for announcing.(Yue, Z, et al., J.Virology 70:3497-3501,1996, be incorporated herein for referencial use).To this modification of program, use above-mentioned clone, can be used for producing the dsRBD that the C-end region is derived, it also can be used for analytic approach of the present invention.

Non-viral dsRNA comprises in conjunction with albumen, but non-being limited to derived from 140 of chicken lung, 000 daltonian Z-DNA is in conjunction with albumen (Herbert, et a1., Nucleic Acids Symp.Ser.33:16-19,1995): the terminal binding structural domain (Cerritelli of saccharomyces cerevisiae RNase H1 N-, S.M., RNA 1:3,246-259,1995); La (SS-B) autoimmunity antigen, its dsRNA that untwists, thereby and suppress the protein kinase (PKR) (Xiao, Q., etal, Nucleic Acids Research, 22:2512-2518,1994) that dsRNA activates; The TRBP (Park, H., et a1., Proc.Natl.Acad.Sci.91:4713-7,1994) that combines with HIV-1 Rev-response element RNA derived from the HeLa cell; (two kinds of forms: a kind of interferon is derivable, and another is a composing type for people K88 clone's dsRNA specificity adenosine deaminase; Patterson, et al., Mol.Cell.Biol 15 (10): 5376-5388,1995); DRAF1 and DRAF2, it participates in causing in the replying of adenovirus or dsRNA, and the activity of the gene that interferon stimulates is transcribed (Daly, C., et al., Mol.Cell.Biol.13 (6): 3756-3764,1993).

B. test the dsRNA fragment

For being used for the present invention's analysis, the dsRNA fragment is a little double helix RNA molecule preferably, and preferred length is at about 10～50 nucleotide.Most of dsRNA by being used for this analysis is in conjunction with the optimum length of protein determination dsRNA fragment.The test that support the present invention of the following stated carries out provides and has been used for optimizing the guidance that the present invention analyzes used dsRNA fragment length.

Combine with the sequence preference or the specificity of test compounds for detecting, it is transformable to comprise one or more to make up the dsRNA fragment, the base-pair sequence of qualification.

Can produce dsRNA by many modes.For example, on the standard oligonucleotide synthesizer, chemosynthesis complementary strand, and mixing separately realizes that annealing is to form dsRNA according to well-known process.Perhaps, the another kind of synthetic method of using the primer that is complementary to the priming site that is positioned at test oligonucleotides top chain 3 ' end can be used to produce dsRNA.Should be used in the prescreen stage usually by synthetic oligonucleotides, with distinguishing sequence specificity and the non-specific RNA binding molecule of sequence.

The RNA molecule also can synthesize in the in-vitro transcription system, and wherein the hair clip oligoribonucleotide is synthetic from dna profiling (that is: linear order comprises cochain, the ring sequence of stem, descends chain to be complementary to the stem cochain then).Use this kind of strategy the dsRNA oligonucleotides of self-annealing is combined with the inherent test site of specificity, this site normal length is 3-8bp.For having the oligonucleotides that mixes the base test site, the part hairpin can be transcribed from dna profiling (be the cochain stem, ring reaches part chain stem down), makes it to anneal and be used to cause the synthetic of residue trunk structure.

Many dsRNA have the ability that damaged RNA is arranged in long complete complementary double-stranded RNA and shorter dsRNA or its secondary structure of distinguishing in conjunction with albumen.For example, in supporting the test that the present invention carries out, the dsRNA that finds 30mer be E3L dsRNA land (dsRBD) efficiently in conjunction with required, and combine with molecule than short molecule such as 19mer, only detect low-down level (if any) (Fig. 4).

Significantly, hPKR is combined with dsRNA, protein combines with dsRNA with cooperation mode, and this is owing to improve in conjunction with rendeing a service also with the increase of RNA size.The single dsRNA land of hPKR occupies about 11 the base-pair sites on the dsRNA, is equivalent to the corner of A type dsRNA.But only combine with short dsRNA like this and under saturated protein concentration, can be proved.Relatively preferably in conjunction be with observe during the dsRNA of 16mer combines, with length be that the binding affinity of the RNA of 22～24 base-pairs obviously increases, this RNA can be fit to the PKR dimer.Combine the combination that can observe further increase with longer dsRNA.30 base-pairs provide stronger combination, and are minimal size (Manche L., et al., Mol.Cell.Biol.12:5238-5248,1992 of activating PKR with dsRNA; Schmedt C., et al., J.Mol.Biol249:29-44,1995; Bevilacqua P.C.et al., Biochemistry 35:9983-9994,1996).

Fig. 2 illustrates combining of vaccinia virus E3L dsRBD and the radiolabeled 30mer double helix dsRNA fragment with SEQ ID No:8 of the present invention (5 '～3 ') sequence.See that in conjunction with condition this paper embodiment 3 is described, and show combination by the radioautography of 6% retardance gel.As shown in the figure, in this analyzes, increase the protein-bonded amount of E3L, cause the dsRNA of 30mer to increase to accumulate and have higher apparent molecular weight, corresponding to band at the 30mer-E3L at gel top compound.Under used condition, calculate the K that is used for combination _dAbout 4-7nM.On the contrary, even in the concentration high as 400nM, E3L albumen can not be effectively with ssRNA ( ³²The 1B of p mark) or the RNA/DNA crossbred in conjunction with (Fig. 3).

Further test illustrates, and E3L albumen requires the dsRNA fragment of a minimum gauge with effective combination.It is the function (illustrating at the gel top) of dsRNA length in conjunction with the formation of compound that Fig. 4 illustrates E3L-dsRNA.Can determine that by these tests 30mer and combining of E3L almost are 50～100 times of 19mer, and the combination of 22mer and 26mer is only slightly good than 19mer.

C. test compounds

Although analysis of the present invention in theory can be tested any compound, in view of the therapeutic purposes of being analyzed the compound of differentiating by screening, some materia medica consider to influence the selection of the library of molecules that is used to screen.Generally, be more preferably less than the micromolecule of 1,000 molecular weight preferably less than the micromolecule of about 10,000 molecular weight.The preferred permeable cell of going into of this compound, and preferably be not polypeptide or polynucleotide, and it is tending towards the degraded sensitivity to endogenous cell mechanism.But concatermer of the present invention can connect through amido link (peptide bond).In addition, when being injected into vertebrate, man-hour especially, as if micromolecule generally be not easy to bring out immune response.Many drugmakers have the extensive library of micromolecular compound, no matter entity discrete or that mix all can be by Analysis and Screening of the present invention.Micromolecule can be the synthetic organic or inorganic compound of biological or chemical.Synthetic library can get through being purchased, comprise but the non-Comgenex of being limited to (Princeton, NJ), Microsource (New Milford, CT), Brandon Associates (Merrimack, NH), Aldrich (Milwaukee, WI).Derived from the native compound library of plant or animal extracts can from as Pan Labs (Bothell, WA) and MycoSearch (NC) be purchased.The library also can systematically be modified to produce derivative compound known or that be easy to differentiate and be used for test.Further should be appreciated that in the present invention, by the compound that screening method described herein is selected in screening for the first time, can be through the also further dsRNA that selects to strengthen of chemical modification in conjunction with character active or that more pharmacy was fit to.So the compound of the chemical modification of selecting is also thought to analyze by screening of the present invention and is selected.

C. catch and detection system

1, conventional method

Any seizure/detection method known in the art can be used for all determining that dsRNA is in conjunction with the binding capacity of albumen and dsRNA fragment in binding analysis of the present invention.One of rna binding protein or test polynucleotide passage or both all can directly be labeled, or use indication molecule such as fluorescent dye, radioactive isotope and enzyme indirectly, carry out mark according to well known method.Normally, be incorporated herein Howard for referencial use, G.C.et al., on-radiation detection method (Appleton ﹠amp; Lange, Norwalk, CT, 1993) in can find the method that some are suitable.

A typical detection system of using in supporting the test that the present invention carries out is that gel shift rate change (" band displacement ", " gel displacement ") is analyzed, and it is described that method sees embodiment 3.At this, the dsRNA fragment is to use ³²P is end-labelled, and under designed condition reaction product is carried out gel electrophoresis, to detect the difference of apparent molecular weight.Show gel by radioautograph, and different by with the bright combination of scale of the dsRNA that migrates to the radioactivity of a certain position in the gel in conjunction with albumen altogether, corresponding higher molecular weight shown.(MountainView CA) can be by quantitatively for or Storm Phos phoimager, Molecular Devices by commercially available gel scanner for this gel.

Other seizure and detection method can comprise directly, indirect or competitive way, and can use compatibility capture system such as streptavidin/biotin combination or immuno-chemical reagent, wherein one or more is in conjunction with albumen and RNA fragment, or the mark of these components or sign are captured.So analyze the drug-induced reduction and the increase that are used for detecting combination between analysis dsRNA fragment and dsRNA are in conjunction with albumen.In conjunction with increasing expression two intermolecular compatibilities with drug-induced increase, expression dissociate than reduction, or the two all has in conjunction with than increase.The medical compounds that shows these characteristics also can be used for Gene regulation or medicine orientation.

One typical capture system utilization " biotin is protected protection " system.At this; base in biotin molecule and the protein binding site is connected; connected mode is to make not multilated of combination of proteins; and when protein combines with the site; biotin is protected not to be combined with streptavidin; expose biotin by medicine displacement conjugated protein, it combines with streptavidin then.This type analysis is used for scintillation proximity assay, and (SPA, Amersham) mode is with quantitative to combination.At this, radiolabeled ( ³³P) the dsRNA molecule is caught by the SPA pearl of the streptavidinization of flooding with scintillator.Radioactive isotope in oligonucleotides (as ³H, ³³P) getting close to of pearl made the pearl flicker.The existence of the effective dna binding molecule of one signal indication; Cycle tests provides higher signal to represent that this analysis is used for high flux screening at not homotactic relative advantage, with screening dsRNA binding compounds (embodiment 7 and 8).Owing to can be higher than the signal of observation base, thereby the substantivity of this analysis can be screened the complex set zoarium of sequence.

Can carry out a similar analysis mode, but wherein the label of other little quencher such as fluorescein combine with binding site.

The filter membrane binding analysis is also applicable to the present invention, and the foundation of this analysis mode and analysis power territory are known.

Other can comprise with the suitable analysis that analysis joint of the present invention is used but non-be limited to shown below: use the indirect SPA of antibody to catch analysis of fluorescence polarization (anisotropy; Checovich W., et al., Nature 375:254-256,1995) multiple mass spectrum enzyme-linked immuno assay (ELISA) RNA PCR identifies (seeing following)

This analysis also can be carried out on biochip, and this can improve the capacity and the complexity of sequence that can be detected greatly.The method and top listed many methods can be used for adapting to dsRNA binding analysis of the present invention with high flux screening.

2, RNA pcr amplification and evaluation

Above-mentioned analysis can with amplification method logotype (polymerase chain reaction (PCR) in one embodiment; Mullis, K.B., et al., United States Patent (USP) 4,683,202 and 4,683,195; Editors such as Innis, PCR scheme: method and application guide, academic press company (1991)), to finish test molecule with it in conjunction with being the discriminating of most preferred RNA sequence.

In this embodiment of the present invention, the synthetic dsRNA test fragment that contains following element:

(ⅰ) dsRNA promptly screens the site in conjunction with the binding site of albumen (as E3L),

(ⅱ) be embedded in the screening site, have one at least by 2 above base-pairs and preferably be less than the cycle tests that 20 base-pairs (more preferably 3-8 base-pair) are formed, and

(ⅲ) means that increase of the sequence of separate selecting, as, in the base of enough numbers of test site sequence flank with priming site, or as the restriction site that is used to promote clone as pcr amplification.

Priming site also can be used as the primer binding site of dideoxy sequencing reaction, and can contain the restriction enzyme cutting site that promotes clone operations.

So one of example of test oligonucleotides is the SEQ ID NO:1 shown in Fig. 7 A, and it contains all possible 3-mer arranges.These type of polynucleotide can be divided so that the analysis of set to be provided again.In the analytical form of set, as described below as confirming the analytical form of logotype with the PCR of binding sequence, all possible (4 ³=64) tripolymer or (4 ⁴=256) four base-pair sequences should be in the aggregate of test dsRNA fragment with etc. mol level present.From then on find out among the embodiment, for 8 base-pair cycle testss, all possible base-pair sequence (4 ⁸=65,536) will in analyzing, this present with equimolar amounts.

