KR20200056352A - Primer set for detecting rift valley virus and uses thereof - Google Patents

Abstract

The present invention relates to a set of primers for detecting Rift Valley fever virus composed of a forward primer described as a basic sequence of sequence no. 1 and a reverse primer described as a basic sequence of sequence no. 2. By using the primer set and a probe of the present invention, Rift Valley fever virus, currently reported, can be detected in one reaction when PCR is being performed, sensitivity is excellent, there is no cross reaction with other strains and interference reaction with interfering substances, a reproducible result is exhibited, and storage stability is excellent. Accordingly, the primer set and the probe of the present invention can be usefully used for detecting and diagnosing the Rift Valley fever virus.

Description

Primer set for detecting rift valley virus and uses thereof

The present invention relates to a primer set for detection of Rift Valley fever virus and a use thereof.

Rift Valley Fever (RVF) belongs to the genus Bunyaviridae and Phlebovirus, and is a single-stranded linear (-) RNA virus consisting of three segments. Since it was first discovered in Kenyan livestock in the early 1900s, it has been reported in many humans and animals through infected livestock. The incubation period is usually 2-6 days, and usually shows mild symptoms such as fever, dizziness, and extreme weight loss, but in severe cases, symptoms such as shock, bleeding, eye disease, headache due to encephalitis, coma, and so on, lead to death. I can. 1% of all infected patients die and the mortality rate of patients with hemorrhagic fever reaches 50%, but no specific antiviral or preventive vaccine has been developed so far, and only public treatment is available at the outbreak. The route of infection can occur when bites by mosquitoes or bloodsucking insects with infected blood, contact with blood, body fluids, or organs of infected animals, or when unprocessed milk from infected animals is consumed. It occurs mainly in most of Africa and the Arabian Peninsula, especially in West Africa, which is a habitat for vector vectors, but there have been no reports of outbreaks in Korea so far.

If such a high-risk virus that has not been introduced into Korea is used for biological terrorism, it is fatal in diagnosis and treatment, and it is difficult to prevent its spread and may seriously affect public health, so it is urgent to prepare countermeasures for this. However, as the immunochromatographic test method mainly used at the site of biological terrorism, detectable biological agents are limited, and thus, expansion of detectable biological agents is required. In addition, in the case of immunochromatography, as the need to improve sensitivity is raised, it is necessary to introduce a field diagnosis method that can be operated in a real-time PCR device that can compensate for this.

Point of Care Testing (POCT) is one of the in vitro diagnostics, and refers to a clinical pathology test method that can be used for treatment and treatment by promptly conducting it without undergoing pre-processing of samples such as centrifugation at a location close to the subject and patient. Until recently, it has been widely used for personal self-glucose measurement, but since several years ago, it has been gradually used and developed for the purpose of diagnosing various diseases, and is in the spotlight as a field that can solve the cost and regulatory issues of other diagnostic products in Western Europe. However, due to its low cost, demand is also increasing in developing countries.

It is an object of the present invention to provide a primer set capable of detecting Rift Valley fever virus.

Another object of the present invention is to provide a composition and kit for detecting Rift Valley fever virus comprising the primer set of the present invention.

Another object of the present invention is to provide a method for detecting Rift Valley fever virus using the primer set of the present invention.

In order to achieve the above object, the present invention provides a primer set for detecting a Rift Valley fever virus comprising a forward primer described by the nucleotide sequence of SEQ ID NO: 1 and a reverse primer described by the nucleotide sequence of SEQ ID NO: 2.

In addition, the present invention provides a composition for detecting Rift Valley fever virus comprising the primer set of the present invention.

In addition, the present invention provides a kit for detecting Rift Valley fever virus comprising the composition of the present invention.

In addition, the present invention provides a method of detecting a Rift Valley fever virus comprising the step of performing a polymerase chain reaction (PCR) using the primer set of the present invention using the nucleic acid isolated from the specimen as a template. .

The primer set of the present invention is designed by collecting the nucleotide sequences of 19 Rift Valley fever virus strains. When performing PCR using the primer set and probe of the present invention, the currently reported Rift Valley fever virus is detected in one reaction. The primer set and probe of the present invention are capable of detecting and diagnosing Rift Valley fever viruses because they are capable of and have excellent sensitivity, no cross-reaction with other strains, no interference reactions with interfering substances, and exhibit reproducible results and excellent storage stability. It can be usefully used.

