KR20220049422A - Biosensor comprising a protein that binds to double-stranded DNA non-specifically with a nucleic acid sequence, or fusion protein comprising the same - Google Patents

Biosensor comprising a protein that binds to double-stranded DNA non-specifically with a nucleic acid sequence, or fusion protein comprising the same Download PDF

Info

Publication number
KR20220049422A
KR20220049422A KR1020200133037A KR20200133037A KR20220049422A KR 20220049422 A KR20220049422 A KR 20220049422A KR 1020200133037 A KR1020200133037 A KR 1020200133037A KR 20200133037 A KR20200133037 A KR 20200133037A KR 20220049422 A KR20220049422 A KR 20220049422A
Authority
KR
South Korea
Prior art keywords
protein
stranded dna
double
fragment
maze
Prior art date
Application number
KR1020200133037A
Other languages
Korean (ko)
Other versions
KR102575754B1 (en
Inventor
강주영
Original Assignee
(주)에스비바이오사이언스
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)에스비바이오사이언스 filed Critical (주)에스비바이오사이언스
Priority to KR1020200133037A priority Critical patent/KR102575754B1/en
Priority to PCT/KR2021/014262 priority patent/WO2022080901A1/en
Publication of KR20220049422A publication Critical patent/KR20220049422A/en
Application granted granted Critical
Publication of KR102575754B1 publication Critical patent/KR102575754B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/465Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from birds
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/245Escherichia (G)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6804Nucleic acid analysis using immunogens
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/558Immunoassay; Biospecific binding assay; Materials therefor using diffusion or migration of antigen or antibody
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Analytical Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Urology & Nephrology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Physics & Mathematics (AREA)
  • Toxicology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Provided is a biosensor comprising a protein which binds to double-stranded DNA in non-specifically with a nucleic acid sequence, or a fusion protein comprising the same and a method for detecting double-stranded DNA using the same. According to the present invention, the double-stranded DNA can be qualitatively and/or quantitatively detected.

Description

이중가닥 DNA에 핵산 서열 비특이적으로 결합하는 단백질, 또는 그를 포함하는 융합단백질을 포함하는 바이오센서 {Biosensor comprising a protein that binds to double-stranded DNA non-specifically with a nucleic acid sequence, or fusion protein comprising the same}A biosensor comprising a protein that binds to double-stranded DNA non-specifically with a nucleic acid sequence, or fusion protein comprising the same }

이중가닥 DNA에 핵산 서열 비특이적으로 결합하는 단백질, 또는 그를 포함하는 융합단백질을 포함하는 바이오센서 및 이를 이용하여 이중가닥 DNA를 검출하는 방법에 관한 것이다.To a biosensor comprising a protein that non-specifically binds to a nucleic acid sequence to double-stranded DNA, or a fusion protein comprising the same, and a method for detecting double-stranded DNA using the same.

측방유동분석(Lateral Flow Assay, LFA)은 특별한 장비가 없이도 간단한 방법으로 액체 샘플에서 타겟을 검출할 수 있는 종이 기반의 바이오센서이다. 기존의 측방유동분석은 주로 금나노입자(Gold Nano Particle, AuNP)에 항체를 접합하여 타겟을 검출하는 방식을 사용하였다. AuNP에 항체를 접합하여 LFA에 응용하는 방법은 타겟 검출에 대한 민감도를 높이고, 결과를 눈으로 관찰할 수 있는 장점이 있다. 하지만 이 방법은 검출하고자 하는 타겟에 따라서 새로 항체를 찾아야 하고, 찾은 항체를 AuNP에 접합하여야 한다. 따라서, 타겟에 특이적으로 반응하는 항체를 찾는 데 많은 비용과 시간이 소모된다. 또한, AuNP에 항체를 접합하는 과정에서 항체의 효율이 떨어지며, AuNP의 생산단가가 비싸다는 문제가 있다.Lateral Flow Assay (LFA) is a paper-based biosensor that can detect a target in a liquid sample in a simple way without special equipment. Existing lateral flow analysis mainly used a method of detecting a target by conjugating an antibody to gold nanoparticles (AuNP). The method of conjugating an antibody to AuNP and applying it to LFA has the advantage of increasing the sensitivity to target detection and visually observing the result. However, in this method, a new antibody must be found according to the target to be detected, and the found antibody must be conjugated to AuNP. Therefore, it is expensive and time-consuming to find an antibody that reacts specifically to a target. In addition, in the process of conjugating the antibody to the AuNP, the efficiency of the antibody is lowered, and there is a problem that the production cost of the AuNP is expensive.

따라서, 보다 간단하고 신속하게 타겟을 검출할 수 있는 LFA-기반 바이오센서의 개발이 여전히 필요하다.Therefore, there is still a need for the development of an LFA-based biosensor capable of detecting a target more simply and quickly.

일 양상은 이중가닥 DNA(dna)에 핵산 서열 비특이적으로 결합하는 단백질 또는 이의 단편, 및 비드에 결합하는 단백질, 또는 이의 단편을 포함하는 융합단백질을 제공한다. One aspect provides a fusion protein comprising a protein or fragment thereof that non-specifically binds to a nucleic acid sequence to double-stranded DNA (dna), and a protein or fragment thereof that binds to a bead.

다른 양상은 일 양상에 따른 상기 융합단백질을 암호화하는 폴리뉴클레오티드를 제공한다.Another aspect provides a polynucleotide encoding the fusion protein according to an aspect.

다른 양상은 일 양상에 따른 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 제공한다.Another aspect provides a recombinant vector comprising the polynucleotide according to an aspect.

다른 양상은 일 양상에 따른 상기 재조합 벡터로 형질전환된 숙주세포를 제공한다.Another aspect provides a host cell transformed with the recombinant vector according to the aspect.

다른 양상은 일 양상에 따른 숙주세포를 배양하는 단계를 포함하는, 상기 융합단백질의 제조방법을 제공한다.Another aspect provides a method for producing the fusion protein, comprising the step of culturing the host cell according to an aspect.

다른 양상은 일 양상에 따른 이중가닥 DNA(dna)에 핵산 서열 비특이적으로 결합하는 단백질 또는 이의 단편을 포함하는 이중가닥 DNA 검출용 조성물을 제공한다.Another aspect provides a composition for detecting double-stranded DNA comprising a protein or fragment thereof that non-specifically binds to a nucleic acid sequence to double-stranded DNA (dna) according to an aspect.

다른 양상은 일 양상에 따른 이중가닥 DNA(dna)에 핵산 서열 비특이적으로 결합하는 단백질 또는 이의 단편을 포함하는 이중가닥 DNA 검출용 키트를 제공한다.Another aspect provides a kit for detecting double-stranded DNA comprising a protein or fragment thereof that non-specifically binds to a nucleic acid sequence to double-stranded DNA (dna) according to an aspect.

다른 양상은 이중가닥 DNA를 검출하기 위한 바이오센서를 제공한다.Another aspect provides a biosensor for detecting double-stranded DNA.

다른 양상은 일 양상에 따른 상기 바이오센서를 이용하여 이중가닥 DNA를 검출하는 방법을 제공한다.Another aspect provides a method for detecting double-stranded DNA using the biosensor according to the aspect.

일 양상은 이중가닥 DNA(dna)에 핵산 서열 비특이적으로 결합하는 단백질 또는 이의 단편, 및 비드에 결합하는 단백질 또는 이의 단편을 포함하는 융합단백질을 제공한다.One aspect provides a fusion protein comprising a protein or fragment thereof that non-specifically binds to a nucleic acid sequence to double-stranded DNA (dna), and a protein or fragment thereof that binds to a bead.

본 명세서에서, 폴리펩티드 또는 폴리뉴클레오티드의 "서열 동일성 (sequence identity)"은 특정 비교 영역에서 양 서열을 최대한 일치되도록 얼라인시킨 후 서열간의 아미노산 잔기 또는 염기의 동일한 정도를 의미한다. 서열 동일성은 특정 비교 영역에서 2개의 서열을 최적으로 얼라인하여 비교함으로써 측정되는 값으로서, 비교 영역 내에서 서열의 일부는 대조 서열 (reference sequence)과 비교하여 부가, 삭제되어 있을 수 있다. 서열 동일성 백분율은 예를 들면, 비교 영역 전체에서 두 개의 최적으로 정렬된 서열을 비교하는 단계, 두 서열 모두에서 동일한 아미노산 또는 핵산이 나타나는 위치의 갯수를 결정하여 일치된 (matched) 위치의 갯수를 수득하는 단계, 상기 일치된 위치의 갯수를 비교 범위 내의 위치의 총 갯수 (즉, 범위 크기)로 나누는 단계, 및 상기 결과에 100을 곱하여 서열 동일성의 백분율을 수득하는 단계에 의해 계산될 수 있다. 상기 서열 동일성의 퍼센트는 공지의 서열 비교 프로그램을 사용하여 결정될 수 있으며, 일례로 BLASTN(NCBI), CLC Main Workbench (CLC bio), MegAlignTM(DNASTAR Inc) 등을 들 수 있다. As used herein, the term "sequence identity" of a polypeptide or polynucleotide refers to the degree of the same degree of amino acid residues or bases between sequences after aligning both sequences to be as consistent as possible in a specific comparison region. Sequence identity is a value measured by optimally aligning and comparing two sequences in a specific comparison region, and a portion of the sequence in the comparison region may be added or deleted compared to a reference sequence. Percent sequence identity can be determined by, for example, comparing two optimally aligned sequences throughout the comparison region, determining the number of positions in both sequences where the same amino acid or nucleic acid appears, to obtain the number of matched positions. , dividing the number of matched positions by the total number of positions within the comparison range (ie, range size), and multiplying the result by 100 to obtain a percentage of sequence identity. The percent sequence identity may be determined using a known sequence comparison program, and examples thereof include BLASTN (NCBI), CLC Main Workbench (CLC bio), MegAlign™ (DNASTAR Inc), and the like.

여러 종의 동일하거나 유사한 기능이나 활성을 가지는 폴리펩티드 또는 폴리뉴클레오티드를 확인하는데 있어 여러 수준의 서열 동일성을 사용할 수 있다. 예를 들어, 50%이상, 55%이상, 60%이상, 65%이상, 70%이상, 75%이상, 80%이상, 85%이상, 90%이상, 95%이상, 96%이상, 97%이상, 98%이상, 99%이상 또는 100% 등을 포함하는 서열 동일성이다.Multiple levels of sequence identity can be used to identify polypeptides or polynucleotides that have the same or similar function or activity of different species. For example, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more. sequence identity including greater than, greater than 98%, greater than 99%, or greater than 100%.

용어 “핵산 서열 비특이적으로 결합”이란 DNA, RNA와 같은 염기 서열을 갖는 물질에의 결합이 그 물질의 염기 서열에 관계없이 이루어지는 것을 의미한다.The term “non-specific binding to a nucleic acid sequence” means that binding to a substance having a nucleotide sequence such as DNA or RNA is performed regardless of the nucleotide sequence of the substance.

따라서, “이중가닥 DNA에 핵산 서열 비특이적으로 결합”이란 이중가닥 DNA의 서열에 관계없이 그 이중가닥 DNA에 결합하는 것을 의미한다.Accordingly, "non-specific binding of a nucleic acid sequence to double-stranded DNA" means binding to double-stranded DNA regardless of the sequence of the double-stranded DNA.

상기 이중가닥 DNA에 핵산 서열 비특이적으로 결합하는 단백질은 단일가닥 DNA (single-stranded DNA, ssDNA)에의 결합능보다 이중가닥 DNA (double-stranded DNA, dsDNA)에의 결합능이 큰 단백질일 수 있다.The protein that non-specifically binds to the nucleic acid sequence to the double-stranded DNA may be a protein having a greater binding capacity to double-stranded DNA (dsDNA) than to single-stranded DNA (ssDNA).

상기 이중가닥 DNA에 핵산 서열 비특이적으로 결합하는 단백질은 등전점이 9.0 이하, 0.1 내지 9.0, 0.1 내지 8.0, 0.1 내지 7.0, 1.0 내지 9.0, 1.0 내지 8.0, 1.0 내지 7.0, 2.0 내지 9.0, 2.0 내지 8.0, 2.0 내지 7.0, 3.0 내지 9.0, 3.0 내지 8.0, 3.0 내지 7.0, 4.0 내지 9.0, 4.0 내지 8.0, 4.0 내지 7.0, 4.0 내지 6.0, 4.0 내지 5.0, 4.5 내지 5.5, 5.0 내지 9.0, 5.0 내지 8.0, 5.0 내지 7.0, 또는 5.0 내지 6.0인 것일 수 있다. 일 구체예에서, 항독소 MazE 단백질의 단편의 모노머는 등전점이 4.0 내지 5.0일 수 있고, 예를 들어 4.83일 수 있다. 다른 구체예에서, 항독소 MazE 단백질의 단편의 다이머는 등전점이 5.0 내지 6.0일 수 있고, 예를 들어 5.31일 수 있다. The protein that non-specifically binds to the double-stranded DNA has an isoelectric point of 9.0 or less, 0.1 to 9.0, 0.1 to 8.0, 0.1 to 7.0, 1.0 to 9.0, 1.0 to 8.0, 1.0 to 7.0, 2.0 to 9.0, 2.0 to 8.0, 2.0 to 7.0, 3.0 to 9.0, 3.0 to 8.0, 3.0 to 7.0, 4.0 to 9.0, 4.0 to 8.0, 4.0 to 7.0, 4.0 to 6.0, 4.0 to 5.0, 4.5 to 5.5, 5.0 to 9.0, 5.0 to 8.0, 5.0 to It may be 7.0, or 5.0 to 6.0. In one embodiment, the monomer of the fragment of the antitoxin MazE protein may have an isoelectric point of 4.0 to 5.0, for example 4.83. In another embodiment, the dimer of the fragment of the antitoxin MazE protein may have an isoelectric point of 5.0 to 6.0, for example 5.31.

상기 이중가닥 DNA에 핵산 서열 비특이적으로 결합하는 단백질은 헬릭스-턴-헬릭스(helix-turn-helix) 도메인, 징크 핑커 도메인, 루신 지퍼(leucine zipper) 도메인, 윙 헬릭스(winged helix) 도메인, 윙 헬릭스-턴-헬릭스(winged helix-turn-helix) 도메인, 헬릭스-루프-헬릭스(helix-loop-helix) 도메인, HMG-박스 도메인, Wor3 도메인, OB-fold 도메인, B3 도메인, TALE(TAL effecter) 도메인, 또는 이들의 2 이상의 조합을 포함하는 것일 수 있다. The protein non-specifically binding to the nucleic acid sequence to the double-stranded DNA is a helix-turn-helix domain, a zinc pinker domain, a leucine zipper domain, a wing helix domain, a wing helix- Turn-helix (winged helix-turn-helix) domain, helix-loop-helix (helix-loop-helix) domain, HMG-box domain, Wor3 domain, OB-fold domain, B3 domain, TALE (TAL effecter) domain, Or it may include a combination of two or more thereof.

상기 이중가닥 DNA에 핵산 서열 비특이적으로 결합하는 단백질은 항독소 MazE 단백질, FOXO(forkhead box 단백질, 예: FOXO1, FOXO2, FOXO3, FOXO4), p53, EcoRV, FoK1, Cro(Control of repressor's operator protein), 또는 이들 중 어느 하나의 단편 또는 그 단편의 다이머일 수 있으나, 이에 제한되지 않는다.The protein that non-specifically binds to the double-stranded DNA is an antitoxin MazE protein, a forkhead box protein (FOXO, such as FOXO1, FOXO2, FOXO3, FOXO4), p53, EcoRV, FoK1, Cro (Control of repressor's operator protein), or a fragment of any one of these or a dimer of the fragment, but is not limited thereto.

