KR20200056352A - Primer set for detecting rift valley virus and uses thereof - Google Patents
Primer set for detecting rift valley virus and uses thereof Download PDFInfo
- Publication number
- KR20200056352A KR20200056352A KR1020200009943A KR20200009943A KR20200056352A KR 20200056352 A KR20200056352 A KR 20200056352A KR 1020200009943 A KR1020200009943 A KR 1020200009943A KR 20200009943 A KR20200009943 A KR 20200009943A KR 20200056352 A KR20200056352 A KR 20200056352A
- Authority
- KR
- South Korea
- Prior art keywords
- fever virus
- rift valley
- valley fever
- detecting
- quencher
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Virology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
본 발명은 리프트밸리열바이러스 검출용 프라이머 세트 및 이의 용도에 관한 것이다. The present invention relates to a primer set for detection of Rift Valley fever virus and a use thereof.
리프트 밸리열(Rift Valley Fever; RVF)은 버냐바이러스(Bunyaviridae)와 필보바이러스(Phlebovirus)속에 속하며, 세 개의 분절로 이루어진 단일가닥의 선형(-)RNA 바이러스이다. 1900년대 초반 케냐의 가축에서 처음 발견된 이후 감염된 가축을 통하여 많은 사람과 동물에서 발생이 보고되고 있다. 잠복기는 대개 2-6일이며, 일반적으로 발열, 현기증, 극심한 체중감소 등의 경미한 증상을 나타내지만 심한 경우에는 쇼크, 출혈, 안질환, 뇌염으로 인한 두통, 혼수상태 등의 증상을 보이며 사망에 이를 수 있다. 전체 감염자의 1%가 사망하고 출혈열 증상 환자의 경우 치사율이 50%에 달하나 현재까지 특이적 항바이러스제나 예방 백신이 개발되지 않았으며, 발병시 대중 치료만 가능하다. 감염 경로는 감염된 혈액을 가진 모기나 흡혈곤충에게 물리거나 감염된 동물의 혈액이나 체액, 장기에 접촉하는 경우, 감염된 동물의 우유를 가공하지 않고 마실 경우에 감염이 일어날 수 있다. 대부분의 아프리카 지역과 아라비아 반도에서 주로 발생하며, 특히 매개모기 서식지인 서아프리카 지역에서 많이 발생하나, 현재까지 국내에서 발병된 보고는 없다.Rift Valley Fever (RVF) belongs to the genus Bunyaviridae and Phlebovirus, and is a single-stranded linear (-) RNA virus consisting of three segments. Since it was first discovered in Kenyan livestock in the early 1900s, it has been reported in many humans and animals through infected livestock. The incubation period is usually 2-6 days, and usually shows mild symptoms such as fever, dizziness, and extreme weight loss, but in severe cases, symptoms such as shock, bleeding, eye disease, headache due to encephalitis, coma, and so on, lead to death. I can. 1% of all infected patients die and the mortality rate of patients with hemorrhagic fever reaches 50%, but no specific antiviral or preventive vaccine has been developed so far, and only public treatment is available at the outbreak. The route of infection can occur when bites by mosquitoes or bloodsucking insects with infected blood, contact with blood, body fluids, or organs of infected animals, or when unprocessed milk from infected animals is consumed. It occurs mainly in most of Africa and the Arabian Peninsula, especially in West Africa, which is a habitat for vector vectors, but there have been no reports of outbreaks in Korea so far.
이러한 국내에 유입되지 않은 고위험 바이러스가 생물테러로 사용될 경우 진단과 치료에 있어 치명적이며, 확산을 방지하기 어려워 국민보건에 심각한 영향을 끼칠 우려가 있으므로 이에 대한 대응책 마련이 시급하다. 그러나 생물테러 사건현장에서 주로 이용되는 면역크로마토그래피 시험법으로는 검출 가능한 생물작용제가 한정되어 있어 검출 가능한 생물작용제의 확대가 요구되고 있다. 또한 면역크로마토그래피 시험법의 경우, 민감도 개선 필요성이 제기됨에 따라 이를 보완할 수 있는 실시간 유전자중폭장비(real-time PCR)기기에서 운용될 수 있는 현장진단법의 도입이 필요한 실정이다. If such a high-risk virus that has not been introduced into Korea is used for biological terrorism, it is fatal in diagnosis and treatment, and it is difficult to prevent its spread and may seriously affect public health, so it is urgent to prepare countermeasures for this. However, as the immunochromatographic test method mainly used at the site of biological terrorism, detectable biological agents are limited, and thus, expansion of detectable biological agents is required. In addition, in the case of immunochromatography, as the need to improve sensitivity is raised, it is necessary to introduce a field diagnosis method that can be operated in a real-time PCR device that can compensate for this.
현장진단(Point of Care Testing, POCT)은 체외진단 중 하나로, 피검자 및 환자와 가까운 위치에서 원심분리 등 샘플 사전가공을 거치지 않고, 신속하게 시행해 진료 및 치료에 활용할 수 있는 임상병리 검사방식을 말한다. 최근까지는 개인의 자가혈당측정 용도로 많이 사용되어 왔지만 수년 전부터 점차 다양한 질환의 진단 목적으로 사용 및 개발되고 있고, 서유럽에서 다른 진단 제품들이 가지고 있는 비용문제, 규제문제를 해결할 수 있는 분야로 각광받고 있으며, 저비용의 장점으로 개발도상국가에서도 수요가 증가하고 있다. Point of Care Testing (POCT) is one of the in vitro diagnostics, and refers to a clinical pathology test method that can be used for treatment and treatment by promptly conducting it without undergoing pre-processing of samples such as centrifugation at a location close to the subject and patient. Until recently, it has been widely used for personal self-glucose measurement, but since several years ago, it has been gradually used and developed for the purpose of diagnosing various diseases, and is in the spotlight as a field that can solve the cost and regulatory issues of other diagnostic products in Western Europe. However, due to its low cost, demand is also increasing in developing countries.
본 발명의 목적은 리프트밸리열바이러스를 검출할 수 있는 프라이머 세트를 제공하는 것이다.It is an object of the present invention to provide a primer set capable of detecting Rift Valley fever virus.
본 발명의 다른 목적은 본 발명의 프라이머 세트를 포함하는 리프트밸리열바이러스 검출용 조성물 및 키트를 제공하는 것이다.Another object of the present invention is to provide a composition and kit for detecting Rift Valley fever virus comprising the primer set of the present invention.
본 발명의 또 다른 목적은 본 발명의 프라이머 세트를 이용하여 리프트밸리열바이러스를 검출하는 방법을 제공하는 것이다. Another object of the present invention is to provide a method for detecting Rift Valley fever virus using the primer set of the present invention.
상기 목적을 달성하기 위하여, 본 발명은 서열번호 1의 염기서열로 기재되는 정방향 프라이머 및 서열번호 2의 염기서열로 기재되는 역방향 프라이머로 이루어진 리프트밸리열바이러스 검출용 프라이머 세트를 제공한다.In order to achieve the above object, the present invention provides a primer set for detecting a Rift Valley fever virus comprising a forward primer described by the nucleotide sequence of SEQ ID NO: 1 and a reverse primer described by the nucleotide sequence of SEQ ID NO: 2.