1 shows the result of alignment of the nucleotide sequences of the collected 19 Rift Valley fever virus strains.
2 is a result of confirming the detection limit when performing PCR using the primer and probe set of the present invention.
(Target: the synthesized target RNA gene of Experimental Example 1-1;
IPC: internal positive control;
CV: The coefficient of variation relative to the mean).
3 is a result of confirming the presence or absence of cross-reaction with other strains when performing PCR using the primer and probe set of the present invention.
4 is a result of confirming the presence or absence of an interference reaction with an interfering substance when performing PCR using the primer and probe set of the present invention.
(Green: internal positive control (ITC); red: Rift Valley fever virus sample; blue line: negative control).
5 is a result of confirming reproducibility when performing PCR using the primer and probe set of the present invention.
(Green: internal positive control (ITC); red: Rift Valley fever virus sample; blue line: negative control).
6 is a result of confirming the storage stability of the primer and probe set of the present invention
(Green: internal positive control (ITC); red: Rift Valley fever virus sample; blue line: negative control).

Hereinafter, the present invention will be described in detail.

The present invention provides a primer set for detection of a Rift Valley fever virus comprising a forward primer described with the nucleotide sequence of SEQ ID NO: 1 and a reverse primer described with the nucleotide sequence of SEQ ID NO: 2.

The primer set may be to amplify the segment S region of the Rift Valley fever virus. In addition, the primer set may be a forward or reverse primer consisting of 10 to 40, specifically 15 to 30 nucleotide sequences capable of complementarily binding to the gene of the segment S region. In one embodiment of the present invention, the primer set may be composed of a forward primer described with the nucleotide sequence of SEQ ID NO: 1 and a reverse primer described with the nucleotide sequence of SEQ ID NO: 2.

The primer can be chemically synthesized using a phosphoramidite solid support method, or other well known method. These primers can be modified using a number of means known in the art as long as they exhibit an effect capable of detecting Rift Valley fever virus. Examples of such modifications include methylation, encapsulation, substitution of one or more homologs of natural nucleotides, and modifications between nucleotides, such as uncharged linkers (e.g., methyl phosphonate, phosphotriester, phosphoroamidate, Carbamate, etc.) or to a charged linker (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids may be one or more additional covalently linked moieties, such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalating agents (e.g., acridin , Proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents. In addition, the primer of the present invention may contain a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means, if necessary. Examples of labels include enzymes (e.g. horseradish peroxidase, alkaline phosphatase), radioactive isotopes (e.g., ³² P), fluorescent molecules and chemical groups (e.g., biotin), etc. There is this.

The primer set may be for point-of-care testing (POCT). The primer set may be a primer set for field diagnosis capable of detecting a yellow fever virus with high sensitivity and specificity using a field diagnosis device.

In addition, the present invention provides a composition for detecting a lift valley fever virus comprising a primer set for detecting a lift valley fever virus consisting of a forward primer described in the nucleotide sequence of SEQ ID NO: 1 and a reverse primer described in the nucleotide sequence of SEQ ID NO: 2 do.

The primer set may have the characteristics as described above. As an example, the primer set may be to amplify the segment S region of the Rift Valley fever virus. In addition, the primer set may be a forward or reverse primer consisting of 10 to 40, specifically 15 to 30 nucleotide sequences capable of complementarily binding to the gene of the segment S region. In one embodiment of the present invention, the primer set may be composed of a forward primer described with the nucleotide sequence of SEQ ID NO: 1 and a reverse primer described with the nucleotide sequence of SEQ ID NO: 2.

In addition, the composition may further include a probe described in the nucleotide sequence of SEQ ID NO: 3.

The term "probe" as used herein refers to a nucleic acid fragment corresponding to several to hundreds of bases capable of specifically binding to DNA or RNA, and an oligonucleotide probe, a single stranded DNA probe , It can be produced in the form of double stranded DNA or RNA.