상기 비드는 마이크로비드 또는 나노비드일 수 있다. 상기 마이크로비드의 크기는 1 μm 내지 1000 μm, 1 μm 내지 500 μm, 1 μm 내지 100 μm, 10 μm 내지 1000 μm, 10 μm 내지 500 μm, 또는 10 μm 내지 100 μm일 수 있으나, 이에 제한되지 않는다. 상기 나노비드의 크기는 1 nm 내지 1000 nm, 1 nm 내지 500 nm, 1 nm 내지 100 nm, 10 nm 내지 1000 nm, 10 nm 내지 500 nm, 10 nm 내지 100 nm, 100 nm 내지 1000 nm, 또는 100 nm 내지 500 nm일 수 있으나, 이에 제한되지 않는다. 일 구체예에서, 상기 비드는 나노입자일 수 있다.The beads may be microbeads or nanobeads. The size of the microbead may be 1 μm to 1000 μm, 1 μm to 500 μm, 1 μm to 100 μm, 10 μm to 1000 μm, 10 μm to 500 μm, or 10 μm to 100 μm, but is not limited thereto. . The size of the nanobeads is 1 nm to 1000 nm, 1 nm to 500 nm, 1 nm to 100 nm, 10 nm to 1000 nm, 10 nm to 500 nm, 10 nm to 100 nm, 100 nm to 1000 nm, or 100 It may be from nm to 500 nm, but is not limited thereto. In one embodiment, the beads may be nanoparticles.

상기 비드는 유리, 니켈, 폴리에틸렌, 폴리프로필렌, 폴리(4-메틸부텐), 폴리스티렌, 폴리아크릴레이트, 폴리에틸렌 테레프탈레이트, 레이온, 나일론, 폴리(비닐 부티레이트), 폴리비닐리덴 디플루오라이드(PCDF), 실리콘, 폴리포름알데히드, 셀룰로스, 셀룰로스 아세테이트, 니트로셀룰로스, 젤라틴, 세파로스 마크로비드, 세파덱스 비드, 덱스트란 마이크로캐리어, 아가로스, 알기네이트, 카라기난, 키틴, 셀룰로스, 덱스트란, 전분, 폴리카프로락톤(PCL), 폴리아크릴아미드, 폴리아크롤레인, 폴리디메틸실록산, 폴리비닐 알콜, 폴리메틸아크릴레이트, 퍼플루오로카본, 실리카, 규조토, 알루미나, 금, 산화철, 그래핀, 산화그래핀, 및 금속 산화물 중 어느 하나의 비드일 수 있으나, 이에 제한되지 않는다. 예를 들어, 상기 비드는 자성 비드 또는 금 비드일 수 있다.The beads are glass, nickel, polyethylene, polypropylene, poly(4-methylbutene), polystyrene, polyacrylate, polyethylene terephthalate, rayon, nylon, poly(vinyl butyrate), polyvinylidene difluoride (PCDF), Silicone, polyformaldehyde, cellulose, cellulose acetate, nitrocellulose, gelatin, sepharose macrobead, sephadex bead, dextran microcarrier, agarose, alginate, carrageenan, chitin, cellulose, dextran, starch, polycaprolactone (PCL), polyacrylamide, polyacrolein, polydimethylsiloxane, polyvinyl alcohol, polymethylacrylate, perfluorocarbon, silica, diatomaceous earth, alumina, gold, iron oxide, graphene, graphene oxide, and metal oxides It may be any one bead, but is not limited thereto. For example, the beads may be magnetic beads or gold beads.

일 구체예에서, 상기 비드는 자성 나노입자 또는 금 나노입자일 수 있다.In one embodiment, the beads may be magnetic nanoparticles or gold nanoparticles.

상기 비드에 결합하는 단백질은 MagR(magnetoreceptor) 단백질, 헴단백질(Heme protein)(예: 헤모글로빈, 사이토크롬 등), 철-황 단백질, 트랜스페린(Transferrin), 락토페린(Lactoferrin), 및 페리틴(Ferritin)으로 이루어진 군으로부터 선택된 어느 하나인 것일 수 있으나, 이에 제한되지 않는다.Protein binding to the bead is MagR (magnetoreceptor) protein, heme protein (eg, hemoglobin, cytochrome, etc.), iron-sulfur protein, transferrin (Transferrin), lactoferrin (Lactoferrin), and ferritin (Ferritin) It may be any one selected from the group consisting of, but is not limited thereto.

일 구체예에서, 상기 융합단백질은 MagR(magnetoreceptor) 단백질, 또는 이의 단편 및 항독소 MazE 단백질, 또는 이의 단편을 포함하는 MagR-MazE 융합단백질일 수 있다.In one embodiment, the fusion protein may be a MagR-MazE fusion protein comprising a magnetoreceptor (MagR) protein, or a fragment thereof and an anti-toxin MazE protein, or a fragment thereof.

용어 “MagR(magnetoreceptor) 단백질”은 “자기수용체 단백질”, “자성수용체(magnetic receptor) 단백질”, “자성 단백질(magnetic protein)”, “ISCA1(Iron-sulfur cluster assembly 1) 단백질” 등으로도 알려져 있다. 상기 MagR 단백질은 자성 물질에 결합할 수 있다. 상기 MagR 단백질의 유래는 초파리, 나방, 조류 등일 수 있으나, 이에 제한되지 않는다. 예를 들어, 상기 MagR 단백질은 초파리속(Drosophila sp.); 아그로티스속(Agrotis sp.); 비둘기(Columba livia) 등의 조류로부터 유래된 것일 수 있으나, 이에 제한되지 않는다. MagR 단백질의 예시적인 서열은 NCBI Accession No. P0DN75.1, NWQ81101.1, XP_027490836.1, XP_005154986.1 등이 있으나, 이에 제한되지 않는다. 예를 들어, MagR 단백질은 NCBI Accession No. P0DN75.1의 16 내지 132번째 아미노산 서열과 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 서열 동일성을 갖는 아미노산 서열을 포함하는 단백질일 수 있다.The term “MagR (magnetoreceptor) protein” is also known as “magnetic receptor protein”, “magnetic receptor protein”, “magnetic protein”, “ISCA1 (Iron-sulfur cluster assembly 1) protein”, etc. there is. The MagR protein may bind to a magnetic material. The MagR protein may be derived from fruit flies, moths, or birds, but is not limited thereto. For example, the MagR protein is from Drosophila sp.; Agrotis genus ( Agrotis sp.); It may be derived from birds such as pigeons ( Columba livia ), but is not limited thereto. Exemplary sequences of the MagR protein are NCBI Accession No. P0DN75.1, NWQ81101.1, XP_027490836.1, XP_005154986.1, etc., but are not limited thereto. For example, the MagR protein is NCBI Accession No. It may be a protein comprising an amino acid sequence having 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity to the 16th to 132th amino acid sequence of P0DN75.1.

용어 “항독소(antitoxin) MazE 단백질”은 타입 II 독소-항독소 시스템의 항독소 성분이다. 상기 항독소 MazE 단백질은 이중가닥 DNA에 결합할 수 있다. 상기 항독소 MazE 단백질은 박테리아 유래 단백질일 수 있고, 예를 들어 대장균(Escherichia coli) 유래 단백질일 수 있으나, 이에 제한되지 않는다. 항독소 MazE 단백질의 예시적인 서열은 NCBI Accession no. WP_000581937 등이 있으나, 이에 제한되지 않는다. 예를 들어, 항독소 MazE 단백질은 NCBI Accession no. WP_000581937의 2 내지 50번째 아미노산 서열과 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 서열 동일성을 갖는 아미노산 서열을 포함하는 단백질일 수 있다.The term “antitoxin MazE protein” is the antitoxin component of the type II toxin-antitoxin system. The antitoxin MazE protein can bind to double-stranded DNA. The antitoxin MazE protein may be a protein derived from bacteria, for example, a protein derived from Escherichia coli , but is not limited thereto. An exemplary sequence of the antitoxin MazE protein is NCBI Accession no. WP_000581937, etc., but is not limited thereto. For example, the antitoxin MazE protein is NCBI Accession no. It may be a protein comprising an amino acid sequence having 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity to the 2nd to 50th amino acid sequence of WP_000581937.

용어 “융합단백질(fusion protein)”은 서로 다른 2개 이상의 단백질 또는 동종의 단백질이 결합된 형태로 만들어진 새로운 단백질이다. 2개 이상의 이종 단백질이 일부와 일부, 일부와 전체, 또는 전체와 전체가 결합한다. “MagR-MazE 융합단백질”은 MagR 단백질과 항독소 MazE 단백질이 일부와 일부, 일부와 전체, 또는 전체와 전체가 결합하여 형성된 단백질을 의미한다. 일 구체예에서, MagR-MazE 융합단백질은 MagR 단백질의 단편 및 항독소 MazE 단백질의 단편을 포함하는 단백질을 의미한다. The term “fusion protein” is a new protein made in the form of two or more different proteins or homologous proteins combined. Two or more heterologous proteins bind in part and in part, in part and in whole, or in whole and in whole. “MagR-MazE fusion protein” refers to a protein formed by combining a MagR protein and an anti-toxin MazE protein in part, in part, in part, or in whole. In one embodiment, the MagR-MazE fusion protein refers to a protein comprising a fragment of a MagR protein and a fragment of an antitoxin MazE protein.

용어 “단편(fragment)”은 전체가 아닌 절단된 일부를 의미한다. 단백질의 단편은 단백질의 절단된 일부 서열을 의미할 수 있다. “MagR 단백질의 단편”은 MagR 단백질의 자기수용체 기능을 갖는 단편을 의미할 수 있다. “항독소 MazE 단백질의 단편”은 항독소 MazE 단백질의 이중가닥 DNA와 결합하는 능력을 갖는 단편을 의미할 수 있다. The term “fragment” refers to a truncated part rather than the whole. A fragment of a protein may refer to a truncated partial sequence of a protein. “Fragment of the MagR protein” may refer to a fragment having a magnetic receptor function of the MagR protein. “Fragment of antitoxin MazE protein” may refer to a fragment having the ability to bind to double-stranded DNA of antitoxin MazE protein.

상기 MagR 단백질의 단편은 서열번호 1의 16 내지 132번째 아미노산 서열을 포함하는 것일 수 있다. 상기 MagR 단백질의 단편은 서열번호 1의 16 내지 132번째 아미노산 서열과 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 서열 동일성을 갖는 아미노산 서열을 포함하는 것일 수 있다. The fragment of the MagR protein may include the 16th to 132th amino acid sequence of SEQ ID NO: 1. The MagR protein fragment comprises an amino acid sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the 16 to 132th amino acid sequence of SEQ ID NO: 1. it could be

상기 항독소 MazE 단백질의 단편은 서열번호 2의 26 내지 74번째 아미노산 서열을 포함하는 것일 수 있다. 상기 항독소 MazE 단백질의 단편은 서열번호 2의 26 내지 74번째 아미노산 서열과 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 서열 동일성을 갖는 아미노산 서열을 포함하는 것일 수 있다.The fragment of the anti-toxin MazE protein may include the amino acid sequence of positions 26 to 74 of SEQ ID NO: 2. The fragment of the anti-toxin MazE protein comprises an amino acid sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the 26th to 74th amino acid sequence of SEQ ID NO: 2. may be doing

상기 MagR-MazE 융합단백질은 항독소 MazE 단백질의 단편을 2개 이상, 2개 내지 10개, 2개 내지 9개, 2개 내지 8개, 2개 내지 7개, 2개 내지 6개, 2개 내지 5개, 2개 내지 4개, 2개 내지 3개, 또는 2개 포함할 수 있다. 상기 MagR-MazE 융합단백질에 포함되는 각각의 항독소 MazE 단백질의 단편은 동일한 서열을 갖는 것이거나 상이한 서열을 갖는 것일 수 있다. 상기 MagR-MazE 융합단백질에 포함되는 각각의 항독소 MazE 단백질의 단편은 동일한 서열을 갖는 것일 수 있다. 일 구체예에 있어서, 상기 융합단백질이 MazE 단백질의 단편(모노머)을 2개 이상 포함할 경우, 상기 각각의 모노머는 링커에 의해 연결될 수 있다. 상기 링커로는 예를 들어, 가요성 링커가 적용될 수 있다. 또한, 상기 링커는 단백질 가수 분해효소 (Protease resistance)에 대한 저항성을 갖는 것일 수 있다. 예를 들어, 상기 링커는, 1 내지 400개, 1 내지 200개, 또는 2 내지 200개의 임의의 아미노산으로 이루어진 폴리펩티드일 수 있다. 상기 펩티드 링커는 Gly, Asn 및 Ser 잔기를 포함할 수 있으며, Thr 및 Ala과 같은 중성 아미노산들도 포함될 수 있다. 펩티드 링커에 적합한 아미노산 서열은 당업계에 공지되어 있다. 또한 기능적 일부분 사이의 적절한 분리를 달성하기 위하여 또는 필수적인 내부-일부분(inter-moiety)의 상호작용을 유지하기 위한 링커의 최적화를 고려하여 카피 수 “n”을 조절할 수 있다. 해당 기술분야에서 다른 가요성 링커들이 알려져 있는데, 예를 들어 수용성을 향상시키기 위하여 극성 아미노산 잔기를 추가하는 것뿐만 아니라 유연성을 유지하기 위하여 T 및 A와 같은 아미노산 잔기를 추가한 G 및 S 링커가 있을 수 있다. 따라서 일 구체예에 있어서, 상기 링커는 G, S, 및/또는 T 잔기를 포함하는 유연성 링커일 수 있다. 상기 링커는 (GpSs)n 및 (SpGs)n으로부터 선택되는 일반식을 가질 수 있고, 이 경우, 독립적으로, p는 1 내지 10의 정수이고, s = 0 내지 10의 0 또는 정수이고, p + s는 20 이하의 정수이고, 및 n은 1 내지 20의 정수이다. 더욱 구체적으로 링커의 예는 (GGGGS)n, (SGGGG)n, (SRSSG)n, (SGSSC)n, (GKSSGSGSESKS)n, (RPPPPC)n, (SSPPPPC)n,  (GSTSGSGKSSEGKG)n, (GSTSGSGKSSEGSGSTKG)n, (GSTSGSGKPGSGEGSTKG)n, 또는 (EGKSSGSGSESKEF)n이고, 상기 n은 1 내지 20, 또는 1 내지 10의 정수이다. The MagR-MazE fusion protein comprises two or more fragments of the antitoxin MazE protein, 2 to 10, 2 to 9, 2 to 8, 2 to 7, 2 to 6, 2 to 5, 2 to 4, 2 to 3, or 2 may be included. Each fragment of the anti-toxin MazE protein included in the MagR-MazE fusion protein may have the same sequence or a different sequence. Each fragment of the anti-toxin MazE protein included in the MagR-MazE fusion protein may have the same sequence. In one embodiment, when the fusion protein includes two or more fragments (monomers) of the MazE protein, each of the monomers may be linked by a linker. As the linker, for example, a flexible linker may be applied. In addition, the linker may have resistance to protease (Protease resistance). For example, the linker may be a polypeptide consisting of any amino acids from 1 to 400, from 1 to 200, or from 2 to 200 amino acids. The peptide linker may include Gly, Asn and Ser residues, and neutral amino acids such as Thr and Ala may also be included. Amino acid sequences suitable for peptide linkers are known in the art. The copy number “n” can also be adjusted to achieve proper separation between functional moieties or to allow for optimization of the linker to maintain the necessary inter-moiety interactions. Other flexible linkers are known in the art, for example G and S linkers to which amino acid residues such as T and A are added to maintain flexibility as well as polar amino acid residues to improve water solubility. can Accordingly, in one embodiment, the linker may be a flexible linker comprising G, S, and/or T residues. The linker may have a general formula selected from (G p S s ) n and (S p G s ) n , in which case, independently p is an integer from 1 to 10, and s = 0 from 0 to 10 or an integer, p + s is an integer of 20 or less, and n is an integer from 1 to 20. More specifically, an example of a linker is (GGGGS) n , (SGGGG) n , (SRSSG) n , (SGSSC) n , (GKSSGSGSESKS) n , (RPPPPC) n , (SSPPPPC) n , (GSTSGSGKSSEGKG) n , (GSTSGSGSGSSEG) n , (GSTSGSGKPGSGEGSTKG) n , or (EGKSSGSGSESKEF) n , wherein n is an integer of 1 to 20, or 1 to 10.