또한, 본 발명은 본 발명의 프라이머 세트를 포함하는 리프트밸리열바이러스 검출용 조성물을 제공한다. In addition, the present invention provides a composition for detecting Rift Valley fever virus comprising the primer set of the present invention.
또한, 본 발명은 본 발명의 조성물을 포함하는 리프트밸리열바이러스 검출용 키트를 제공한다. In addition, the present invention provides a kit for detecting Rift Valley fever virus comprising the composition of the present invention.
또한, 본 발명은 검체로부터 분리된 핵산을 주형으로 본 발명의 프라이머 세트를 이용하여 중합효소 연쇄반응(polymerase chain reaction, PCR)을 수행하는 단계를 포함하는 리프트밸리열바이러스를 검출하는 방법을 제공한다. In addition, the present invention provides a method of detecting a Rift Valley fever virus comprising the step of performing a polymerase chain reaction (PCR) using the primer set of the present invention using the nucleic acid isolated from the specimen as a template. .
본 발명의 프라이머 세트는 19개의 리프트밸리열바이러스 균주들의 염기서열을 수집하여 디자인한 것으로, 본 발명의 프라이머 세트 및 프로브를 이용하여 PCR 수행 시 현재 보고되어 있는 리프트밸리열바이러스를 한 번의 반응으로 검출할 수 있고 민감도가 우수하고 타 균주와의 교차반응 및 간섭물질과의 간섭반응이 없으며 재현성있는 결과를 나타내고 보관 안정성이 우수하므로, 본 발명의 프라이머 세트 및 프로브는 리프트밸리열바이러스를 검출 및 진단하는 데 유용하게 사용될 수 있다. The primer set of the present invention is designed by collecting the nucleotide sequences of 19 Rift Valley fever virus strains. When performing PCR using the primer set and probe of the present invention, the currently reported Rift Valley fever virus is detected in one reaction. The primer set and probe of the present invention are capable of detecting and diagnosing Rift Valley fever viruses because they are capable of and have excellent sensitivity, no cross-reaction with other strains, no interference reactions with interfering substances, and exhibit reproducible results and excellent storage stability. It can be usefully used.
도 1은 수집한 19개의 리프트밸리열바이러스 균주의 염기서열을 정렬(alignment)한 결과를 나타낸 것이다.
도 2는 본 발명의 프라이머 및 프로브 세트를 이용하여 PCR 수행 시 검출한계를 확인한 결과이다
(Target: 실험예 1-1의 합성된 타겟 RNA 유전자;
IPC: 내부 양성 대조군(internal positive control);
CV: 평균 대비 표준편차의 비율(coefficient of variation)).
도 3은 본 발명의 프라이머 및 프로브 세트를 이용하여 PCR 수행 시 타균주와의 교차반응의 유무를 확인한 결과이다.
도 4는 본 발명의 프라이머 및 프로브 세트를 이용하여 PCR 수행 시 간섭물질과의 간섭반응의 유무를 확인한 결과이다
(녹색: 내부 양성 대조군(ITC); 빨간색: 리프트밸리열 바이러스 시료; 파란선: 음성 대조군).
도 5는 본 발명의 프라이머 및 프로브 세트를 이용하여 PCR 수행 시 재현성을 확인한 결과이다
(녹색: 내부 양성 대조군(ITC); 빨간색: 리프트밸리열 바이러스 시료; 파란선: 음성 대조군).
도 6은 본 발명의 프라이머 및 프로브 세트의 보관 안정성을 확인한 결과이다
(녹색: 내부 양성 대조군(ITC); 빨간색: 리프트밸리열 바이러스 시료; 파란선: 음성 대조군).1 shows the result of alignment of the nucleotide sequences of the collected 19 Rift Valley fever virus strains.
2 is a result of confirming the detection limit when performing PCR using the primer and probe set of the present invention.
(Target: the synthesized target RNA gene of Experimental Example 1-1;
IPC: internal positive control;
CV: The coefficient of variation relative to the mean).
3 is a result of confirming the presence or absence of cross-reaction with other strains when performing PCR using the primer and probe set of the present invention.
4 is a result of confirming the presence or absence of an interference reaction with an interfering substance when performing PCR using the primer and probe set of the present invention.
(Green: internal positive control (ITC); red: Rift Valley fever virus sample; blue line: negative control).
5 is a result of confirming reproducibility when performing PCR using the primer and probe set of the present invention.
(Green: internal positive control (ITC); red: Rift Valley fever virus sample; blue line: negative control).
6 is a result of confirming the storage stability of the primer and probe set of the present invention
(Green: internal positive control (ITC); red: Rift Valley fever virus sample; blue line: negative control).
이하, 본 발명을 상세히 설명한다. Hereinafter, the present invention will be described in detail.
본 발명은 서열번호 1의 염기서열로 기재되는 정방향 프라이머 및 서열번호 2의 염기서열로 기재되는 역방향 프라이머로 이루어진 리프트밸리열바이러스 검출용 프라이머 세트를 제공한다. The present invention provides a primer set for detection of a Rift Valley fever virus comprising a forward primer described with the nucleotide sequence of SEQ ID NO: 1 and a reverse primer described with the nucleotide sequence of SEQ ID NO: 2.
상기 프라이머 세트는 리프트밸리열바이러스의 segment S 영역을 증폭하는 것일 수 있다. 또한, 상기 프라이머 세트는 상기 segment S 영역의 유전자에 상보적으로 결합 가능한 10 내지 40개, 구체적으로 15 내지 30개의 염기서열로 이루어진 정방향 또는 역방향 프라이머일 수 있다. 본 발명의 일 실시예에서, 상기 프라이머 세트는 서열번호 1의 염기서열로 기재되는 정방향 프라이머 및 서열번호 2의 염기서열로 기재되는 역방향 프라이머로 이루어진 것일 수 있다. The primer set may be to amplify the segment S region of the Rift Valley fever virus. In addition, the primer set may be a forward or reverse primer consisting of 10 to 40, specifically 15 to 30 nucleotide sequences capable of complementarily binding to the gene of the segment S region. In one embodiment of the present invention, the primer set may be composed of a forward primer described with the nucleotide sequence of SEQ ID NO: 1 and a reverse primer described with the nucleotide sequence of SEQ ID NO: 2.