The probe can be chemically synthesized using the phosphoramidite solid support method, or other well known methods. These primers can be modified using a number of means known in the art, as long as they exhibit an effect capable of detecting Rift Valley fever virus. Examples of such modifications include methylation, encapsulation, substitution of one or more homologs of natural nucleotides, and modifications between nucleotides, such as uncharged linkers (e.g., methyl phosphonate, phosphotriester, phosphoroamidate, Carbamate, etc.) or to a charged linker (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids may be one or more additional covalently linked moieties, such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalating agents (e.g., acridine , Proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents.

The probe may further have a reporter attached to its 5'end. The reporter is FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein, HEX (2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein) , Fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethylrhodamine, FITC (fluorescein isothiocyanate), oregon green, Alexa Fluoro (alexa fluor), JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-X-Rhodamine), TET (Tetrachloro-Fluorescein), TRITC ( tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine-based dyes, and thiadicarbocyanine. However, any other known material that can be used as a reporter in the art may be used. In an embodiment of the present invention, the reporter may be 6-carboxyfluorescein (FAM).

The probe may be further conjugated to a quencher at its 3'end. The quencher is TAMRA (6-carboxytetramethyl-rhodamine), BHQ1 (black hole quencher 1), BHQ2 (black hole quencher 2), BHQ3 (black hole quencher 3), NFQ (nonfluorescent quencher), dabcyl, Eclipse, DDQ (Deep Dark Quencher), Blackberry Quencher (Blackberry Quencher), and may be any one or more selected from the group consisting of Iowa black (Iowa black), in addition to any one known as a material that can be used as a quencher in the art can be used. In an embodiment of the present invention, the quencher may be a black hole quencher (BHQ) 1.

In addition to the primer set and probe, the composition may include reverse transcription polymerase, DNA polymerase, cofactors such as Mg2+, dATP, dCTP, dGTP, and dTTP. In order to amplify the reverse transcribed cDNA, various DNA polymerases can be used in the amplification step of the present invention. Examples of DNA polymerases include Klenow fragment of E. coli DNA polymerase I, thermostable DNA polymerase, or bacteriophage T7 DNA polymerization. There are enzymes. The polymerase can be isolated from the bacterium itself, purchased commercially, or obtained from cells expressing high levels of the cloning gene encoding the polymerase.

In a specific embodiment of the present invention, the present inventors produced a forward primer described with the nucleotide sequence of SEQ ID NO: 1, a reverse primer described with the nucleotide sequence of SEQ ID NO: 2, and a probe described with the nucleotide sequence of SEQ ID NO: 3, and are currently reported. The Rift Valley fever virus can be detected in a single reaction within a short period of time in a compact and fast real-time gene amplification device, and the sensitivity is excellent as it shows a minimum detection limit of 11.89 copies/reaction. It was confirmed that there is no cross-reaction with the strain, there is no interference reaction with interfering substances that may affect the detection result because it is contained in the sample, shows reproducible results, and shows storage stability for 365 days (Figs. 6).

Therefore, the primer set and probe of the present invention can be usefully used to detect and diagnose Rift Valley fever virus.

In addition, the present invention provides a kit for detecting Rift Valley fever virus comprising the composition of the present invention.

The composition may have the characteristics as described above. As an example, the composition may include a primer set for detecting a Rift Valley fever virus comprising a forward primer described in the nucleotide sequence of SEQ ID NO: 1 and a reverse primer described in the nucleotide sequence of SEQ ID NO: 2. In addition, the composition may further include a probe described in the nucleotide sequence of SEQ ID NO: 3. The probe may further have a reporter attached to its 5'end. In addition, a quencher may be further bonded to the 3'end of the probe.

The kit may further include one or more other component compositions, solutions or devices suitable for the assay method. The kit includes reverse transcriptase for synthesizing complementary cDNA from Rift Valley fever virus RNA, DNA polymerase for amplifying complementary DNA, tube or other suitable container, in addition to a set of primers specific for a specific region of Rift Valley fever virus, Reaction buffer (varies in pH and magnesium concentration), deoxynucleotides (dNTPs), enzymes such as hot-start Taq-polymerase and reverse transcriptase, DNase, RNase inhibitor, DEPC-water and sterile water, etc. Can include. Meanwhile, the ingredients included in the kit may be prepared in a liquid form, or may be prepared in a dried form to improve product stability by lowering the degree of freedom of the included ingredients. In order to manufacture such a dried form, it is necessary to apply a drying step, and in this case, heated drying, natural drying, vacuum drying, freeze drying, or a complex process thereof may be used.