일 구체예에서, 상기 융합단백질은 MagR(magnetoreceptor) 단백질, 또는 이의 단편 및 항독소 MazE 단백질, 또는 이의 단편의 다이머를 포함하는 MagR-MazE 융합단백질일 수 있다. 상기 항독소 MazE 단백질의 단편의 다이머는 항독소 MazE 단백질의 단편의 모노머 2개가 결합하여 형성된 것이다. 상기 항독소 MazE 단백질의 단편의 모노머는 서열번호 2의 26 내지 74번째 아미노산 서열을 포함하는 것일 수 있다. 상기 항독소 MazE 단백질의 단편의 모노머는 링커에 의해 연결된 것일 수 있다.In one embodiment, the fusion protein may be a MagR-MazE fusion protein comprising a magnetoreceptor (MagR) protein, or a fragment thereof, and an anti-toxin MazE protein, or a dimer of a fragment thereof. The dimer of the fragment of the antitoxin MazE protein is formed by combining two monomers of the fragment of the antitoxin MazE protein. The monomer of the fragment of the antitoxin MazE protein may include the amino acid sequence of positions 26 to 74 of SEQ ID NO: 2. The monomers of the fragment of the antitoxin MazE protein may be linked by a linker.

상기 MagR-MazE 융합단백질은 서열번호 3의 아미노산 서열을 포함하는 것일 수 있다. 상기 MagR-MazE 융합단백질은 서열번호 3의 아미노산 서열과 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상의 서열 동일성을 갖는 아미노산 서열을 포함하는 것일 수 있다. 상기 MagR-MazE 융합단백질은 서열번호 3의 아미노산 서열로 구성되는 것일 수 있다.The MagR-MazE fusion protein may include the amino acid sequence of SEQ ID NO: 3. The MagR-MazE fusion protein has 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more sequence identity with the amino acid sequence of SEQ ID NO: 3 It may include an amino acid sequence. The MagR-MazE fusion protein may be composed of the amino acid sequence of SEQ ID NO: 3.

본 명세서에서, 단백질은 그 기능적 동등물을 포함한다. 상기 기능적 동등물에는 단백질의 일부 또는 전부가 치환되거나, 일부가 결실 또는 부가된 아미노산 서열 변형체가 상기 단백질의 기능을 유지하는 것 모두를 포함한다. 아미노산의 치환은 보존적 치환을 의미할 수 있다. 천연에 존재하는 아미노산의 보존적 치환의 예는 다음과 같다: 지방족 아미노산(Gly, Ala, Pro), 소수성 아미노산(Ile, Leu, Val), 방향족 아미노산(Phe, Tyr, Trp), 산성 아미노산(Asp, Glu), 염기성 아미노산(His, Lys, Arg, Gln, Asn) 및 황함유 아미노산(Cys, Met). 아미노산의 결실은 상기 단백질의 활성에 직접 관여하지 않는 부분에 위치한다.As used herein, a protein includes its functional equivalent. The functional equivalent includes all or part of the protein in which all or part of the amino acid sequence variant is deleted or added, which retains the function of the protein. Substitution of amino acids may refer to conservative substitutions. Examples of conservative substitutions for naturally occurring amino acids are: aliphatic amino acids (Gly, Ala, Pro), hydrophobic amino acids (Ile, Leu, Val), aromatic amino acids (Phe, Tyr, Trp), acidic amino acids (Asp) , Glu), basic amino acids (His, Lys, Arg, Gln, Asn) and sulfur-containing amino acids (Cys, Met). Deletion of amino acids is located in a region not directly involved in the activity of the protein.

상기 MagR-MazE 융합단백질은 비드에 특이적으로 결합하는 영역 및 이중가닥 DNA (dsDNA)에 핵산 서열 비특이적으로 결합하는 영역을 포함하는 것일 수 있다. 예를 들어, MagR-MazE 융합단백질에서 MagR 단백질의 단편 서열이 포함된 영역은 비드에 결합할 수 있고, MazE 단백질의 단편 서열이 포함된 영역은 dsDNA에 핵산 서열 비특이적으로 결합할 수 있다.The MagR-MazE fusion protein may include a region specifically binding to a bead and a region binding to a nucleic acid sequence non-specifically to double-stranded DNA (dsDNA). For example, in the MagR-MazE fusion protein, a region containing a fragment sequence of a MagR protein may bind to a bead, and a region containing a fragment sequence of a MazE protein may non-specifically bind a nucleic acid sequence to dsDNA.

다른 양상은 일 양상에 따른 상기 융합단백질을 암호화하는 폴리뉴클레오티드를 제공한다.Another aspect provides a polynucleotide encoding the fusion protein according to an aspect.

상기 폴리뉴클레오티드는 변형될 수 있다. 상기 변형은 뉴클레오티드의 추가, 결실, 또는 비보존적 치환 또는 보존적 치환을 포함한다.The polynucleotide may be modified. Such modifications include additions, deletions, or non-conservative or conservative substitutions of nucleotides.

상기 폴리뉴클레오티드는 서열번호 4의 뉴클레오티드 서열을 포함하는 것일 수 있다. 상기 폴리뉴클레오티드는 서열번호 4의 뉴클레오티드 서열로 구성되는 것일 수 있다. 상기 폴리뉴클레오티드는 서열번호 4의 뉴클레오티드 서열과 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상의 서열 동일성을 갖는 뉴클레오티드 서열로 구성되는 것일 수 있다. The polynucleotide may include the nucleotide sequence of SEQ ID NO: 4. The polynucleotide may be composed of the nucleotide sequence of SEQ ID NO: 4. The polynucleotide consists of a nucleotide sequence having 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more sequence identity to the nucleotide sequence of SEQ ID NO: 4 it may be

다른 양상은 일 양상에 따른 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 제공한다.Another aspect provides a recombinant vector comprising the polynucleotide according to an aspect.

용어 "벡터(vector)"는 숙주 세포에서 목적 유전자를 발현시키기 위한 수단을 의미한다. 예를 들어, 플라스미드 벡터, 코즈미드(cosmid) 벡터, 박테리오파지(bacteriophage) 벡터, 아데노바이러스(adenovirus) 벡터, 레트로바이러스(retrovirus) 벡터 및 아데노-연관 바이러스 벡터와 같은 바이러스 벡터를 포함한다. 상기 재조합 벡터로 사용될 수 있는 벡터는 당업계에서 종종 사용되는 플라스미드 (예를 들어, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pGEX 시리즈, pET 시리즈, pUC19 및 p426GPD 등), 파아지(예를 들어, λλλλΔ및 M13 등) 또는 바이러스(예를 들어, CMV, SV40 등)를 조작하여 제작될 수 있으나, 이에 제한되는 것은 아니다. 플라스미드가 현재 벡터의 가장 통상적으로 사용되는 형태이므로, 본 발명의 명세서에서 "플라스미드(plasmid)" 및 "벡터(vector)"는 때로 상호 교환적으로 사용된다.The term “vector” refers to a means for expressing a gene of interest in a host cell. Examples include viral vectors such as plasmid vectors, cosmid vectors, bacteriophage vectors, adenovirus vectors, retrovirus vectors and adeno-associated viral vectors. Vectors that can be used as the recombinant vector include plasmids often used in the art (eg, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14. , pGEX series, pET series, pUC19 and p426GPD, etc.), phage (e.g., λλλλΔ and M13, etc.) or viruses (e.g., CMV, SV40, etc.), but are not limited thereto. Since a plasmid is currently the most commonly used form of a vector, "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention.

상기 재조합 벡터에서 서열번호 3의 아미노산 서열을 암호화하는 폴리뉴클레오티드는 프로모터에 작동 가능하게 연결될 수 있다. 용어 “작동적으로 연결”된 것이란 목적 단백질을 암호화하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터의 서열과 상기 폴리뉴클레오티드 서열이 기능적으로 연결되어 있는 것을 의미한다.In the recombinant vector, the polynucleotide encoding the amino acid sequence of SEQ ID NO: 3 may be operably linked to a promoter. The term “operably linked” means that a promoter sequence that initiates and mediates transcription of a polynucleotide encoding a target protein and the polynucleotide sequence are functionally linked.

상기 재조합 벡터는 전형적으로 클로닝을 위한 벡터 또는 발현을 위한 벡터로서 구축될 수 있다. 상기 발현용 벡터는 당업계에서 식물, 동물 또는 미생물에서 외래의 단백질을 발현하는데 사용되는 통상의 것을 사용할 수 있다. 상기 재조합 벡터는 당업계에 공지된 다양한 방법을 통해 구축될 수 있다.The recombinant vector can typically be constructed as a vector for cloning or as a vector for expression. The expression vector may be a conventional vector used to express a foreign protein in plants, animals or microorganisms in the art. The recombinant vector can be constructed through various methods known in the art.

상기 재조합 벡터는 원핵 세포 또는 진핵 세포를 숙주로 하여 구축될 수 있다. 예를 들어, 사용되는 벡터가 발현 벡터이고 원핵 세포를 숙주로 하는 경우, 전사를 진행시킬 수 있는 강력한 프로모터(예를 들어, pLλ프로모터, trp 프로모터, lac 프로모터, tac 프로모터, T7 프로모터 등), 해독의 개시를 위한 라이보좀 결합 자리 및 전사/해독 종결 서열을 포함하는 것이 일반적이다. 진핵 세포를 숙주로 하는 경우, 벡터에 포함되는 진핵 세포에서 작동하는 복제원점은 f1 복제원점, SV40 복제원점, pMB1 복제원점, 아데노 복제원점, AAV 복제원점, CMV 복제원점 및 BBV 복제원점 등을 포함하나, 이에 제한되는 것은 아니다. 또한, 포유동물 세포의 게놈으로부터 유래된 프로모터(예를 들어, 메탈로티오닌 프로모터) 또는 포유동물 바이러스로부터 유래된 프로모터(예를 들어, 아데노바이러스 후기 프로모터, 백시니아 바이러스 7.5K 프로모터, SV40 프로모터, 사이토메갈로바이러스(CMV) 프로모터 및 HSV의 tk 프로모터)가 이용될 수 있으며, 일반적으로 전사 종결 서열로서 폴리아데닐화 서열을 가진다.The recombinant vector can be constructed using a prokaryotic cell or a eukaryotic cell as a host. For example, when the vector used is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of propagating transcription (eg, pLλ promoter, trp promoter, lac promoter, tac promoter, T7 promoter, etc.), translation It is common to include a ribosome binding site and transcription/translation termination sequence for initiation of When a eukaryotic cell is used as a host, the replication origin operating in the eukaryotic cell included in the vector includes the f1 origin of replication, SV40 origin of replication, pMB1 origin of replication, adeno origin of replication, AAV origin of replication, CMV origin of replication and BBV origin of replication. However, the present invention is not limited thereto. In addition, promoters derived from the genome of mammalian cells (eg, metallotionine promoter) or from mammalian viruses (eg, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, The cytomegalovirus (CMV) promoter and the tk promoter of HSV) can be used, and generally have a polyadenylation sequence as a transcription termination sequence.

다른 양상은 일 양상에 따른 상기 재조합 벡터로 형질전환된 숙주세포를 제공한다.Another aspect provides a host cell transformed with the recombinant vector according to the aspect.

재조합 벡터로 형질전환될 수 있는 숙주세포로는 통상 DNA의 도입 효율과 도입된 DNA의 발현 효율이 높은 숙주가 사용된다. 예를 들어 대장균, 슈도모나스, 바실러스, 스트렙토마이세스, 진균, 효모와 같은 주지의 진핵 및 원핵 숙주들, 스포도프테라 프루기페르다(SF 9)와 같은 곤충 세포, CHO, COS 1, COS 7, BSC 1, BSC40, BMT 10 등의 동물 세포 등이 사용될 수 있으나, 이에 제한되지 않는다.As a host cell that can be transformed with a recombinant vector, a host with high DNA introduction efficiency and high expression efficiency of the introduced DNA is usually used. Well-known eukaryotic and prokaryotic hosts, e.g. E. coli, Pseudomonas, Bacillus, Streptomyces, fungi, yeast, insect cells such as Spodoptera frugiperda (SF 9), CHO, COS 1, COS 7, Animal cells such as BSC 1, BSC40, and BMT 10 may be used, but the present invention is not limited thereto.

폴리뉴클레오티드 또는 이를 포함하는 재조합 벡터의 숙주세포 내로의 삽입은, 당업계에 널리 알려진 방법을 사용할 수 있다. 상기 운반 방법은 예를 들어, 숙주세포가 원핵 세포인 경우, 칼슘 클로라이드(CaCl2) 방법 또는 전기천공법 등을 사용할 수 있고, 숙주세포가 진핵 세포인 경우, 미세 주입법, 칼슘 포스페이트 침전법, 전기천공법, 리포좀-매개 형질감염법 및 유전자 밤바드먼트 등을 사용할 수 있으나, 이에 제한되지 않는다. Insertion of a polynucleotide or a recombinant vector containing the same into a host cell may use a method well known in the art. As the transport method, for example, when the host cell is a prokaryotic cell, a calcium chloride (CaCl2) method or electroporation method may be used, and when the host cell is a eukaryotic cell, a microinjection method, calcium phosphate precipitation method, electroporation method, liposome-mediated transfection, and gene bombardment may be used, but are not limited thereto.

다른 양상은 일 양상에 따른 숙주세포를 배양하는 단계를 포함하는, 상기 융합단백질의 제조방법을 제공한다.Another aspect provides a method for producing the fusion protein, comprising the step of culturing the host cell according to an aspect.

상기 배양하는 단계에서 배지와 배양조건은 숙주세포에 따라 통상적으로 이용되는 것을 적절하게 선택하여 이용할 수 있으며, 융합단백질의 대량 생산에 적합하도록 온도, 배양시간 등의 배양 조건을 조절할 수 있다. 배양 단계를 거쳐 발현된 융합단백질은 세포의 여액(lysate)으로부터 분리할 수 있다. 과잉발현이 끝난 형질전환체를 원심분리하여 세포 펠렛(cell pellet)을 수득하고, 파열된 세포벽 또는 세포막이 포함된 배지 성분들을 제거함으로써 세포 여액(cell lysate)을 포함하는 용리액을 얻을 수 있다. 여기에서, 세포 펠렛은 당업계에 잘 알려진 방법, 예컨대 알칼리, 계면활성제 (CHAPS 및 SDS 등), 유기 용매 및 효소 (라이소자임 등)의 사용, 초음파처리(sonication) 및 고압분쇄기(French Press)의 사용, 주기적인 고온, 압력, 냉동 및 해동 사이클의 적용 등에 의하여 파쇄 (lysis)할 수 있다.In the culturing step, the medium and culture conditions may be appropriately selected and used depending on the host cell, and the culture conditions such as temperature and culture time may be adjusted to be suitable for mass production of the fusion protein. The fusion protein expressed through the culture step can be isolated from the lysate of the cell. The overexpression transformant is centrifuged to obtain a cell pellet, and an eluate containing a cell lysate can be obtained by removing the media components including the ruptured cell wall or cell membrane. Here, the cell pellet is prepared by methods well known in the art, such as alkalis, surfactants (CHAPS and SDS, etc.), organic solvents and enzymes (lysozyme, etc.), sonication and use of a French press. , can be lysed by periodic application of high temperature, pressure, freezing and thawing cycles, etc.