상기 프라이머는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성될 수 있다. 이러한 프라이머는 리프트밸리열바이러스를 검출할 수 있는 효과를 나타내는 한, 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 예로는 메틸화, 캡화, 천연 뉴클레오티드 하나 이상의 동족체로의 치환 및 뉴클레오티드 간의 변형, 예를 들면, 하전되지 않은 연결체(예를 들어, 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예를 들어, 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형을 포함할 수 있다. 핵산은 하나 이상의 부가적인 공유 결합된 잔기, 예를 들면, 단백질(예를 들어, 뉴클레아제, 독소, 항체, 시그널 펩타이드, 폴리-L-리신 등), 삽입제(예를 들어, 아크리딘, 프로랄렌 등), 킬레이트화제(예를 들어, 금속, 방사성 금속, 철, 산화성 금속 등) 및 알킬화제를 함유할 수 있다. 또한, 본 발명의 프라이머는 필요한 경우, 분광학적, 광화학적, 생화학적, 면역화학적 또는 화학적 수단에 의해 직접적으로 또는 간접적으로 검출 가능한 표지를 포함할 수 있다. 표지의 예로는, 효소(예를 들어, 호스래디쉬 퍼옥시다제, 알칼린 포스파타아제), 방사성 동위원소(예를 들어, 32P), 형광성 분자 및 화학그룹(예를 들어, 바이오틴) 등이 있다. The primer can be chemically synthesized using a phosphoramidite solid support method, or other well known method. These primers can be modified using a number of means known in the art as long as they exhibit an effect capable of detecting Rift Valley fever virus. Examples of such modifications include methylation, encapsulation, substitution of one or more homologs of natural nucleotides, and modifications between nucleotides, such as uncharged linkers (e.g., methyl phosphonate, phosphotriester, phosphoroamidate, Carbamate, etc.) or to a charged linker (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids may be one or more additional covalently linked moieties, such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalating agents (e.g., acridin , Proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents. In addition, the primer of the present invention may contain a label detectable directly or indirectly by spectroscopic, photochemical, biochemical, immunochemical or chemical means, if necessary. Examples of labels include enzymes (e.g. horseradish peroxidase, alkaline phosphatase), radioactive isotopes (e.g., 32 P), fluorescent molecules and chemical groups (e.g., biotin), etc. There is this.
상기 프라이머 세트는 현장진단(point-of-care testing, POCT)을 위한 것일 수 있다. 상기 프라이머 세트는 현장진단용 기기를 이용하여 황열바이러스를 높은 민감도 및 특이도로 검출할 수 있는 현장진단을 위한 프라이머 세트일 수 있다. The primer set may be for point-of-care testing (POCT). The primer set may be a primer set for field diagnosis capable of detecting a yellow fever virus with high sensitivity and specificity using a field diagnosis device.
또한, 본 발명은 서열번호 1의 염기서열로 기재되는 정방향 프라이머 및 서열번호 2의 염기서열로 기재되는 역방향 프라이머로 이루어진 리프트밸리열바이러스 검출용 프라이머 세트를 포함하는 리프트밸리열바이러스 검출용 조성물을 제공한다. In addition, the present invention provides a composition for detecting a lift valley fever virus comprising a primer set for detecting a lift valley fever virus consisting of a forward primer described in the nucleotide sequence of SEQ ID NO: 1 and a reverse primer described in the nucleotide sequence of SEQ ID NO: 2 do.
상기 프라이머 세트는 상술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 프라이머 세트는 리프트밸리열바이러스의 segment S 영역을 증폭하는 것일 수 있다. 또한, 상기 프라이머 세트는 상기 segment S 영역의 유전자에 상보적으로 결합 가능한 10 내지 40개, 구체적으로 15 내지 30개의 염기서열로 이루어진 정방향 또는 역방향 프라이머일 수 있다. 본 발명의 일 실시예에서, 상기 프라이머 세트는 서열번호 1의 염기서열로 기재되는 정방향 프라이머 및 서열번호 2의 염기서열로 기재되는 역방향 프라이머로 이루어진 것일 수 있다.The primer set may have the characteristics as described above. As an example, the primer set may be to amplify the segment S region of the Rift Valley fever virus. In addition, the primer set may be a forward or reverse primer consisting of 10 to 40, specifically 15 to 30 nucleotide sequences capable of complementarily binding to the gene of the segment S region. In one embodiment of the present invention, the primer set may be composed of a forward primer described with the nucleotide sequence of SEQ ID NO: 1 and a reverse primer described with the nucleotide sequence of SEQ ID NO: 2.
또한, 상기 조성물은 서열번호 3의 염기서열로 기재되는 프로브를 더 포함할 수 있다. In addition, the composition may further include a probe described in the nucleotide sequence of SEQ ID NO: 3.
본 명세서에서 사용되는 용어 "프로브"는 DNA 또는 RNA와 특이적으로 결합할 수 있는 수개 내지 수백 개의 염기에 해당하는 핵산 단편을 의미하며, 올리고뉴클레오티드(oligonucleotide) 프로브, 단쇄 DNA(single stranded DNA) 프로브, 이중쇄 DNA(double stranded DNA) 또는 RNA 등의 형태로 제작될 수 있다. The term "probe" as used herein refers to a nucleic acid fragment corresponding to several to hundreds of bases capable of specifically binding to DNA or RNA, and an oligonucleotide probe, a single stranded DNA probe , It can be produced in the form of double stranded DNA or RNA.
상기 프로브는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성될 수 있다. 이러한 프라이머는 리프트밸리열바이러스를 검출할 수 있는 효과를 나타내는 한, 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 예로는 메틸화, 캡화, 천연 뉴클레오티드 하나 이상의 동족체로의 치환 및 뉴클레오티드 간의 변형, 예를 들면, 하전되지 않은 연결체(예를 들어, 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예를 들어, 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형을 포함할 수 있다. 핵산은 하나 이상의 부가적인 공유 결합된 잔기, 예를 들면, 단백질(예를 들어, 뉴클레아제, 독소, 항체, 시그널 펩타이드, 폴리-L-리신 등), 삽입제(예를 들어, 아크리딘, 프로랄렌 등), 킬레이트화제(예를 들어, 금속, 방사성 금속, 철, 산화성 금속 등) 및 알킬화제를 함유할 수 있다. The probe can be chemically synthesized using the phosphoramidite solid support method, or other well known methods. These primers can be modified using a number of means known in the art, as long as they exhibit an effect capable of detecting Rift Valley fever virus. Examples of such modifications include methylation, encapsulation, substitution of one or more homologs of natural nucleotides, and modifications between nucleotides, such as uncharged linkers (e.g., methyl phosphonate, phosphotriester, phosphoroamidate, Carbamate, etc.) or to a charged linker (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids may be one or more additional covalently linked moieties, such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalating agents (e.g., acridine , Proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents.
상기 프로브는 이의 5' 말단에 리포터가 추가로 더 접합될 수 있다. 상기 리포터는 FAM(6-carboxyfluorescein), 텍사스 레드(texas red), 플루오레신(fluorescein), HEX(2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein), 플루오레신 클로로트리아지닐(fluorescein chlorotriazinyl), 로다민 그린(rhodamine green), 로다민 레드(rhodamine red), 테트라메틸로다민(tetramethylrhodamine), FITC(fluorescein isothiocyanate), 오레곤 그린(oregon green), 알렉사 플루오로(alexa fluor), JOE(6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX(6-Carboxyl-X-Rhodamine), TET(Tetrachloro-Fluorescein), TRITC(tertramethylrodamine isothiocyanate), TAMRA(6-carboxytetramethyl-rhodamine), NED(N-(1-Naphthyl) ethylenediamine), 시아닌(Cyanine) 계열 염료 및 씨아디카르보시아닌(thiadicarbocyanine)으로 구성된 군으로부터 선택되는 어느 하나 이상일 수 있으나, 이외에 당업계에서 리포터로 사용될 수 있는 물질이라고 알려진 것이라면 모두 사용할 수 있다. 본 발명의 일 실시예에서, 상기 리포터는 FAM(6-carboxyfluorescein)일 수 있다. The probe may further have a reporter attached to its 5'end. The reporter is FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein, HEX (2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein) , Fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethylrhodamine, FITC (fluorescein isothiocyanate), oregon green, Alexa Fluoro (alexa fluor), JOE (6-Carboxy-4',5'-Dichloro-2',7'-Dimethoxyfluorescein), ROX (6-Carboxyl-X-Rhodamine), TET (Tetrachloro-Fluorescein), TRITC ( tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N-(1-Naphthyl) ethylenediamine), cyanine-based dyes, and thiadicarbocyanine. However, any other known material that can be used as a reporter in the art may be used. In an embodiment of the present invention, the reporter may be 6-carboxyfluorescein (FAM).