With regard to any strand test polynucleotide aggregate, single chain molecule and primer annealing, and by chain under the primer extension reaction enzymic synthesis.The advantage that the present invention uses this analysis/amplification PCR circulation embodiment is to be convenient to study bigger cycle tests in this embodiment.This scheme is particularly suited for measuring high-affinity binding sequence, rather than measures putting in order of all cycle tests combinations; This arrangement can be measured by screening as above-mentioned independent sequence.

3, measure the interior combination of test oligonucleotides mixing aggregate with the dsRNA binding analysis

Use double-stranded test rna fragment, this fundamental analysis is as described below substantially carries out (D part): typically do not use the radiological measuring system.Any RNA: the protein combination can be used for this analytic system.One typical combination is as the embodiment 3 described dsRNA lands (dRBD) that combine the E3L albumen of using with the dsRNA molecule.

In this embodiment of the present invention, with E3L dRBD add test oligonucleotides aggregate in the reaction mixture (for example, it is interior that oneself contains the test dsRNA polynucleotide passage of 256 four base-pair cycle testss, these cycle testss in above-mentioned oligonucleotides aggregate with etc. mol level present), as described in embodiment 3.The test candidate compound by with cycle tests in conjunction with and to E3L RNA: the different damage capabilities of protein complex combination.Adding test molecule (as compound) afterwards, with analysis of mixtures incubation required time derived from combinatorial libraries, fermentation broth or fungal extract.Then with dsRNA one in conjunction with separating among the dsRNA of albumen composition by means known in the art combination never.One suitable separation and authentication method is preparation gel band shift analysis, wherein the dsRNA polynucleotide passage is that radioactivity is end-labelled, and by native gel potpourri is carried out electrophoresis, carry out radioautograph then, to show protein bound and unconjugated dsRNA fragment.Perhaps, this analysis of mixtures can separate by chromatography such as HPLC.

In an embodiment of this analysis, with the round pcr unconjugated dsRNA that increases.With equal portions of gained pcr amplification thing again through RNA: protein bound analysis and pcr amplification, to detect and to differentiate the sequence that protein is therefrom replaced during binding analysis.Using each order filtrate repeats these separation and reactions steps several times.Behind each pcr amplification, reserve part pcr amplification thing carries out sequencing analysis.By repeating to analyze/circulation of amplification program, the result is that the test oligonucleotide sequence that is amplified contains is the cycle tests in test molecule preferred combination site.Through analysis/amplification cycles subsequently, these oligonucleotides are amplified, with the RNA molecule total group of the amplification of representing more and more number percents.

Briefly, preferably the PCR strategy that screens the enhancing of analysis joint with the present invention is " iteration form ", may further comprise the steps:

1, from containing the sequence synthetic set of single stranded RNA in drug test district at random.

2, use the RNA primer, NTPS, and RNA dependent form rna polymerase activity copy single stranded RNA are to produce double-stranded RNA.

3, use combination of the present invention and selection and analyze isolation of RNA from free RNA: protein complex.This can be undertaken by natural gel mobility shift assay.

4, with the RNA (be emitting isotope end-labelled) of RNA in conjunction with the protein bound of test compounds displacement minimum detectable range measurement, (promptly by titration).

5, the RNA that replaces with the pcr amplification medicine.Double-stranded DNA PCR product is checked order, with the consensus sequence in the observation test site.

6, transcribe double-stranded DNA to produce the aggregate that screens the single stranded RNA of selecting.

7, if desired, repeat the 1-6 step, obtain enough materials that detects.

Except PCR, unconjugated dsRNA component can be through other method amplification.For example, the rna transcription in the filtrate can be become corresponding dna molecular, be cloned into the carrier (as phage vector, as bacteriophage lambda, or standard cloning vector such as pBR322 base or pUC base carrier) of selection.Sequence with this clone is converted in the suitable hosts then, wherein the carrier of Xuan Zeing reproducible (as bacterium or yeast).Cultivate the host transformed body, amplification simultaneously contains the carrier of clone's sequence.Then by standard program (Maniatis, et al., Sambrook, et al., Ausubel et al.) carrier of separating.Typically, derive from the clone's of RNA filtrate sequence at first, separate (for example, the swimming of the electric current of digestion product separates, subsequently with corresponding cloned sequence electroelution) (Ausubel et al.) by restriction enzyme digestion and size fractionation and derive from carrier.The test oligonucleotide sequence of the amplification of these separation can be continued circulation through above-mentioned analysis/amplification more then.

In another embodiment, the oligonucleotides that exists in the original RNA filtrate can be separated, order-checking and external synthetic amplification that copies by oligonucleotides.

To the dna sequencing of amplification, according to well known method, use automatic sequencer, application examples such as radiolabeled primer and dideoxy sequencing method or standard chemical process check order to each circulation sample.If the sequence of amplification is not enough to explanation and obtains non-ambiguity sequence information, then gained cDNA is further purified and checks order.

Another embodiment is removed the dsRNA amplification step.In this embodiment, analysis of mixtures contains oligonucleotides aggregate and dsRNA in conjunction with albumen.With the test compounds incubation then with separating as HPLC.The HPLC system that is purchased can provide very high resolution.The HPLC component of analysis of mixtures can be by mass spectrophotometry.But derive from the preferred combination sequence of mass spectral clip types differential test compound.

4, measure the modification of the downstream factor

The another kind of mode of estimating combination is utilized the cascade of biology incident.When dsRNA was imported eukaryotic host cell, it can activate the biology cascade of events in cell.Fig. 8 is illustrated in the mammalian cell diagram of dsRNA being replied protein kinase (PKR) cascade that the dsRNA of generation activates.As shown in the figure, when combining with dsRNA, PKR carries out autophosphorylation, but it makes other substrate comprise the indicant PKR protein substrate phosphorylation of eIF-2 and/or other phosphorylation thus, and these substrates can be present in the potpourri or be added into wherein, as scheme represented.The phosphorylation of eIF-2 causes protein synthesis to reduce.Therefore, when reaction mixture also contains various components and reagent such as ATP, can be to the interference that combines of dsRNA and PKR in each step measurements of this approach-for example, PKR as shown in FIG., the phosphorylation level of eIF-2 or indicator protein, or protein synthesis level.

D. analysis condition

1, fundamental analysis condition

Analysis of the present invention provides a kind of the discriminating can destroy dsRNA in conjunction with albumen or the protein complex method with the compound that combines of dsRNA.In brief, aforesaid test compounds is mixed existing dsRNA to combine albumen with dsRNA under the situation of the dsRNA fragment of combination with it in conjunction with albumen.Under the situation whether compound exists, measure dsRNA fragment and the protein-bonded level that combines, and contrasted.If when having medicament, show tie water dawn and reduce, think that then this test compounds can destroy the protein-bonded combination of dsRNA:dsRNA.Perhaps, this analysis can be used for detecting and strengthens dsRNA in conjunction with the compound that combine of albumen with dsRNA, gets final product in conjunction with the level increase existing under the situation of compound by monitoring reaction simply.In the present invention, term " significantly " or " effectively " expression that is used to set forth in conjunction with level tested and contrasts in conjunction with having between the level on the statistics obviously different.Can measure significance,statistical by the whole bag of tricks known in the art, as long as this method is applicable to analytical form of the present invention.

In supporting the test that the present invention carries out, it is described to see embodiment 3, usefulness γ- ³²P ATP uses 30mer RNA polynucleotide ³²P is at S ' end mark.Will ³²The oligonucleotides annealing P mark and unlabelled is to produce double-stranded 30mer RNA.In parallel experiment, with 30merRNA and the annealing of complementary DNA molecule, to produce double-stranded 30mer RNA/DNA crossbred.In other test, similarly produce 19mer, 22mer and 26mer RNA double helix molecule.

In the presence of suitable double helix RNA (or RNA/DNA crossbred) fragment, will be as the reorganization E3L albumen (1-400nM) of generation as described in embodiment 1 and 2, adding contains in the reaction mixture of 0.2nMRNA or RNA/DNA crossbred.After at room temperature reacting 30 minutes, sample pipetting volume is blocked gel in 6%; Treatment gel is also carried out radioautograph, monitors the detection of combination by the migration position of observing radiolabeled RNA in the also quantitative gel.

The following stated result has disclosed the ability of E3L in conjunction with double-stranded 30mer RNA oligonucleotides, and by contrast, E3L combines deficiency with ssRNA or RNA/DNA crossbred.Also set forth E3L preferred to the ribonucleotide formed by at least 30 base-pairs.

2, the effect of test compounds in analysis

Fig. 5 (A-D) illustrates dsRNA binding analysis diagram, and dsRNA shown in it combines with 30-mer in conjunction with albumen, should understand and show that making protein-bonded structure can be simple protein or the protein complex be made up of two or more protein subunits.Fig. 5 B illustrates medicine or the test compounds that combines with the core of 30-mer dsRNA molecule, thereby this combination suppresses the binding ability of dsRNA in conjunction with albumen and 30-mer.According to a hypothesis that does not limit the present invention in any way, the dsRNA center exists compound to produce the equivalent of 2 15-mer; Because find in advance in conjunction with albumen the combination than micromolecule obviously to be reduced (Fig. 4), the combination of fragment or illustrated 10mer fragment (Fig. 5 C) correspondingly reduces therewith.Fig. 5 D illustrates near the situation of the medicine combination end of dsRNA fragment.It is undesirable that this construct is considered to this analysis usually, this be since combine with stub area be not enough to can measure the combining of displacement or destruction and polynucleotide sequence.

In supporting that the present invention tests, a kind of known intercalator ethidium bromide added contain in the reaction mixture of 30-mer dsRNA oligonucleotides, incubation 30 minutes adds E3L then, and with reaction mixture at room temperature incubation 30 minutes again.By above-mentioned gel retardation assay analytic sample.

Fig. 6 A and 6B illustrate the result of these tests, and ethidium bromide can stop E3L to combine (Fig. 6 A) with dsRNA more than 10 μ M concentration, and when gel also contained 3 μ M ethidium bromides, low concentration (3.3 μ M) can effectively reduce in conjunction with (Fig. 6 B).The actual K of these results suggest _dBe lower than 3 μ M probably.In the test findings that ethidium bromide is added reaction mixture before or after the E3L incubation is similar.Except that the information that provides about the associativity of ethidium bromide, this test is also as the example that can be used to estimate with dsRNA or other polynucleotide binding affinity.

In other test described herein, with rna binding protein, Staufen, E3L, mPKR and hPKR and length are that the double helix dsRNA of 30 polynucleotide cultivates.Figure 12 illustrates all four kinds of equal high-affinities of albumen and combines with dsRNA.The hPKR binding affinity is the highest.Test the effect that known RNA bound drug combines with double helix dsRNA hPKR then.As shown in figure 14, when these medicines of test, as what expect, neomycin and dsRNA binding affinity are the highest.

Then, this analysis is used to screen the bias library of noval chemical compound, and to differentiate the compound that combines and replace hPKR with dsRNA, 144 kinds of compounds of screening have 9 kinds of energy to combine and replace hPKR with dsRNA.

More than tested illustration when the result type of finding that compound obtains when stoping dsRNA to combine with dsRNA in conjunction with albumen.Ying Zhiwei makes this compound become suitable drug candidates, should carry out further toxotest.For example, as above the toxicity of the compound of Xuan Zeing can be tested in mammalian cell, guaranteeing this compound when not having dsRNA to exist, can not be non-selective in conjunction with the host cell endogenous polynucleotide of other form or otherwise influence cellular metabolism.