또한, 상기 융합단백질은 정제과정을 거쳐 순수하게 분리될 수 있다.In addition, the fusion protein may be isolated purely through a purification process.

다른 양상은 상기 이중가닥 DNA(dna)에 핵산 서열 비특이적으로 결합하는 단백질 또는 이의 단편을 포함하는 이중가닥 DNA 검출용 조성물을 제공한다.Another aspect provides a composition for detecting double-stranded DNA comprising a protein or fragment thereof that non-specifically binds to a nucleic acid sequence to the double-stranded DNA (dna).

용어 “이중가닥 DNA 검출”이란 이중가닥 DNA의 존재 여부를 확인하는 것을 의미한다. 상기 이중가닥 DNA 검출은 이중가닥 DNA를 특이적으로 검출하는 것을 의미할 수 있다. “이중가닥 DNA를 특이적으로 검출”하는 것은 단일가닥 DNA 등과 같은 이중가닥 DNA가 아닌 물질은 검출하지 않고 이중가닥 DNA만을 검출하는 것을 의미할 수 있다. 상기 이중가닥 DNA 검출은 이중가닥 DNA를 핵산 서열 비특이적으로 검출하는 것을 의미할 수 있다. 일 구체예에서, 상기 이중가닥 DNA 검출은 PCR 산물의 존재 여부를 검출하는 것일 수 있으나, 이에 제한되지 않는다.The term “double-stranded DNA detection” refers to determining the presence or absence of double-stranded DNA. The detection of double-stranded DNA may mean specifically detecting double-stranded DNA. “Specifically detecting double-stranded DNA” may mean detecting only double-stranded DNA without detecting non-double-stranded DNA, such as single-stranded DNA. The detection of double-stranded DNA may refer to non-specific detection of double-stranded DNA as a nucleic acid sequence. In one embodiment, the detection of the double-stranded DNA may be to detect the presence of a PCR product, but is not limited thereto.

일 구체예에서, 상기 조성물은 상기 이중가닥 DNA (dsDNA)에 핵산 서열 비특이적으로 결합하는 단백질 또는 이의 단편; 및 상기 단백질 또는 이의 단편과 연결된 비드 또는 항체를 포함하는 컨쥬게이트를 포함하는 것일 수 있다.In one embodiment, the composition comprises a protein or fragment thereof that non-specifically binds to the double-stranded DNA (dsDNA); and a conjugate comprising a bead or antibody linked to the protein or fragment thereof.

상기 이중가닥 DNA에 핵산 서열 비특이적으로 결합하는 단백질 또는 이의 단편은 전술한 바와 같다.The protein or fragment thereof that non-specifically binds to the nucleic acid sequence to the double-stranded DNA is as described above.

일 구체예에서, 상기 이중가닥 DNA에 핵산 서열 비특이적으로 결합하는 단백질 또는 이의 단편은 MazE 단백질 또는 이의 단편의 다이머일 수 있으나, 이에 제한되지 않는다.In one embodiment, the protein or fragment thereof that non-specifically binds to the nucleic acid sequence to the double-stranded DNA may be a dimer of the MazE protein or fragment thereof, but is not limited thereto.

상기 비드는 전술한 바와 같다. 일 구체예에서, 상기 비드는 자성 나노입자 또는 금 나노입자인 것일 수 있다.The bead is as described above. In one embodiment, the beads may be magnetic nanoparticles or gold nanoparticles.

상기 이중가닥 DNA (dsDNA)에 핵산 서열 비특이적으로 결합하는 단백질 또는 이의 단편은 비드와 결합할 수 있는 단백질 또는 이의 단편을 통해 상기 비드와 연결된 것일 수 있다. 상기 비드와 결합할 수 있는 단백질 또는 이의 단편은 비드에 결합하는 단백질 또는 이의 단편일 수 있다. 상기 비드에 결합하는 단백질 또는 이의 단편은 전술한 바와 같다.The protein or fragment thereof that non-specifically binds to the nucleic acid sequence to the double-stranded DNA (dsDNA) may be linked to the bead through a protein or fragment thereof capable of binding to the bead. The bead-binding protein or fragment thereof may be a bead-binding protein or fragment thereof. The protein or fragment thereof binding to the bead is as described above.

일 구체예에서, 상기 비드와 결합할 수 있는 단백질은 MagR일 수 있으나, 이에 제한되지 않는다.In one embodiment, the protein capable of binding to the bead may be MagR, but is not limited thereto.

상기 항체는 표적 항원에 특이적으로 결합하는 항체를 의미하며, 결합 특이성을 보유한다면 항체의 단편도 포함하는 의미이다. 상기 항체는 모노클로날 항체 또는 폴리클로날 항체일 수 있다. The antibody refers to an antibody that specifically binds to a target antigen, and includes a fragment of an antibody if it has binding specificity. The antibody may be a monoclonal antibody or a polyclonal antibody.

일 구체예에서, 상기 조성물은 MagR-MazE 융합단백질; 및 상기 융합단백질과 연결된 비드를 포함하는 컨쥬게이트를 포함하는 것일 수 있다. 상기 비드는 자성 나노입자일 수 있다. 상기 컨쥬게이트는 MagR-MazE 융합단백질-자성 나노입자 컨쥬게이트일 수 있다. 상기 컨쥬게이트는 MagR-MazE 융합단백질 및 자성 나노입자를 접촉시키는 단계에 의하여 제조될 수 있다. MagR-MazE 융합단백질의 MagR 단백질 단편 서열을 포함하는 영역과 자성 나노입자의 결합이 안정적이기 때문에, 타겟 질환이 바뀔 때마다 새로운 항체를 금 나노입자에 접합하여야 해서 효율이 떨어지던 기존 방법의 단점을 보완할 수 있다. In one embodiment, the composition comprises a MagR-MazE fusion protein; and a conjugate comprising a bead linked to the fusion protein. The beads may be magnetic nanoparticles. The conjugate may be a MagR-MazE fusion protein-magnetic nanoparticle conjugate. The conjugate may be prepared by contacting the MagR-MazE fusion protein and magnetic nanoparticles. Since the binding of magnetic nanoparticles to the region containing the MagR protein fragment sequence of the MagR-MazE fusion protein is stable, a new antibody must be conjugated to gold nanoparticles whenever the target disease changes. can be supplemented

상기 MagR-MazE 융합단백질-자성 나노입자 컨쥬게이트에서, MagR-MazE 융합단백질의 MazE 단백질 아미노산 서열을 포함하는 영역이 dsDNA에 결합하는 능력을 가지므로, 이에 의해 dsDNA를 검출할 수 있다. In the MagR-MazE fusion protein-magnetic nanoparticle conjugate, the region comprising the MazE protein amino acid sequence of the MagR-MazE fusion protein has the ability to bind to dsDNA, thereby detecting dsDNA.

다른 양상은 일 양상에 따른 상기 이중가닥 DNA 검출용 조성물을 포함하는 이중가닥 DNA 검출용 키트를 제공한다.Another aspect provides a kit for detecting double-stranded DNA comprising the composition for detecting double-stranded DNA according to an aspect.

상기 조성물 또는 키트에는 당업계에서 일반적으로 사용되는 도구, 시약 등을 추가로 포함할 수 있다. 이러한 도구 또는 시약으로는 적합한 담체, 검출 가능한 신호를 생성할 수 있는 표지 물질, 용해제, 세정제, 완충제, 안정화제 등을 포함하나, 이에 제한되는 것은 아니다.The composition or kit may further include tools, reagents, etc. commonly used in the art. Such tools or reagents include, but are not limited to, suitable carriers, labels capable of generating a detectable signal, solubilizing agents, detergents, buffers, stabilizers, and the like.

상기 키트에서, 상기 컨쥬게이트는 고체 지지체 상에 고정된 상태로 이용될 수 있다. 다양한 물질이 고체 지지체로 사용될 수 있으며, 셀룰로오스, 니트로셀룰로오스, 폴리비닐클로라이드, 실리카겔, 폴리스티렌, 나일론, 활성화된 비드 등을 예로 들 수 있으나, 이에 제한되는 것은 아니다.In the kit, the conjugate may be used in a state immobilized on a solid support. Various materials may be used as the solid support, and examples thereof include, but are not limited to, cellulose, nitrocellulose, polyvinyl chloride, silica gel, polystyrene, nylon, activated beads, and the like.

다른 양상은 이중가닥 DNA에 핵산 서열 비특이적으로 결합하는 단백질 또는 이의 단편을 포함하며, 이중가닥 DNA를 검출하기 위한 바이오센서를 제공한다.Another aspect provides a biosensor for detecting double-stranded DNA, comprising a protein or fragment thereof that non-specifically binds to a nucleic acid sequence to double-stranded DNA.

일 구체예에서, 상기 바이오센서는 이중가닥 DNA에 핵산 서열 비특이적으로 결합하는 단백질 또는 이의 단편; 및 상기 단백질 또는 이의 단편과 연결된 비드 또는 항체를 포함하는 컨쥬게이트를 포함하는 것일 수 있다.In one embodiment, the biosensor comprises a protein or fragment thereof that non-specifically binds to a nucleic acid sequence to double-stranded DNA; and a conjugate comprising a bead or antibody linked to the protein or fragment thereof.

상기 바이오센서는 지지체를 더 포함할 수 있다. 상기 지지체는 고체 지지체일 수 있다.The biosensor may further include a support. The support may be a solid support.

상기 컨쥬게이트는 지지체 상에 고정된 것일 수 있다. 상기 컨쥬게이트는 공유 결합 또는 비-공유 결합을 통해 지지체 상에 고정되는 것일 수 있다. 상기 비-공유 결합은 스트렙타비딘과 바이오틴의 결합 및 티올과 금의 결합으로 이루어진 군으로부터 선택된 적어도 하나의 구성원을 포함할 수 있다.The conjugate may be fixed on a support. The conjugate may be immobilized on a support through a covalent bond or a non-covalent bond. The non-covalent bond may include at least one member selected from the group consisting of a bond between streptavidin and biotin and a bond between thiol and gold.

상기 바이오센서는 이중가닥 DNA에 핵산 서열 비특이적으로 결합하는 단백질 또는 이의 단편을 사용하여 이중가닥 DNA를 검출하는 것을 구현할 수 있는 것이라면 그 종류를 제한하지 않는다.The type of the biosensor is not limited as long as it can be implemented to detect double-stranded DNA using a protein or fragment thereof that non-specifically binds to a nucleic acid sequence to double-stranded DNA.

일 구체예에서, 상기 바이오센서는 전기화학적 센서일 수 있다.In one embodiment, the biosensor may be an electrochemical sensor.

상기 바이오센서는 상기 이중가닥 DNA에 핵산 서열 비특이적으로 결합하는 단백질 또는 이의 단편과 결합하는 이중가닥 DNA의 농도에 따른 전기화학적 신호로부터 이중가닥 DNA의 농도를 검출하는 것일 수 있다.The biosensor may detect the concentration of double-stranded DNA from an electrochemical signal according to the concentration of the double-stranded DNA that binds to a protein or fragment thereof that non-specifically binds to the nucleic acid sequence to the double-stranded DNA.

일 구체예에서, 상기 바이오센서는 스트립 형태의 측방유동분석(Lateral flow assay, LFA)-기반 바이오센서일 수 있다.In one embodiment, the biosensor may be a strip-type lateral flow assay (LFA)-based biosensor.

상기 LFA-기반 바이오센서는 일단으로부터 타단 방향으로 순차적으로 배치된, (a) 샘플 패드, (b) 컨쥬게이트 패드, (c) 멤브레인, 및 (d) 흡수 패드를 포함한다.The LFA-based biosensor includes (a) a sample pad, (b) a conjugate pad, (c) a membrane, and (d) an absorption pad, which are sequentially arranged from one end to the other.

상기 “샘플 패드”는 분석을 행할 샘플을 수용하여 확산 흐름이 가능한 패드를 의미하며, 분석을 행할 샘플을 수용하여 함유하기에 충분한 다공성을 갖는 물질로 구성된다. 이러한 다공성 물질로는 섬유성 종이, 셀룰로오스 물질로 된 미세 기공 멤브레인, 셀룰로오스, 셀룰로오스 아세테이트와 같은 셀룰로오스 유도체, 니트로셀룰로오스, 유리섬유, 천연발생의 면(cotton), 나일론과 같은 직물 또는 다공성 겔 등이 있으나, 이에 제한되지 않는다.The "sample pad" means a pad capable of diffusion flow by receiving a sample to be analyzed, and is composed of a material having sufficient porosity to receive and contain a sample to be analyzed. Examples of such porous materials include fibrous paper, microporous membranes made of cellulosic materials, cellulose derivatives such as cellulose and cellulose acetate, nitrocellulose, glass fibers, naturally occurring cotton, fabrics such as nylon, or porous gels. , but not limited thereto.

상기 “컨쥬게이트 패드”는 샘플 패드로부터 확산되어 이동되는 샘플을 수용한다. 상기 컨쥬게이트 패드에는 이중가닥 DNA (dsDNA)에 핵산 서열 비특이적으로 결합하는 단백질 또는 이의 단편; 및 상기 단백질 또는 이의 단편과 연결된 비드를 포함하는 컨쥬게이트가 포함될 수 있다. 상기 컨쥬게이트 패드에는 상기 MagR-MazE 융합단백질; 및 상기 융합단백질과 연결된 비드를 포함하는 컨쥬게이트가 포함될 수 있다. 상기 비드는 자성 나노입자일 수 있다. 상기 컨쥬게이트는 MagR-MazE 융합단백질-자성 나노입자 컨쥬게이트일 수 있다. 상기 컨쥬게이트 패드는 샘플 패드와 마찬가지로 확산 흐름이 가능한 물질로 구성된다. 금나노입자 대신 자성 나노입자를 사용할 경우, 비용이 저렴할 수 있다.The "conjugate pad" receives the sample that is diffused and moved from the sample pad. The conjugate pad includes a protein or fragment thereof that non-specifically binds to a nucleic acid sequence to double-stranded DNA (dsDNA); and a conjugate comprising a bead linked to the protein or fragment thereof. The conjugate pad includes the MagR-MazE fusion protein; and a conjugate comprising a bead linked to the fusion protein. The beads may be magnetic nanoparticles. The conjugate may be a MagR-MazE fusion protein-magnetic nanoparticle conjugate. The conjugate pad, like the sample pad, is made of a material capable of diffusion flow. When magnetic nanoparticles are used instead of gold nanoparticles, the cost may be low.