상기 프로브는 이의 3' 말단에 소광자가 추가로 더 접합될 수 있다. 상기 소광자는 TAMRA(6-carboxytetramethyl-rhodamine), BHQ1(black hole quencher 1), BHQ2(black hole quencher 2), BHQ3(black hole quencher 3), NFQ(nonfluorescent quencher), 답실(dabcyl), Eclipse, DDQ(Deep Dark Quencher), 블랙베리 퀸처(Blackberry Quencher), 아이오와 블랙(Iowa black)으로 구성된 군으로부터 선택되는 어느 하나 이상일 수 있으나, 이외에 당업계에서 소광자로 사용될 수 있는 물질이라고 알려진 것이라면 모두 사용할 수 있다. 본 발명의 일 실시예에서, 상기 소광자는 BHQ(black hole quencher) 1일 수 있다. The probe may be further conjugated to a quencher at its 3'end. The quencher is TAMRA (6-carboxytetramethyl-rhodamine), BHQ1 (black hole quencher 1), BHQ2 (black hole quencher 2), BHQ3 (black hole quencher 3), NFQ (nonfluorescent quencher), dabcyl, Eclipse, DDQ (Deep Dark Quencher), Blackberry Quencher (Blackberry Quencher), and may be any one or more selected from the group consisting of Iowa black (Iowa black), in addition to any one known as a material that can be used as a quencher in the art can be used. In an embodiment of the present invention, the quencher may be a black hole quencher (BHQ) 1.
상기 조성물에는 상기 프라이머 세트 및 프로브 이외에 역전사 중합효소, DNA 중합효소, Mg2+와 같은 조인자, dATP, dCTP, dGTP 및 dTTP가 포함될 수 있다. 역전사된 cDNA를 증폭하기 위하여 다양한 DNA 중합효소가 본 발명의 증폭 단계에 이용될 수 있으며, DNA 중합효소의 예로 E. coli DNA 중합효소 I의 클레나우 단편, 열안정성 DNA 중합효소 또는 박테리오파지 T7 DNA 중합효소가 있다. 중합효소는 박테리아 그 자체로부터 분리하거나 상업적으로 구입하거나 중합효소를 암호화하는 클로닝 유전자의 높은 레벨을 발현하는 세포로부터 수득할 수 있다. In addition to the primer set and probe, the composition may include reverse transcription polymerase, DNA polymerase, cofactors such as Mg2+, dATP, dCTP, dGTP, and dTTP. In order to amplify the reverse transcribed cDNA, various DNA polymerases can be used in the amplification step of the present invention. Examples of DNA polymerases include Klenow fragment of E. coli DNA polymerase I, thermostable DNA polymerase, or bacteriophage T7 DNA polymerization. There are enzymes. The polymerase can be isolated from the bacterium itself, purchased commercially, or obtained from cells expressing high levels of the cloning gene encoding the polymerase.
본 발명의 구체적인 실시예에서, 본 발명자들은 서열번호 1의 염기서열로 기재되는 정방향 프라이머, 서열번호 2의 염기서열로 기재되는 역방향 프라이머 및 서열번호 3의 염기서열로 기재되는 프로브를 제작하여 현재 보고되어 있는 리프트밸리열바이러스를 소형·신속 실시간 유전자 증폭 장치에서 짧은 시간 안에 한 번의 반응으로 리프트밸리열바이러스를 검출할 수 있고, 11.89 copies/reaction의 최소검출한계를 나타내어 민감도가 우수하며, 88개의 타균주와 교차반응이 없고, 검체 내 포함되어 검출 결과에 영향을 미칠 수 있는 간섭물질과의 간섭반응이 없으며, 재현성있는 결과를 나타내고, 365일 동안의 보관 안정성을 나타냄을 확인하였다(도 2 내지 도 6 참조).In a specific embodiment of the present invention, the present inventors produced a forward primer described with the nucleotide sequence of SEQ ID NO: 1, a reverse primer described with the nucleotide sequence of SEQ ID NO: 2, and a probe described with the nucleotide sequence of SEQ ID NO: 3, and are currently reported. The Rift Valley fever virus can be detected in a single reaction within a short period of time in a compact and fast real-time gene amplification device, and the sensitivity is excellent as it shows a minimum detection limit of 11.89 copies/reaction. It was confirmed that there is no cross-reaction with the strain, there is no interference reaction with interfering substances that may affect the detection result because it is contained in the sample, shows reproducible results, and shows storage stability for 365 days (Figs. 6).
따라서, 본 발명의 프라이머 세트 및 프로브는 리프트밸리열바이러스를 검출 및 진단하는 데 유용하게 사용될 수 있다. Therefore, the primer set and probe of the present invention can be usefully used to detect and diagnose Rift Valley fever virus.
또한, 본 발명은 본 발명의 조성물을 포함하는 리프트밸리열바이러스 검출용 키트를 제공한다. In addition, the present invention provides a kit for detecting Rift Valley fever virus comprising the composition of the present invention.
상기 조성물은 상술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 조성물은 서열번호 1의 염기서열로 기재되는 정방향 프라이머 및 서열번호 2의 염기서열로 기재되는 역방향 프라이머로 이루어진 리프트밸리열바이러스 검출용 프라이머 세트를 포함하는 것일 수 있다. 또한, 상기 조성물은 서열번호 3의 염기서열로 기재되는 프로브를 더 포함할 수 있다. 상기 프로브는 이의 5' 말단에 리포터가 추가로 더 접합될 수 있다. 또한, 상기 프로브는 이의 3' 말단에 소광자(quencher)가 추가로 더 접합될 수 있다. The composition may have the characteristics as described above. As an example, the composition may include a primer set for detecting a Rift Valley fever virus comprising a forward primer described in the nucleotide sequence of SEQ ID NO: 1 and a reverse primer described in the nucleotide sequence of SEQ ID NO: 2. In addition, the composition may further include a probe described in the nucleotide sequence of SEQ ID NO: 3. The probe may further have a reporter attached to its 5'end. In addition, a quencher may be further bonded to the 3'end of the probe.