3, test and special RNA sequence combines

Should recognize the combination in the specific bond site of all possible given length, all can mix theoretically in the single dsRNA polynucleotide with qualification sequence.For example, with regard to the 3-nucleotide binding site, have 4 ³=64 kinds of possible combinations can be mixed (Fig. 7 A) in the 34-mer dsRNA sequence.So sequence one example sees shown in Fig. 7 A that wherein all possible 3-mer represents with "+" or "-" chain.Be the purpose of screening analysis, the 34-mer sequence can be divided into some oligonucleotides.For example, can be bordering on and be divided into 2 oligonucleotides, each has unique cover 3 nucleotide binding sites (Fig. 7 B).Provide flanking sequence to be used for enough sizes of the dsRNA of combination with assurance.Fig. 7 F and 7G illustrate two nucleotide oligonucleotides with flanking sequence, and it provides all 64 kinds of 3 nucleotide binding sites may make up together.The oligonucleotides of Fig. 7 F is biotin labeled, and is used for scintillation proximity assay.This 32-mer group contains all 64 kinds of not having the 3-mer of Feng Yu sequence and may make up.The double helix oligonucleotides can be considered to 32-mer group to be easy to analysis among Fig. 7 A.When this double helix was considered to 32-mer group, any two or more oligonucleotides can be differentiated that it provides all 64 kinds of 3 nucleotide may make up together.

Similarly, in 8 nucleotide, can provide all possible 4 ⁴=256 kinds of 4-nucleotide binding sites (Figure 11).In another embodiment, each oligonucleotides has been introduced two or more binding sites, shown in Fig. 7 C.In this case, the 34-mer sequence can be divided into 2 above oligonucleotides.For example the 34-mer sequence can be divided into 4 nucleotide, and each carries 2 copies (Fig. 7 C) of about 25% 34mer sequence.Nucleotide sequence is rearrangeable in one of copy of each oligonucleotides, to promote the exact annealing process of oligonucleotide chain.For carrying out the binding sequence The specificity of this compound, the 34-mer sequence can further be divided into more number nucleotide, and each is with the part of single (Fig. 7 D) or a plurality of (Fig. 7 E) 34-nucleotide sequence.

With mixing many binding sites, the polynucleotide shown in Fig. 7 B, 7C, oligonucleotides carry out the preliminary screening (preliminary election) of compound.Carry out the sequence-specific evaluation of compound with being similar to the oligonucleotides shown in Fig. 7 D and the 7E subsequently, oligonucleotides is designed in the subclass of pre-selection step in conjunction with the nucleotide binding site of certain compound.Carry out RT-PCR research simultaneously to confirm the binding site of dsRNA sequence-specific compound.

III, dsRNA bond

A, micromolecule concatermer dsRNA bond

According to an important feature of the present invention, above-mentioned screening analysis can be used for differentiating (ⅰ) relative with dsRNA than high-affinity in conjunction with (as Kd micromole level or on) thereby and the compound that combines with RNA in conjunction with albumen of inhibition, (ⅱ) compound that combines with double helix dsRNA sequence-specific, or (ⅲ) compound of non-sequence-specific and dsRNA structure specific bond.According to the present invention, sequence-specific and non-sequence-specific compound all can be used for forming to dsRNA specific multi-joint dose with enhancing.Can be from the non-specific compound of independent sequence, or independent sequence-specific compound, or from its combination, form preparation.This two compounds all can be used screening analysis described herein and differentiate, based on its characteristic, and can be by catalog classification so that form the multi-joint double helix dsRNA bond of customization.

According in this respect, more particularly visible the present invention sets forth and comprises and combining with the base sequence specificity with dsRNA and the dsRNA bond of non-base sequence specificity combination.The information design of said preparation derived from binding analysis sees following.When differentiating that target dsRNA divides the period of the day from 11 p.m. to 1 a.m (as by selecting the known specific virus of being regulated in conjunction with albumen by dsRNA of its genome), the sequence of rna gene group, or its part, can be differentiated, use the library of compounds that limits by screening in the analysis of aforementioned part, design the concatermer of two or more micromolecule dsRNA binding compounds.Can according to can sequence selective ground and 3-16 particularly, or preferred 3-8 the base-pair sequence of also finding in the target gene group is in conjunction with one or more compound of selection.Select second kind with viral genome in adjoin or compound that near district (in about 20 bases) combine, and this second kind of compound connected through suitable chemistry, comprise but non-being limited to used polynucleotide joint, peptide linker, polysaccharide interval base etc. is connected with first kind of compound, and is as described below.

Perhaps, according to an importance of the present invention, concatermer can be made up of the compound that combines with the non-sequence-specific of dsRNA.So combination is particularly useful for resisting unknown aetology and/or not clear infectant.More preferably, this preparation is made up of the potpourri of sequence-specific and non-sequence-specific molecule.

The gained preparation is preferably by first and second kinds of covalently bound linearities that form of compound, non-oligonucleotides concatermer, and as described below, at least a compound combined to provide with the base specific in 3-8 base-pair zone among the target dsRNA during optional majority was conjuncted.Other compound of selecting for the formation concatermer can be sequence non-specific binding or sequence-specific (base specific) combination.

As mentioned above, using at least a advantage that is the concatermer subunit of sequence non-specific binding is: it enlarges the organic scope that can be hit by this preparation target potentially.This wide spectrum preparation is particularly important in resisting the viral pathogens (as influenza virus) with unknown and/or high mutator group sequence.

This advantage that produces the multi-joint approach of antivirotic partly depends on following analysis.Any special RNA of screening discerns 2-4 base-pair site only in conjunction with micromolecule in promptly analyzing.Even this identification is very specific, this molecule still may be toxic to host cell, although this is because mammalian cell does not generally have the long sequence of double helix RNA, for example has short sequence really in the hair clip district of transfer RNA (tRNA).But the genotoxic potential of RNA bound drug can be by producing dimer, tripolymer or polymer with these medicines and obviously reducing, and this is owing to so many conjuncted preparation will may be the zone combination of virus with long.

In addition, consider from the theory that is accompanied by medicine and the Gibbs free that combines of dsRNA, dimeric inherent binding constant should be the monomer binding constant square.The binding affinity that tripolymerization produces in theory should be autohaploid subunit or allos monomer subunit compatibility cube, trimerizing has produced in the DNA system to have up to 10 ^-12The compound of M compatibility (Laugaa, et al., Biochemistry 23:1336,1985).

As a false example of intending, if dsRNA bound drug X that will be weak relatively is Dimerized, itself and 4bp site binding affinity are 2 * 10 ^-5M, the theoretical compatibility in this pair-X medicine identification 8bp site will be 4 * 10 ^-10M.Compatibility between monomer X and the two-X-shaped formula differs 200,000 times.

Two kinds of direct benefits with moderately toxic monomer medicine Dimerized (or polymerization) are arranged.At first, because than high-affinity, thereby required drug concentration is lowered, so that even also useful as drug of relative toxicity molecule.Secondly, because toxicity is mostly with relevant with genome and/or the drug molecule average that combines with transcript or rRNA, owing to the length by the increase binding site improves specificity to longer dsRNA domain, thereby toxicity is lowered.Yet, preferably before selecting as potential therapeutic agent, test compounds in cytotoxicity analysis.

Should point out at this, screening technique of the present invention produces a compound as the dsRNA bond " storehouse " with high combination potentiality, if found 50～100 dsRNA in conjunction with the monomer part, expression and 250～500 high-affinity sites and 1000～2500 potentiality that moderate compatibility site combines.Therefore, the probability of finding the high-affinity medicine binding site of the significant target site of some suitable medical science is very big.In addition, the heterodimer medicine can be designed to mate 8 or the RNA target site of a plurality of bp, provides specificity to potential drug.

As mentioned above, in case the sequence preference of more known molecules, this information can be used for designing and has the oligomer molecule of very big sequence-specific with very high binding affinity, or concatermer (homology or allos condensate).For example, if a dsRNA binding molecule X and 4bp sequence 5 '-ACGU-3 '/5 '-ACGU-3 ' are 2 * 10 with balance compatibility constant ^-5M combination, then the dimer X of X ₂Should be (2 * 10 with binding equilibrium compatibility constant ^-5M) ²=4 * 10 ^-10M binding sequence dimer, i.e. 5 '-ACGUACGU-3 '/5 '-ACGUACGU-3 ' (SEQ ID NO:2).This dsRNA is in conjunction with dimer molecule X ₂With higher sequence specific recognition 8bp sequence, have in theory than RNA in conjunction with high 200, the 000 times binding affinity of monomer X.

Identical argument may extend to the tripolymer X of tripolymer molecule: X ₃To be 8 * 10 with theoretical balance compatibility constant ^-15M is in conjunction with the 12bp sequence, 5 '-ACGUACGUACGU-3 '/5 '-ACGUACGUACGU-3 ' (SEQ ID NO:3).The RNA conjugated polymer that makes up with said method can be the homology or the allos polymkeric substance of parental generation compound or the oligomeric compounds be made up of the subunit of parental generation compound.The homologous polymerization thing is the molecule with subunit's structure of two or more same monomer RNA binding molecule.The allos polymkeric substance is the molecule with subunit's structure of two or more different monomers RNA binding molecule.Oligomeric compounds is to be mixed and made up by the fragment of parental generation compound, and can be allos or autohaploid.

RNA can be formed allos or homologous polymerization thing by chemical coupling in conjunction with subunit.Subunit can directly be connected to each other, as the family of distamycin molecule, or subunit's availability interval molecule such as carbochain or peptide bond connection.The coupling of subunit depends on the chemical characteristic of subunit: the suitable coupling reaction of wantonly two sub-unit molecules can be determined from Chemistry Literature.The sequence of being hit by target is depended in the selection of subunit, and the data of method accumulation described in the application's VI .B part.

B.dsRNA modifies reagent

One important feature according to the present invention, should recognize with regard to some application, need make the concatermer preparation that forms as mentioned above have additional chemical reaction, when bond combine with dsRNA or with dsRNA very near the time, it will be optionally (surpass cell or tissue in all other molecules), and dsRNA is modified on chemical ground.At this, the dimer/polymer of concatermer molecule partly mediates and combines as above-mentioned dsRNA.The nonessential participation of the reactive moieties of this molecule combines with RNA's.The reactive moieties advantageous applications is similar to as above-mentioned generation dimer/polymeric joint strategy and is connected with linear polymer concatermer.According to this embodiment of the present invention, design effectively the irreversible chemical of dsRNA is modified, with some important or basic functions of RNA interfering, thereby make it its normal function of few participation, for example virus replication.

There are some chemical reactions to can be used for making up molecule like this.The certain preferred embodiments of not getting rid of other comprises (1) covalent modification (promptly passing through the poly-different aromatic agent alkylation guanine base of the preceding chylopropyl official's functionalization of sub-reagent of mustargen or reaction), (2) interchain linkage (promptly passing through psoralen), (3) transesterification cutting (promptly by Lewis acid metal-chelating compound), (4) (are ene-diynes by the material cutting of other activation; High-valency metal-oxygen the base complex that activates).The molecule advantage that forms in this respect according to the present invention provide than dimer only/polymer in conjunction with and the function of the enhancing that reaches or reply.

IV. practicality

RNA of the present invention: protein analysis has been designed to screen the compound of RNA sequence combination of the four corner of all lengths and complicacy.Analyze the RNA binding molecule that discloses thus and have as molecular agents the potentiality of therapeutic agent or therapeutic agent precursor.The disease that the non-specific dsRNA binding molecule of sequence-specific or sequence is any dsRNA of relating to basically or the effective potential therapeutic agent of the state of an illness.The example of the cycle tests that is used to analyze comprises a) and to participate in the especially binding sequence of the factor of keeping or breeding of virus, bacterium, yeast and other fungi of infectant, b) cause the sequence of the inappropriate expression of some viral gene, c) participate in the sequence of the cellular replication of growth fast.

The molecule of being differentiated by this analysis is valuable especially as the guiding compound that exploitation has the congener of homospecificity not or different compatibilities.

An advantage of the present invention be this analyze screen at common dsRNA in conjunction with active (as dsRNA structure specificity or the non-specific compound of dsRNA sequence), or at the combination activity (dsRNA sequence-specific compound) of specificity dsRNA sequence.A type of target sequence comprises that those are present in medical science or the agriculture sequence that significant pathogen (being respectively virus and viroid).

This analyzes and also can be used for screening the molecule with sequence preference associativity, determining to have the sequence of high binding affinity, and/or is used to measure the relative compatibility between a large amount of different sequences.Also can be used for detecting and/or the design novel treatment.