상기 “멤브레인”은 샘플 물질이 통과할 수 있는 것이라면 어떠한 물질로도 제조될 수 있다. 예를 들어, 천연, 합성, 또는 합성에 의해 변형된 천연 발생 물질, 예를 들어 폴리사카라이드(예: 셀룰로오스 물질, 종이, 셀룰로오스 아세테이트 및 니트로셀룰로오스와 같은 셀룰로오스 유도체); 폴리에테르 술폰; 폴리에틸렌; 나일론; 폴리비닐리덴 플루오라이드(PVDF); 폴리에스테르; 폴리프로필렌; 실리카; 비닐 클로라이드, 비닐클로라이드-프로필렌 공중합체 및 비닐 클로라이드-비닐 아세테이트 공중합체와 같은 중합체와 함께 다공성 중합체 매트릭스에 균일하게 분산된 무기 물질, 예를 들어 불활성화된 알루미나, 규조토, MgSO4, 또는 다른 무기 미분 물질; 자연 발생(예: 면) 및 합성(예: 나일론 또는 레이온) 천; 다공성 겔, 예를 들어 실리카겔, 아가로스, 덱스트란 및 젤라틴; 중합체 필름, 예를 들어 폴리아크릴아미드 등의 물질로부터 형성될 수 있다. 일 구체예에서, 상기 멤브레인은 중합체 물질, 예를 들어 니트로셀룰로오스, 폴리에테르술폰, 폴리에틸렌, 나일론, 폴리비닐리덴 플루오라이드, 폴리에스테르 또는 폴리프로필렌을 포함한다.The “membrane” may be made of any material that can pass through the sample material. For example, naturally occurring, synthetic, or synthetically modified materials, such as polysaccharides (eg, cellulosic materials, paper, cellulose derivatives such as cellulose acetate and nitrocellulose); polyether sulfone; polyethylene; nylon; polyvinylidene fluoride (PVDF); Polyester; polypropylene; silica; An inorganic material uniformly dispersed in a porous polymer matrix with a polymer such as vinyl chloride, vinylchloride-propylene copolymer and vinyl chloride-vinyl acetate copolymer, for example deactivated alumina, diatomaceous earth, MgSO 4 , or other inorganic fines matter; naturally occurring (such as cotton) and synthetic (such as nylon or rayon) fabrics; porous gels such as silica gel, agarose, dextran and gelatin; It may be formed from a material such as a polymer film, for example polyacrylamide. In one embodiment, the membrane comprises a polymeric material such as nitrocellulose, polyethersulfone, polyethylene, nylon, polyvinylidene fluoride, polyester or polypropylene.

상기 “흡수 패드”는 상기 멤브레인의 말단에 또는 그 가까이에 인접해서 위치할 수 있다. 흡수 패드는 일반적으로 전체 멤브레인을 통해 이동하는 유체 샘플을 받아들인다. 흡수 패드는 멤브레인을 통한 모세관 작용 및 유체의 확산 유동을 촉진하는 데 도움을 줄 수 있다.The “absorbent pad” may be positioned adjacent to or near the distal end of the membrane. The absorbent pad generally receives a fluid sample that travels through the entire membrane. Absorbent pads can help promote capillary action and diffuse flow of fluids through the membrane.

상기 LFA-기반 바이오센서는 상기한 샘플 패드, 컨쥬게이트 패드, 멤브레인 및 흡수 패드가 동일한 지지체 상에 순차적으로 배치된 것이다.In the LFA-based biosensor, the sample pad, the conjugate pad, the membrane, and the absorbent pad are sequentially disposed on the same support.

상기 지지체는 상기한 샘플 패드, 컨쥬게이트 패드, 멤브레인 및 흡수 패드를 지지 및 운반할 수 있다면 어떠한 물질로도 형성될 수 있다. 일 구체예에서, 상기 지지체는 상기 멤브레인을 통해 확산하는 샘플의 유체가 지지체를 통해 누출되지 않도록 액체 불투과성이다. 예컨대, 유리; 중합체물질, 예를 들어 폴리스티렌, 폴리프로필렌, 폴리에스테르, 폴리부타디엔, 폴리비닐클로라이드, 폴리아미드, 폴리카르보네이트, 에폭시드, 메타크릴레이트, 폴리멜라민 등을 포함하지만, 이에 제한되지 않는다. The support may be formed of any material as long as it can support and transport the sample pad, conjugate pad, membrane and absorbent pad described above. In one embodiment, the support is liquid impermeable such that fluid of the sample diffusing through the membrane does not leak through the support. For example, glass; polymeric materials such as, but not limited to, polystyrene, polypropylene, polyester, polybutadiene, polyvinylchloride, polyamide, polycarbonate, epoxide, methacrylate, polymelamine, and the like.

상기 멤브레인 상에는 상기 컨쥬게이트 패드로부터 상기 흡수 패드 방향으로 테스트 영역 및 컨트롤 영역이 순차적으로 형성되어 있다.A test region and a control region are sequentially formed on the membrane in a direction from the conjugate pad to the absorbent pad.

상기 테스트 영역에는 상기 컨쥬게이트의 이중가닥 DNA에 핵산 서열 비특이적으로 결합하는 단백질 또는 이의 단편과 결합되는 표적 물질과 특이적으로 결합하는 제1 바인더, 예를 들면, 아비딘, 스트렙타비딘, 뉴트라비딘이 고정되어 있을 수 있다.In the test region, a first binder, for example, avidin, streptavidin, or neutravidin, that specifically binds to a target material that binds to a protein or fragment thereof that non-specifically binds to the nucleic acid sequence of the double-stranded DNA of the conjugate may be fixed.

상기 컨트롤 영역에는 상기 표적 물질에는 특이적으로 결합하지 않으나 상기 이중가닥 DNA에 핵산 서열 비특이적으로 결합하는 단백질 또는 이의 단편과는 결합하는 제2 바인더, 예를 들면, 이중 가닥 DNA가 스트렙타비딘을 통해 고정되어 있을 수 있다.In the control region, a second binder that does not specifically bind to the target material, but binds to a protein or fragment thereof that non-specifically binds to the nucleic acid sequence to the double-stranded DNA, for example, double-stranded DNA through streptavidin may be fixed.

상기 표적 물질은 dsDNA일 수 있다. 상기 dsDNA는 중합효소연쇄반응(PCR)에 의해 증폭된 산물일 수 있다. 상기 표적 물질은 상기 테스트 영역의 제1 바인더와 결합할 수 있도록 표지된 것일 수 있다. The target material may be dsDNA. The dsDNA may be a product amplified by polymerase chain reaction (PCR). The target material may be labeled so as to be able to bind to the first binder of the test region.

본 명세서에서 용어 “표지된” 또는 "라벨"은 예로써, 방사성 표지된 아미노산의 함입에 의한, 또는 표시된 아비딘 (가령, 광학적 또는 비색 방법에 의해 검출될 수 있는 형광 마커 또는 효소적 활성을 내포하는 스트렙타비딘)에 의해 검출될 수 있는 비오틴 모이어티의 폴리펩티드에 부착에 의한 검출가능한 마커의 부착을 지칭한다. 폴리펩티드와 당단백질을 표지하는 다양한 방법은 당분야에 공지되어 있고 이용될 수 있다. 폴리펩티드에 대한 라벨의 실례에는 하기가 포함되지만 이들에 국한되지 않는다: 방사성동위원소 또는 방사성핵종 (가령, 3H, 14C, 15N, 35S, 90Y, 99Tc, 111In, 125I, 131I), 형광 라벨 (가령, FITC, 로다민, 란타니드 포스포르), 효소적 라벨 (가령, 양고추냉이 과산화효소, β-갈락토시다아제, 루시페라아제, 알칼리성 포스파타아제), 화학발광제 또는 비오틴을 포함할 수 있다. As used herein, the term “labeled” or “label” refers to a fluorescent marker or enzymatic activity that can be detected, e.g., by incorporation of a radiolabeled amino acid, or by the indicated avidin (e.g., by optical or colorimetric methods). Streptavidin) refers to the attachment of a detectable marker by attachment to a polypeptide of a biotin moiety. Various methods for labeling polypeptides and glycoproteins are known in the art and can be used. Examples of labels for polypeptides include, but are not limited to: a radioisotope or radionuclide (eg, 3 H, 14 C, 15 N, 35 S, 90 Y, 99 Tc, 111 In, 125 I, 131 I), fluorescent label (eg FITC, rhodamine, lanthanide phosphor), enzymatic label (eg horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase), chemiluminescent agent or biotin.

다른 양상은 일 양상에 따른 바이오센서를 이용하여 이중가닥 DNA를 검출하는 방법을 제공한다.Another aspect provides a method for detecting double-stranded DNA using the biosensor according to the aspect.

상기 방법은, 액상의 샘플을 일 양상에 따른 바이오센서에 로딩시키는 단계; 및 상기 바이오센서에서 생성되는 신호를 측정하여 샘플 내의 이중가닥 DNA를 검출하는 단계를 포함할 수 있다.The method includes: loading a liquid sample into the biosensor according to an aspect; and detecting the double-stranded DNA in the sample by measuring the signal generated by the biosensor.

일 구체예에서, 상기 바이오센서는 전기화학적 센서일 수 있다. 이 경우, 상기 방법은 액상의 샘플을 상기 전기화학적 센서에 로딩시키는 단계; 및 상기 전기화학적 센서에서 생성되는 전기화학적 신호를 측정하여 샘플 내의 이중가닥 DNA를 검출하는 단계를 포함할 수 있다.In one embodiment, the biosensor may be an electrochemical sensor. In this case, the method includes loading a liquid sample into the electrochemical sensor; and detecting the double-stranded DNA in the sample by measuring the electrochemical signal generated by the electrochemical sensor.

다른 구체예에서, 상기 바이오센서는 측방유동분석-기반 바이오센서일 수 있다. 이 경우, 상기 방법은 액상의 샘플을 상기 측방유동분석-기반 바이오센서의 샘플 패드에 로딩시키는 단계; 및 상기 테스트 영역 및 컨트롤 영역에서 생성되는 신호를 측정하여 샘플 내의 이중가닥 DNA를 검출하는 단계를 포함할 수 있다.In another embodiment, the biosensor may be a lateral flow analysis-based biosensor. In this case, the method includes loading a liquid sample into a sample pad of the lateral flow analysis-based biosensor; and detecting the double-stranded DNA in the sample by measuring signals generated in the test region and the control region.

상기 샘플은 개체로부터 분리된 검체에 대해 중합효소연쇄반응 (PCR)을 수행하여 얻은 PCR 산물인 것일 수 있다. 상기 중합효소연쇄반응은 검출하고자 하는 핵산 서열에 특이적으로 결합하는 프라이머를 사용하여 수행되는 것일 수 있다. 따라서, 확인하고자 하는 감염병 혹은 질환의 유전 정보만 있으면 상기 바이오센서에 의한 검출에 사용할 수 있다. The sample may be a PCR product obtained by performing a polymerase chain reaction (PCR) on a specimen isolated from an individual. The polymerase chain reaction may be performed using a primer that specifically binds to a nucleic acid sequence to be detected. Therefore, as long as there is genetic information of the infectious disease or disease to be confirmed, it can be used for detection by the biosensor.

상기 개체로부터 분리된 검체는 혈액, 타액, 뇌척수액, 땀, 소변, 젖, 복수, 점액, 비강유체(nasal fluid), 객혈, 관절혈액, 복강액, 질액, 월경분비물, 양수, 정액 등을 포함할 수 있으나, 이에 제한되지 않는다.The sample separated from the subject may include blood, saliva, cerebrospinal fluid, sweat, urine, milk, ascites, mucus, nasal fluid, hemoptysis, joint blood, abdominal fluid, vaginal fluid, menses, amniotic fluid, semen, etc. can, but is not limited thereto.

상기 방법에 의해, 이중가닥 DNA를 정성적으로, 정량적으로, 또는 정성적 및 정량적으로 검출할 수 있다.By the method, double-stranded DNA can be detected qualitatively, quantitatively, or both qualitatively and quantitatively.

일 양상에 따른 이중가닥 DNA에 핵산 서열 비특이적으로 결합하는 단백질, 또는 그를 포함하는 융합단백질을 사용함으로써, 이중가닥 DNA를 검출할 수 있다. 따라서, 상기 단백질을 이중가닥 DNA를 검출하기 위한 바이오센서 등으로 응용할 수 있다.Double-stranded DNA can be detected by using a protein that non-specifically binds to a nucleic acid sequence or a fusion protein comprising the same to double-stranded DNA according to an aspect. Therefore, the protein can be applied as a biosensor for detecting double-stranded DNA.

도 1은 MagR-MazE 융합단백질을 이용한 측방유동분석-기반 바이오센서의 검출 원리를 나타낸 것이다.
도 2는 His-tag 컬럼 또는 자성 나노입자를 이용한 MagR-MazE 융합단백질의 정제도를 분석한 결과이다. His-Tag의 경우, FT: 통과액(flow through); W1: 50 mM NaH2PO4, 300 mM NaCl, 및 60 mM 이미다졸 20 ml; W2: 50 mM NaH2PO4, 300 mM NaCl, 및 60 mM 이미다졸 20 ml; E: 50 mM NaH2PO4, 300 mM NaCl, 및 300 mM 이미다졸 15 ml. 자성 나노입자(Mag nanoparticle)의 경우, FT: 통과액(flow through); W1: 200 nm 자성 나노입자와 MagR-MazE 융합단백질을 상온에서 섞은 뒤 10분 인큐베이션 후 자석으로 자성 나노입자를 가라앉힌 후의 상층액; W2: 200 nm 자성 나노입자와 MagR-MazE 융합단백질을 상온에서 섞은 뒤 10분 인큐베이션 후 자석으로 자성 나노입자를 가라앉힌 후의 상층액; E: 200 nm 자성 나노입자.
도 3은 전기영동 또는 LFA-기반 바이오센서를 사용한 대장균 감염 여부 확인 결과를 나타낸 것이다.
도 4는 전기영동 또는 LFA-기반 바이오센서를 사용한 항생제 내성 유전자 검출 결과를 나타낸 것이다.
1 shows the detection principle of a lateral flow analysis-based biosensor using a MagR-MazE fusion protein.
2 is a result of analyzing the degree of purification of the MagR-MazE fusion protein using a His-tag column or magnetic nanoparticles. For His-Tag, FT: flow through; W1: 50 mM NaH 2 PO 4 , 300 mM NaCl, and 20 ml of 60 mM imidazole; W2: 50 mM NaH 2 PO 4 , 300 mM NaCl, and 20 ml of 60 mM imidazole; E: 15 ml of 50 mM NaH 2 PO 4 , 300 mM NaCl, and 300 mM imidazole. For Mag nanoparticles, FT: flow through; W1: Supernatant after mixing 200 nm magnetic nanoparticles and MagR-MazE fusion protein at room temperature, incubating for 10 minutes, and submerging magnetic nanoparticles with a magnet; W2: Supernatant after mixing 200 nm magnetic nanoparticles and MagR-MazE fusion protein at room temperature, incubating for 10 minutes, and submerging magnetic nanoparticles with a magnet; E: 200 nm magnetic nanoparticles.
Figure 3 shows the results of checking whether E. coli infection using an electrophoresis or LFA-based biosensor.
4 shows the results of antibiotic resistance gene detection using an electrophoresis or LFA-based biosensor.

이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

실시예 1: MagR-MazE 융합단백질의 제조Example 1: Preparation of MagR-MazE fusion protein

자성 나노입자 (Magnetic nanoparticle, MNP)에 특이적으로 결합하는 MagR 단백질의 단편 및 dsDNA (double stranded DNA)에 특이적으로 결합하는 항독소 MazE 단백질의 단편을 포함하는 MagR-MazE 융합단백질을 제조하였다.A MagR-MazE fusion protein comprising a fragment of the MagR protein that specifically binds to magnetic nanoparticles (MNP) and a fragment of the antitoxin MazE protein that specifically binds to dsDNA (double stranded DNA) was prepared.