상기 키트는 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성 성분 조성물, 용액 또는 장치를 더 포함할 수 있다. 상기 키트는 리프트밸리열바이러스의 특정 영역에 대한 특이적인 프라이머 세트 이외에도 리프트밸리열바이러스 RNA로부터 상보적인 cDNA를 합성하기 위한 역전사 효소, 상보적인 DNA를 증폭하기 위한 DNA 중합효소, 튜브 또는 다른 적절한 컨테이너, 반응 완충액(pH 및 마그네슘 농도는 다양), 데옥시뉴클레오티드(dNTPs), hot-start Taq-폴리머라제 및 역전사 효소와 같은 효소, DNase, RNase 억제제, DEPC-물(DEPC-water) 및 멸균수 등을 포함할 수 있다. 한편, 키트에 포함되는 성분들은 액상 형태로 제조될 수도 있고, 포함 성분들의 자유도를 낮추어 제품의 안정성을 제고하기 위해 건조된 형태로 제조될 수도 있다. 이러한 건조된 형태로의 제조를 위해서는 건조 단계의 적용이 필요하고, 이 때 가온건조, 자연건조, 감압건조, 동결건조 또는 이들의 복합 공정이 사용될 수 있다. The kit may further include one or more other component compositions, solutions or devices suitable for the assay method. The kit includes reverse transcriptase for synthesizing complementary cDNA from Rift Valley fever virus RNA, DNA polymerase for amplifying complementary DNA, tube or other suitable container, in addition to a set of primers specific for a specific region of Rift Valley fever virus, Reaction buffer (varies in pH and magnesium concentration), deoxynucleotides (dNTPs), enzymes such as hot-start Taq-polymerase and reverse transcriptase, DNase, RNase inhibitor, DEPC-water and sterile water, etc. Can include. Meanwhile, the ingredients included in the kit may be prepared in a liquid form, or may be prepared in a dried form to improve product stability by lowering the degree of freedom of the included ingredients. In order to manufacture such a dried form, it is necessary to apply a drying step, and in this case, heated drying, natural drying, vacuum drying, freeze drying, or a complex process thereof may be used.
또한, 본 발명은 검체로부터 분리된 핵산을 주형으로 본 발명의 프라이머 세트를 이용하여 중합효소 연쇄반응(polymerase chain reaction, PCR)을 수행하는 단계를 포함하는 리프트밸리열바이러스를 검출하는 방법을 제공한다.In addition, the present invention provides a method of detecting a Rift Valley fever virus comprising the step of performing a polymerase chain reaction (PCR) using the primer set of the present invention using the nucleic acid isolated from the specimen as a template. .
상기 검체는 임상시료 또는 환경시료로부터 수득되는 것일 수 있다. 예를 들어, 임상시료는 조직, 세포, 전혈, 혈청, 혈장, 타액, 객담, 뇌척수액 또는 뇨로부터 수득되는 시료일 수 있다. The specimen may be obtained from a clinical sample or an environmental sample. For example, the clinical sample may be a sample obtained from tissue, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, or urine.
상기 프라이머 세트는 상술한 바와 같은 특징을 가질 수 있다. 일례로, 상기 프라이머 세트는 리프트밸리열바이러스의 segment S 영역을 증폭하는 것일 수 있다. 또한, 상기 프라이머 세트는 상기 segment S 영역의 유전자에 상보적으로 결합 가능한 10 내지 40개, 구체적으로 15 내지 30개의 염기서열로 이루어진 정방향 또는 역방향 프라이머일 수 있다. 본 발명의 일 실시예에서, 상기 프라이머 세트는 서열번호 1의 염기서열로 기재되는 정방향 프라이머 및 서열번호 2의 염기서열로 기재되는 역방향 프라이머로 이루어진 것일 수 있다. The primer set may have the characteristics as described above. As an example, the primer set may be to amplify the segment S region of the Rift Valley fever virus. In addition, the primer set may be a forward or reverse primer consisting of 10 to 40, specifically 15 to 30 nucleotide sequences capable of complementarily binding to the gene of the segment S region. In one embodiment of the present invention, the primer set may be composed of a forward primer described with the nucleotide sequence of SEQ ID NO: 1 and a reverse primer described with the nucleotide sequence of SEQ ID NO: 2.
이하, 본 발명을 하기 실시예에 의해 상세히 설명한다. Hereinafter, the present invention will be described in detail by the following examples.
단, 하기 실시예는 본 발명을 예시하기 위한 것일 뿐, 본 발명이 이들에 의해 제한되는 것은 아니다.However, the following examples are for illustrative purposes only, and the present invention is not limited thereto.
<실시예 1> 리프트밸리열바이러스를 검출할 수 있는 프라이머 및 프로브 제작<Example 1> Preparation of primers and probes capable of detecting Rift Valley fever virus
리프트밸리열바이러스를 검출할 수 있는 현장 검출용(Point-Of Care-Testing, POCT) 프라이머 및 프로브 세트와 실험실 검출용 프라이머 및 프로브 세트를 제작하였다. A set of primers and probes for field detection (Point-Of Care-Testing, POCT) capable of detecting Rift Valley fever virus and a set of primers and probes for laboratory detection were prepared.
리프트밸리열바이러스 균주를 탐색한 후 미국국립생물정보센터(NCBI, https://www.ncbi.nlm.nih.gov/)에서 19개의 리프트밸리열바이러스 균주들의 염기서열을 수집하였다(표 1). 수집된 염기서열을 이용하여 유전자를 정렬(alignment)하였고, segment S를 표적 유전자로 하여 리프트밸리열바이러스를 검출할 수 있는 프라이머 및 프로브를 제작하였다(도 1 및 표 2). 프로브의 5' 말단에는 리포터 FAM(6-carboxyfluorescein)를 결합시켰으며, 3' 말단에는 소광자 BHQ(black hole quencher) 1를 결합시켰다. After searching for Rift Valley fever virus strains, the nucleotide sequences of 19 Rift Valley fever virus strains were collected at the National Center for Biological Information (NCBI, https://www.ncbi.nlm.nih.gov/) (Table 1). . Genes were aligned using the collected nucleotide sequences, and primers and probes capable of detecting Rift Valley fever virus were prepared using segment S as a target gene (FIG. 1 and Table 2). Reporter FAM (6-carboxyfluorescein) was bound to the 5'end of the probe, and quencher BHQ (black hole quencher) 1 was bound to the 3'end.
유전자Target
gene
Primer or probe
프라이머Forward direction
primer
(서열번호 1)TTCTCATGGCTTATAAAGTTGCTA
(SEQ ID NO: 1)
프라이머Reverse
primer
(서열번호 2)CAAACCTCCGAGGyAGAACA
(SEQ ID NO: 2)
(서열번호 3)ACTGCTGCATTCATTGGCTGCGT
(SEQ ID NO: 3)
<실험예 1> 프라이머 및 프로브 세트의 리프트밸리열바이러스의 검출 능력 평가<Experimental Example 1> Evaluation of detection ability of Rift Valley fever virus of primer and probe set
<1-1> 검출한계 평가<1-1> Detection limit evaluation
실시예 1에서 제조한 리프트밸리열바이러스의 현장 검출용 프라이머 및 프로브 세트를 이용하여 PCR 수행 시, 프라이머 및 프로브 세트의 최소검출한계(limit of detection, LoD)를 분석하고자 하였다. When performing PCR using the primer and probe set for field detection of the Rift Valley fever virus prepared in Example 1, it was intended to analyze the limit of detection (LoD) of the primer and probe set.
