KR20220049422A - Biosensor comprising a protein that binds to double-stranded DNA non-specifically with a nucleic acid sequence, or fusion protein comprising the same - Google Patents

Abstract

Provided is a biosensor comprising a protein which binds to double-stranded DNA in non-specifically with a nucleic acid sequence, or a fusion protein comprising the same and a method for detecting double-stranded DNA using the same. According to the present invention, the double-stranded DNA can be qualitatively and/or quantitatively detected.

Description

A biosensor comprising a protein that binds to double-stranded DNA non-specifically with a nucleic acid sequence, or fusion protein comprising the same }

To a biosensor comprising a protein that non-specifically binds to a nucleic acid sequence to double-stranded DNA, or a fusion protein comprising the same, and a method for detecting double-stranded DNA using the same.

Lateral Flow Assay (LFA) is a paper-based biosensor that can detect a target in a liquid sample in a simple way without special equipment. Existing lateral flow analysis mainly used a method of detecting a target by conjugating an antibody to gold nanoparticles (AuNP). The method of conjugating an antibody to AuNP and applying it to LFA has the advantage of increasing the sensitivity to target detection and visually observing the result. However, in this method, a new antibody must be found according to the target to be detected, and the found antibody must be conjugated to AuNP. Therefore, it is expensive and time-consuming to find an antibody that reacts specifically to a target. In addition, in the process of conjugating the antibody to the AuNP, the efficiency of the antibody is lowered, and there is a problem that the production cost of the AuNP is expensive.

Therefore, there is still a need for the development of an LFA-based biosensor capable of detecting a target more simply and quickly.

One aspect provides a fusion protein comprising a protein or fragment thereof that non-specifically binds to a nucleic acid sequence to double-stranded DNA (dna), and a protein or fragment thereof that binds to a bead.

Another aspect provides a polynucleotide encoding the fusion protein according to an aspect.

Another aspect provides a recombinant vector comprising the polynucleotide according to an aspect.

Another aspect provides a host cell transformed with the recombinant vector according to the aspect.

Another aspect provides a method for producing the fusion protein, comprising the step of culturing the host cell according to an aspect.

Another aspect provides a composition for detecting double-stranded DNA comprising a protein or fragment thereof that non-specifically binds to a nucleic acid sequence to double-stranded DNA (dna) according to an aspect.

Another aspect provides a kit for detecting double-stranded DNA comprising a protein or fragment thereof that non-specifically binds to a nucleic acid sequence to double-stranded DNA (dna) according to an aspect.

Another aspect provides a biosensor for detecting double-stranded DNA.

Another aspect provides a method for detecting double-stranded DNA using the biosensor according to the aspect.

One aspect provides a fusion protein comprising a protein or fragment thereof that non-specifically binds to a nucleic acid sequence to double-stranded DNA (dna), and a protein or fragment thereof that binds to a bead.

As used herein, the term "sequence identity" of a polypeptide or polynucleotide refers to the degree of the same degree of amino acid residues or bases between sequences after aligning both sequences to be as consistent as possible in a specific comparison region. Sequence identity is a value measured by optimally aligning and comparing two sequences in a specific comparison region, and a portion of the sequence in the comparison region may be added or deleted compared to a reference sequence. Percent sequence identity can be determined by, for example, comparing two optimally aligned sequences throughout the comparison region, determining the number of positions in both sequences where the same amino acid or nucleic acid appears, to obtain the number of matched positions. , dividing the number of matched positions by the total number of positions within the comparison range (ie, range size), and multiplying the result by 100 to obtain a percentage of sequence identity. The percent sequence identity may be determined using a known sequence comparison program, and examples thereof include BLASTN (NCBI), CLC Main Workbench (CLC bio), MegAlign™ (DNASTAR Inc), and the like.

Multiple levels of sequence identity can be used to identify polypeptides or polynucleotides that have the same or similar function or activity of different species. For example, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more. sequence identity including greater than, greater than 98%, greater than 99%, or greater than 100%.

The term “non-specific binding to a nucleic acid sequence” means that binding to a substance having a nucleotide sequence such as DNA or RNA is performed regardless of the nucleotide sequence of the substance.

Accordingly, "non-specific binding of a nucleic acid sequence to double-stranded DNA" means binding to double-stranded DNA regardless of the sequence of the double-stranded DNA.

The protein that non-specifically binds to the nucleic acid sequence to the double-stranded DNA may be a protein having a greater binding capacity to double-stranded DNA (dsDNA) than to single-stranded DNA (ssDNA).

The protein that non-specifically binds to the double-stranded DNA has an isoelectric point of 9.0 or less, 0.1 to 9.0, 0.1 to 8.0, 0.1 to 7.0, 1.0 to 9.0, 1.0 to 8.0, 1.0 to 7.0, 2.0 to 9.0, 2.0 to 8.0, 2.0 to 7.0, 3.0 to 9.0, 3.0 to 8.0, 3.0 to 7.0, 4.0 to 9.0, 4.0 to 8.0, 4.0 to 7.0, 4.0 to 6.0, 4.0 to 5.0, 4.5 to 5.5, 5.0 to 9.0, 5.0 to 8.0, 5.0 to It may be 7.0, or 5.0 to 6.0. In one embodiment, the monomer of the fragment of the antitoxin MazE protein may have an isoelectric point of 4.0 to 5.0, for example 4.83. In another embodiment, the dimer of the fragment of the antitoxin MazE protein may have an isoelectric point of 5.0 to 6.0, for example 5.31.

The protein non-specifically binding to the nucleic acid sequence to the double-stranded DNA is a helix-turn-helix domain, a zinc pinker domain, a leucine zipper domain, a wing helix domain, a wing helix- Turn-helix (winged helix-turn-helix) domain, helix-loop-helix (helix-loop-helix) domain, HMG-box domain, Wor3 domain, OB-fold domain, B3 domain, TALE (TAL effecter) domain, Or it may include a combination of two or more thereof.

The protein that non-specifically binds to the double-stranded DNA is an antitoxin MazE protein, a forkhead box protein (FOXO, such as FOXO1, FOXO2, FOXO3, FOXO4), p53, EcoRV, FoK1, Cro (Control of repressor's operator protein), or a fragment of any one of these or a dimer of the fragment, but is not limited thereto.