Also be ingredient of the present invention be the method that treatment or pre-anti-virus or viroid infect.As the concatermer that the method generally comprises to infect individual or the dsRNA binding compounds Cheng Youqi that uses for the individuality that is in the risk of infection to select according to screening described herein forms.Although available these methods of some viruses are handled, comprise the virus of the sudden change of the unknown or mutator group sequence, have genomic virus of known ssRNA or dsRNA or viroid and also can described in the lower part, handle.

A. preparation: target biosome

Use the compound of analytical approach announcement of the present invention and the concatermer compound that makes up according to the present invention, be particularly useful for resisting disease, reason such as above-mentioned with virus causing disease.It is available that the effective viral therapy agent of minority is only arranged at present.In addition,, comprise viral genome along with to all biosystems, cellular genome, the accumulation of the sequence data of pathogen gene group (bacterium, fungi, eucaryon parasite etc.), dsRNA bound drug target position is counted will increased in the future greatly.

The method of the effective target sequence of medical science of many discriminating dsRNA bound drugs is arranged, comprise but the non-the following stated that is limited to.At first, find in the pathogen of the effective target sequence of medical science in organic sphere, especially in viral pathogen, find.Secondly, the target region of pathogen identifies that as in the ssRNA or dsRNA sequence of virus, the expression or the active specific target sequence that influence the geneome RNA molecule are identified, as participating in the site of virus replication.

As mentioned above, RNA viruses particularly is fit to antiviral method as herein described and composition.Table 1 is listed some potential target pathogen, comprises people, animal and phytopathogen.

Table 1 pathogenicity RNA viruses

Genome	Section	Belong to	Kind
				Single stranded RNA	Picornaviridae	Enterovirus genus	Back of the body poliomyelitis virus 1,2,3
Normal chain			CA 1-22, A24
				Non-segmented			People Europe can viral 1-7,11-27,29-33
????7．2-8．4Kb			HEV 68-71
							Swine vesicular disease virus
			Pig enterovirus 1-8
							Bovine enteroviruses 1-7
		Cardiovirus	Encephalomyocarditis virus
						Rhinovirus	ERC group virus 1-100,1A, 1B, Hanks
			Bovine rhinovirus 1-3
							Equine rhinoviruses 1 and 2
		Hostis	Foot and mouth disease virus O, A, C, SAT1-3
						Hepatovirus	Hepatitis A virus
Single stranded RNA	The embedding Caliciviridae	The embedding calicivirus belongs to	Norwalk (Nan Hanpudun, snow mountain, Hawaii, Taunton)
				Normal chain			Viral hepatitis type E virus (unfiled)
Non-segmented			The pig vesicular exanthema virus
				????7．4-7．7Kb			Dog embedding calicivirus
			Roll road embedding calicivirus
							Chitling road embedding calicivirus
			Mink embedding calicivirus
							Fowl embedding calicivirus
Single stranded RNA	Astroviridae	Astrovirus	Human astrovirus 1-5
				Normal chain			Ox astrovirus 1 and 2
Non-segmented			The pig astrovirus
				????7．2-7．9Kb			Dog star shape virus
Single stranded RNA	Togaviridae	Alphavirus	Eastern equine encephalitis virus
				Normal chain			Venezuelan equine encephalitis virus
Non-segmented			Sindbis virus (Ochelobo and Babanki)
				????9．7-11．8Kb			Chikungunya virus
			Ao Niyongniyong virus
							Igbo Ora virus

Genome	Section	Belong to	Kind
							Ross River virus
			Mayaro virus
							Barmah Forest virus
			Eastern equine encephalitis virus
							Venezuelan equine encephalitis virus
			Eastern equine encephalitis virus
							Western equine encephalitis virus
			Getah virus
						Rubella virus genus	Rubella virus
Single stranded RNA	Flaviviridae	Flavivirus	Yellow fever virus
				Normal chain			Dengue virus 1-4
Non-segmented			Japanese encephalitis virus
				????9．5-12．5Kb			West nile virus
			Murray valley encephalitis virus
							Rocio virus
			Tick-brone encephalitis virus
							The Europe tick-brone encephalitis virus
			Far east tick-borne encephalitis virus
							Russian spring-summer encephalitis virus
			Merchant's Sanur forest fever virus
							Msk haemorrhagia fever virus
			Luoping virus
							Ripple watt diffusing virus
		Pestivirus	Bovine viral diarrhea virus
							CSFV
			The sheep border disease virus
						Unnamed	Hepatitis C virus
			Heptan hepatovirus
				Single stranded RNA	Coronaviridae	Coronavirus genus	Human corona virus 229-E, OC43, other
Normal chain			Avian infectious bronchitis virus
				Non-segmented			The turkey blue comb
????20-36Kb			The propagated marcy agent of pig
							Pigs haemagglutinating encephalomyelitis virus

Genome	Section	Belong to	Kind
							The pig epidemic hemorrhagic fever virus
			Bovine coronavirus
							Feline infectious peritonitis virus
			Cat enteric coronavirus virus
							Canine coronavirus
		?Torovirus	Enteron aisle and Respirovirus
							Berne virus (horse)
			Breda virus (calf)
							Bovine respiratory torovirus
			Cat torovirus
				Single stranded RNA		The artery viroid belongs to	Lelystad virus (pig reproduction and respiration syndrome virus)
Normal chain
			Non-segmented			VR2332 (pig)
????15Kb							Equine arteritis virus
			Single stranded RNA	Paramyxoviridae	Paramyxovirus genus	Human parainfluenza viruses 1 and 3
Minus strand							Bovine parainfluenza virus 3
			Non-segmented			Sendai virus
????16-20Kb		?Rubulavirus					People's mumps
						The human parainfluenza viruses 2,4a and 4b
							Newcastle disease virus
						Avian paramyxoviruses 2 (yucaipa virus)
							Avian paramyxoviruses 3,4,5 (Kunitachi)
						Pig rubuIavirus (1a-Piedad-Michoacan-Mexico)
							The monkey parainfluenza virus
					Morbillivirus	Measles virus
							CDV
						Rinderpest virus
							Peste des petits ruminants pestivirus (goat and sheep)
						Equine morbillivirus
		Pneumovirus					The human respiratory syncytial virus
						Bovine respiratory syncytial virus
							Mouse pneumonia virus

Genome	Section	Belong to	Kind
				Single stranded RNA	Rhabdoviridae	Vesiculovirus belongs to	Vesicular stomatitis virus
Minus strand			Money Depew virus
				Non-segmented			Piry virus
????13-16Kb			????Isfahan
						Lyssavirus	Hydrophobin
			Europe bat viruses 1 and 2
							Mokoa virus
			Duvenhage virus
							The Lagos bat viruses
		Ephemerovirus	Bovine ephemeral fever virus
				SS, negative justice, 8.9Kb	Unfiled	Borna disease virus belongs to	Borna disease virus
Single stranded RNA	Linear viral section	Filamentous form virus belongs to	Marburg virus
				Minus strand			Ebola virus
Non-segmented			Zaire Ebola virus
				????19．1Kb			The Sudan Ebola virus
Single stranded RNA	Orthomyxoviridae family	Influenza virus A, B	Influenza virus A, B (people and many animals)
				Negative justice and some ambisenses		Influenza virus C	Influenza virus C (people and pig)
Segmented
				????10-13．6Kb
Single stranded RNA	Bunyaviridae	Bunyavirus	Bunyavirus
				Negative justice and some ambisenses			Watt friend's virus
Segmented			Oriboca virus
				????11-21Kb			Oropouche virus
			Guama virus
							LaCrosse virus
			Jamestown Canycn virus
							California antigenic group viruses
			Showshoe hare virus (rabbit is to the people)
							Tahyna virus
			Akabane and Aino (animal)
						Phlebotomus fever virus belongs to	Sand-fly fever-Naples virus
			Sand-fly fever-Sicilian virus
							Thunder is paid the shelling fever virus

Genome	Section	Belong to	Kind
						Nairovirus	Crimean-Congo hemorrhagic fever virus
		Hantavirus	Hantaan virus
							SEOV (Hemorrhagic fever) with nephrotic syndrome
			Sin Nombre virus (acute respiratory distress syndrome)
							Puumala virus (EN)
Single stranded RNA	Arenaviridae	Arenavirus genus	Lymphocytic choriomeningitis virus
				Negative justice and some ambisenses			Lassa virus
Segmented			Machupo virus (Bolivian hemorrhagic fever)
				????10-14Kb			Junin virus (Argentinian hemorrhagic fever)
			Guanarito virus (Venezuela's Hemorrhagic fever)
				Double-stranded RNA	Reoviridae	Reovirus genus	People's reovirus 1,2,3 is pathogenic not to be very strong
Justice			The fowl reovirus
				Segmented		Orbivirus	Orungo virus (Nigeria and ugandan pyreticosis)
????16-27Kb			Kemerovo virus (Russia and Egyptian pyreticosis)
							Blue tongue virus 1-25
			African horse sickness virus 1-9
							Equine encephalosis virus
		Rotavirus	HRV A and B group
							Pig B and E rotavirus
			Fowl D rotavirus
							F group fowl rotavirus
		Coltivirus	Colorado tick fever virus
							Eyach virus (people)
Double-stranded RNA	Birnavirus section	Birnavirus belongs to	Infectious bursal disease virus (poultry)
				Justice			The fish infectious pancreas necrosis virus
Segmented
				????5．7-5．9Kb
Single stranded RNA		δ virus	People's hepatitis δ virus (deficiency)
				Ring-type

Genome	Section	Belong to	Kind
				Negative justice
????1．7Kb
				Single stranded RNA		Viroid	Potato spindle-like tubers virus
Ring-type			Avocado sunbloth viroid
				????250-350bp			The grape viroid
Infectious RNA			Citrus exocortis viroid
							The little macula lutea viroid of grape
			Hops are downgraded viroid
							Decorative pattern apple class virus
			The short top of tomato viroid
							Other plant viroid

B. treat the method for virus infections

As mentioned above, the compound that screening technique discloses according to the present invention is specially adapted to prevent and/or treat the virus infections that is caused by RNA viruses (have ssRNA or dsRNA and make genomic virus).

According to this aspect of the invention, the viral pathogen of inferring can check measuring its genomic sequence or not to be examined, and the compound that special base-pair sequence specificity (if mensuration) or non-specific (if undetermined) combine in searching and selection and the genome.

An importance of the present invention is the broad-spectrum disease resistance toxic agent.Because the long sequence of dsRNA only occurs in the cell of virus infections, thus be the compound that the non-base-pair sequence specificity of dsRNA combines and be used as the broad-spectrum disease resistance toxic agent.

Test the dsRNA binding compounds as required and can form a concatermer in any combination with sequence-specific and/or the non-spy of sequence son estranged.This compound will combine with adjacent 3-16 or 3-8 base-pair zone.At this, term " adjacent " means within 20 base-pairs each other approximately.

From 2 binding molecule subunits, form a concatermer then, after suitable cell and animal toxicity test, this compound is formulated in the suitable drug excipient regulates research.Suitable excipient, dosage and dose form and mode can change according to the type and size of the compound that forms concatermer; In case the composition of known concatermer is thisly determined to be well known to those skilled in the art.Then the concatermer (or unijunction mixture) of individual body and function treatment effective dose is treated.

The list of references of quoting especially in all the application and the full text of patent are incorporated reference into, and especially with reference to the content of quoting.

Following examples illustration is set forth the present invention, and unrestricted the present invention.

Embodiment

Embodiment 1

E3L, Staufen, hPKR, the clone and the expression of the dsRNA binding structural domain of mPKR

Set forth in the document many dsRNA in conjunction with albumen (Burd C.G., et al., Science265:615-621.1994).Because the factor that different activity of proteins, dissolubility, output, stability and other impact analysis carried out has nothing in common with each other, thereby will express some rna binding proteins.

Vaccinia virus E3L, Drosophila melanogaster Staufen and people and mouse PKR albumen have the domain of similar identification dsRNA, St.Johnston etc. provide RNA binding structural domain (the St.Johnston D. of these protein in one piece of article, et al., Proc.NatlAcad Sci USA 89:10979-10983,1982).The dsRNA binding structural domain (dsRBD) of these protein is expressed in E.coli does glutathione S-transferase (GST) fusion (Chang H-W and Jacobs B.L., Virology 194:537-547,1993; BurdC.and Dreyfuss G., Science 265:615-621,1995).Obtain the dna fragmentation of the dsRBD of these protein of coding by PCR.By making template, obtain E3L dsRBD as described in example 2 above with vaccinia virus DNA.Make template with the dsRBD3 plasmid DNA that contains Staufen dsRBD and obtain Staufen dsRBD (St Johnston D., et al., Proc Natl AcadSci USA 89:10979-10983,1992; St Johnson D., et al., Cell 66:5-63,1991).Personnel selection and mouse cDNA and Advantage cDNA PCR kit obtain people and mouse PKR dsRBD.Carry out PCR according to producer's introduction.

Following DNA oligonucleotides is used as primer in the PCR reaction.The restriction enzyme sites underscore.

E3L：

Forward:

GCGGGGATCCTTTGATGATGTTATTCCGG(Bam?HⅠ)(SEQ?ID?NO：4)

Oppositely:

GCGGAATTCAGAATCTAATGATGACT(EcoRI)(SEQ?ID?NO：5)

Staufen：

Forward:

GCGCAGATCTATGGATGAGGGTGACAAGAA(Bgl?Ⅱ)(SEQ?ID?NO：17)

Oppositely:

GCGGAATTCACTTGGTGGGCGTAAGG(Eco?RⅠ)(SEQ?ID?NO：18)

hPKR：

Forward:

GCGCAGATCTGCTGGTGATCTTTCAGC(Bgl?Ⅱ)(SEQ?ID?NO：11)

Oppositely:

GCGCGATATCTAACCATTCATAAGCAACGAA(Eco?RⅤ)(SEQ?ID?NO：12)

mPKR：

Forward:

GCGCAGATCTGCCAGTGATACCCCAT(Bgl?Ⅱ)(SEQ?ID?NO：13)

Oppositely:

GCGCGATATCTAATTACTTGTCATAGACGAG(Eco?RⅤ)(SEQ?ID?NO：14)

PGEX-2T E coli plasmid expression vector is used for the clone PCR fragment.This carrier contains the glutathione binding motif (Smith D.B., et al., Gene 67:31-40,1988) of the Schistosoma japonicum glutathione s-transferase (GST) under strong chimeric tac promoter control.The PCR fragment is cloned into GST open reading frame as the substitute of GST motif, and dsRBDs is made GST carboxyl terminal fusion by expression.For this reason, with Bgl II and Eco R V restriction enzyme cutting hPKR and mPKR fragment, and it is cloned into the carrier of Bam H I/Sma I cutting, with Bgl II and Eco R I restriction enzyme cutting Staufen PCR fragment, and be cloned in the pGEX-2T carrier of BAM H I/EcoR I digestion, followingly clone with the T4 dna ligase.

With 1: 10 ratio mixing plasmid and insert DNA, and with the T4 dna ligase at 10 ℃, at 50mM Tris-HCl pH7.5,7mM MgCl ₂, 1mM DTT, 1mM ATP connects in 1 μ g DNA and the 50U/ml enzyme and spends the night.Instruct Transformed E .coli (the super competent cell of Epicurian Coli XL1-Blue) with connecting potpourri according to manufacturer.On culture plate, separate positive bacterium colony with 100 μ g/ml ampicillins, and use Wizard ^TMMinipreps dna purification system (Promega Madison WI) plasmid purification.Plasmid with restriction enzyme analysis check purifying guarantees correct the insertion.

Basically as cultivation contain pGEX-2T carrier or derivatives thereof bacterial strain as described in (Smithand Johnson Gene 67:3l, 1988), culture expression E3L, Staufen, the E coli bacterial strain of the dsRBD of hPKR and mPKR albumen.The overnight culture of E coli bacterial strain is diluted with 1: 10 with the 600ml LB nutrient culture media that contains the 100mkg/ml ampicillin, and 30-33 ℃ in controllable environment incubator shaking table (New Brunswick Scientific, Edison NJ) with the 150rpm shaken cultivation.Adding IPTG (isopropylthio-β-thiogalactoside enzyme; Gibco BRL, Gaithersburg, MD) to the 0.2mM concentration, cell growth 1 hour, and collect after 5 hours in growth in addition.Get cell sample after before inducing, reaching., be resuspended among the PBS of initial volume and centrifugal again cell in the little hydro-extractor of Eppendorf centrifugal 2 minutes with 5000rpm with the same terms.With the granular pellet resuspended of cell in 1 * sample buffer (0.25M Tris-HCl, pH6.8,20% glycerine, 0.1% bromophenol blue, 2.5% beta-mercaptoethanol, 5%SDS), and, instruct in the 6-20%Tris-glycine gels through SDS-PAGE isolated cell albumen according to manufacturer 100 ℃ of insulations 5 minutes.Detect the band of the protein that is equivalent to 37KD in the cell of inducing, it is near the expectation size of GST-Staufen and GST-E3L fusion (35KD), but does not detect in the cell of not inducing.

Similarly, the band that is equivalent to 47KD and 50KD protein detects in total cell lysate of E.coliGST-mPKR that induces and GST-hPKR, but does not detect in the cell lysate of not inducing.

Contain the GST-E3L of double-stranded binding structural domain separately, GST-Staufen, GST-mPKR and GST-hPKR fusion are known as E3L respectively, Staufen, mPKR and hPKR.

Embodiment 2

E3L, Staufen, the purifying of mPKR and hPKR

Precipitation is as the cell culture of generation as described in the embodiment 1, and is suspended in (Gibco BRL, Gaithersburg MD) among the Dulbecco PBS with 1: 100 volume of culture.By low conversion Braun-Sonic 2000 ultrasonic generators, destroying cell through 4 * 30 seconds circulating ultrasonics on ice with highoutput.With Triton X-100 (Sigma, St Louis MO) add to 1% concentration, and with lysate in the JA-20 centrifuge rotor with 19,000rpm is centrifugal 30 minutes at 5 ℃.Find some E3L and Staufen albumen in supernatant, it is denoted as " PBS component ".Most of E3L and Staufen albumen remain in the precipitation.MPKR and hPKR are soluble substantially, and in fact all hPKR and most of mPKR find in supernatant.

By with 0.5M NaCl-40mM Tris-HCl, pH7.5 at room temperature extracted 1.5～2 hours and reclaimed E3L in precipitating.In the JA-20 hydro-extractor with 19000rpm centrifugal 30 minutes of room temperature with separate dissolved and not molten component.Recovery is labeled as " pH7.5 component " from the E3L of supernatant.To precipitate with 0.5M NaCl-Tris-HCl pH8.0 and further extract, centrifugal subsequently.This supernatant is labeled as " pH8.0 component ".Under alkaline pH value more, as can from precipitation, obtaining further E3L protein extract with 40mM carbonate buffer solution pH9.5.

Water is with 1: 2 dilution E3L pH7.5 and pH8.0 component, and (PharmaciaBiotech Sweden) is incubated 1 hour on 4 ℃ of glutathione S epharose 4B pearls with 1/20 volume with the component of dilution and PBS component.With pearl flushing 3 times, and with the glutathione-50mM Tris-HCl of 5mM reduction, pH8.0 is wash-out E3L albumen from pearl with every kind of component damping fluid of 20X volume.The E3L albumen that obtains in eluate is basic purifying.To contain the component set of E3L albumen, and with the 0.5M NaCl-40mM tris-HCl of 100 volumes, pH8.0, the 2mM dithiothreitol (DTT), 0.1%Triton-X-100,20% glycerine is dialysed.E3L dsRNA detects indifference (data not shown goes out) in conjunction with activity between component.With gained protein prepared product five equilibrium and freezing at-80 ℃.

At 4 ℃ of glutathione S epharose 4B pearl (Pharmacia BiotechSweden) and Staufen with 1/20 volume, mPKR and the insulation of hPKR supernatant component 1 hour, with the PBS damping fluid of 20 times of volumes with pearl flushing 3 times, and with glutathione-50mM Tris-HCl pH8.0 elute protein from pearl of 5mM reduction.

Shown in polyacrylamide gel electrophoresis, hPKR that obtains in eluate and mPKR albumen are basic purifying, and Staufen is about 50% purifying.To contain the component set of Staufen, and with the 0.5M NaCl of 100 volumes, 40mM tris-HCl, pH8.0,2mM one sulphur threitol, 0.1% Triton-X-100,25% glycerine is dialysed.Contain the 0.1M NaCl of the component of mPKR or hPKR, 40mM tris-HCl, pH8,2mM dithiothreitol (DTT), 0.1% Triton X-100, the dialysis of 20% glycerine with 100 volumes.With gained protein prepared product five equilibrium and freezing at-80 ℃.

Embodiment 3

The RNA binding analysis

E3L is in conjunction with double-stranded RNA, but not in conjunction with ssRNA or RNA/DNA crossbred (Kiongand Shuman, Virology 217:227,1996; Also see Fig. 3).At the synthetic E3L-RNA that carries out of Cruachem Inc.Dulles VA in conjunction with the used RNA oligonucleotides of test.1T??????5’-GCUGGGUUCUUGCGGUGGCUCGUGCUUUCG-3’(SEQ?ID?NO：6)1B??????3’-CGACCCAAGAACGCCACCGAGCACGAAAGC-5’(SEQ?ID?NO：16)19T?????5’-UUCUUGCGGUGGCUCGAGC(SEQ?ID?NO：7)22T?????5’-GGUUCUUGCGGUGGCUCGUGCU(SEQ?ID?NO：8)26T?????5’-UGGGUUCUUGCGGUGGCUCGUGCUUU(SEQ?ID?NO：9)

At Keystone Laboratorios.Inc., Redwood City, CA synthesizes the 30-mer DNA oligonucleotides 1TD that has with RNA oligonucleotides 1T identical sequence.1TD?5’-GCTGGGTTCTTGCGGTGGCTCGTGCTTTCG-3’(SEQ?ID?NO：10)。According to manufacturer instruct with the T4 polynucleotide kinase (New England Biolabs, Beverly, MA) with γ- ³²(Amersham, Arlington Heights is IL) with oligonucleotides 1B end mark for P ATP. ³²The 1B of P mark and unlabelled oligonucleotides 1T, 19T, 22T or 26T are containing 700nM ³²The unlabelled 1T of the 1B of P mark and 800nM, 1TD, 19T, 22T or 26T, 15mM Tris-HCl, pH7.5,400mM NaCl anneals in the reaction mixture of 2.5mM EDTA.During 2 hours, sample slowly is cooled to room temperature from 70 ℃.The annealing of 1T and 1B oligonucleotides produces the double-stranded 30-mer RNA of pairing fully.The annealing of lTD and 1B oligonucleotides produces the double-stranded 30-mer RNA/DNA crossbred of pairing fully.19T, the RNA that the annealing of 22T and 26T and 1B produces has the double-stranded RNA of the pairing fully structure of 19,22 and 26 base-pairs, and is called 19-, 22-and 26-mer.

Containing 0.2nM RNA or RNA/DNA crossbred, 50mM Tris-HCl, pH8.0,1mM EDTA, 40mM NaCl, 0.1%Triton X-100,5% glycerine, carry out combining of E3L and oligonucleotides in the reaction mixture of 2mM dithiothreitol (DTT) and 1-400nM E3L albumen, will be reflected at room temperature and continue 30 minutes, add 70% glycerine to 15% concentration afterwards and sample is gone up application of sample at 6% retardance gel (Novex San Diego CA).With gel at Novex XCell with the filling of 0.5 * tbe buffer liquid ^TMAmong the Mini-Cell with 100v rotation 30-45 minute, and with SGD-40 gel drying instrument (Savant Instruments, Inc.Farmingdale, N.Y.) drying.(Scientific Imaging film, Eastman KodakCo. N.Y) spend the night the gel exposure with the science imaging sheets employing.

E3L can be approximately 4-12nM in conjunction with double-stranded 30-mer RNA dsRNA fragment polynucleotide (SEQ ID NO:6) (Fig. 2) with Kd, even and its high as 400nM concentration can not be effectively in conjunction with ssRNA ( ³²The 1B of P mark) or RNA/DNA crossbred (Fig. 3).Except E3L is that typically duplex structure combines with RNA specifically, the dsRNA structure that also needs the bottom line size is with effective combination.The E3L combination of 30-mer is higher approximately 50-100 times than the efficient of the combination of 19-mer, and the combination of a 22-mer and 26-mer summary good (Fig. 4) than 19-mer.

Embodiment 4: test compounds to dsRNA:dsRNA in conjunction with protein bound effect

The ethidium bromide adding is contained in the reaction mixture of 30-mer dsRNA oligonucleotides as described in embodiment 2, be incubated 30 minutes, add E3L then, and reaction mixture is incubated 30 minutes again, as the above-mentioned gel retardation assay analytic sample that passes through in room temperature.Ethidium bromide can stop E3L to combine (Fig. 6 A) with dsRNA in about 10 μ M concentration.If gel contains ethidium bromide, low concentration then, 3.3 μ M also are effectively (Fig. 6 B), and this shows actual K _dBe starkly lower than 3mM.Test findings is similar, and though ethidium bromide be with E3L insulation before or after add reaction mixture (data not shown goes out).

Embodiment 5: analysis and HTS that preparation dsRNA is used to carry out based on initial gel analyze

Synthetic oligonucleotide and dsRNA with the Protocols in Molecular Biology preparation all can be used for analysis described herein.Synthetic complementary oligoribonucleotide, preferred 15～30 bases are long, can anneal and use dsRNA to produce test, depend on analysis type, oligonucleotides can be unmodified or at special position usefulness biotin, fluorophore or quencher base group modification.Synthetic oligonucleotides is used in the prescreen stage usually, to detect dsRNA binding molecule and difference sequence-specific and the non-specific RNA binding molecule of sequence.The RNA molecule also can synthesize in the in-vitro transcription system, wherein synthetic hair clip oligoribonucleotide (that is, linear order comprises the cochain of stem, ring sequence, chain under the complementation of stem then) from dna profiling.Use this type of strategy and can synthesize the dsRNA oligonucleotides of self-annealing with special inside 4bp test site.For the oligonucleotides with mixed base test site, the part hairpin is transcribed from dna profiling (that is, chain under stem cochain, ring, the part stem), makes it to anneal and be used to cause the synthetic of residue stem structure.This strategy makes and can synthesize well-mixed complementary cycle tests and also be convenient to filter membrane radio-labeled (if being that routine analyzer is required).This area known the concrete grammar of realizing above-mentioned synthetic example (as, Ausubel F.M., et al., the current scheme of molecular biology, John Wiley﹠ Sons, Media, PA).

Embodiment 6: scintillation proximity assay

Scintillation proximity assay (SPA) be the analytical approach known (see as, United States Patent (USP) 4,382,074 and 4,271,139, this incorporate into reference to).In this analyzed, as shown in Figure 9, radiolabeled atoms in space was got close to and can be measured bag by the flicker of pearl.When the atomic decay of a radioactivity, it discharges subatomic particle, as electronics.The distance that these particles will pass water is limited, and depends on the character of radioactive atoms.If a radioactive atoms as ³³P gets close to the pearl that contains scintillator, and electronics can arrive pearl and stimulate scintillator luminous.If but the atom of radioactivity is away from pearl, then electronics can not arrive pearl and unglazed emission.Thereby the molecule that the utmost point is got close to the radioactivity of pearl can identify from the molecule away from pearl.The SPA technology successfully is used for enzyme catalysis analysis, DNA-protein and protein-protein interaction analysis, receptor binding assay, radiommunoassay, by cell and metabolic system thereof absorption, screening DNA bound drug to compound.But the analysis of RNA-protein interaction or screening dsRNA bound drug (VIRIA SPA) are the new application of SPA.

When streptavidin-SPA pearl with ³³When the biotinylated dsRNA oligonucleotides of P mark mixed, biotin-streptavidin interacted and causes combining of oligonucleotides and pearl.After combination, ³³The P atom is positioned at very close pearl part, and ³³The electronics that P produced between decay period arrives the scintillator in the pearl.This causes the emission of photon, and its available scintillation counter is measured.If but a kind of protein combines with the dsRNA oligonucleotides before the insulation of dsRNA oligonucleotides and pearl, biotin-streptavidin interacts can be by space ground prevention (biotin protection) (Fig. 9 B).When the dsRNA medicine that can combine with dsRNA imports reaction mixture, contain the protein-bonded medicine of dsRNA and dsRNA and from oligonucleotides, replace dsRNA in conjunction with albumen.Biotin changes into and can interact with streptavidin then, and the emission of photon recovers (Fig. 9 C).

SPA not only can be used for detecting the dsRNA bound drug, can be used for also determining whether these medicines can be in conjunction with the nucleic acid of any other form, as ssRNA, ssDNA or dsDNA, the RNA/DNA crossbred, nucleic acid hair clip, projection, and any nucleic acid form of any nucleotide sequence, structure, size or conformation, and the degree of combination.

In one embodiment, a cold nucleic acid competitor such as DNA and ³³The dsRNA of P mark imports in the reaction mixture together.If the dsRNA bound drug not in conjunction with DNA, is then compared with the contrast that does not contain DNA, import the signal that DNA does not influence observation.DsRNA does not combine with any nucleic acid except long dsRNA in conjunction with albumen such as E3L or PKR.If but medicine can in conjunction with RNA and DNA the two, if especially the DNA amount surpasses RNA, then signal will disappear.

SPA can be used for also determining whether two or more medicines compete the identical or overlapping binding site on the dsRNA.If determine very much the binding site of at least a competition medicine, then can obtain the data where medicine and dsRNA combine.

The SPA pearl is commercially available from Amersham Pharmacia Biotech, and makes up in the mode in conjunction with special molecular.Can be used for an embodiment in conjunction with the SPA pearl of the streptavidin bag quilt of biotinylated RNA oligonucleotides, but can also can be used in the different amending methods of SPA as pearl in conjunction with protein-bonded other type of dsRNA SPA pearl with anti--GST antibody or albumin A bag quilt.RNA nucleotide can directly be realized (the SPA pearl of GST bag quilt) with combining of pearl in the GST of fusion component, or realizes (pearl of albumin A bag quilt) through GST or PKR specific antibody.Not biotinylated RNA oligonucleotides can be used for these situations.

Biotinylated RNA oligonucleotides is commercially available from Cruachem.The oligonucleotides preferred length near but non-ly be limited to 30 nucleotide.Also can use long and short RNA.Can use any nucleotide sequence that meets special demand.For example, be the sequence specific Journal of Sex Research, all possible 3-nucleotide sequence can be distributed between 2 34-mer dsRNA oligonucleotides (Fig. 7), and all 4-nucleotide sequences can be distributed between 10 30-mer oligonucleotides (Figure 11).Between synthesis phase, use the interval base of all size, one or more biotin component can through the dU motif attached to oligonucleotides in any position.In an embodiment preferred, the biotin component, for example at the 12nd and is hybridized with complementary oligonucleotide as shown in figure 11 through basic attached to the centre near 30-mer nucleotide at interval.The few nucleosides of complementary RNA can be synthesized, and with biotinylated oligonucleotide hybridization.Complementary oligonucleotide or biotinylated oligonucleotides or the two all available γ ³³P ATP (Amersham) and polynucleotide kinase (as the T4 polynucleotide kinase, New England Biolabs) were used before hybridization ³³P carries out end mark.Mark can carry out knowing under the condition.

DsRNA with dsRNA binding motif is in conjunction with albumen, and as Drosophilamelanogaster Staufen, vaccinia virus E3L reaches people or mouse PKR and can be used for this analysis.As described in embodiment 1, in E coli, the dsRNA bound fraction of these protein is expressed the fusion of doing with glutathione s-transferase (GST) (Fig. 1).The biotin protection test

In the biotin protection test, contrast E3L, Staufen, mPKR and hPKR are to estimate their performances in SPA.At dsRNA in conjunction with albumen with after biotinylated dsRNA combines, the biotin among the RNA is estimated to be stoped with streptavidin in the pearl by ground, space and is combined (biotin protection).This can detect (Fig. 9 B) by the signal weakening of pearl emission.It is active that different protein estimates to have different biotin protections, and be fully or not exclusively protection in different proteins concentration.

Biotinylated ³³The 30-mer dsRNA oligonucleotides of P mark is used for this test (Figure 11), at Cruachem, and Dulles, synthetic the going up of VA reaches chain RNA oligonucleotides (first is biotinylated) down.The RNA oligonucleotides ³³The P end mark is by the catalysis of T4 polynucleotide kinase, its mediation ³³The P phosphate group from ³³P-γ ATP is transferred to 5 ' end of RNA oligonucleotides. ³³P-γ ATP is produced by Amersham.The T4 polynucleotide kinase can derive from NewEngland Biolabs, Beverly, MA.Carry out mark according to T4 polynucleotide kinase manufacturer guidance.Go up or chain or the two are all available down ³³The P mark, but typically have only biotinylated RNA oligonucleotides to be labeled.Typically, with 2 μ l 50,000nM RNA oligonucleotides (Cruachem), 2.5 μ l, 10 * T4 polynucleotide kinase damping fluid (New EnglandBiolabs), 15 μ l γ- ³³P ATP (10 mCi/ml), 10 μ l H ₂O, 3 μ l T4 polynucleotide kinases (10,000 U/ml) combination final volume is 50 μ l.This reaction mixture is incubated 30 minutes at 37 ℃, and by adding 50 μ l 25mM EDTA cessation reactions.According to the producer's guidance, (5 Prime-3 Prime, Boulder CO) will by gel filtration on G-25 spin post ³³The oligonucleotides of P mark purifying from other component of reaction mixture comes out.In annealing buffer (15mM tris-HCl, pH7.5,40mMNaCl, 2.5mM EDTA) anneals with 400-500nM concentration with the complementary RNA oligonucleotides.This mixture heated to 65-70 ℃, and was slowly cooled to room temperature in 2-5 hour.With what produce ³³The dsRNA oligonucleotides of P mark is diluted to 2nM concentration, five equilibrium and-80 ℃ of storages.

For carrying out the biotin protection test, the preparation feedback potpourri, it contains 0.25nM ³³The biotinylated dsRNA 30-mer oligonucleotides of P mark, 50mM tris-HCl pH8.0,1mMEDTA, 40mM NaCl, 0.1%Triton X-100,5% glycerine, 2mM dithiothreitol (DTT) and 0-280nM dsRNA are in conjunction with albumen.Be reflected in the Wallac culture plate of 96-hole and carry out, 200 μ l/ holes.This reaction mixture room temperature insulation 1.5 hours, is added 50 μ g/ pore chain Avidin SPA PVT pearls (Amersham) afterwards, and then is incubated 15 minutes.With culture plate sealing and by at the bottom of centrifugal 3 minutes of 1000g pearl being precipitated to the hole.Count with Wallac culture plate readout instrument.In this biotin protection test, hPKR more has activity than other protein, and it is in the approaching protection fully of 0.4～1.2nM concentration.Select 0.7nM concentration hPKR to carry out further shaker test.Other protein active is relatively poor, and mPKR requires 10nM and E3L to require 31～93nM concentration just near protection fully.Staufen is active minimum in the protein of estimating.Even can not be fit to complete biotin protection (Figure 12) in 280nM concentration.

As shown in figure 12, all 4 kinds all can stop the interaction of biotinylated dsRNA and streptavidin pearl in conjunction with albumen.HPKR has the compatibility the highest to dsRNA, and the most effective in the biotin protection.In 0.4nM concentration, the basic all dsRNA of hPKR displacement from interact with pearl.Thereby hPKR is used for the high-level efficiency screening as drug candidate as described in the embodiment 7.

Next the known medicine that combines with dsRNA is used to confirm the replaceable rna binding protein of the medicine that combines with dsRNA.As mentioned above, rna binding protein is replaced in the combination of medicine, and causes the increase of photo emissions.

Following in this test compound is screened: Kanendomycin sulfate (Sigma), Lividomycin A sulfate (Sigma), neomycinsulphate (Sigma), tobramycin (Fluka), gentamicin sulphate (Fluka), netropsin (Sigma), 21x (netropsin dimer), ethidium bromide, acridine orange (Sigma), Distacin (Sigma).

With these compound dissolutions (50mM tris-HClpH8.0,1mM EDTA, 40mM NaCl in RNA binding buffer liquid (RBB), 0.1% TritonX-100,5% glycerine, 2mM dithiothreitol (DTT)), compound is added in the reaction mixture in 96 well culture plates, and it contains 0.2nM ³³The biotinylated dsRNA oligonucleotides of P mark and the hPKR of 0.6nM in RBB.Compound is made serial dilution.Gained reaction mixture volume is 200 μ l.To react insulation 90 minutes in room temperature, adding streptavidin SPA pearl (Amersham) to the final concentration of 10 μ l in RBB then is 50 μ g/ holes, and then is incubated 20 minutes.At 700rpm with centrifugal 2.5 minutes of culture plate, with the precipitation pearl, and with Micro Beta Trilux (EG﹠amp; GWallac) calculating instrument is counted flicker at the bottom of the hole.

Derive from result among the SPA and announcement to pass through compound and dsRNA binding data that distinct methods obtains very identical.Known and the strong compound that combines of dsRNA are as intercalator and neomycin, in SPA more weak dsRNA bond be combined (Figure 13).SPA is a reliable method, itself in addition can detection compound and Light Difference during dsRNA combines.For example, as in of the unwind test of dsRNA-medicine, measuring to dsRNA, by the difference that exists between the melting temperature (Δ Tm=14.3 ℃) due to melting temperature due to the lividomycin (Δ Tm=15.2 ℃) and the aminodeoxykanamycin less than 1 ℃, show that lividomycin is the dsRNA bond (Biochemistry 36:11402-11407,1997) slightly stronger than aminodeoxykanamycin.Similarly, lividomycin has slightly high compatibility than aminodeoxykanamycin, and as shown in figure 13, it is the strongest bond that medicine neomycin (Δ Tm=24.7 ℃) illustrates by SPA.As expected, dna binding molecule distamycin and netropsin are the most weak combination in SPA.

Expect by interaction stabilized DNA or RNA double helix additional between the chain is provided with the equal compound that combines of two chains of dsDNA or dsRNA.Compound is strong more with combining of dsRNA or dsDNA, and the double-helical temperature of unwinding is high more.Thereby compound combines by the thermal denaturation conventional determining with double-strandednucleic acid.(Wilson?W．D．，et?al．，Biochemistry32：4098-4104，1993；McConnaughie?A．W．，et?al．，J．Med．Chem．37：1063-1069，1994；Chen?Q．，et?al．，Biochemistry?36：11402-11407，1997)。

Embodiment 7: the high flux screening of combinatorial libraries is to differentiate the dsRNA binding compounds

Design and synthesize the library of designing the compound that combines with double helix nucleic acid.Up to the present, synthetic about 200 noval chemical compounds.These compounds are at the gel band shift analysis, and SPA reaches in fluorescence/quencher analysis screened.There are at present 12 kinds to combine in 144 kinds of compounds analyzing with dsRNA.Following table 2 has been summarized 12 kinds of %R values that compound hits thing.

It also is positive in the gel displacement that the strongest SPA hits thing.More weak SPA hits the susceptibility that thing is starkly lower than the gel displacement.Figure 14 illustrates some data that obtain by SPA.X-axis, the value of the counting that %R, the comparative counting that expression obtains during this compound of existence in analyzing obtain divided by at no compound the time.The %R value representation when having compound, the significantly improving of photo emissions.Thereby the high value of %R illustrates compound consumingly from dsRNA displacement hPKR.

The screening of compound is substantially as described in the embodiment 6 among the SPA, is about 10mM except compound is dissolved in DMSO to concentration.The DMSO solution of this compound is added in the 200 μ l reaction mixtures of 0.05mM concentration, and this reaction mixture contains 0.2 μ M concentration ³³The biotinylated dsRNA 30-mer of P mark and the hPKR of 0.7nM concentration.With the reaction mixture in 96 well culture plates as insulation and processing as described in the embodiment 6.The result calculates %R parameter (Figure 14) with Microsoft Excel routine processes gained.Generation has the compound of the signal of statistics enhancing to be considered to " hitting thing " (Figure 15) than background.9 of 8～170%R scope are hit thing shown in Figure 14.All 12 kinds %R values of hitting thing are all be sure of on background.Even the poorest 1a series hits thing, and it also is that statistics is significant that its %R value is low to moderate the T-test value: A5-0.006, C10-0.0002.

This compound is also screened in gel displacement, substantially as described in the embodiment 6, removes with 0.7nM concentration hPKR and replaces E3L.Screening is carried out the double test at the compound-1mM and the 0.2mM-of 2 kinds of concentration.Three kinds of compd Bs 4, B5 and B6 the strongest in SPA are also detected in the gel displacement.Compd B 4 and B5 are active and strong, and dsRNA combination antibiotic neomycin is suitable, and compound B-26 is then relatively poor.Gel shifted data and SPA data are very identical, and wherein compound B-26 is also very different than compd B 4 and B5.

Be the dsRNA structure specificity of research 1a series compound combination, B4, B5 and B6 be combining by qualitative by direct monitoring and dsRNA and ssRNA also.With every kind of compound of 1mM and 0.2nM dsRNA (24-mer) or ssRNA (30-mer) room temperature insulation 1 hour.This reaction mixture application of sample is blocked on the gel in 6%RNA, and process with StormphosPhoimager.Combine with dsRNA by all three kinds of compounds of dsRNA mobility displacement may observe.Combine with the direct of ssRNA although observe B4, in ssRNA, do not have obviously displacement, show that it is specific to dsRNA by B5 and B6.

Table 2

Compound %R1a series

A5/GEN00697??????????????????????8

A9/GEN00699??????????????????????9

A11/GEN0066??????????????????????10

B4/GEN0067???????????????????????170

B5/GEN00700??????????????????????140

B6/GEN0056???????????????????????31

B7/GEN0018???????????????????????8

C2/GEN0048???????????????????????17

C10/GEN0077??????????????????????8

D12/GEN0063 91b series

B11/GEN00120?????????????????????9

D8/GEN00158??????????????????????22

Embodiment 8

Fluorescence/quencher analysis

Developed one and can shift the analysis of (FRET), to differentiate the dsRNA binding compounds based on fluorescence resonance.FRET is a kind of phenomenon, and wherein fluorescent photon can be transferred to another from a fluorescence molecule with detecting.In most of FRET reactions, first kind of dyestuff excites (excitation maximum) in given optical wavelength.Emission is transferred to second kind of dyestuff effectively from the light of first dyestuff, normally because the excitation spectrum of the emission spectrum of first kind of dyestuff and second kind of dyestuff is obviously overlapping.Second kind of dyestuff absorbs the photon that is sent by first kind of dyestuff, and the more low-energy fluorescent photon of emission longer wavelength.

Another kind of FRET commonly used pairing is that donor/quencher dye ligand is right.In this interacts, do not send from the resonance energy of first kind of dye transfer to the second kind of dyestuff as second kind of light, and in generation, dissipate in the system with heat, thereby " quencher " dyestuff obviously reduces the fluorescence that causes by system sends of closely getting close to of fluorescent dye.Dabcyl is a mark, and it has become a class " general " quencher component, is because its fluorescence of many different fluorophores of quencher effectively.

But the double helix that combines stabilized DNA or RNA or the spiral form of part and double-strandednucleic acid.In the past, the test of pyrolysis chain is used for illustrating nearly all part and the rising (in considerably less known case, finding that part combines and make it stable with single stranded DNA) that combining of DNA or RNA all causes Tm, in the fifties salt is shown in early days the Tm of DNA is raise.Polyamines, small-molecule drug, peptide and protein have been shown from that time all makes its Tm raise when combining with nucleic acid.

The end-labelled complementation " indication oligonucleotides " that the FRET analysis and utilization is short, it is a strand under the standard analysis condition, part forms stable double-spiral structure in conjunction with promoting in some this indication oligonucleotides.In the double helix conformation, the quencher dyestuff, the fluorescent dye (fluorescein or analog) in Dabcyl and these " the indication oligonucleotides " is closely got close to, and causes the unexpected reduction of fluorescence.Therefore, part reduces fluorescence with combining of this specific " indication oligonucleotides ".

This analysis is the theme that transfers the common pending application USSN__ of present assignee, and it all incorporates reference into this total application (USSN__).

This analyzes with gel SPA and band shift analysis shared, can screen structure bias chemistry library.The specificity that B5 combines with dsRNA is also confirmed in the fluorescent quenching competition analysis.In this competition analysis, unlabelled dsRNA or ssRNA are added in the analysis of mixtures with the concentration that increases.If medicine can be in conjunction with the unmarked oligonucleotides of any of these, reduce with the quenching effect that observes after F/Q-RNA combines at medicine.Known specificity is with dsRNA but not the lividomycin that dsDNA combines is used to test this new analytical form; DsRNA and dsDNA are as competitor.Have only dsRNA can make fluorescence signal reach original level, show that this is a specificity competition analysis.

Then, carry out fluorescence/quencher competition experiments, to check itself and the preferred property that combines of multi-form nucleic acid with 1a series B5 compound.In these trials, B5 successfully competes dsDNA with the combining of dsRNA of fluorescence/dabcyl mark, and the combination of ssRNA and DNA/RNA crossbred with regard to the B5 compound, shows that it preferably combines with dsRNA.Following oligonucleotides is used for this analysis: 24mer 24DB, 5 '-d (TTATTCTGTCGTG CTGGTTTATTC); 24mer 24DT, 5 '-d (GAATAAACCAGCACGACAGAATAA); 24mer 24J, 5 '-r (GAAVAAACCAGCACGACAGAAVAA); 24mer 24JB, 5 '-r (UUAUUCUGUCGUGCUGGUUUAUUC); 14mer Vir51,5 '-r (FCVAGAUCUGAACUU); And 9mer Vir55,5 '-r (CAGAUCUAGQ), F indication fluorescein and Q represent dabcyl.

By with at 10mM HEPES pH7.5, final concentration among 1mM EDTA and the 10mM NaCl is that 100 μ M mix each oligonucleotides, with mixture heated to 80 ℃, 5 minutes, and make it slowly cool to room temperature at 3 hours to form dsRNA (24J+24JB), dsRNA (24DT+24DB) and DNA/RNA crossbred (24JB+24DT).

Is 200 μ l by add 25nM Vir51 and 40nM Vir55 in each medicine to cumulative volume, and in conjunction with directly monitoring, used drug concentration shows in the accompanying drawings to medicine.For competition experiments, to compete nucleic acid dsRNA, dsDNA, the DNA/RNA crossbred adds in the Vir51/Vir55 potpourri with two kinds of different concentration (0.5 and 1 μ M) with ssRNA (24JB), and add in the medicine of each concentration immediately and measure relative fluorescence, all tests are all containing 10mM HEPES pH7.5, carry out in the damping fluid of 1mM EDTA and 10mM NaCl, with Cytofluor fluorescence reader, porous plate reader series 4000 (PerseptiveBiosystems) is measured immediately after mixing.Exciting of dedicated bandwidth 20 is 485, and the emission of dedicated bandwidth 25 is 530, amplifies 70.At 10 μ M B5, have only dsRNA but not dsDNA, ssRNA or DNA/RNA hybridization physical efficiency make the signal of B5 quencher reach original level, show that the associativity of B5 and dsRNA surpasses dsDNA, ssRNA and DNA/RNA crossbred (seeing Figure 15 A-D).These results are consistent with gained result in SPA and gel mobility shift assay.

Although the present invention sets forth with reference to concrete grammar and embodiment, should recognize not departing from the scope of the invention and can make various modifications and change.

Sequence table＜110〉Alexander S.Belyaev Thomas Wayne Bruice cynthia A.Edwards Kirk E.Fry Lisa M.Turin＜120〉dsRNA/dsRNA is in conjunction with protein process and composition＜130〉4600-0127; 41〈140〉〈141〉〈150〉60／058,740〈151〉1997-09-12〈160〉32〈170〉FastSEQ for Windows 3.0〈210〉1〈211〉34〈212〉RNA〈213〉〈220〉〈221〉misc〈222〉 ( 1 ) … ( 34 ) 〈223〉〈400〉1aaaccagcac gacaucccgc cuacucaaga auaa 34〈210〉2〈211〉8〈212〉RNA〈213〉〈220〉〈221〉misc_binding〈222〉 ( 1 ) … ( 8 ) 〈223〉〈400〉2acguacgu〈210〉3〈211〉12〈212〉RNA〈213〉〈220〉〈221〉misc_〈222〉 ( 1 ) … ( 12 ) 〈223〉〈400〉3acguacguac gc 12〈210〉4〈211〉28〈212〉DNA〈213〉〈220〉〈221〉〈222〉 ( 1 ) … ( 28 ) 〈223〉〈400〉4gcgggatcct ttgatgatgt tattccgg 28〈210〉5〈211〉26〈212〉DNA〈213〉〈220〉〈221〉〈222〉 ( 1 ) … ( 26 ) 〈223〉〈400〉5gcggaattca gaatctaatg atgacg 26〈210〉6〈211〉30〈212〉RNA〈213〉〈220〉〈221〉〈222〉 ( 1 ) … ( 30 ) 〈223〉〈400〉6gcuggguucu ugcgguggcu cgugcuuucg 30〈210〉7〈211〉19〈212〉RNA〈213〉〈220〉〈221〉〈222〉 ( 1 ) … ( 19 ) 〈223〉〈400〉7uucuugcggu ggcucgagc 19〈210〉8〈211〉22〈212〉RNA〈213〉〈220〉〈221〉〈222〉 ( 1 ) … ( 22 ) 〈223〉〈400〉8gguucuugcg guggcucgug cu 22〈210〉9〈211〉26〈212〉RNA〈213〉〈220〉〈221〉〈222〉 ( 1 ) … ( 26 ) 〈223〉〈400〉9uggguucuug cgguggcucg ugcuuu 26〈210〉10〈211〉30〈212〉DNA〈213〉〈220〉〈221〉〈222〉 ( 1 ) … ( 30 ) 〈223〉〈400〉10gctgggttct tgcggtggct cgtgctttcg 30〈210〉11〈211〉27〈212〉DNA〈213〉〈220〉〈221〉〈222〉 ( 1 ) … ( 27 ) 〈223〉〈400〉11gcgcagatct gctggtgatc tttcagc 27〈210〉12〈211〉31〈212〉DNA〈213〉〈220〉〈221〉〈222〉 ( 1 ) … ( 31 ) 〈223〉〈400〉12gcgcgatacc taaccattca taagcaacga a 31〈210〉13〈211〉26〈212〉DNA〈213〉〈220〉 〈221〉〈222〉 ( 1 ) … ( 31 ) 〈223〉〈400〉13gcgcagatct gccagtgata ccccag 31〈210〉14〈211〉31〈212〉DNA〈213〉〈220〉〈221〉〈222〉 ( 1 ) … ( 31 ) 〈223〉〈400〉14gcgcgatatc taattacttg tcatagacga g 31〈210〉15〈211〉34〈212〉RNA〈213〉〈220〉〈221〉〈222〉 ( 1 ) … ( 34 ) 〈223〉〈400〉15uuuggucgug cuguagggcg gaugaguucu uauu 34〈210〉16〈211〉30〈212〉RNA〈213〉〈220〉〈221〉〈222〉 ( 1 ) … ( 30 ) 〈223〉〈400〉16cgacccaaga acgccaccga gcacgaaagc 30〈210〉17〈211〉30〈212〉DNA〈213〉〈220〉〈221〉〈222〉 ( 1 ) … ( 30 ) 〈223〉〈400〉17gcgcagatct atggatgagg gtgacaagaa 30〈210〉18〈211〉26〈212〉DNA〈213〉〈220〉〈221〉〈222〉 ( 1 ) … ( 26 ) 〈223〉〈400〉18 gcggaattca cttggtgggc gtaagg 26〈210〉19〈211〉30〈212〉RNA〈213〉〈220〉〈221〉misc_〈222〉 ( 1 ) … ( 30 ) 〈223〉〈400〉19acgacagaau aaaccagcac gacagaauaa 30〈210〉20〈211〉30〈212〉RNA〈213〉〈220〉〈221〉misc_〈222〉 ( 1 ) … ( 30 ) 〈223〉〈400〉20uacucauccc gccuacucaa gggaugaucc 30〈210〉21〈211〉30〈212〉RNA〈213〉〈220〉〈221〉misc_〈222〉 ( 1 ) …30〈223〉〈400〉21aacuagcaug ccagcgguaa cuagcaugcc 30〈210〉22〈211〉30〈212〉RNA〈213〉〈220〉〈221〉misc_〈222〉 ( 1 ) … ( 30 ) 〈223〉〈400〉22ccccggcucg augauggccc cggcucgaug 30〈210〉23〈211〉30〈212〉RNA〈213〉〈220〉〈221〉misc_〈222〉 ( 1 ) … ( 30 ) 〈223〉〈400〉23cguacugcaa aaggauccgu acugcaaaag 30〈210〉24〈211〉30〈212〉RNA〈213〉〈220〉〈221〉misc_〈222〉 ( 1 ) … ( 30 ) 〈223〉〈400〉24ugacguuuaa uacaagcuga cguuuaauac 30〈210〉25〈211〉30〈212〉RNA〈213〉〈220〉〈221〉misc_〈222〉 ( 1 ) … ( 30 ) 〈223〉〈400〉25agauaauuca acacuacaga uaauucaaca 30〈210〉26〈211〉30〈212〉RNA〈213〉〈220〉〈221〉misc_〈222〉 ( 1 ) … ( 30 ) 〈223〉〈400〉26auaggcgcga caaacauaua ggcgcgacaa 30〈210〉27〈211〉30〈212〉RNA〈213〉〈220〉〈221〉misc_〈222〉 ( 1 ) … ( 30 ) 〈223〉〈400〉27aaaucauugg guacaagaaa ucauugggua 30〈210〉28〈211〉30〈212〉RNA〈213〉〈220〉〈221〉misc_〈222〉 ( 1 ) … ( 30 ) 〈223〉〈400〉28gaacccucca cacucgggaa cccuccacac 30〈210〉29〈211〉30〈212〉RNA〈213〉〈220〉〈221〉misc_〈222〉 ( 1 ) … ( 30 ) 〈223〉〈400〉29aggaccuuag agacaccagg accuuagaga 30〈211〉30〈212〉RNA〈213〉〈220〉〈221〉misc_〈222〉 ( 1 ) … ( 30 ) 〈223〉〈400〉30ucacgcacuu cguagacuca cgcacuucgu 30〈210〉31〈211〉30〈212〉RNA〈213〉〈220〉〈221〉misc_〈222〉 ( 1 ) … ( 30 ) 〈223〉〈400〉31acgacagaau aaaccagcac gacagaauaa 30〈210〉32〈211〉30〈212〉RNA〈213〉〈220〉〈221〉misc_〈222〉 ( 1 ) … ( 30 ) 〈223〉〈400〉32uuauucuguc gugcugguuu auucugucgu 30

Claims (26)

1, a kind of method of screening compounds, this compound can change dsRNA and combine with the non-base-pair sequence dependence of dsRNA fragment in conjunction with albumen or albumen composition, and this method may further comprise the steps:

(a) form a reaction mixture, it is composed of the following components: (ⅰ) described dsRNA is in conjunction with albumen or albumen composition, and (ⅱ) double helix dsRNA fragment, describedly do not rely on the dsRNA base-pair sequence with combining of this double helix dsRNA fragment in conjunction with albumen;

(b) existing or not existing under the situation of described compound, detect described dsRNA in conjunction with the level that combines of albumen with described dsRNA fragment;

(c) contrast is in the combination of (b) step observation;

(d) if exist and the difference of the combination observed when not having compound is higher than a set point value, then select this compound.

2, method as claimed in claim 1, the binding affinity of wherein said compound and dsRNA, than be selected from single stranded RNA, 2-3 is doubly at least for the binding affinity height of the polynucleotide of single stranded DNA and double-stranded DNA.

3, method as claimed in claim 1, the concentration of wherein said rna binding protein or albumen composition are effectively to form the amount of compound when not having described compound to exist with at least 50% dsRNA.

4, method as claimed in claim 1, wherein about 10～100 base-pairs of double helix dsRNA fragment length.

5, method as claimed in claim 4, wherein about 16～50 base-pairs of double helix dsRNA fragment length.

6, method as claimed in claim 5, wherein about 30～50 base-pairs of double helix dsRNA fragment length.

7, method as claimed in claim 1 is used to differentiate candidate's antiviral compound, and wherein double helix dsRNA is a virus protein in conjunction with albumen.

8, method as claimed in claim 7, wherein virus protein is selected from E3L, and σ 3, a group of forming of E3L dsRNA binding structural domain and σ 3 dsRNA binding structural domains.

9, method as claimed in claim 8, wherein virus protein is E3L or its dsRNA binding structural domain.

10, method as claimed in claim 1, wherein double helix dsRNA is to be selected from PKR in conjunction with albumen, DRAF1, DRAF2, RNAaseH, Z-DNA be in conjunction with albumen, La (SS-B), one group the cell protein that TRBP and dsRNA specificity adenosine deaminase are formed.

11, as the method for claim 10, wherein said is PKR in conjunction with albumen.

12, method as claimed in claim 1, wherein rna binding protein or albumen composition detect with combining by the gel band shift analysis of dsRNA.

13, method as claimed in claim 1, wherein rna binding protein or albumen composition detect with combining by scintillation proximity assay of dsRNA.

14, method as claimed in claim 1, wherein rna binding protein or albumen composition detect with combining by the filter membrane binding analysis of dsRNA.

15, method as claimed in claim 1, wherein said compound is that base-pair sequence is not dependent with combining of dsRNA.

16, a kind of treatment comprises the compound that gives the individual drugs effective dose by the method for the individuality of picornavirus infection, and this compound is selected through following steps:

(a) form a reaction mixture, it is composed of the following components: (ⅰ) described dsRNA is in conjunction with albumen or albumen composition, and (ⅱ) double helix dsRNA fragment, describedly do not rely on the dsRNA base-pair sequence with combining of this double helix dsRNA fragment in conjunction with albumen;

(b) existing or not existing under the situation of described compound, detect described dsRNA in conjunction with the level that combines of albumen with described dsRNA fragment;

(c) contrast is in the combination of (b) step observation;

(d) if exist and the difference of the combination observed when not having compound is higher than a set point value, then select this compound.

17, as the method for claim 16, the binding affinity of wherein said compound and dsRNA, than be selected from single stranded RNA, 2-3 is doubly at least for the binding affinity height of the polynucleotide of single stranded DNA and double-stranded DNA.

18, as the method for claim 16, wherein said compound combines with the described double helix dsRNA of about 10-100 base-pair.

19, as the method for claim 16, wherein said compound combines with the described double helix dsRNA of about 16-50 base-pair.

20, as the method for claim 16, wherein said compound combines with the described double helix dsRNA of about 30-50 base-pair.

21, as the method for claim 16, wherein said compound is that base-pair sequence is not dependent with combining of dsRNA.

22, as the method for claim 16, wherein said compound comprises the concatermer of at least 2 subunits, and each subunit is selected through following steps:

(a) form a reaction mixture, it is composed of the following components: (ⅰ) described dsRNA is in conjunction with albumen or albumen composition, and (ⅱ) double helix dsRNA fragment, describedly do not rely on the dsRNA base-pair sequence with combining of this double helix dsRNA fragment in conjunction with albumen;

(b) existing or not existing under the situation of described compound, detect described dsRNA in conjunction with the level that combines of albumen with described dsRNA fragment;

(c) contrast is in the combination of (b) step observation;

(d) if exist and the difference of the combination observed when not having compound is higher than a set point value, then select this compound.

23, a polymer dsRNA bond comprises by covalently bound the first kind and second kind of linear concatermer that the dsRNA binding compounds forms, the selection of every kind of compound (a)-(d) as claimed in claim 1 step at least.

24, as the dsRNA bond of claim 23, wherein at least a described dsRNA binding compounds is that base-pair sequence is not dependent with combining of dsRNA.

25, as the dsRNA bond of claim 23, wherein every kind of described dsRNA binding compounds all is that base-pair sequence is not dependent with combining of dsRNA.

26, as the RNA bond of claim 23, it further comprises and the covalently bound RNA dressing agent of a kind of dsRNA binding compounds wherein, or the RNA decomposition agent.

Images