구체적으로, 표 1에 기재된 리프트밸리열바이러스 균주의 공통 영역을 타겟(target)으로 설정한 후, 정제된 DNA를 이용하여 시험관 내 전사(in vitro transcription(T7))를 진행하여 RNA 유전자를 합성하였다. 150, 75, 37.5, 18.75, 9.375 및 4.688 copies/reaction 농도의 리프트밸리열이러스의 합성된 RNA 3 ㎕, 2x 마스터 믹스(Master mix) 5 ㎕, 프라이머 프로브 믹스(primer probe mix) 1 ㎕ 및 PCR이 잘 수행되었는지 확인하는 내부 양성 대조군(Internal positive control) 1 ㎕을 혼합한 후, 하기 표 3과 같은 반응 조건으로 실시간 RT-PCR의 반응을 수행하였다(UltraFast LabChip real-time PCR G2-4). 동일한 조건으로 30회 반복실험을 수행하여 Ct(cycle threshold)값 및 검출률을 측정하였고, 95% 양성구간을 통계프로그램(IBM SPSS Statistics, IBM)을 이용하여 프로빗(probit) 회귀모델로 검증하였다. 최소검출한계는 식품의약품안전처의 <체외진단용 의료기기 허가심사 가이드라인>에서 제시한 정의대로 '표준물질을 이용하여 95% 검출률을 보이는 최저 농도'로 계산하였다.Specifically, after setting the common region of the Rift Valley fever virus strain described in Table 1 as a target, in vitro transcription (T7) was performed using purified DNA to synthesize an RNA gene. . 150, 75, 37.5, 18.75, 9.375 and 4.688 copies/reaction concentration of Rift Valley pylori synthesized
그 결과, 도 2에 나타낸 바와 같이, 합성된 타겟 RNA 유전자(Target으로 표기)의 농도가 높을수록 Ct 값은 낮아졌으며, 리프트밸리열바이러스 segment S를 타겟으로 하는 프라이머 및 프로브 세트는 11.89 copies/reaction의 최소검출한계를 나타내, 민감도가 우수함을 알 수 있었다(도 2). As a result, as shown in Figure 2, the higher the concentration of the synthesized target RNA gene (denoted as Target), the lower the Ct value, and the primer and probe set targeting the Rift Valley fever virus segment S was 11.89 copies/reaction. Shows the minimum detection limit of, it was found that the sensitivity is excellent (Fig. 2).
(*기계 상에서 결과값을 읽는 시간까지 포함된 총 소요시간)( * Total time required including reading time on the machine)
<1-2> 타균주 유전자와의 교차반응 시험을 통한 특이도 평가<1-2> Specificity evaluation through cross-reaction test with other strain genes
실시예 1에서 제조한 리프트밸리열바이러스의 현장 검출용 프라이머 및 프로브 세트를 이용하여 PCR 수행 시, 프라이머 및 프로브 세트의 특이도를 평가하고자 타균주와의 교차반응 시험을 수행하였다. 리프트밸리열 바이러스는 BL3 항목의 고위험군 물질이므로 국내 반입이 불가능해 불가피하게 제외하였으며, 리프트밸리열 바이러스 대신 합성한 양성 대조군으로 검출여부를 확인하였다. When performing PCR using the primer and probe set for field detection of the Rift Valley fever virus prepared in Example 1, a cross-reaction test with other strains was performed to evaluate the specificity of the primer and probe set. Since Lift Valley Fever virus is a high-risk substance in the BL3 category, it was inevitably excluded because it was impossible to bring it into Korea. The detection was confirmed with a positive control synthesized instead of Lift Valley Fever virus.
구체적으로, 총 88개의 균주 유전자(도 3에서 '굵게'로 표시) 및 질병관리본부에서 제공받은 전사체(transcript, 도 3에서 '밑줄'로 표시)를 이용한 교차반응 시험을 수행하였다. 사용한 균주들 중 바이러스는 104 copies/㎕의 농도로 적용하였고, 나머지 균주들은 1 ng/㎕의 농도로 적용하였다. 리프트밸리열바이러스 RNA 대신 동량의 상기 병원체 유전자 및 전사체를 사용한 것을 제외하고는 상기 실험예 1-1에 기재된 것과 동일한 방법으로 실시간 RT-PCR을 수행하였다.Specifically, a cross-reaction test was performed using a total of 88 strain genes (indicated in'bold' in Fig. 3) and a transcript (indicated by'underline' in Fig. 3) provided by the Centers for Disease Control and Prevention. Among the strains used, the virus was applied at a concentration of 10 4 copies/µl, and the remaining strains were applied at a concentration of 1 ng/µl. Real-time RT-PCR was performed in the same manner as described in Experimental Example 1-1, except that the same amount of the pathogen gene and transcript were used instead of Rift Valley fever virus RNA.
그 결과, 실시예 1에서 제조한 프라이머 및 프로브 세트는 88개의 타균주와의 교차반응이 나타나지 않았다(도 3). As a result, the primer and probe set prepared in Example 1 did not show cross-reaction with 88 other strains (FIG. 3).
<1-3> 간섭물질과의 간섭반응 시험을 통한 특이도 평가<1-3> Evaluation of specificity through interference reaction test with interfering substances
실시예 1에서 제조한 리프트밸리열바이러스의 현장 검출용 프라이머 및 프로브 세트를 이용하여 PCR 수행 시, 프라이머 및 프로브 세트의 특이도를 평가하고자 검체 내 포함되어 실험에 영향을 미칠 수 있는 간섭물질과의 간섭반응을 확인하였다. When performing PCR using the primer and probe set for field detection of the Rift Valley fever virus prepared in Example 1, to evaluate the specificity of the primer and probe set, it was included in the sample and interfering with interfering substances that may affect the experiment. The interference reaction was confirmed.
구체적으로, 간섭물질은 <CLSI 가이드라인>의 'EP7-A2'를 참고하여 헤모글로빈, IgG, 헤파린, EDTA 및 시트르산 나트륨(Na-citrate)으로 선정하였고, 간섭물질을 포함 또는 간섭물질을 포함하지 않은 시료를 이용하여 실험예 1-1에 기재된 것과 동일한 방법으로 실시간 RT-PCR을 수행하였으며, 간섭물질을 포함하지 않은 양성대조군과의 Ct 값 차이(Ct difference)를 산출하였다. 이 때, 리프트밸리열바이러스로부터 합성한 RNA는 최소검출한계(11.89 copies/reaction)의 25배 또는 100배의 농도로 첨가하였으며, 각 간섭물질은 1 mg/㎖의 헤모글로빈(hemoglobin), 12.5 ㎍/㎖의 면역글로불린 G(immunoglobulin G, IgG), 0.1 mg/㎖의 헤파린(heparin), 4 mM의 EDTA(ethylenediaminetetraacetic acid) 또는 20 mM의 시트르산나트륨(Na-citrate)의 농도로 첨가하였다. Specifically, the interfering substances were selected as hemoglobin, IgG, heparin, EDTA, and sodium citrate (Na-citrate), referring to'EP7-A2' of the <CLSI Guidelines>, and containing or not containing interfering substances. Real-time RT-PCR was performed using the sample in the same manner as described in Experimental Example 1-1, and the Ct value difference (Ct difference) from the positive control group that did not contain an interference substance was calculated. At this time, RNA synthesized from Rift Valley fever virus was added at a concentration of 25 or 100 times the minimum detection limit (11.89 copies/reaction), and each interfering substance was 1 mg/ml hemoglobin, 12.5 μg/ It was added at a concentration of immunoglobulin G (IgG), 0.1 mg/ml heparin, 4 mM ethylenediaminetetraacetic acid (EDTA), or 20 mM sodium citrate.