The beads may be microbeads or nanobeads. The size of the microbead may be 1 μm to 1000 μm, 1 μm to 500 μm, 1 μm to 100 μm, 10 μm to 1000 μm, 10 μm to 500 μm, or 10 μm to 100 μm, but is not limited thereto. . The size of the nanobeads is 1 nm to 1000 nm, 1 nm to 500 nm, 1 nm to 100 nm, 10 nm to 1000 nm, 10 nm to 500 nm, 10 nm to 100 nm, 100 nm to 1000 nm, or 100 It may be from nm to 500 nm, but is not limited thereto. In one embodiment, the beads may be nanoparticles.

The beads are glass, nickel, polyethylene, polypropylene, poly(4-methylbutene), polystyrene, polyacrylate, polyethylene terephthalate, rayon, nylon, poly(vinyl butyrate), polyvinylidene difluoride (PCDF), Silicone, polyformaldehyde, cellulose, cellulose acetate, nitrocellulose, gelatin, sepharose macrobead, sephadex bead, dextran microcarrier, agarose, alginate, carrageenan, chitin, cellulose, dextran, starch, polycaprolactone (PCL), polyacrylamide, polyacrolein, polydimethylsiloxane, polyvinyl alcohol, polymethylacrylate, perfluorocarbon, silica, diatomaceous earth, alumina, gold, iron oxide, graphene, graphene oxide, and metal oxides It may be any one bead, but is not limited thereto. For example, the beads may be magnetic beads or gold beads.

In one embodiment, the beads may be magnetic nanoparticles or gold nanoparticles.

Protein binding to the bead is MagR (magnetoreceptor) protein, heme protein (eg, hemoglobin, cytochrome, etc.), iron-sulfur protein, transferrin (Transferrin), lactoferrin (Lactoferrin), and ferritin (Ferritin) It may be any one selected from the group consisting of, but is not limited thereto.

In one embodiment, the fusion protein may be a MagR-MazE fusion protein comprising a magnetoreceptor (MagR) protein, or a fragment thereof and an anti-toxin MazE protein, or a fragment thereof.

The term “MagR (magnetoreceptor) protein” is also known as “magnetic receptor protein”, “magnetic receptor protein”, “magnetic protein”, “ISCA1 (Iron-sulfur cluster assembly 1) protein”, etc. there is. The MagR protein may bind to a magnetic material. The MagR protein may be derived from fruit flies, moths, or birds, but is not limited thereto. For example, the MagR protein is from Drosophila sp.; Agrotis genus ( Agrotis sp.); It may be derived from birds such as pigeons ( Columba livia ), but is not limited thereto. Exemplary sequences of the MagR protein are NCBI Accession No. P0DN75.1, NWQ81101.1, XP_027490836.1, XP_005154986.1, etc., but are not limited thereto. For example, the MagR protein is NCBI Accession No. It may be a protein comprising an amino acid sequence having 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity to the 16th to 132th amino acid sequence of P0DN75.1.

The term “antitoxin MazE protein” is the antitoxin component of the type II toxin-antitoxin system. The antitoxin MazE protein can bind to double-stranded DNA. The antitoxin MazE protein may be a protein derived from bacteria, for example, a protein derived from Escherichia coli , but is not limited thereto. An exemplary sequence of the antitoxin MazE protein is NCBI Accession no. WP_000581937, etc., but is not limited thereto. For example, the antitoxin MazE protein is NCBI Accession no. It may be a protein comprising an amino acid sequence having 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity to the 2nd to 50th amino acid sequence of WP_000581937.

The term “fusion protein” is a new protein made in the form of two or more different proteins or homologous proteins combined. Two or more heterologous proteins bind in part and in part, in part and in whole, or in whole and in whole. “MagR-MazE fusion protein” refers to a protein formed by combining a MagR protein and an anti-toxin MazE protein in part, in part, in part, or in whole. In one embodiment, the MagR-MazE fusion protein refers to a protein comprising a fragment of a MagR protein and a fragment of an antitoxin MazE protein.

The term “fragment” refers to a truncated part rather than the whole. A fragment of a protein may refer to a truncated partial sequence of a protein. “Fragment of the MagR protein” may refer to a fragment having a magnetic receptor function of the MagR protein. “Fragment of antitoxin MazE protein” may refer to a fragment having the ability to bind to double-stranded DNA of antitoxin MazE protein.

The fragment of the MagR protein may include the 16th to 132th amino acid sequence of SEQ ID NO: 1. The MagR protein fragment comprises an amino acid sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the 16 to 132th amino acid sequence of SEQ ID NO: 1. it could be

The fragment of the anti-toxin MazE protein may include the amino acid sequence of positions 26 to 74 of SEQ ID NO: 2. The fragment of the anti-toxin MazE protein comprises an amino acid sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the 26th to 74th amino acid sequence of SEQ ID NO: 2. may be doing

The MagR-MazE fusion protein comprises two or more fragments of the antitoxin MazE protein, 2 to 10, 2 to 9, 2 to 8, 2 to 7, 2 to 6, 2 to 5, 2 to 4, 2 to 3, or 2 may be included. Each fragment of the anti-toxin MazE protein included in the MagR-MazE fusion protein may have the same sequence or a different sequence. Each fragment of the anti-toxin MazE protein included in the MagR-MazE fusion protein may have the same sequence. In one embodiment, when the fusion protein includes two or more fragments (monomers) of the MazE protein, each of the monomers may be linked by a linker. As the linker, for example, a flexible linker may be applied. In addition, the linker may have resistance to protease (Protease resistance). For example, the linker may be a polypeptide consisting of any amino acids from 1 to 400, from 1 to 200, or from 2 to 200 amino acids. The peptide linker may include Gly, Asn and Ser residues, and neutral amino acids such as Thr and Ala may also be included. Amino acid sequences suitable for peptide linkers are known in the art. The copy number “n” can also be adjusted to achieve proper separation between functional moieties or to allow for optimization of the linker to maintain the necessary inter-moiety interactions. Other flexible linkers are known in the art, for example G and S linkers to which amino acid residues such as T and A are added to maintain flexibility as well as polar amino acid residues to improve water solubility. can Accordingly, in one embodiment, the linker may be a flexible linker comprising G, S, and/or T residues. The linker may have a general formula selected from (G _p S _s ) _n and (S _p G _s ) _n , in which case, independently p is an integer from 1 to 10, and s = 0 from 0 to 10 or an integer, p + s is an integer of 20 or less, and n is an integer from 1 to 20. More specifically, an example of a linker is (GGGGS) _n , (SGGGG) _n , (SRSSG) _n , (SGSSC) _n , (GKSSGSGSESKS) _n , (RPPPPC) _n , (SSPPPPC) _n , (GSTSGSGKSSEGKG) _n , (GSTSGSGSGSSEG) _n , (GSTSGSGKPGSGEGSTKG) _n , or (EGKSSGSGSESKEF) _n , wherein n is an integer of 1 to 20, or 1 to 10.