구체적으로, MagR-MazE 융합단백질은 다음과 같이 제조하였다. i) 집비둘기(Coluba livia)의 MagR(잔기 16-132)과 ii) 대장균(Escherichia coli) MazE(잔기 2-49)의 두 반복을 GGGGSGGGGSG 아미노산 링커로 연결한 것을 융합하여 MagR-MazE 융합 구축물을 제조하였다. 사용된 MagR의 아미노산 서열은 서열번호 1로 표시하였고, 뉴클레오티드 서열은 서열번호 5로 표시하였다. 사용된 MazE의 아미노산 서열은 서열번호 2로 표시하였고, 뉴클레오티드 서열은 서열번호 6으로 표시하였다. 사용된 MagR-MazE 융합 구축물의 뉴클레오티드 서열은 서열번호 4로 표시하였다. 상기 MagR-MazE 융합 구축물을 pET His6 LIC 클로닝 벡터(2Bc-T)에 클로닝하였다.Specifically, the MagR-MazE fusion protein was prepared as follows. The MagR-MazE fusion construct was prepared by fusing two repeats of i) MagR (residues 16-132) and ii) Escherichia coli MazE (residues 2-49) of Coluba livia by a GGGGSGGGGSG amino acid linker. did The amino acid sequence of MagR used is shown in SEQ ID NO: 1, and the nucleotide sequence is shown in SEQ ID NO: 5. The amino acid sequence of MazE used is shown in SEQ ID NO: 2, and the nucleotide sequence is shown in SEQ ID NO: 6. The nucleotide sequence of the MagR-MazE fusion construct used is shown in SEQ ID NO:4. The MagR-MazE fusion construct was cloned into the pET His6 LIC cloning vector (2Bc-T).

융합단백질의 과발현을 위해, 상기 벡터를 BL21 (DE3) 세포로 형질전환 하였다. 세포를 37℃에서 0.5-0.6의 OD600으로 성장시킨 다음, IPTG를 최종 농도 0.5 mM이 되도록 첨가 하였다. 세포를 18℃에서 밤새(18시간) 배양 하였다. His-태그된 MagR-MazE 융합단백질을 Ni-NTA 컬럼(GE Healthcare, Chicago, IL, U.S.A.)을 사용하여 정제하고 완충액(50 mM NaH2PO4,300 mM NaCl, 300 mM 이미다졸)으로 용리하였다. clMagR-MazE 융합단백질의 추가 정제를 위해 PBS로 사전 평형화된 Superdex 200-pg FPLC 컬럼(GE Healthcare, Chicago, IL, U.S.A.)에 단백질을 로딩하였다. For overexpression of the fusion protein, the vector was transformed into BL21 (DE3) cells. Cells were grown at 37°C to an OD600 of 0.5-0.6, and then IPTG was added to a final concentration of 0.5 mM. Cells were incubated overnight (18 hours) at 18 °C. His-tagged MagR-MazE fusion protein was purified using a Ni-NTA column (GE Healthcare, Chicago, IL, USA) and eluted with buffer (50 mM NaH 2 PO 4 ,300 mM NaCl, 300 mM imidazole). . For further purification of the clMagR-MazE fusion protein, the protein was loaded onto a Superdex 200-pg FPLC column (GE Healthcare, Chicago, IL, USA) pre-equilibrated with PBS.

제조된 MagR-MazE 융합단백질의 아미노산 서열은 서열번호 3에 나타낸 바와 같다.The amino acid sequence of the prepared MagR-MazE fusion protein is as shown in SEQ ID NO: 3.

실시예 2: MagR-MazE 융합단백질을 이용한 측방유동분석-기반 바이오센서의 제조Example 2: Preparation of lateral flow analysis-based biosensor using MagR-MazE fusion protein

실시예 1에서 제조한 MagR-MazE 융합단백질을 이용하여 LFA-기반 바이오센서를 제작하였다.An LFA-based biosensor was prepared using the MagR-MazE fusion protein prepared in Example 1.

먼저 MagR-MazE 융합단백질(2 mg/ml) 200 μl과 자성 나노입자(MNP, 25 mg/ml, 직경 200 nm, fluidMAG-DX dextran) 100 μl를 혼합하고 5분 동안 배양하여 MagR-MazE 융합단백질과 MNP를 컨쥬게이션 하였다. 컨쥬게이션된 혼합물을 200 μL의 PBST로 3회 세척하였다. 마지막으로, 컨쥬게이션된 혼합물을 1%(v/v) Triton x-10 및 2%(v/v) Tween-20을 포함하는 PBS로 1/2로 희석하였다.First, 200 μl of MagR-MazE fusion protein (2 mg/ml) and 100 μl of magnetic nanoparticles (MNP, 25 mg/ml, diameter 200 nm, fluidMAG-DX dextran) were mixed, and incubated for 5 minutes. and MNP were conjugated. The conjugated mixture was washed 3 times with 200 μL of PBST. Finally, the conjugated mixture was diluted 1/2 with PBS containing 1% (v/v) Triton x-10 and 2% (v/v) Tween-20.

상기 MagR-MazE 융합단백질을 이용하여 샘플 패드, 컨쥬게이트 패드, 멤브레인(FF80HP Membranes | Cytiva, formerly GE Healthcare Life Sciences), 및 흡수 패드를 포함하는 측방유동분석-기반 바이오센서를 제작하였다.A lateral flow analysis-based biosensor including a sample pad, a conjugate pad, a membrane (FF80HP Membranes | Cytiva, formerly GE Healthcare Life Sciences), and an absorbent pad was manufactured using the MagR-MazE fusion protein.

도 1은 MagR-MazE 융합단백질을 이용한 측방유동분석-기반 바이오센서의 검출 원리를 나타낸 것이다.1 shows the detection principle of a lateral flow analysis-based biosensor using a MagR-MazE fusion protein.

실시예 3: MagR-MazE 융합단백질의 자성 나노입자에 대한 결합능 확인Example 3: Confirmation of binding ability of MagR-MazE fusion protein to magnetic nanoparticles

MagR-MazE 융합단백질의 자성 나노입자(MNP)에 대한 결합능을 확인하기 위하여, 단백질을 정제할 때 일반적으로 사용하는 His-tag 컬럼 또는 자성 나노입자를 사용하여 MagR-MazE 융합단백질의 정제도를 비교하였다. In order to confirm the binding ability of the MagR-MazE fusion protein to magnetic nanoparticles (MNP), the degree of purification of the MagR-MazE fusion protein was compared using a His-tag column or magnetic nanoparticles generally used for protein purification. .

구체적으로, MagR-MazE 융합단백질과 MNP의 접합을 위해, 세포 용해(cell lysis)된 200 μL의 MagR-MazE 단백질 혼합물과 100 μL의 MNP(25 mg/mL, 직경 200nm)를 혼합하고 최소 5분 동안 배양하였다. 접합된 혼합물을 200 μL의 PBST로 3 회 세척 하였다. 최종 결과물 20 ul에 대해 SDS-PAGE를 통해 정제도를 분석하였다. Specifically, for conjugation of MagR-MazE fusion protein and MNP, mix 200 µL of cell lysed MagR-MazE protein mixture with 100 µL of MNP (25 mg/mL, diameter 200 nm) and mix for at least 5 minutes during cultured. The conjugated mixture was washed 3 times with 200 μL of PBST. Purification was analyzed through SDS-PAGE for 20 ul of the final product.

도 2는 His-tag 컬럼 또는 자성 나노입자를 이용한 MagR-MazE 융합단백질의 정제도를 분석한 결과이다. 2 is a result of analyzing the degree of purification of the MagR-MazE fusion protein using a His-tag column or magnetic nanoparticles.

도 2에 나타낸 바와 같이, E (Elution)의 결과를 보면 자성 나노입자를 사용하여도 단백질이 높은 순도로 정제된다는 것을 확인하였다. 따라서, MagR-MazE 융합단백질의 자성 나노입자에 대한 결합능이 우수함을 알 수 있었다.As shown in FIG. 2 , looking at the result of E (Elution), it was confirmed that the protein was purified to a high purity even using magnetic nanoparticles. Therefore, it was confirmed that the MagR-MazE fusion protein had excellent binding ability to magnetic nanoparticles.

실시예 4: LFA-기반 바이오센서를 이용한 대장균의 검출Example 4: Detection of E. coli using LFA-based biosensors

실시예 2에서 제작한 LFA-기반 바이오센서를 이용하여 대장균을 검출하였다.E. coli was detected using the LFA-based biosensor prepared in Example 2.

구체적으로, PBS에 대장균을 희석한 샘플에서 DNA를 분리하고, 하기 표 1에 기재된 대장균 특이적 프라이머 세트(서열번호 7 및 8, 또는 서열번호 7 및 9)를 사용하여 PCR을 수행하였다. PCR 산물을 실시예 2의 LFA-기반 바이오센서의 샘플 패드에 로딩하였다.Specifically, DNA was isolated from a sample in which E. coli was diluted in PBS, and PCR was performed using E. coli-specific primer sets (SEQ ID NOs: 7 and 8, or SEQ ID NOs: 7 and 9) described in Table 1 below. The PCR product was loaded onto the sample pad of the LFA-based biosensor of Example 2.

프라이머 명칭Primer name 프라이머 방향Primer direction 서열(5'→3')Sequence (5'→3') 서열번호SEQ ID NO: 16s rRNA primer (410F)16s rRNA primer (410F) 정방향forward AAGAAGGCCTTCGGGTTGTAAAGTACAAGAAGGCCTTCGGGTTGTAAAGTAC 77 16s rRNA primer (907R)16s rRNA primer (907R) 역방향reverse CCGTCAATTCCTTTAAGTTTCCGTCAATTCCTTTAAGTTT 88 CCGTCAATTCCTTTGAGTTTCCGTCAATTCCTTTGAGTTT 99

도 3은 전기영동 또는 LFA-기반 바이오센서를 사용한 대장균 감염 여부 확인 결과를 나타낸 것이다.Figure 3 shows the results of checking whether E. coli infection using an electrophoresis or LFA-based biosensor.

도 3에 나타낸 바와 같이, PCR 산물을 전기영동으로 확인한 결과와 LFA-기반 바이오센서를 통해 확인한 결과가 동일하다는 것을 알 수 있었다. 따라서, 전기영동 없이도 MagR-MazE 융합단백질을 이용한 LFA-기반 바이오센서를 통해 표적 물질을 간단히 검출할 수 있음을 확인하였다.As shown in FIG. 3 , it was found that the result of confirming the PCR product by electrophoresis and the result of confirming through the LFA-based biosensor were the same. Therefore, it was confirmed that the target material could be simply detected through the LFA-based biosensor using the MagR-MazE fusion protein without electrophoresis.

실시예 5: LFA-기반 바이오센서를 이용한 항생제 내성 유전자의 검출Example 5: Detection of antibiotic resistance gene using LFA-based biosensor

실시예 2에서 제작한 LFA-기반 바이오센서를 이용하여 항생제 내성 유전자를 검출하였다.An antibiotic resistance gene was detected using the LFA-based biosensor prepared in Example 2.

구체적으로, 암피실린(ampicillin, AMP) 내성 유전자를 포함하는 플라스미드를 갖는 대장균을 PBS에 희석한 샘플에서 DNA를 분리하고, 하기 표 2에 기재된 암피실린 내성 유전자 특이적 프라이머 세트를 사용하여 PCR을 수행하였다. PCR 조건은 95℃ 5분 후, 95℃ 1분, 55℃ 1분, 72℃ 1분, 30사이클이었다. PCR 산물을 실시예 2의 LFA-기반 바이오센서의 샘플 패드에 로딩하였다.Specifically, DNA was isolated from a sample diluted in PBS with E. coli having a plasmid containing an ampicillin (AMP) resistance gene, and PCR was performed using the ampicillin resistance gene-specific primer set described in Table 2 below. PCR conditions were 95°C for 5 minutes, 95°C for 1 minute, 55°C for 1 minute, 72°C for 1 minute, and 30 cycles. The PCR product was loaded onto the sample pad of the LFA-based biosensor of Example 2.

프라이머 명칭Primer name 프라이머 방향Primer direction 서열(5'→3')Sequence (5'→3') 서열번호SEQ ID NO: AMP resistance gene primer (305F)AMP resistance gene primer (305F) 정방향forward GATGCTGAAGATCAGTTGGGATGCTGAAAGATCAGTTGG 1010 AMP resistance gene primer (1020R)AMP resistance gene primer (1020R) 역방향
reverse
CGTTCATCCATAGTTGCCCGTTCATCCATAGTTGCC 1111

도 4는 전기영동 또는 LFA-기반 바이오센서를 사용한 항생제 내성 유전자 검출 결과를 나타낸 것이다.4 shows the results of antibiotic resistance gene detection using an electrophoresis or LFA-based biosensor.

도 4에 나타낸 바와 같이, PCR 산물을 전기영동으로 확인한 결과와 LFA-기반 바이오센서를 통해 확인한 결과가 동일하다는 것을 알 수 있었다. 따라서, 전기영동 없이도 MagR-MazE 융합단백질을 이용한 LFA-기반 바이오센서를 통해 표적 물질을 간단히 검출할 수 있음을 확인하였다.As shown in FIG. 4 , it was found that the result of confirming the PCR product by electrophoresis and the result of confirming through the LFA-based biosensor were the same. Therefore, it was confirmed that the target material could be simply detected through the LFA-based biosensor using the MagR-MazE fusion protein without electrophoresis.

<110> SB Bioscience Co., Ltd. <120> Biosensor comprising a protein that binds to double-stranded DNA non-specifically with a nucleic acid sequence, or fusion protein comprising the same <130> PN200157 <160> 11 <170> KoPatentIn 3.0 <210> 1 <211> 142 <212> PRT <213> Columba livia <400> 1 Met Lys Ser Ser His His His His His His Gly Ser Ser Val Ser Lys 1 5 10 15 Arg Lys Ile Gln Ala Thr Arg Ala Ala Leu Thr Leu Thr Pro Ser Ala 20 25 30 Val Gln Lys Ile Lys Glu Leu Leu Lys Asp Lys Pro Glu His Val Gly 35 40 45 Val Lys Val Gly Val Arg Thr Arg Gly Cys Asn Gly Leu Ser Tyr Thr 50 55 60 Leu Glu Tyr Thr Lys Ser Lys Gly Asp Ser Asp Glu Glu Val Val Gln 65 70 75 80 Asp Gly Val Arg Val Phe Ile Glu Lys Lys Ala Gln Leu Thr Leu Leu 85 90 95 Gly Thr Glu Met Asp Tyr Val Glu Asp Lys Leu Ser Ser Glu Phe Val 100 105 110 Phe Asn Asn Pro Asn Ile Lys Gly Thr Cys Gly Cys Gly Glu Ser Phe 115 120 125 Asn Ile Glu Asn Leu Tyr Phe Gln Ser Asn Ile Gly Ser Gly 130 135 140 <210> 2 <211> 134 <212> PRT <213> Escherichia coli <400> 2 Met Lys Ser Ser His His His His His His Glu Asn Leu Tyr Phe Gln 1 5 10 15 Ser Asn Ala Asp Asp Asp Asp Lys Gly Ile His Ser Ser Val Lys Arg 20 25 30 Trp Gly Asn Ser Pro Ala Val Arg Ile Pro Ala Thr Leu Met Gln Ala 35 40 45 Leu Asn Leu Asn Ile Asp Asp Glu Val Lys Ile Asp Leu Val Asp Gly 50 55 60 Lys Leu Ile Ile Glu Pro Val Arg Lys Glu Gly Gly Gly Gly Ser Gly 65 70 75 80 Gly Gly Gly Ser Gly Ile His Ser Ser Val Lys Arg Trp Gly Asn Ser 85 90 95 Pro Ala Val Arg Ile Pro Ala Thr Leu Met Gln Ala Leu Asn Leu Asn 100 105 110 Ile Asp Asp Glu Val Lys Ile Asp Leu Val Asp Gly Lys Leu Ile Ile 115 120 125 Glu Pro Val Arg Lys Glu 130 <210> 3 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> MagR-MazE fusion protein <400> 3 Met Lys Ser Ser His His His His His His Gly Ser Ser Val Ser Lys 1 5 10 15 Arg Lys Ile Gln Ala Thr Arg Ala Ala Leu Thr Leu Thr Pro Ser Ala 20 25 30 Val Gln Lys Ile Lys Glu Leu Leu Lys Asp Lys Pro Glu His Val Gly 35 40 45 Val Lys Val Gly Val Arg Thr Arg Gly Cys Asn Gly Leu Ser Tyr Thr 50 55 60 Leu Glu Tyr Thr Lys Ser Lys Gly Asp Ser Asp Glu Glu Val Val Gln 65 70 75 80 Asp Gly Val Arg Val Phe Ile Glu Lys Lys Ala Gln Leu Thr Leu Leu 85 90 95 Gly Thr Glu Met Asp Tyr Val Glu Asp Lys Leu Ser Ser Glu Phe Val 100 105 110 Phe Asn Asn Pro Asn Ile Lys Gly Thr Cys Gly Cys Gly Glu Ser Phe 115 120 125 Asn Ile Glu Asn Leu Tyr Phe Gln Ser Asn Ala Asp Asp Asp Asp Lys 130 135 140 Gly Ile His Ser Ser Val Lys Arg Trp Gly Asn Ser Pro Ala Val Arg 145 150 155 160 Ile Pro Ala Thr Leu Met Gln Ala Leu Asn Leu Asn Ile Asp Asp Glu 165 170 175 Val Lys Ile Asp Leu Val Asp Gly Lys Leu Ile Ile Glu Pro Val Arg 180 185 190 Lys Glu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Ile His Ser 195 200 205 Ser Val Lys Arg Trp Gly Asn Ser Pro Ala Val Arg Ile Pro Ala Thr 210 215 220 Leu Met Gln Ala Leu Asn Leu Asn Ile Asp Asp Glu Val Lys Ile Asp 225 230 235 240 Leu Val Asp Gly Lys Leu Ile Ile Glu Pro Val Arg Lys Glu 245 250 <210> 4 <211> 765 <212> DNA <213> Artificial Sequence <220> <223> MagR-MazE fusion protein <400> 4 atgaaatctt ctcaccatca ccatcaccat ggttcttctg tatcaaaaag aaagatacaa 60 gctacaaggg cggcactgac tttgaccccg agcgcggtcc agaagattaa agagctgttg 120 aaggacaagc cggagcacgt gggcgtaaaa gttggcgtgc gcacccgtgg ttgcaatggt 180 ctctcctaca ccctggaata tacgaaaagc aaaggtgatt ctgatgagga ggtcgtgcag 240 gatggtgttc gtgttttcat cgagaaaaag gctcaactga ccttactggg cacggaaatg 300 gactacgtgg aagacaagct gtcgagcgaa tttgttttca acaacccgaa tattaagggc 360 acctgtggct gcggtgaaag ctttaacatc gaaaacctgt acttccaatc caatgcagac 420 gatgatgaca agggtattca ttcatcagtg aagcgttggg gtaactcgcc cgctgttcgc 480 attcctgcca cattaatgca ggctctgaac ttgaacatcg acgacgaagt taaaattgat 540 ttagtagacg gtaaattgat catcgaaccg gtgcgcaagg agggtggagg gggatcggga 600 gggggcggtt cgggaatcca tagcagtgta aagcgctggg gcaattcacc agcggtccgt 660 atccctgcaa cactgatgca agccctgaac ttaaatattg acgatgaagt caagatcgac 720 ttggtagatg gtaaacttat cattgagccg gtgcgtaagg agtaa 765 <210> 5 <211> 502 <212> DNA <213> Columba livia <400> 5 cctgcaggac tcgagttcta gaaataattt tgtttaactt taagaaggag atatacatat 60 gaaatcttct caccatcacc atcaccatgg ttcttctgta tcaaaaagaa agatacaagc 120 tacaagggcg gcactgactt tgaccccgag cgcggtccag aagattaaag agctgttgaa 180 ggacaagccg gagcacgtgg gcgtaaaagt tggcgtgcgc acccgtggtt gcaatggtct 240 ctcctacacc ctggaatata cgaaaagcaa aggtgattct gatgaggagg tcgtgcagga 300 tggtgttcgt gttttcatcg agaaaaaggc tcaactgacc ttactgggca cggaaatgga 360 ctacgtggaa gacaagctgt cgagcgaatt tgttttcaac aacccgaata ttaagggcac 420 ctgtggctgc ggtgaaagct ttaacatcga aaacctgtac ttccaatcca atattggaag 480 tggataacgg atccgcgatc gc 502 <210> 6 <211> 385 <212> DNA <213> Escherichia coli <400> 6 tacttccaat ccaatgcaga cgatgatgac aagggtattc attcatcagt gaagcgttgg 60 ggtaactcgc ccgctgttcg cattcctgcc acattaatgc aggctctgaa cttgaacatc 120 gacgacgaag ttaaaattga tttagtagac ggtaaattga tcatcgaacc ggtgcgcaag 180 gagggtggag ggggatcggg agggggcggt tcgggaatcc atagcagtgt aaagcgctgg 240 ggcaattcac cagcggtccg tatccctgca acactgatgc aagccctgaa cttaaatatt 300 gacgatgaag tcaagatcga cttggtagat ggtaaactta tcattgagcc ggtgcgtaag 360 gagtaataac attggaagtg gataa 385 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> 16s rRNA primer (410F) <400> 7 aagaaggcct tcgggttgta aagtac 26 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 16s rRNA primer (907R) <400> 8 ccgtcaattc ctttaagttt 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 16s rRNA primer (907R) <400> 9 ccgtcaattc ctttgagttt 20 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> AMP resistance gene primer (305F) <400> 10 gatgctgaag atcagttgg 19 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> AMP resistance gene primer (1020R) <400> 11 cgttcatcca tagttgcc 18 <110> SB Bioscience Co., Ltd. <120> Biosensor comprising a protein that binds to double-stranded DNA non-specifically with a nucleic acid sequence, or fusion protein comprising the same <130> PN200157 <160> 11 <170> KoPatentIn 3.0 <210> 1 <211> 142 <212> PRT <213> Columba livia <400> 1 Met Lys Ser Ser His His His His His His His Gly Ser Ser Val Ser Lys 1 5 10 15 Arg Lys Ile Gln Ala Thr Arg Ala Ala Leu Thr Leu Thr Pro Ser Ala 20 25 30 Val Gln Lys Ile Lys Glu Leu Leu Lys Asp Lys Pro Glu His Val Gly 35 40 45 Val Lys Val Gly Val Arg Thr Arg Gly Cys Asn Gly Leu Ser Tyr Thr 50 55 60 Leu Glu Tyr Thr Lys Ser Lys Gly Asp Ser Asp Glu Glu Val Val Gln 65 70 75 80 Asp Gly Val Arg Val Phe Ile Glu Lys Lys Ala Gln Leu Thr Leu Leu 85 90 95 Gly Thr Glu Met Asp Tyr Val Glu Asp Lys Leu Ser Ser Glu Phe Val 100 105 110 Phe Asn Asn Pro Asn Ile Lys Gly Thr Cys Gly Cys Gly Glu Ser Phe 115 120 125 Asn Ile Glu Asn Leu Tyr Phe Gln Ser Asn Ile Gly Ser Gly 130 135 140 <210> 2 <211> 134 <212> PRT <213> Escherichia coli <400> 2 Met Lys Ser Ser His His His His His His His Glu Asn Leu Tyr Phe Gln 1 5 10 15 Ser Asn Ala Asp Asp Asp Asp Lys Gly Ile His Ser Ser Val Lys Arg 20 25 30 Trp Gly Asn Ser Pro Ala Val Arg Ile Pro Ala Thr Leu Met Gln Ala 35 40 45 Leu Asn Leu Asn Ile Asp Asp Glu Val Lys Ile Asp Leu Val Asp Gly 50 55 60 Lys Leu Ile Ile Glu Pro Val Arg Lys Glu Gly Gly Gly Gly Ser Gly 65 70 75 80 Gly Gly Gly Ser Gly Ile His Ser Ser Val Lys Arg Trp Gly Asn Ser 85 90 95 Pro Ala Val Arg Ile Pro Ala Thr Leu Met Gln Ala Leu Asn Leu Asn 100 105 110 Ile Asp Asp Glu Val Lys Ile Asp Leu Val Asp Gly Lys Leu Ile Ile 115 120 125 Glu Pro Val Arg Lys Glu 130 <210> 3 <211> 254 <212> PRT <213> Artificial Sequence <220> <223> MagR-MazE fusion protein <400> 3 Met Lys Ser Ser His His His His His His His Gly Ser Ser Val Ser Lys 1 5 10 15 Arg Lys Ile Gln Ala Thr Arg Ala Ala Leu Thr Leu Thr Pro Ser Ala 20 25 30 Val Gln Lys Ile Lys Glu Leu Leu Lys Asp Lys Pro Glu His Val Gly 35 40 45 Val Lys Val Gly Val Arg Thr Arg Gly Cys Asn Gly Leu Ser Tyr Thr 50 55 60 Leu Glu Tyr Thr Lys Ser Lys Gly Asp Ser Asp Glu Glu Val Val Gln 65 70 75 80 Asp Gly Val Arg Val Phe Ile Glu Lys Lys Ala Gln Leu Thr Leu Leu 85 90 95 Gly Thr Glu Met Asp Tyr Val Glu Asp Lys Leu Ser Ser Glu Phe Val 100 105 110 Phe Asn Asn Pro Asn Ile Lys Gly Thr Cys Gly Cys Gly Glu Ser Phe 115 120 125 Asn Ile Glu Asn Leu Tyr Phe Gln Ser Asn Ala Asp Asp Asp Asp Lys 130 135 140 Gly Ile His Ser Ser Val Lys Arg Trp Gly Asn Ser Pro Ala Val Arg 145 150 155 160 Ile Pro Ala Thr Leu Met Gln Ala Leu Asn Leu Asn Ile Asp Asp Glu 165 170 175 Val Lys Ile Asp Leu Val Asp Gly Lys Leu Ile Ile Glu Pro Val Arg 180 185 190 Lys Glu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Ile His Ser 195 200 205 Ser Val Lys Arg Trp Gly Asn Ser Pro Ala Val Arg Ile Pro Ala Thr 210 215 220 Leu Met Gln Ala Leu Asn Leu Asn Ile Asp Asp Glu Val Lys Ile Asp 225 230 235 240 Leu Val Asp Gly Lys Leu Ile Ile Glu Pro Val Arg Lys Glu 245 250 <210> 4 <211> 765 <212> DNA <213> Artificial Sequence <220> <223> MagR-MazE fusion protein <400> 4 atgaaatctt ctcaccatca ccatcaccat ggttcttctg tatcaaaaag aaagatacaa 60 gctacaaggg cggcactgac tttgaccccg agcgcggtcc agaagattaa agagctgttg 120 aaggacaagc cggagcacgt gggcgtaaaa gttggcgtgc gcacccgtgg ttgcaatggt 180 ctctcctaca ccctggaata tacgaaaagc aaaggtgatt ctgatgagga ggtcgtgcag 240 gatggtgttc gtgttttcat cgagaaaaag gctcaactga ccttactggg cacggaaatg 300 gactacgtgg aagacaagct gtcgagcgaa tttgttttca acaacccgaa tattaagggc 360 acctgtggct gcggtgaaag ctttaacatc gaaaacctgt acttccaatc caatgcagac 420 gatgatgaca agggtattca ttcatcagtg aagcgttggg gtaactcgcc cgctgttcgc 480 attcctgcca cattaatgca ggctctgaac ttgaacatcg acgacgaagt taaaattgat 540 ttagtagacg gtaaattgat catcgaaccg gtgcgcaagg agggtggagg gggatcggga 600 gggggcggtt cgggaatcca tagcagtgta aagcgctggg gcaattcacc agcggtccgt 660 atccctgcaa cactgatgca agccctgaac ttaaatattg acgatgaagt caagatcgac 720 ttggtagatg gtaaacttat cattgagccg gtgcgtaagg agtaa 765 <210> 5 <211> 502 <212> DNA <213> Columba livia <400> 5 cctgcaggac tcgagttcta gaaataattt tgtttaactt taagaaggag atatacatat 60 gaaatcttct caccatcacc atcaccatgg ttcttctgta tcaaaaagaa agatacaagc 120 tacaagggcg gcactgactt tgaccccgag cgcggtccag aagattaaag agctgttgaa 180 ggacaagccg gagcacgtgg gcgtaaaagt tggcgtgcgc acccgtggtt gcaatggtct 240 ctcctacacc ctggaatata cgaaaagcaa aggtgattct gatgaggagg tcgtgcagga 300 tggtgttcgt gttttcatcg agaaaaaggc tcaactgacc ttactgggca cggaaatgga 360 ctacgtggaa gacaagctgt cgagcgaatt tgttttcaac aacccgaata ttaagggcac 420 ctgtggctgc ggtgaaagct ttaacatcga aaacctgtac ttccaatcca atattggaag 480 tggataacgg atccgcgatc gc 502 <210> 6 <211> 385 <212> DNA <213> Escherichia coli <400> 6 tacttccaat ccaatgcaga cgatgatgac aagggtattc attcatcagt gaagcgttgg 60 ggtaactcgc ccgctgttcg cattcctgcc acattaatgc aggctctgaa cttgaacatc 120 gacgacgaag ttaaaattga tttagtagac ggtaaattga tcatcgaacc ggtgcgcaag 180 gagggtggag ggggatcggg agggggcggt tcgggaatcc atagcagtgt aaagcgctgg 240 ggcaattcac cagcggtccg tatccctgca acactgatgc aagccctgaa cttaaatatt 300 gacgatgaag tcaagatcga cttggtagat ggtaaactta tcattgagcc ggtgcgtaag 360 gagtaataac attggaagtg gataa 385 <210> 7 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> 16s rRNA primer (410F) <400> 7 aagaaggcct tcgggttgta aagtac 26 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 16s rRNA primer (907R) <400> 8 ccgtcaattc ctttaagttt 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> 16s rRNA primer (907R) <400> 9 ccgtcaattc ctttgagttt 20 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> AMP resistance gene primer (305F) <400> 10 gatgctgaag atcagttgg 19 <210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> AMP resistance gene primer (1020R) <400> 11 cgttcatcca tagttgcc 18

Claims (20)

MagR(magnetoreceptor) 단백질, 또는 이의 단편 및 항독소 MazE 단백질, 또는 이의 단편의 다이머를 포함하는 MagR-MazE 융합단백질.A MagR-MazE fusion protein comprising a magnetoreceptor (MagR) protein, or a fragment thereof, and a dimer of the antitoxin MazE protein, or a fragment thereof. 청구항 1에 있어서, 상기 MagR 단백질의 단편은 서열번호 1의 16 내지 132번째 아미노산 서열을 포함하는 것인 MagR-MazE 융합단백질.The MagR-MazE fusion protein according to claim 1, wherein the MagR protein fragment comprises the 16th to 132th amino acid sequence of SEQ ID NO: 1. 청구항 1에 있어서, 항독소 MazE 단백질의 단편의 모노머는 서열번호 2의 26 내지 74번째 아미노산 서열을 포함하는 것인 MagR-MazE 융합단백질.The MagR-MazE fusion protein according to claim 1, wherein the monomer of the fragment of the antitoxin MazE protein comprises the 26th to 74th amino acid sequence of SEQ ID NO:2. 청구항 1에 있어서, 항독소 MazE 단백질의 단편의 모노머는 링커에 의해 연결된 것인 MagR-MazE 융합단백질.The MagR-MazE fusion protein according to claim 1, wherein the monomers of the fragment of the antitoxin MazE protein are linked by a linker. 청구항 1에 있어서, 상기 MagR-MazE 융합단백질은 서열번호 3의 아미노산 서열을 포함하는 것인 MagR-MazE 융합단백질.The MagR-MazE fusion protein according to claim 1, wherein the MagR-MazE fusion protein comprises the amino acid sequence of SEQ ID NO: 3. 청구항 1에 있어서, 상기 MagR-MazE 융합단백질은 비드에 특이적으로 결합하는 영역 및 이중가닥 DNA (dsDNA)에 핵산 서열 비특이적으로 결합하는 영역을 포함하는 것인 MagR-MazE 융합단백질.The MagR-MazE fusion protein according to claim 1, wherein the MagR-MazE fusion protein comprises a region that specifically binds to a bead and a region that non-specifically binds to a nucleic acid sequence to double-stranded DNA (dsDNA). 이중가닥 DNA (dsDNA)에 핵산 서열 비특이적으로 결합하는 단백질 또는 이의 단편; 및 상기 단백질 또는 이의 단편과 연결된 비드 또는 항체를 포함하는 컨쥬게이트를 포함하는 이중가닥 DNA 검출용 조성물.a protein or fragment thereof that non-specifically binds a nucleic acid sequence to double-stranded DNA (dsDNA); And a composition for detecting double-stranded DNA comprising a conjugate comprising a bead or antibody linked to the protein or fragment thereof. 청구항 7에 있어서, 상기 이중가닥 DNA (dsDNA)에 핵산 서열 비특이적으로 결합하는 단백질 또는 이의 단편은 단일가닥 DNA (ssDNA)에의 결합능보다 dsDNA에의 결합능이 큰 것이고, 등전점이 9 이하인 것인 조성물. The composition according to claim 7, wherein the protein or fragment thereof that non-specifically binds to the nucleic acid sequence to the double-stranded DNA (dsDNA) has greater binding capacity to dsDNA than to single-stranded DNA (ssDNA), and has an isoelectric point of 9 or less. 청구항 7에 있어서, 상기 이중가닥 DNA (dsDNA)에 핵산 서열 비특이적으로 결합하는 단백질은 헬릭스-턴-헬릭스(helix-turn-helix) 도메인, 징크 핑커 도메인, 루신 지퍼(leucine zipper) 도메인, 윙 헬릭스(winged helix) 도메인, 윙 헬릭스-턴-헬릭스(winged helix-turn-helix) 도메인, 헬릭스-루프-헬릭스(helix-loop-helix) 도메인, HMG-박스 도메인, Wor3 도메인, OB-fold 도메인, B3 도메인, TALE(TAL effecter) 도메인, 또는 이들의 2 이상의 조합을 포함하는 것인 조성물. The method according to claim 7, wherein the protein binding to the nucleic acid sequence non-specifically to the double-stranded DNA (dsDNA) is a helix-turn-helix domain, a zinc pinker domain, a leucine zipper domain, a wing helix ( winged helix domain, wing helix-turn-helix domain, helix-loop-helix domain, HMG-box domain, Wor3 domain, OB-fold domain, B3 domain , TALE (TAL effecter) domain, or a composition comprising two or more combinations thereof. 청구항 7에 있어서, 상기 이중가닥 DNA (dsDNA)에 핵산 서열 비특이적으로 결합하는 단백질은 MazE 단백질, FOXO, p53, EcoRV, FoK1, Cro, 또는 이들 중 어느 하나의 단편 또는 그 단편의 다이머인 것인 조성물. The method according to claim 7, wherein the protein that non-specifically binds to the nucleic acid sequence to the double-stranded DNA (dsDNA) is a MazE protein, FOXO, p53, EcoRV, FoK1, Cro, or any one of these fragments or a dimer of the fragment. . 청구항 7에 있어서, 상기 비드는 자성 나노입자 또는 금 나노입자인 것인 조성물.The composition of claim 7, wherein the beads are magnetic nanoparticles or gold nanoparticles. 청구항 7에 있어서, 상기 이중가닥 DNA (dsDNA)에 핵산 서열 비특이적으로 결합하는 단백질 또는 이의 단편은 비드와 결합할 수 있는 단백질 또는 이의 단편을 통해 상기 비드와 연결된 것인 조성물.The composition according to claim 7, wherein the protein or fragment thereof that non-specifically binds to the nucleic acid sequence to the double-stranded DNA (dsDNA) is linked to the bead through a protein or fragment thereof capable of binding to the bead. 청구항 12에 있어서, 상기 비드와 결합할 수 있는 단백질은 MagR, 헴단백질(Heme protein), 철-황 단백질, 트랜스페린, 락토페린, 및 페리틴으로 이루어진 군으로부터 선택된 어느 하나인 것인 조성물.The composition of claim 12, wherein the protein capable of binding to the bead is any one selected from the group consisting of MagR, heme protein, iron-sulfur protein, transferrin, lactoferrin, and ferritin. 청구항 7의 조성물을 포함하는 이중가닥 DNA 검출용 키트.A kit for detecting double-stranded DNA comprising the composition of claim 7. 이중가닥 DNA (dsDNA)에 핵산 서열 비특이적으로 결합하는 단백질 또는 이의 단편; 및 상기 단백질 또는 이의 단편과 연결된 비드 또는 항체를 포함하는 컨쥬게이트를 포함하며, 상기 컨쥬게이트가 지지체 상에 고정된 것인, 이중가닥 DNA를 검출하기 위한 바이오센서.a protein or fragment thereof that non-specifically binds a nucleic acid sequence to double-stranded DNA (dsDNA); and a conjugate comprising a bead or antibody linked to the protein or fragment thereof, wherein the conjugate is immobilized on a support, a biosensor for detecting double-stranded DNA. 청구항 15에 있어서, 상기 바이오센서는 전기화학적 센서, 또는 스트립 형태의 측방유동분석-기반 바이오센서인 것인 바이오센서.The biosensor of claim 15 , wherein the biosensor is an electrochemical sensor or a lateral flow analysis-based biosensor in the form of a strip. 청구항 16에 있어서, 상기 스트립 형태의 측방유동분석-기반 바이오센서는,
일단으로부터 타단 방향으로 순차적으로 배치된, (a) 샘플 패드, (b) 컨쥬게이트 패드, (c) 멤브레인, 및 (d) 흡수 패드를 포함하고,
상기 컨쥬게이트 패드에는 이중가닥 DNA (dsDNA)에 핵산 서열 비특이적으로 결합하는 단백질 또는 이의 단편; 및 상기 단백질 또는 이의 단편과 연결된 비드를 포함하는 컨쥬게이트가 포함되어 있고,
상기 멤브레인 상에는 상기 컨쥬게이트 패드로부터 상기 흡수 패드 방향으로 테스트 영역 및 컨트롤 영역이 순차적으로 형성되어 있고,
상기 테스트 영역에는 상기 컨쥬게이트의 이중가닥 DNA에 핵산 서열 비특이적으로 결합하는 단백질 또는 이의 단편과 결합되는 표적 물질과 특이적으로 결합하는 제1 바인더가 고정되어 있고,
상기 컨트롤 영역에는 상기 표적 물질에는 특이적으로 결합하지 않으나 상기 이중가닥 DNA에 핵산 서열 비특이적으로 결합하는 단백질 또는 이의 단편과는 결합하는 제2 바인더가 고정되어 있는 것인, 측방유동분석-기반 바이오센서.
The method according to claim 16, wherein the strip-type lateral flow analysis-based biosensor,
and (a) a sample pad, (b) a conjugate pad, (c) a membrane, and (d) an absorbent pad, disposed sequentially from one end to the other end;
The conjugate pad includes a protein or fragment thereof that non-specifically binds to a nucleic acid sequence to double-stranded DNA (dsDNA); and a conjugate comprising a bead linked to the protein or fragment thereof,
a test region and a control region are sequentially formed on the membrane in a direction from the conjugate pad to the absorbent pad;
A first binder that specifically binds to a target material that binds to a protein or fragment thereof that non-specifically binds a nucleic acid sequence to the double-stranded DNA of the conjugate is fixed to the test region,
In the control region, a second binder that does not specifically bind to the target material but binds to a protein or fragment thereof that non-specifically binds to the nucleic acid sequence to the double-stranded DNA is fixed, lateral flow analysis-based biosensor .
액상의 샘플을 청구항 15에 따른 바이오센서에 로딩시키는 단계; 및
상기 바이오센서에서 생성되는 신호를 측정하여 샘플 내의 이중가닥 DNA를 검출하는 단계를 포함하는, 이중가닥 DNA를 검출하는 방법.
loading a liquid sample into the biosensor according to claim 15; and
A method of detecting double-stranded DNA, comprising the step of detecting the double-stranded DNA in the sample by measuring the signal generated by the biosensor.
청구항 18에 있어서, 상기 샘플은 개체로부터 분리된 검체에 대해 중합효소연쇄반응 (PCR)을 수행하여 얻은 PCR 산물인 것인 방법.The method according to claim 18, wherein the sample is a PCR product obtained by performing a polymerase chain reaction (PCR) on a specimen isolated from an individual. 청구항 18에 있어서, 이중가닥 DNA를 정성적으로, 정량적으로, 또는 정성적 및 정량적으로 검출하는 것인 방법.The method of claim 18 , wherein the double-stranded DNA is detected qualitatively, quantitatively, or both qualitatively and quantitatively.
KR1020200133037A 2020-10-14 2020-10-14 Biosensor comprising a protein that binds to double-stranded DNA non-specifically with a nucleic acid sequence, or fusion protein comprising the same KR102575754B1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
KR1020200133037A KR102575754B1 (en) 2020-10-14 2020-10-14 Biosensor comprising a protein that binds to double-stranded DNA non-specifically with a nucleic acid sequence, or fusion protein comprising the same
PCT/KR2021/014262 WO2022080901A1 (en) 2020-10-14 2021-10-14 Biosensor comprising protein nucleic-acid-sequence-non-specifically binding to double-stranded dna, or fusion protein including same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020200133037A KR102575754B1 (en) 2020-10-14 2020-10-14 Biosensor comprising a protein that binds to double-stranded DNA non-specifically with a nucleic acid sequence, or fusion protein comprising the same

Publications (2)

Publication Number Publication Date
KR20220049422A true KR20220049422A (en) 2022-04-21
KR102575754B1 KR102575754B1 (en) 2023-09-07

Family

ID=81207421

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020200133037A KR102575754B1 (en) 2020-10-14 2020-10-14 Biosensor comprising a protein that binds to double-stranded DNA non-specifically with a nucleic acid sequence, or fusion protein comprising the same

Country Status (2)

Country Link
KR (1) KR102575754B1 (en)
WO (1) WO2022080901A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090170069A1 (en) * 2007-11-01 2009-07-02 The Arizona Board Of Regents On Behalf Of The University Of Arizona Cell free methods for detecting protein-ligand binding
KR20110090840A (en) * 2010-02-04 2011-08-10 삼성전자주식회사 Kit including sequence specific binding protein and method and device for determining nucleotide sequence of target nucleic acid
KR101223918B1 (en) * 2003-06-13 2013-01-25 유니버시티 오브 메디신 앤드 덴티스트리 오브 뉴 저지 RNA interferases and methods of use thereof
KR101911859B1 (en) * 2018-02-02 2018-12-28 주식회사 바이오이즈 Signal Probe Using Double-stranded Nucleic Acid and a Method for Detecting a Target Molecule Using the Same

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101223918B1 (en) * 2003-06-13 2013-01-25 유니버시티 오브 메디신 앤드 덴티스트리 오브 뉴 저지 RNA interferases and methods of use thereof
US20090170069A1 (en) * 2007-11-01 2009-07-02 The Arizona Board Of Regents On Behalf Of The University Of Arizona Cell free methods for detecting protein-ligand binding
KR20110090840A (en) * 2010-02-04 2011-08-10 삼성전자주식회사 Kit including sequence specific binding protein and method and device for determining nucleotide sequence of target nucleic acid
KR101911859B1 (en) * 2018-02-02 2018-12-28 주식회사 바이오이즈 Signal Probe Using Double-stranded Nucleic Acid and a Method for Detecting a Target Molecule Using the Same

Also Published As

Publication number Publication date
KR102575754B1 (en) 2023-09-07
WO2022080901A1 (en) 2022-04-21

Similar Documents

Publication Publication Date Title
CN111534641B (en) Nucleic acid detection kit, detection method and application
JP5186689B2 (en) Protein immobilization method and immobilizing agent via protein binding to silicon oxide-containing substance
CN110894557A (en) CRRNA (crribonucleic acid) for detecting African swine fever virus based on CRISPR (clustered regularly interspaced short palindromic repeats) mode and kit
Chauvaux et al. Distinct affinity of binding sites for S-layer homologous domains in Clostridium thermocellum and Bacillus anthracis cell envelopes
JPH10506795A (en) Enzyme that cleaves the anchor region of surface proteins from Gram-positive bacteria
JP5442641B2 (en) Method for measuring all Haemophilus influenzae
US10900960B2 (en) Allosteric split trehalase biosensor
KR102575754B1 (en) Biosensor comprising a protein that binds to double-stranded DNA non-specifically with a nucleic acid sequence, or fusion protein comprising the same
US8283130B2 (en) Protein fragments of virB10 and sero-detection of anaplasma phagocytophium
US8859722B2 (en) Hemolysin and its protein fragments in sero-detection of anaplasma phagocytophilum
Taheri et al. Engineering, expression and purification of a chimeric fibrin-specific streptokinase
JP2010006745A (en) Fused protein, fused protein-immobilized carrier, method for screening compound, screening composition and screening kit
US8338190B2 (en) Type IV secretion system proteins in sero-detection of Anaplasma phagocytophilum
KR101923196B1 (en) DNA aptamer specifically binding to CFP10 and use thereof
JP2007057509A (en) Method of measuring cat activin a, and measuring kit
US9134324B2 (en) Anaplasma translocated substrate-1 (Ats-1) and sero-detection of Anaplasma phagocytophilum
KR101871802B1 (en) Mushroom Stereum hirsutum lectin specifically binding to polyfucosylated N-linked glycan and uses thereof
JPH09505144A (en) Method for detecting hdm-2-specific antibody
CN110903356B (en) Porcine circovirus type II antigen and colloidal gold immunochromatographic test strip for detecting porcine circovirus type II antibody
Buinovskaya et al. Hybrid bifunctional protein based on OmpF porin and highly active alkaline phosphatase
KR20220063460A (en) Epitope polymer of omega-5-gliadin from Triticum aestivum and use thereof
ES2803273T3 (en) Alcaligenes faecalis mutant 3-hydroxybutyrate dehydrogenase, as well as procedures and uses involving the same
Singh et al. In vitro and in vivo Assessment of Protein Acetylation Status in Mycobacteria
Golmei et al. Expression of F1L, a vaccinia virus H3L transmembrane protein analogue of orf virus, and its successful purification as a diagnostic antigen
SE1950251A1 (en) Rickettsia assay

Legal Events

Date Code Title Description
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right