그 결과, 5종의 간섭물질에 따른 Ct 값의 차이는 미미하므로, 실시예 1에서 제조한 프라이머 및 프로브 세트는 간섭물질로 작용하는 헤모글로빈, IgG, 헤파린, EDTA 또는 시트르산 나트륨(Na-citrate)과 간섭반응이 나타나지 않음을 확인하였다(도 4). As a result, since the difference in Ct values according to the five interfering substances is insignificant, the primer and probe set prepared in Example 1 were hemoglobin, IgG, heparin, EDTA, or sodium citrate (Na-citrate) acting as interfering substances It was confirmed that no interference reaction appeared (FIG. 4).
<1-4> 재현성 평가<1-4> Reproducibility evaluation
실시예 1에서 제조한 리프트밸리열바이러스의 현장 검출용 프라이머 및 프로브 세트를 이용하여 PCR 수행 시, 프라이머 및 프로브 세트의 재현성을 평가하고자 하였다. When performing PCR using the primer and probe set for field detection of the Rift Valley fever virus prepared in Example 1, the reproducibility of the primer and probe set was evaluated.
구체적으로, 리프트밸리열바이러스로부터 합성한 RNA를 최소검출한계(11.89 copies/reaction)의 5배, 25배 또는 100배의 농도로 반응시킨 것을 제외하고는 5일 동안 하루에 2회씩 반복하여 실험예 1-1에 기재된 것과 동일한 방법으로 실시간 RT-PCR을 수행하였으며, 측정한 Ct값의 평균, 표준편차 및 CV(coefficient of variation, 평균 대비 표준편차의 비율) 값을 산출하였다. 음성 대조군은 리프트밸리열바이러스의 합성 RNA를 포함하지 않은 시료이다.Specifically, except for reacting RNA synthesized from Rift Valley fever virus at a concentration of 5, 25 or 100 times the minimum detection limit (11.89 copies/reaction), it was repeated twice a day for 5 days. Real-time RT-PCR was performed in the same manner as described in 1-1, and the average, standard deviation, and coefficient of variation (CV) of the measured Ct values were calculated. The negative control was a sample that did not contain synthetic RNA of Rift Valley fever virus.
그 결과, 10번의 반복실험에 따른 CV 값이 0.02% 이하로 나타나, 실시예 1에서 제조한 프라이머 및 프로브 세트는 재현성있는 결과를 나타냄을 확인하였다(도 5).As a result, it was confirmed that the CV value according to the 10 replicate experiments was 0.02% or less, and the primer and probe set prepared in Example 1 showed reproducible results (FIG. 5).
<1-5> 보관 안정성 평가<1-5> Storage stability evaluation
실시예 1에서 제조한 리프트밸리열바이러스의 현장 검출용 프라이머 및 프로브 세트의 보관 안정성을 평가하고자, <식품의약품안전처 고시 제2014-178호>에 제시된 의료기기의 안정성 시험기준에 따른 가속노화실험을 통하여 조사하였다.Accelerated aging experiment according to the stability test standard of medical devices as set forth in <Ministry of Food and Drug Safety Notice No. It was investigated through.
구체적으로, 하기 계산식 1을 이용하여 가속노화계수(AAF)를 산출하고, 계산식 2를 이용하여 가속노화시간(AAT)을 산출하였다. Specifically, the accelerated aging coefficient (AAF) was calculated using the following
[계산식 1][Calculation 1]
AAF = Q10 |(TAA-TRT)/10| AAF = Q 10 |(TAA-TRT)/10|
Q10: 온도 10℃ 상승 또는 감소 시 노화계수, 2Q 10 : Aging coefficient when temperature rises or decreases by 10℃, 2
TAA: 가속노화온도, 45℃TAA: accelerated aging temperature, 45℃
TRT: 제품 보관온도, -20℃TRT: Product storage temperature, -20℃
[계산식 2][Calculation 2]
AAT = 설정된 유효기간 / AAFAAT = Set validity period / AAF
설정된 유효기간: 365일Set validity period: 365 days
AAF: 90.51 (계산식 1로부터 도출된 가속노화계수)AAF: 90.51 (accelerated aging coefficient derived from equation 1)
산출된 조건에 따라 4일간 45℃에서 상기 실시예 1에서 제작한 프라이머 및 프로브 세트를 세 가지 농도(최소검출한계 11.89 copies/reaction의 5X, 25X 또는 100X)로 보관하고, 0, 3, 6, 9 또는 12개월째에 상기 실험예 1-1에 기재된 것과 동일한 방법으로 실시간 RT-PCR을 수행하였으며, 0일차의 Ct 값과 비교하여 Ct 값 차이(Ct difference)를 산출하였다. 양성 대조군으로는 리프트밸리열바이러스의 특정 서열로 이루어진 플라스미드 DNA를 이용하였고, 음성 대조군으로는 리프트밸리열바이러스 서열을 갖는 양성 대조군 또는 전사체 RNA가 포함되지 않은 시료를 이용하였다. Depending on the calculated conditions, the primer and probe set prepared in Example 1 were stored at 45° C. for 4 days at three concentrations (minimum detection limit of 11.89 copies/reaction of 5X, 25X or 100X), and 0, 3, 6, At 9 or 12 months, real-time RT-PCR was performed in the same manner as described in Experimental Example 1-1, and the Ct value difference (Ct difference) was calculated by comparing it with the Ct value of
그 결과, 실시예 1에서 제조한 프라이머 및 프로브 세트는 ±1 이내의 Ct 값을 나타냈으며, 통상적으로 대조군과의 Ct값 차이가 ±2범위 내에 있는 경우 안정한 것으로 판단하므로, 65일 동안의 보관 안정성을 갖는 것으로 확인되었다(도 6).As a result, the primer and probe set prepared in Example 1 showed a Ct value within ±1, and it is generally determined that the Ct value difference from the control group is within the range of ±2, so storage stability for 65 days It was confirmed to have (Fig. 6).
<110> Korea Centers for Disease Control and Prevention
MICOBIOMED CO., LTD.
<120> Primer set for detecting rift valley virus and uses thereof
<130> 2018P-07-009
<160> 3
<170> KoPatentIn 3.0
<210> 1
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> RVFV-S1-F
<400> 1
ttctcatggc ttataaagtt gcta 24
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> RVFV-S1-R
<400> 2
caaacctccg aggyagaaca 20
<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> RVFV-S1-P
<400> 3
actgctgcat tcattggctg cgt 23
<110> Korea Centers for Disease Control and Prevention
MICOBIOMED CO., LTD.
<120> Primer set for detecting rift valley virus and uses thereof
<130> 2018P-07-009
<160> 3
<170> KoPatentIn 3.0
<210> 1
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> RVFV-S1-F
<400> 1
ttctcatggc ttataaagtt gcta 24
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> RVFV-S1-R
<400> 2
caaacctccg aggyagaaca 20
<210> 3
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> RVFV-S1-P
<400> 3
Claims (9)
A forward primer described in SEQ ID NO: 1; A reverse primer described by the nucleotide sequence of SEQ ID NO: 2; And a lift valley virus detection composition consisting of a probe described in SEQ ID NO: 3.
According to claim 1, wherein the probe is a reporter is further conjugated to the 5 'end, Rift Valley fever virus detection composition.
According to claim 1, wherein the probe is a quencher is further conjugated to the 3 'end, the composition for detecting the Rift Valley fever virus.