In addition, the present invention provides a method of detecting a Rift Valley fever virus comprising the step of performing a polymerase chain reaction (PCR) using the primer set of the present invention using the nucleic acid isolated from the specimen as a template. .

The specimen may be obtained from a clinical sample or an environmental sample. For example, the clinical sample may be a sample obtained from tissue, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, or urine.

The primer set may have the characteristics as described above. As an example, the primer set may be to amplify the segment S region of the Rift Valley fever virus. In addition, the primer set may be a forward or reverse primer consisting of 10 to 40, specifically 15 to 30 nucleotide sequences capable of complementarily binding to the gene of the segment S region. In one embodiment of the present invention, the primer set may be composed of a forward primer described with the nucleotide sequence of SEQ ID NO: 1 and a reverse primer described with the nucleotide sequence of SEQ ID NO: 2.

Hereinafter, the present invention will be described in detail by the following examples.

However, the following examples are for illustrative purposes only, and the present invention is not limited thereto.

<Example 1> Preparation of primers and probes capable of detecting Rift Valley fever virus

A set of primers and probes for field detection (Point-Of Care-Testing, POCT) capable of detecting Rift Valley fever virus and a set of primers and probes for laboratory detection were prepared.

After searching for Rift Valley fever virus strains, the nucleotide sequences of 19 Rift Valley fever virus strains were collected at the National Center for Biological Information (NCBI, https://www.ncbi.nlm.nih.gov/) (Table 1). . Genes were aligned using the collected nucleotide sequences, and primers and probes capable of detecting Rift Valley fever virus were prepared using segment S as a target gene (FIG. 1 and Table 2). Reporter FAM (6-carboxyfluorescein) was bound to the 5'end of the probe, and quencher BHQ (black hole quencher) 1 was bound to the 3'end.

Rift Valley fever virus strain One H1825RSA75 11 SPU2223KEN07 2 ZH501EGY77 12 SPU2214KEN07 3 ZH548EGY77 13 SPU2215KEN07 4 SPU204ANGL85 14 SPU2220KEN07 5 R1662CAR85 15 SPU10301KEN07 6 SPU45ZAMB85 16 SPU10302KEN07 7 900085MAU88 17 SPU10307KEN07 8 SPU384001KEN97 18 SPU10315KEN07 9 SPU77NAMB04 19 SPU152RSA08 10 SPU2207KEN07

Target
gene Primer or probe
Sequence (5'->3') Length GC% Tm Amplification product size segment S Set 1 Forward direction
primer RVFV-S1-F TTCTCATGGCTTATAAAGTTGCTA
(SEQ ID NO: 1) 24 33 60 94 bp Reverse
primer RVFV-S1-R CAAACCTCCGAGGyAGAACA
(SEQ ID NO: 2) 20 53 61 Probe RVFV-S1-P ACTGCTGCATTCATTGGCTGCGT
(SEQ ID NO: 3) 23 52 71

<Experimental Example 1> Evaluation of detection ability of Rift Valley fever virus of primer and probe set

<1-1> Detection limit evaluation

When performing PCR using the primer and probe set for field detection of the Rift Valley fever virus prepared in Example 1, it was intended to analyze the limit of detection (LoD) of the primer and probe set.

Specifically, after setting the common region of the Rift Valley fever virus strain described in Table 1 as a target, in vitro transcription (T7) was performed using purified DNA to synthesize an RNA gene. . 150, 75, 37.5, 18.75, 9.375 and 4.688 copies/reaction concentration of Rift Valley pylori synthesized RNA 3 µl, 2x Master mix 5 µl, primer probe mix 1 µl and PCR After mixing 1 µl of an internal positive control to check whether it performed well, a real-time RT-PCR reaction was performed under the reaction conditions shown in Table 3 below (UltraFast LabChip real-time PCR G2-4). Ct (cycle threshold) value and detection rate were measured by performing 30 replicate experiments under the same conditions, and the 95% positive interval was verified with a probit regression model using a statistical program (IBM SPSS Statistics, IBM). The minimum detection limit was calculated as'the lowest concentration showing 95% detection rate using standard substances' as defined in the <Guideline for In Vitro Diagnostic Medical Device License Review> of the Ministry of Food and Drug Safety.

As a result, as shown in Figure 2, the higher the concentration of the synthesized target RNA gene (denoted as Target), the lower the Ct value, and the primer and probe set targeting the Rift Valley fever virus segment S was 11.89 copies/reaction. Shows the minimum detection limit of, it was found that the sensitivity is excellent (Fig. 2).

Temperature time cycle 50℃ 5 minutes One 95℃ 8 seconds One 95℃ 13 seconds 44 54℃ 13 seconds Total Time 34 minutes 40 seconds ^*

( ^* Total time required including reading time on the machine)

<1-2> Specificity evaluation through cross-reaction test with other strain genes

When performing PCR using the primer and probe set for field detection of the Rift Valley fever virus prepared in Example 1, a cross-reaction test with other strains was performed to evaluate the specificity of the primer and probe set. Since Lift Valley Fever virus is a high-risk substance in the BL3 category, it was inevitably excluded because it was impossible to bring it into Korea. The detection was confirmed with a positive control synthesized instead of Lift Valley Fever virus.

Specifically, a cross-reaction test was performed using a total of 88 strain genes (indicated in'bold' in Fig. 3) and a transcript (indicated by'underline' in Fig. 3) provided by the Centers for Disease Control and Prevention. Among the strains used, the virus was ^{applied at a concentration of 10 4} copies/µl, and the remaining strains were applied at a concentration of 1 ng/µl. Real-time RT-PCR was performed in the same manner as described in Experimental Example 1-1, except that the same amount of the pathogen gene and transcript were used instead of Rift Valley fever virus RNA.

As a result, the primer and probe set prepared in Example 1 did not show cross-reaction with 88 other strains (FIG. 3).

<1-3> Evaluation of specificity through interference reaction test with interfering substances

When performing PCR using the primer and probe set for field detection of the Rift Valley fever virus prepared in Example 1, to evaluate the specificity of the primer and probe set, it was included in the sample and interfering with interfering substances that may affect the experiment. The interference reaction was confirmed.

Specifically, the interfering substances were selected as hemoglobin, IgG, heparin, EDTA, and sodium citrate (Na-citrate), referring to'EP7-A2' of the <CLSI Guidelines>, and containing or not containing interfering substances. Real-time RT-PCR was performed using the sample in the same manner as described in Experimental Example 1-1, and the Ct value difference (Ct difference) from the positive control group that did not contain an interference substance was calculated. At this time, RNA synthesized from Rift Valley fever virus was added at a concentration of 25 or 100 times the minimum detection limit (11.89 copies/reaction), and each interfering substance was 1 mg/ml hemoglobin, 12.5 μg/ It was added at a concentration of immunoglobulin G (IgG), 0.1 mg/ml heparin, 4 mM ethylenediaminetetraacetic acid (EDTA), or 20 mM sodium citrate.

As a result, since the difference in Ct values according to the five interfering substances is insignificant, the primer and probe set prepared in Example 1 were hemoglobin, IgG, heparin, EDTA, or sodium citrate (Na-citrate) acting as interfering substances It was confirmed that no interference reaction appeared (FIG. 4).

<1-4> Reproducibility evaluation

When performing PCR using the primer and probe set for field detection of the Rift Valley fever virus prepared in Example 1, the reproducibility of the primer and probe set was evaluated.

Specifically, except for reacting RNA synthesized from Rift Valley fever virus at a concentration of 5, 25 or 100 times the minimum detection limit (11.89 copies/reaction), it was repeated twice a day for 5 days. Real-time RT-PCR was performed in the same manner as described in 1-1, and the average, standard deviation, and coefficient of variation (CV) of the measured Ct values were calculated. The negative control was a sample that did not contain synthetic RNA of Rift Valley fever virus.

As a result, it was confirmed that the CV value according to the 10 replicate experiments was 0.02% or less, and the primer and probe set prepared in Example 1 showed reproducible results (FIG. 5).

<1-5> Storage stability evaluation

Accelerated aging experiment according to the stability test standard of medical devices as set forth in <Ministry of Food and Drug Safety Notice No. It was investigated through.

Specifically, the accelerated aging coefficient (AAF) was calculated using the following calculation formula 1, and the accelerated aging time (AAT) was calculated using the calculation formula 2.

[Calculation 1]

AAF = Q ₁₀ ^{｜(TAA-TRT)/10｜}

Q ₁₀ : Aging coefficient when temperature rises or decreases by 10℃, 2

TAA: accelerated aging temperature, 45℃

TRT: Product storage temperature, -20℃

[Calculation 2]

AAT = Set validity period / AAF

Set validity period: 365 days

AAF: 90.51 (accelerated aging coefficient derived from equation 1)

Depending on the calculated conditions, the primer and probe set prepared in Example 1 were stored at 45° C. for 4 days at three concentrations (minimum detection limit of 11.89 copies/reaction of 5X, 25X or 100X), and 0, 3, 6, At 9 or 12 months, real-time RT-PCR was performed in the same manner as described in Experimental Example 1-1, and the Ct value difference (Ct difference) was calculated by comparing it with the Ct value of day 0. As a positive control, a plasmid DNA consisting of a specific sequence of Rift Valley Fever virus was used, and as a negative control, a positive control having a Rift Valley Fever virus sequence or a sample without transcript RNA was used.

As a result, the primer and probe set prepared in Example 1 showed a Ct value within ±1, and it is generally determined that the Ct value difference from the control group is within the range of ±2, so storage stability for 65 days It was confirmed to have (Fig. 6).

<110> Korea Centers for Disease Control and Prevention MICOBIOMED CO., LTD. <120> Primer set for detecting rift valley virus and uses thereof <130> 2018P-07-009 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> RVFV-S1-F <400> 1 ttctcatggc ttataaagtt gcta 24 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> RVFV-S1-R <400> 2 caaacctccg aggyagaaca 20 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> RVFV-S1-P <400> 3 actgctgcat tcattggctg cgt 23

Claims (9)

A forward primer described in SEQ ID NO: 1; A reverse primer described by the nucleotide sequence of SEQ ID NO: 2; And a lift valley virus detection composition consisting of a probe described in SEQ ID NO: 3.
According to claim 1, wherein the probe is a reporter is further conjugated to the 5 'end, Rift Valley fever virus detection composition.
According to claim 1, wherein the probe is a quencher is further conjugated to the 3 'end, the composition for detecting the Rift Valley fever virus.
According to claim 2, The reporter is FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein (fluorescein), HEX (2 ', 4', 5 ', 7'-tetrachloro-6-carboxy- 4,7-dichlorofluorescein, fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethylrhodamine, FITC (fluorescein isothiocyanate), Oregon Green (oregon green), Alexa fluor, JOE (6-Carboxy-4 ', 5'-Dichloro-2', 7'-Dimethoxyfluorescein), ROX (6-Carboxyl-X-Rhodamine), TET (Tetrachloro -Fluorescein, TRITC (tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N- (1-Naphthyl) ethylenediamine), cyanine-based dye and thiadicarbocyanine Any one selected, a composition for the detection of Rift Valley fever virus.
The method according to claim 3, wherein the quencher is TAMRA (6-carboxytetramethyl-rhodamine), BHQ1 (black hole quencher 1), BHQ2 (black hole quencher 2), BHQ3 (black hole quencher 3), NFQ (nonfluorescent quencher), dabsil ( dabcyl), Eclipse, DDQ (Deep Dark Quencher), Blackberry Quencher (Blackberry Quencher), Iowa Black (Iowa black) any one selected from the group consisting of, the composition for detecting the Rift Valley fever virus.
Kit for detecting a Rift Valley fever virus comprising the composition of claim 1.
1) separating the nucleic acid from the sample;
2) amplifying a target sequence by performing a polymerase chain reaction (PCR) using the composition of claim 1 as a template for the nucleic acid isolated from the sample; And
3) detecting the amplification product of step 2) through fluorescence measurement; Method for detecting a lift valley fever virus comprising a.
The method of claim 7, wherein the sample is obtained from a clinical sample or an environmental sample.
The method of claim 7, wherein the method of detecting the Rift Valley fever virus indicates a minimum detection limit of 10 to 20 copies / reaction.

Images