In one embodiment, the fusion protein may be a MagR-MazE fusion protein comprising a magnetoreceptor (MagR) protein, or a fragment thereof, and an anti-toxin MazE protein, or a dimer of a fragment thereof. The dimer of the fragment of the antitoxin MazE protein is formed by combining two monomers of the fragment of the antitoxin MazE protein. The monomer of the fragment of the antitoxin MazE protein may include the amino acid sequence of positions 26 to 74 of SEQ ID NO: 2. The monomers of the fragment of the antitoxin MazE protein may be linked by a linker.

The MagR-MazE fusion protein may include the amino acid sequence of SEQ ID NO: 3. The MagR-MazE fusion protein has 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity with the amino acid sequence of SEQ ID NO: 3 It may include an amino acid sequence. The MagR-MazE fusion protein may be composed of the amino acid sequence of SEQ ID NO: 3.

As used herein, a protein includes its functional equivalent. The functional equivalent includes all or part of the protein in which all or part of the amino acid sequence variant is deleted or added, which retains the function of the protein. Substitution of amino acids may refer to conservative substitutions. Examples of conservative substitutions for naturally occurring amino acids are: aliphatic amino acids (Gly, Ala, Pro), hydrophobic amino acids (Ile, Leu, Val), aromatic amino acids (Phe, Tyr, Trp), acidic amino acids (Asp) , Glu), basic amino acids (His, Lys, Arg, Gln, Asn) and sulfur-containing amino acids (Cys, Met). Deletion of amino acids is located in a region not directly involved in the activity of the protein.

The MagR-MazE fusion protein may include a region specifically binding to a bead and a region binding to a nucleic acid sequence non-specifically to double-stranded DNA (dsDNA). For example, in the MagR-MazE fusion protein, a region containing a fragment sequence of a MagR protein may bind to a bead, and a region containing a fragment sequence of a MazE protein may non-specifically bind a nucleic acid sequence to dsDNA.

Another aspect provides a polynucleotide encoding the fusion protein according to an aspect.

The polynucleotide may be modified. Such modifications include additions, deletions, or non-conservative or conservative substitutions of nucleotides.

The polynucleotide may include the nucleotide sequence of SEQ ID NO: 4. The polynucleotide may be composed of the nucleotide sequence of SEQ ID NO: 4. The polynucleotide consists of a nucleotide sequence having 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more sequence identity to the nucleotide sequence of SEQ ID NO: 4 it may be

Another aspect provides a recombinant vector comprising the polynucleotide according to an aspect.

The term “vector” refers to a means for expressing a gene of interest in a host cell. Examples include viral vectors such as plasmid vectors, cosmid vectors, bacteriophage vectors, adenovirus vectors, retrovirus vectors and adeno-associated viral vectors. Vectors that can be used as the recombinant vector include plasmids often used in the art (eg, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14. , pGEX series, pET series, pUC19 and p426GPD, etc.), phage (e.g., λλλλΔ and M13, etc.) or viruses (e.g., CMV, SV40, etc.), but are not limited thereto. Since a plasmid is currently the most commonly used form of a vector, "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention.

In the recombinant vector, the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 may be operably linked to a promoter. The term “operably linked” means that a promoter sequence that initiates and mediates transcription of a polynucleotide encoding a target protein and the polynucleotide sequence are functionally linked.

The recombinant vector can typically be constructed as a vector for cloning or as a vector for expression. The expression vector may be a conventional vector used to express a foreign protein in plants, animals or microorganisms in the art. The recombinant vector can be constructed through various methods known in the art.

The recombinant vector can be constructed using a prokaryotic cell or a eukaryotic cell as a host. For example, when the vector used is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of propagating transcription (eg, pLλ promoter, trp promoter, lac promoter, tac promoter, T7 promoter, etc.), translation It is common to include a ribosome binding site and transcription/translation termination sequence for initiation of When a eukaryotic cell is used as a host, the replication origin operating in the eukaryotic cell included in the vector includes the f1 origin of replication, SV40 origin of replication, pMB1 origin of replication, adeno origin of replication, AAV origin of replication, CMV origin of replication and BBV origin of replication. However, the present invention is not limited thereto. In addition, promoters derived from the genome of mammalian cells (eg, metallotionine promoter) or from mammalian viruses (eg, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, The cytomegalovirus (CMV) promoter and the tk promoter of HSV) can be used, and generally have a polyadenylation sequence as a transcription termination sequence.

Another aspect provides a host cell transformed with the recombinant vector according to the aspect.

As a host cell that can be transformed with a recombinant vector, a host with high DNA introduction efficiency and high expression efficiency of the introduced DNA is usually used. Well-known eukaryotic and prokaryotic hosts, e.g. E. coli, Pseudomonas, Bacillus, Streptomyces, fungi, yeast, insect cells such as Spodoptera frugiperda (SF 9), CHO, COS 1, COS 7, Animal cells such as BSC 1, BSC40, and BMT 10 may be used, but the present invention is not limited thereto.

Insertion of a polynucleotide or a recombinant vector containing the same into a host cell may use a method well known in the art. As the transport method, for example, when the host cell is a prokaryotic cell, a calcium chloride (CaCl2) method or electroporation method may be used, and when the host cell is a eukaryotic cell, a microinjection method, calcium phosphate precipitation method, electroporation method, liposome-mediated transfection, and gene bombardment may be used, but are not limited thereto.

Another aspect provides a method for producing the fusion protein, comprising the step of culturing the host cell according to an aspect.

In the culturing step, the medium and culture conditions may be appropriately selected and used depending on the host cell, and the culture conditions such as temperature and culture time may be adjusted to be suitable for mass production of the fusion protein. The fusion protein expressed through the culture step can be isolated from the lysate of the cell. The overexpression transformant is centrifuged to obtain a cell pellet, and an eluate containing a cell lysate can be obtained by removing the media components including the ruptured cell wall or cell membrane. Here, the cell pellet is prepared by methods well known in the art, such as alkalis, surfactants (CHAPS and SDS, etc.), organic solvents and enzymes (lysozyme, etc.), sonication and use of a French press. , can be lysed by periodic application of high temperature, pressure, freezing and thawing cycles, etc.

In addition, the fusion protein may be isolated purely through a purification process.

Another aspect provides a composition for detecting double-stranded DNA comprising a protein or fragment thereof that non-specifically binds to a nucleic acid sequence to the double-stranded DNA (dna).

The term “double-stranded DNA detection” refers to determining the presence or absence of double-stranded DNA. The detection of double-stranded DNA may mean specifically detecting double-stranded DNA. “Specifically detecting double-stranded DNA” may mean detecting only double-stranded DNA without detecting non-double-stranded DNA, such as single-stranded DNA. The detection of double-stranded DNA may refer to non-specific detection of double-stranded DNA as a nucleic acid sequence. In one embodiment, the detection of the double-stranded DNA may be to detect the presence of a PCR product, but is not limited thereto.

In one embodiment, the composition comprises a protein or fragment thereof that non-specifically binds to the double-stranded DNA (dsDNA); and a conjugate comprising a bead or antibody linked to the protein or fragment thereof.

The protein or fragment thereof that non-specifically binds to the nucleic acid sequence to the double-stranded DNA is as described above.

In one embodiment, the protein or fragment thereof that non-specifically binds to the nucleic acid sequence to the double-stranded DNA may be a dimer of the MazE protein or fragment thereof, but is not limited thereto.

The bead is as described above. In one embodiment, the beads may be magnetic nanoparticles or gold nanoparticles.

The protein or fragment thereof that non-specifically binds to the nucleic acid sequence to the double-stranded DNA (dsDNA) may be linked to the bead through a protein or fragment thereof capable of binding to the bead. The bead-binding protein or fragment thereof may be a bead-binding protein or fragment thereof. The protein or fragment thereof binding to the bead is as described above.

In one embodiment, the protein capable of binding to the bead may be MagR, but is not limited thereto.

The antibody refers to an antibody that specifically binds to a target antigen, and includes a fragment of an antibody if it has binding specificity. The antibody may be a monoclonal antibody or a polyclonal antibody.

In one embodiment, the composition comprises a MagR-MazE fusion protein; and a conjugate comprising a bead linked to the fusion protein. The beads may be magnetic nanoparticles. The conjugate may be a MagR-MazE fusion protein-magnetic nanoparticle conjugate. The conjugate may be prepared by contacting the MagR-MazE fusion protein and magnetic nanoparticles. Since the binding of magnetic nanoparticles to the region containing the MagR protein fragment sequence of the MagR-MazE fusion protein is stable, a new antibody must be conjugated to gold nanoparticles whenever the target disease changes. can be supplemented

In the MagR-MazE fusion protein-magnetic nanoparticle conjugate, the region comprising the MazE protein amino acid sequence of the MagR-MazE fusion protein has the ability to bind to dsDNA, thereby detecting dsDNA.

Another aspect provides a kit for detecting double-stranded DNA comprising the composition for detecting double-stranded DNA according to an aspect.

The composition or kit may further include tools, reagents, etc. commonly used in the art. Such tools or reagents include, but are not limited to, suitable carriers, labels capable of generating a detectable signal, solubilizing agents, detergents, buffers, stabilizers, and the like.

In the kit, the conjugate may be used in a state immobilized on a solid support. Various materials may be used as the solid support, and examples thereof include, but are not limited to, cellulose, nitrocellulose, polyvinyl chloride, silica gel, polystyrene, nylon, activated beads, and the like.

Another aspect provides a biosensor for detecting double-stranded DNA, comprising a protein or fragment thereof that non-specifically binds to a nucleic acid sequence to double-stranded DNA.

In one embodiment, the biosensor comprises a protein or fragment thereof that non-specifically binds to a nucleic acid sequence to double-stranded DNA; and a conjugate comprising a bead or antibody linked to the protein or fragment thereof.

The biosensor may further include a support. The support may be a solid support.

The conjugate may be fixed on a support. The conjugate may be immobilized on a support through a covalent bond or a non-covalent bond. The non-covalent bond may include at least one member selected from the group consisting of a bond between streptavidin and biotin and a bond between thiol and gold.

The type of the biosensor is not limited as long as it can be implemented to detect double-stranded DNA using a protein or fragment thereof that non-specifically binds to a nucleic acid sequence to double-stranded DNA.

In one embodiment, the biosensor may be an electrochemical sensor.

The biosensor may detect the concentration of double-stranded DNA from an electrochemical signal according to the concentration of the double-stranded DNA that binds to a protein or fragment thereof that non-specifically binds to the nucleic acid sequence to the double-stranded DNA.

In one embodiment, the biosensor may be a strip-type lateral flow assay (LFA)-based biosensor.

The LFA-based biosensor includes (a) a sample pad, (b) a conjugate pad, (c) a membrane, and (d) an absorption pad, which are sequentially arranged from one end to the other.

The "sample pad" means a pad capable of diffusion flow by receiving a sample to be analyzed, and is composed of a material having sufficient porosity to receive and contain a sample to be analyzed. Examples of such porous materials include fibrous paper, microporous membranes made of cellulosic materials, cellulose derivatives such as cellulose and cellulose acetate, nitrocellulose, glass fibers, naturally occurring cotton, fabrics such as nylon, or porous gels. , but not limited thereto.

The "conjugate pad" receives the sample that is diffused and moved from the sample pad. The conjugate pad includes a protein or fragment thereof that non-specifically binds to a nucleic acid sequence to double-stranded DNA (dsDNA); and a conjugate comprising a bead linked to the protein or fragment thereof. The conjugate pad includes the MagR-MazE fusion protein; and a conjugate comprising a bead linked to the fusion protein. The beads may be magnetic nanoparticles. The conjugate may be a MagR-MazE fusion protein-magnetic nanoparticle conjugate. The conjugate pad, like the sample pad, is made of a material capable of diffusion flow. When magnetic nanoparticles are used instead of gold nanoparticles, the cost may be low.

The “membrane” may be made of any material that can pass through the sample material. For example, naturally occurring, synthetic, or synthetically modified materials, such as polysaccharides (eg, cellulosic materials, paper, cellulose derivatives such as cellulose acetate and nitrocellulose); polyether sulfone; polyethylene; nylon; polyvinylidene fluoride (PVDF); Polyester; polypropylene; silica; An inorganic material uniformly dispersed in a porous polymer matrix with a polymer such as vinyl chloride, vinylchloride-propylene copolymer and vinyl chloride-vinyl acetate copolymer, for example deactivated alumina, diatomaceous earth, MgSO ₄ , or other inorganic fines matter; naturally occurring (such as cotton) and synthetic (such as nylon or rayon) fabrics; porous gels such as silica gel, agarose, dextran and gelatin; It may be formed from a material such as a polymer film, for example polyacrylamide. In one embodiment, the membrane comprises a polymeric material such as nitrocellulose, polyethersulfone, polyethylene, nylon, polyvinylidene fluoride, polyester or polypropylene.

The “absorbent pad” may be positioned adjacent to or near the distal end of the membrane. The absorbent pad generally receives a fluid sample that travels through the entire membrane. Absorbent pads can help promote capillary action and diffuse flow of fluids through the membrane.

In the LFA-based biosensor, the sample pad, the conjugate pad, the membrane, and the absorbent pad are sequentially disposed on the same support.

The support may be formed of any material as long as it can support and transport the sample pad, conjugate pad, membrane and absorbent pad described above. In one embodiment, the support is liquid impermeable such that fluid of the sample diffusing through the membrane does not leak through the support. For example, glass; polymeric materials such as, but not limited to, polystyrene, polypropylene, polyester, polybutadiene, polyvinylchloride, polyamide, polycarbonate, epoxide, methacrylate, polymelamine, and the like.

A test region and a control region are sequentially formed on the membrane in a direction from the conjugate pad to the absorbent pad.

In the test region, a first binder, for example, avidin, streptavidin, or neutravidin, that specifically binds to a target material that binds to a protein or fragment thereof that non-specifically binds to the nucleic acid sequence of the double-stranded DNA of the conjugate may be fixed.

In the control region, a second binder that does not specifically bind to the target material, but binds to a protein or fragment thereof that non-specifically binds to the nucleic acid sequence to the double-stranded DNA, for example, double-stranded DNA through streptavidin may be fixed.

The target material may be dsDNA. The dsDNA may be a product amplified by polymerase chain reaction (PCR). The target material may be labeled so as to be able to bind to the first binder of the test region.

As used herein, the term “labeled” or “label” refers to a fluorescent marker or enzymatic activity that can be detected, e.g., by incorporation of a radiolabeled amino acid, or by the indicated avidin (e.g., by optical or colorimetric methods). Streptavidin) refers to the attachment of a detectable marker by attachment to a polypeptide of a biotin moiety. Various methods for labeling polypeptides and glycoproteins are known in the art and can be used. Examples of labels for polypeptides include, but are not limited to: a radioisotope or radionuclide (eg, ³ H, ¹⁴ C, ¹⁵ N, ³⁵ S, ⁹⁰ Y, ⁹⁹ Tc, ¹¹¹ In, ¹²⁵ I, ¹³¹ I), fluorescent label (eg FITC, rhodamine, lanthanide phosphor), enzymatic label (eg horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase), chemiluminescent agent or biotin.

Another aspect provides a method for detecting double-stranded DNA using the biosensor according to the aspect.

The method includes: loading a liquid sample into the biosensor according to an aspect; and detecting the double-stranded DNA in the sample by measuring the signal generated by the biosensor.

In one embodiment, the biosensor may be an electrochemical sensor. In this case, the method includes loading a liquid sample into the electrochemical sensor; and detecting the double-stranded DNA in the sample by measuring the electrochemical signal generated by the electrochemical sensor.

In another embodiment, the biosensor may be a lateral flow analysis-based biosensor. In this case, the method includes loading a liquid sample into a sample pad of the lateral flow analysis-based biosensor; and detecting the double-stranded DNA in the sample by measuring signals generated in the test region and the control region.

The sample may be a PCR product obtained by performing a polymerase chain reaction (PCR) on a specimen isolated from an individual. The polymerase chain reaction may be performed using a primer that specifically binds to a nucleic acid sequence to be detected. Therefore, as long as there is genetic information of the infectious disease or disease to be confirmed, it can be used for detection by the biosensor.

The sample separated from the subject may include blood, saliva, cerebrospinal fluid, sweat, urine, milk, ascites, mucus, nasal fluid, hemoptysis, joint blood, abdominal fluid, vaginal fluid, menses, amniotic fluid, semen, etc. can, but is not limited thereto.

By the method, double-stranded DNA can be detected qualitatively, quantitatively, or both qualitatively and quantitatively.

Double-stranded DNA can be detected by using a protein that non-specifically binds to a nucleic acid sequence or a fusion protein comprising the same to double-stranded DNA according to an aspect. Therefore, the protein can be applied as a biosensor for detecting double-stranded DNA.

1 shows the detection principle of a lateral flow analysis-based biosensor using a MagR-MazE fusion protein.
2 is a result of analyzing the degree of purification of the MagR-MazE fusion protein using a His-tag column or magnetic nanoparticles. For His-Tag, FT: flow through; W1: 50 mM NaH ₂ PO ₄ , 300 mM NaCl, and 20 ml of 60 mM imidazole; W2: 50 mM NaH ₂ PO ₄ , 300 mM NaCl, and 20 ml of 60 mM imidazole; E: 15 ml of 50 mM NaH ₂ PO ₄ , 300 mM NaCl, and 300 mM imidazole. For Mag nanoparticles, FT: flow through; W1: Supernatant after mixing 200 nm magnetic nanoparticles and MagR-MazE fusion protein at room temperature, incubating for 10 minutes, and submerging magnetic nanoparticles with a magnet; W2: Supernatant after mixing 200 nm magnetic nanoparticles and MagR-MazE fusion protein at room temperature, incubating for 10 minutes, and submerging magnetic nanoparticles with a magnet; E: 200 nm magnetic nanoparticles.
Figure 3 shows the results of checking whether E. coli infection using an electrophoresis or LFA-based biosensor.
4 shows the results of antibiotic resistance gene detection using an electrophoresis or LFA-based biosensor.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example 1: Preparation of MagR-MazE fusion protein

A MagR-MazE fusion protein comprising a fragment of the MagR protein that specifically binds to magnetic nanoparticles (MNP) and a fragment of the antitoxin MazE protein that specifically binds to dsDNA (double stranded DNA) was prepared.

Specifically, the MagR-MazE fusion protein was prepared as follows. The MagR-MazE fusion construct was prepared by fusing two repeats of i) MagR (residues 16-132) and ii) Escherichia coli MazE (residues 2-49) of Coluba livia by a GGGGSGGGGSG amino acid linker. did The amino acid sequence of MagR used is shown in SEQ ID NO: 1, and the nucleotide sequence is shown in SEQ ID NO: 5. The amino acid sequence of MazE used is shown in SEQ ID NO: 2, and the nucleotide sequence is shown in SEQ ID NO: 6. The nucleotide sequence of the MagR-MazE fusion construct used is shown in SEQ ID NO:4. The MagR-MazE fusion construct was cloned into the pET His6 LIC cloning vector (2Bc-T).

For overexpression of the fusion protein, the vector was transformed into BL21 (DE3) cells. Cells were grown at 37°C to an OD600 of 0.5-0.6, and then IPTG was added to a final concentration of 0.5 mM. Cells were incubated overnight (18 hours) at 18 °C. His-tagged MagR-MazE fusion protein was purified using a Ni-NTA column (GE Healthcare, Chicago, IL, USA) and eluted with buffer (50 mM NaH ₂ PO ₄ ,300 mM NaCl, 300 mM imidazole). . For further purification of the clMagR-MazE fusion protein, the protein was loaded onto a Superdex 200-pg FPLC column (GE Healthcare, Chicago, IL, USA) pre-equilibrated with PBS.

The amino acid sequence of the prepared MagR-MazE fusion protein is as shown in SEQ ID NO: 3.

Example 2: Preparation of lateral flow analysis-based biosensor using MagR-MazE fusion protein

An LFA-based biosensor was prepared using the MagR-MazE fusion protein prepared in Example 1.

First, 200 μl of MagR-MazE fusion protein (2 mg/ml) and 100 μl of magnetic nanoparticles (MNP, 25 mg/ml, diameter 200 nm, fluidMAG-DX dextran) were mixed, and incubated for 5 minutes. and MNP were conjugated. The conjugated mixture was washed 3 times with 200 μL of PBST. Finally, the conjugated mixture was diluted 1/2 with PBS containing 1% (v/v) Triton x-10 and 2% (v/v) Tween-20.

A lateral flow analysis-based biosensor including a sample pad, a conjugate pad, a membrane (FF80HP Membranes | Cytiva, formerly GE Healthcare Life Sciences), and an absorbent pad was manufactured using the MagR-MazE fusion protein.

1 shows the detection principle of a lateral flow analysis-based biosensor using a MagR-MazE fusion protein.

Example 3: Confirmation of binding ability of MagR-MazE fusion protein to magnetic nanoparticles

In order to confirm the binding ability of the MagR-MazE fusion protein to magnetic nanoparticles (MNP), the degree of purification of the MagR-MazE fusion protein was compared using a His-tag column or magnetic nanoparticles generally used for protein purification. .

Specifically, for conjugation of MagR-MazE fusion protein and MNP, mix 200 µL of cell lysed MagR-MazE protein mixture with 100 µL of MNP (25 mg/mL, diameter 200 nm) and mix for at least 5 minutes during cultured. The conjugated mixture was washed 3 times with 200 μL of PBST. Purification was analyzed through SDS-PAGE for 20 ul of the final product.

2 is a result of analyzing the degree of purification of the MagR-MazE fusion protein using a His-tag column or magnetic nanoparticles.

As shown in FIG. 2 , looking at the result of E (Elution), it was confirmed that the protein was purified to a high purity even using magnetic nanoparticles. Therefore, it was confirmed that the MagR-MazE fusion protein had excellent binding ability to magnetic nanoparticles.

Example 4: Detection of E. coli using LFA-based biosensors

E. coli was detected using the LFA-based biosensor prepared in Example 2.

Specifically, DNA was isolated from a sample in which E. coli was diluted in PBS, and PCR was performed using E. coli-specific primer sets (SEQ ID NOs: 7 and 8, or SEQ ID NOs: 7 and 9) described in Table 1 below. The PCR product was loaded onto the sample pad of the LFA-based biosensor of Example 2.

Primer name Primer direction Sequence (5'→3') SEQ ID NO: 16s rRNA primer (410F) forward AAGAAGGCCTTCGGGTTGTAAAGTAC 7 16s rRNA primer (907R) reverse CCGTCAATTCCTTTAAGTTT 8 CCGTCAATTCCTTTGAGTTT 9

Figure 3 shows the results of checking whether E. coli infection using an electrophoresis or LFA-based biosensor.

As shown in FIG. 3 , it was found that the result of confirming the PCR product by electrophoresis and the result of confirming through the LFA-based biosensor were the same. Therefore, it was confirmed that the target material could be simply detected through the LFA-based biosensor using the MagR-MazE fusion protein without electrophoresis.

Example 5: Detection of antibiotic resistance gene using LFA-based biosensor

An antibiotic resistance gene was detected using the LFA-based biosensor prepared in Example 2.

Specifically, DNA was isolated from a sample diluted in PBS with E. coli having a plasmid containing an ampicillin (AMP) resistance gene, and PCR was performed using the ampicillin resistance gene-specific primer set described in Table 2 below. PCR conditions were 95°C for 5 minutes, 95°C for 1 minute, 55°C for 1 minute, 72°C for 1 minute, and 30 cycles. The PCR product was loaded onto the sample pad of the LFA-based biosensor of Example 2.

Primer name Primer direction Sequence (5'→3') SEQ ID NO: AMP resistance gene primer (305F) forward GATGCTGAAAGATCAGTTGG 10 AMP resistance gene primer (1020R) reverse
CGTTCATCCATAGTTGCC 11

4 shows the results of antibiotic resistance gene detection using an electrophoresis or LFA-based biosensor.

As shown in FIG. 4 , it was found that the result of confirming the PCR product by electrophoresis and the result of confirming through the LFA-based biosensor were the same. Therefore, it was confirmed that the target material could be simply detected through the LFA-based biosensor using the MagR-MazE fusion protein without electrophoresis.

<110> SB Bioscience Co., Ltd. <120> Biosensor comprising a protein that binds to double-stranded DNA non-specifically with a nucleic acid sequence, or fusion protein comprising the same <130> PN200157 <160> 11 <170> KoPatentIn 3.0 <210> 1 <211> 142 <212> PRT <213> Columba livia <400> 1 Met Lys Ser Ser His His His His His His His Gly Ser Ser Val Ser Lys 1 5 10 15 Arg Lys Ile Gln Ala Thr Arg Ala Ala Leu Thr Leu Thr Pro Ser Ala 20 25 30 Val Gln Lys Ile Lys Glu Leu Leu Lys Asp Lys Pro Glu His Val Gly 35 40 45 Val Lys Val Gly Val Arg Thr Arg Gly Cys Asn Gly Leu Ser Tyr Thr 50 55 60 Leu Glu Tyr Thr Lys Ser Lys Gly Asp Ser Asp Glu Glu Val Val Gln 65 70 75 80 Asp Gly Val Arg Val Phe Ile Glu Lys Lys Ala Gln Leu Thr Leu Leu 85 90 95 Gly Thr Glu Met Asp Tyr Val Glu Asp Lys Leu Ser Ser Glu Phe Val 100 105 110 Phe Asn Asn Pro Asn Ile Lys Gly Thr Cys Gly Cys Gly Glu Ser Phe 115 120 125 Asn Ile Glu Asn Leu Tyr Phe Gln Ser Asn Ile Gly Ser Gly 130 135 140 <210> 2 <211> 134 <212> PRT <213> Escherichia coli <400> 2 Met Lys Ser Ser His His His His His His His Glu Asn Leu Tyr Phe Gln 1 5 10 15 Ser Asn Ala Asp Asp Asp Asp Lys Gly Ile His Ser Ser Val Lys Arg 20 25 30 Trp Gly Asn Ser Pro Ala Val Arg Ile Pro Ala Thr Leu Met Gln Ala 35 40 45 Leu Asn Leu Asn Ile Asp Asp Glu Val Lys Ile Asp Leu Val Asp Gly 50 55 60 Lys Leu Ile Ile Glu Pro Val Arg Lys Glu Gly Gly Gly Gly Ser Gly 65 70 75 80 Gly Gly Gly Ser Gly Ile His Ser Ser Val Lys Arg Trp Gly Asn Ser 85 90 95 Pro Ala Val Arg Ile Pro Ala Thr Leu Met Gln Ala Leu Asn Leu Asn 100 105 110 Ile Asp Asp Glu Val Lys Ile Asp Leu Val Asp Gly Lys Leu Ile Ile 115 120 125 Glu Pro Val Arg Lys Glu 130 <210> 3 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> MagR-MazE fusion protein <400> 3 Met Lys Ser Ser His His His His His His His Gly Ser Ser Val Ser Lys 1 5 10 15 Arg Lys Ile Gln Ala Thr Arg Ala Ala Leu Thr Leu Thr Pro Ser Ala 20 25 30 Val Gln Lys Ile Lys Glu Leu Leu Lys Asp Lys Pro Glu His Val Gly 35 40 45 Val Lys Val Gly Val Arg Thr Arg Gly Cys Asn Gly Leu Ser Tyr Thr 50 55 60 Leu Glu Tyr Thr Lys Ser Lys Gly Asp Ser Asp Glu Glu Val Val Gln 65 70 75 80 Asp Gly Val Arg Val Phe Ile Glu Lys Lys Ala Gln Leu Thr Leu Leu 85 90 95 Gly Thr Glu Met Asp Tyr Val Glu Asp Lys Leu Ser Ser Glu Phe Val 100 105 110 Phe Asn Asn Pro Asn Ile Lys Gly Thr Cys Gly Cys Gly Glu Ser Phe 115 120 125 Asn Ile Glu Asn Leu Tyr Phe Gln Ser Asn Ala Asp Asp Asp Asp Lys 130 135 140 Gly Ile His Ser Ser Val Lys Arg Trp Gly Asn Ser Pro Ala Val Arg 145 150 155 160 Ile Pro Ala Thr Leu Met Gln Ala Leu Asn Leu Asn Ile Asp Asp Glu 165 170 175 Val Lys Ile Asp Leu Val Asp Gly Lys Leu Ile Ile Glu Pro Val Arg 180 185 190 Lys Glu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Ile His Ser 195 200 205 Ser Val Lys Arg Trp Gly Asn Ser Pro Ala Val Arg Ile Pro Ala Thr 210 215 220 Leu Met Gln Ala Leu Asn Leu Asn Ile Asp Asp Glu Val Lys Ile Asp 225 230 235 240 Leu Val Asp Gly Lys Leu Ile Ile Glu Pro Val Arg Lys Glu 245 250 <210> 4 <211> 765 <212> DNA <213> Artificial Sequence <220> <223> MagR-MazE fusion protein <400> 4 atgaaatctt ctcaccatca ccatcaccat ggttcttctg tatcaaaaag aaagatacaa 60 gctacaaggg cggcactgac tttgaccccg agcgcggtcc agaagattaa agagctgttg 120 aaggacaagc cggagcacgt gggcgtaaaa gttggcgtgc gcacccgtgg ttgcaatggt 180 ctctcctaca ccctggaata tacgaaaagc aaaggtgatt ctgatgagga ggtcgtgcag 240 gatggtgttc gtgttttcat cgagaaaaag gctcaactga ccttactggg cacggaaatg 300 gactacgtgg aagacaagct gtcgagcgaa tttgttttca acaacccgaa tattaagggc 360 acctgtggct gcggtgaaag ctttaacatc gaaaacctgt acttccaatc caatgcagac 420 gatgatgaca agggtattca ttcatcagtg aagcgttggg gtaactcgcc cgctgttcgc 480 attcctgcca cattaatgca ggctctgaac ttgaacatcg acgacgaagt taaaattgat 540 ttagtagacg gtaaattgat catcgaaccg gtgcgcaagg agggtggagg gggatcggga 600 gggggcggtt cgggaatcca tagcagtgta aagcgctggg gcaattcacc agcggtccgt 660 atccctgcaa cactgatgca agccctgaac ttaaatattg acgatgaagt caagatcgac 720 ttggtagatg gtaaacttat cattgagccg gtgcgtaagg agtaa 765 <210> 5 <211> 502 <212> DNA <213> Columba livia <400> 5 cctgcaggac tcgagttcta gaaataattt tgtttaactt taagaaggag atatacatat 60 gaaatcttct caccatcacc atcaccatgg ttcttctgta tcaaaaagaa agatacaagc 120 tacaagggcg gcactgactt tgaccccgag cgcggtccag aagattaaag agctgttgaa 180 ggacaagccg gagcacgtgg gcgtaaaagt tggcgtgcgc acccgtggtt gcaatggtct 240 ctcctacacc ctggaatata cgaaaagcaa aggtgattct gatgaggagg tcgtgcagga 300 tggtgttcgt gttttcatcg agaaaaaggc tcaactgacc ttactgggca cggaaatgga 360 ctacgtggaa gacaagctgt cgagcgaatt tgttttcaac aacccgaata ttaagggcac 420 ctgtggctgc ggtgaaagct ttaacatcga aaacctgtac ttccaatcca atattggaag 480 tggataacgg atccgcgatc gc 502 <210> 6 <211> 385 <212> DNA <213> Escherichia coli <400> 6 tacttccaat ccaatgcaga cgatgatgac aagggtattc attcatcagt gaagcgttgg 60 ggtaactcgc ccgctgttcg cattcctgcc acattaatgc aggctctgaa cttgaacatc 120 gacgacgaag ttaaaattga tttagtagac ggtaaattga tcatcgaacc ggtgcgcaag 180 gagggtggag ggggatcggg agggggcggt tcgggaatcc atagcagtgt aaagcgctgg 240 ggcaattcac cagcggtccg tatccctgca acactgatgc aagccctgaa cttaaatatt 300 gacgatgaag tcaagatcga cttggtagat ggtaaactta tcattgagcc ggtgcgtaag 360 gagtaataac attggaagtg gataa 385 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> 16s rRNA primer (410F) <400> 7 aagaaggcct tcgggttgta aagtac 26 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 16s rRNA primer (907R) <400> 8 ccgtcaattc ctttaagttt 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 16s rRNA primer (907R) <400> 9 ccgtcaattc ctttgagttt 20 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> AMP resistance gene primer (305F) <400> 10 gatgctgaag atcagttgg 19 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> AMP resistance gene primer (1020R) <400> 11 cgttcatcca tagttgcc 18

Claims (20)

A MagR-MazE fusion protein comprising a magnetoreceptor (MagR) protein, or a fragment thereof, and a dimer of the antitoxin MazE protein, or a fragment thereof. The MagR-MazE fusion protein according to claim 1, wherein the MagR protein fragment comprises the 16th to 132th amino acid sequence of SEQ ID NO: 1. The MagR-MazE fusion protein according to claim 1, wherein the monomer of the fragment of the antitoxin MazE protein comprises the 26th to 74th amino acid sequence of SEQ ID NO:2. The MagR-MazE fusion protein according to claim 1, wherein the monomers of the fragment of the antitoxin MazE protein are linked by a linker. The MagR-MazE fusion protein according to claim 1, wherein the MagR-MazE fusion protein comprises the amino acid sequence of SEQ ID NO: 3. The MagR-MazE fusion protein according to claim 1, wherein the MagR-MazE fusion protein comprises a region that specifically binds to a bead and a region that non-specifically binds to a nucleic acid sequence to double-stranded DNA (dsDNA). a protein or fragment thereof that non-specifically binds a nucleic acid sequence to double-stranded DNA (dsDNA); And a composition for detecting double-stranded DNA comprising a conjugate comprising a bead or antibody linked to the protein or fragment thereof. The composition according to claim 7, wherein the protein or fragment thereof that non-specifically binds to the nucleic acid sequence to the double-stranded DNA (dsDNA) has greater binding capacity to dsDNA than to single-stranded DNA (ssDNA), and has an isoelectric point of 9 or less. The method according to claim 7, wherein the protein binding to the nucleic acid sequence non-specifically to the double-stranded DNA (dsDNA) is a helix-turn-helix domain, a zinc pinker domain, a leucine zipper domain, a wing helix ( winged helix domain, wing helix-turn-helix domain, helix-loop-helix domain, HMG-box domain, Wor3 domain, OB-fold domain, B3 domain , TALE (TAL effecter) domain, or a composition comprising two or more combinations thereof. The method according to claim 7, wherein the protein that non-specifically binds to the nucleic acid sequence to the double-stranded DNA (dsDNA) is a MazE protein, FOXO, p53, EcoRV, FoK1, Cro, or any one of these fragments or a dimer of the fragment. . The composition of claim 7, wherein the beads are magnetic nanoparticles or gold nanoparticles. The composition according to claim 7, wherein the protein or fragment thereof that non-specifically binds to the nucleic acid sequence to the double-stranded DNA (dsDNA) is linked to the bead through a protein or fragment thereof capable of binding to the bead. The composition of claim 12, wherein the protein capable of binding to the bead is any one selected from the group consisting of MagR, heme protein, iron-sulfur protein, transferrin, lactoferrin, and ferritin. A kit for detecting double-stranded DNA comprising the composition of claim 7. a protein or fragment thereof that non-specifically binds a nucleic acid sequence to double-stranded DNA (dsDNA); and a conjugate comprising a bead or antibody linked to the protein or fragment thereof, wherein the conjugate is immobilized on a support, a biosensor for detecting double-stranded DNA. The biosensor of claim 15 , wherein the biosensor is an electrochemical sensor or a lateral flow analysis-based biosensor in the form of a strip. The method according to claim 16, wherein the strip-type lateral flow analysis-based biosensor,
and (a) a sample pad, (b) a conjugate pad, (c) a membrane, and (d) an absorbent pad, disposed sequentially from one end to the other end;
The conjugate pad includes a protein or fragment thereof that non-specifically binds to a nucleic acid sequence to double-stranded DNA (dsDNA); and a conjugate comprising a bead linked to the protein or fragment thereof,
a test region and a control region are sequentially formed on the membrane in a direction from the conjugate pad to the absorbent pad;
A first binder that specifically binds to a target material that binds to a protein or fragment thereof that non-specifically binds a nucleic acid sequence to the double-stranded DNA of the conjugate is fixed to the test region,
In the control region, a second binder that does not specifically bind to the target material but binds to a protein or fragment thereof that non-specifically binds to the nucleic acid sequence to the double-stranded DNA is fixed, lateral flow analysis-based biosensor . loading a liquid sample into the biosensor according to claim 15; and
A method of detecting double-stranded DNA, comprising the step of detecting the double-stranded DNA in the sample by measuring the signal generated by the biosensor. The method according to claim 18, wherein the sample is a PCR product obtained by performing a polymerase chain reaction (PCR) on a specimen isolated from an individual. The method of claim 18 , wherein the double-stranded DNA is detected qualitatively, quantitatively, or both qualitatively and quantitatively.

Images