According to claim 2, The reporter is FAM (6-carboxyfluorescein), Texas red (texas red), fluorescein (fluorescein), HEX (2 ', 4', 5 ', 7'-tetrachloro-6-carboxy- 4,7-dichlorofluorescein, fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethylrhodamine, FITC (fluorescein isothiocyanate), Oregon Green (oregon green), Alexa fluor, JOE (6-Carboxy-4 ', 5'-Dichloro-2', 7'-Dimethoxyfluorescein), ROX (6-Carboxyl-X-Rhodamine), TET (Tetrachloro -Fluorescein, TRITC (tertramethylrodamine isothiocyanate), TAMRA (6-carboxytetramethyl-rhodamine), NED (N- (1-Naphthyl) ethylenediamine), cyanine-based dye and thiadicarbocyanine Any one selected, a composition for the detection of Rift Valley fever virus.
The method according to claim 3, wherein the quencher is TAMRA (6-carboxytetramethyl-rhodamine), BHQ1 (black hole quencher 1), BHQ2 (black hole quencher 2), BHQ3 (black hole quencher 3), NFQ (nonfluorescent quencher), dabsil ( dabcyl), Eclipse, DDQ (Deep Dark Quencher), Blackberry Quencher (Blackberry Quencher), Iowa Black (Iowa black) any one selected from the group consisting of, the composition for detecting the Rift Valley fever virus.
Kit for detecting a Rift Valley fever virus comprising the composition of claim 1.
2) 상기 검체로부터 분리한 핵산을 주형으로 제1항의 조성물을 이용하여 중합 효소 연쇄반응(polymerase chain reaction, PCR)을 수행하여 표적서열을 증폭하는 단계; 및
3) 상기 단계 2)의 증폭산물을 형광측정을 통해 검출하는 단계; 를 포함하는 리프트밸리열 바이러스를 검출하는 방법.
1) separating the nucleic acid from the sample;
2) amplifying a target sequence by performing a polymerase chain reaction (PCR) using the composition of claim 1 as a template for the nucleic acid isolated from the sample; And
3) detecting the amplification product of step 2) through fluorescence measurement; Method for detecting a lift valley fever virus comprising a.
The method of claim 7, wherein the sample is obtained from a clinical sample or an environmental sample.
The method of claim 7, wherein the method of detecting the Rift Valley fever virus indicates a minimum detection limit of 10 to 20 copies / reaction.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020200009943A KR102149373B1 (en) | 2020-01-28 | 2020-01-28 | Primer set for detecting rift valley virus and uses thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020200009943A KR102149373B1 (en) | 2020-01-28 | 2020-01-28 | Primer set for detecting rift valley virus and uses thereof |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020180140005 Division | 2018-11-14 |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20200056352A true KR20200056352A (en) | 2020-05-22 |
KR102149373B1 KR102149373B1 (en) | 2020-08-31 |
Family
ID=70914235
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020200009943A KR102149373B1 (en) | 2020-01-28 | 2020-01-28 | Primer set for detecting rift valley virus and uses thereof |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR102149373B1 (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20230138279A (en) | 2022-03-23 | 2023-10-05 | 한국표준과학연구원 | Rift valley fever virus universal primer sets for whole genome amplification method and diagnosis kit |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101742470B1 (en) * | 2015-04-21 | 2017-06-15 | 대한민국 | Method for Differentiating between Rift Valley Fever Virus and its Vaccine(Clone 13), and Primer Set and Probe Used for the Differentiation |
-
2020
- 2020-01-28 KR KR1020200009943A patent/KR102149373B1/en active IP Right Grant
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR101742470B1 (en) * | 2015-04-21 | 2017-06-15 | 대한민국 | Method for Differentiating between Rift Valley Fever Virus and its Vaccine(Clone 13), and Primer Set and Probe Used for the Differentiation |
Also Published As
Publication number | Publication date |
---|---|
KR102149373B1 (en) | 2020-08-31 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR102231338B1 (en) | Primers and probes for detection of avian influenza, newcastle disease and avian infectious bronchitis viruses, and detecting method of avian influenza, newcastle disease and avian infectious bronchitis viruses using the same | |
KR20190041237A (en) | Oligonucleotide set for detection of dengue virus and uses thereof | |
KR20220024254A (en) | High sensitive multiplex loop-mediated isothermal amplification primer set for detection of novel coronavirus-19 | |
KR101857684B1 (en) | Primers and probe for detection of middle east respiratory syndrome coronavirus and detecting method for middle east respiratory syndrome coronavirus using the same | |
KR102207965B1 (en) | Primers and probes for detection of Hantaan virus and Seoul virus and detecting method for Hantaan virus and Seoul virus using the same | |
KR102149373B1 (en) | Primer set for detecting rift valley virus and uses thereof | |
KR102388060B1 (en) | Composition for distinguishing between Mycobacterium tuberculosis and Beijing family Mycobacterium tuberculosis and method for detecting Mycobacterium tuberculosis using the same | |
KR102252750B1 (en) | Primer and probe sets for diagnosing african swine fever virus and uses thereof | |
KR102189593B1 (en) | Primer set for detecting yellow fever virus and uses thereof | |
KR102149396B1 (en) | Primer set for detecting hantaan virus and uses thereof | |
KR102143071B1 (en) | Primer set for detecting hantaan virus and uses thereof | |
KR20210073220A (en) | Primer and probe sets for simultaneous detecting severe fever with thrombocytopenia syndrome and orientia tsutsugamushi | |
KR20210103109A (en) | Primer and probe sets for detecting subjects causing febrile disease, kit comprising the same and detecting method using the same | |
KR102284243B1 (en) | Primers and probes for simultaneous detection of nipah and hendra viruses and detecting method for nipah and hendra viruses using the same | |
KR102189576B1 (en) | Primers and probes for simultaneous detection of subtypes of Ebola virus and detecting method for ebola virus using the same | |
KR102284248B1 (en) | Primers and probes for detection of nipah virus and detecting method for nipah virus using the same | |
KR102142134B1 (en) | Primers and probes for differentiation between Rabies virus and vaccine strains and differentiating method between Rabies virus and vaccine strains using the same | |
KR102189581B1 (en) | Primers and probes for simultaneous detection of lineage of lassa virus and detecting method for lassa virus using the same | |
KR102189587B1 (en) | Primers and probes for simultaneous detection of subtypes of Marburg virus and detecting method for Marburg virus using the same | |
KR102453357B1 (en) | Primer set for multiplex loop-mediated isothermal amplification reaction for detection and identification of Candida albicans, Candida auris and Candida glabrata using fluorescent probe | |
KR102516022B1 (en) | Detection and Differentiation of African Swine Fever Virus and Classical Swine Fever Virus by One Step Duplex Reverse Transcriptase Quantitative PCR Assay | |
KR102421844B1 (en) | Novel Marker for diagnosis of Sars coronavirus2 infection and use thereof | |
KR102172810B1 (en) | A composition for simultaneous detecting of H5 highly pathogenic avian influenza virus clades and uses thereof | |
KR102435209B1 (en) | Composition for simultaneously distinguishing and detecting influenza type A and type B viruses and type 2 severe acute respiratory syndrome coronavirus and detection method using the same | |
KR102572368B1 (en) | Primer set for detection and identification of parainfluenza virus type 1 and type 3 and use thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant |