KR20210073220A - Primer and probe sets for simultaneous detecting severe fever with thrombocytopenia syndrome and orientia tsutsugamushi - Google Patents

Abstract

The present application provides a primer and probe set for simultaneous detection of severe fever with thrombocytopenia syndrome and tsutsugamushi, and thus, there are effects of detecting SFTS virus and orientia tsutsugamushi quickly and accurately at the same time. In addition, the specificity and sensitivity are high, so that clinical diagnosis can be made accurately and easily.

Description

Primer and probe set for simultaneous detection of severe febrile thrombocytopenia syndrome and tsutsugamushi {PRIMER AND PROBE SETS FOR SIMULTANEOUS DETECTING SEVERE FEVER WITH THROMBOCYTOPENIA SYNDROME AND ORIENTIA TSUTSUGAMUSHI}

The present application relates to a primer and probe set for diagnosing severe fever with thrombocytopenia syndrome and tsutsugamushi.

Severe fever with thrombocytopenia syndrome (SFTS) is an infectious disease caused by severe fever with thrombocytopenia syndrome (SFTS). to be. A putative vector for this is known as the small tick (Haemophysalis longicornis), and it has been reported that SFTS virus infection appears in mammals such as cattle, goats, sheep, monkeys, pigs, deer, cats, and mice as well as humans.

In addition, severe fever with thrombocytopenia syndrome virus (SFTS virus) that causes SFTS belongs to the Bunyavirus family (Bunyaviridae family), and is an RNA virus isolated and reported for the first time in China in 2009. The SFTS virus has a spherical virus shape with a diameter of 80 to 100 nm, and has a single-stranded RNA genome composed of a total of three segments. The fragments include an S fragment with a total length of 1744 bp (encoding a nucleocapsid protein, a nonstructural protein), an M fragment with a total length of 3378 bp (encoding two glycoproteins), and an L fragment with a total length of 6368 bp (RNA-dependent) which encodes an RNA synthetase).

Tsutsugamushi disease is an acute febrile disease transmitted by the bite of Trombiculidae larvae infected by Orientia tsutsugamushi, and shows characteristic clinical features due to systemic vasculitis. The main host is rodents, and mites are both hosts and carriers.

Since it was first reported in Korea in 1951 as a major autumn febrile disease, it has occurred all over Korea and has occurred between September and November. In particular, 30% of patients who occur in autumn in Korea are diagnosed with Tsutsugamushi disease. patient is occurring.

Since SFTS and tsutsugamushi have similar symptoms, it is necessary to diagnose which of the two diseases is different. However, a technology for detecting both diseases at the same time has not been revealed.

Currently, the diagnosis of SFTS mainly uses a method using real-time polymerase chain reaction (real time PCR), and the indirect immunofluorescence antibody method and immunoenzyme measurement method are most widely used for the diagnosis of tsutsugamushi. These two methods have the advantage of being able to differentiate between initial infection and re-infection with high sensitivity and specificity, and are currently preferred methods recommended by the WHO.

The indirect immunofluorescence antibody test requires a facility capable of tissue culture or egg hatching to obtain the necessary antigen, and has the disadvantage that it can only be tested in a laboratory equipped with a fluorescence microscope. In addition, immunoenzyme assays have the disadvantage that they often show false-positives. In addition, all of these methods used for serological diagnosis require a large amount of antigen, so culture of the bacteria to obtain the necessary antigen is absolutely necessary, and there are also disadvantages in that it is helpful for diagnosis only in the early stage of the onset. These conventional inspection methods have a problem in that the inspection process is complicated and the inspection takes a lot of time, requires a precision instrument to process the sample and reads the result, and also requires highly skilled professional technology.

Therefore, it is necessary to develop new primers and probes that have high sensitivity and specificity and are easy to diagnose, and a detection method that can make quick judgments.

The primer and probe set according to the present application has been devised to solve the conventional problems as described above, and an object of the present application is to provide a primer and probe set capable of simultaneously detecting severe fever with thrombocytopenia syndrome and tsutsugamushi.

The present application provides a first primer and probe set comprising a primer set of SEQ ID NO: 1 to 2 and a probe of SEQ ID NO: 3; and a second primer and probe set comprising a primer set of SEQ ID NOs: 7 to 8 and a probe of SEQ ID NO: 9; To provide a primer and probe set for simultaneous detection of severe fever with Thrombocytopenia Syndrome (SFTS) and tsutsugamushi, including

The present application is to provide a composition for simultaneous detection of severe fever with thrombocytopenia syndrome and tsutsugamushi, including the primer and probe set.

The present application intends to provide a kit for simultaneous detection of severe fever with thrombocytopenia syndrome and tsutsugamosis, including a composition for simultaneous detection of severe fever with thrombocytopenia syndrome and tsutsugamosis.

The present application relates to (a) obtaining genomic DNA containing Orientia tsutsugamushi from a biological sample containing Orientia tsutsugamushi, and RNA transcriptome containing SFTS virus from a biological sample containing SFTS virus. ) to obtain; (b) using the nucleic acid obtained in step (a) as a template and amplifying the target sequence by performing an amplification reaction with the primer and probe sets; and (c) detecting the amplification product obtained in step (b); It provides a test method for simultaneous detection of severe febrile thrombocytopenia syndrome and tsutsugamushi comprising a.

In order to solve the above problems, one embodiment of the present application provides a first primer and probe set comprising a primer set of SEQ ID NO: 1 to 2 and a probe of SEQ ID NO: 3; and a second primer and probe set comprising a primer set of SEQ ID NOs: 7 to 8 and a probe of SEQ ID NO: 9; It provides a primer and probe set for simultaneous detection of severe fever with Thrombocytopenia Syndrome (SFTS) and tsutsugamushi (Orientia tsutsugamushi) comprising a.

In one embodiment of the present application, the first primer and probe set may be complementary to the S segment (small segment, S segment) of the SFTS virus.

In one embodiment of the present application, the second primer and probe set may complementarily bind to the htrA gene of Orientia tsutsugamushi.

In one embodiment of the present application, the primer and probe set may be a primer and probe set for real time reverse transcription polymerase chain reaction (real time RT-PCR).

In one embodiment of the present application, the detection limit of the first primer and probe set may be 2 to 5 Copy number/ul.

In one embodiment of the present application, the detection limit of the second primer and probe set may be 10 to 16 Copy number/ul.

One embodiment of the present application provides a composition for simultaneous detection of severe fever with thrombocytopenia syndrome and tsutsugamushi, including the primer and probe set.

In one embodiment of the present application, the composition, PCR premix; a mixed solution of the primer and probe set; and Internal positive control (IPC); may include.

One embodiment of the present application provides a kit for simultaneous detection of severe fever with thrombocytopenia syndrome and tsutsugamosis, comprising the composition for simultaneous detection of severe fever with thrombocytopenia syndrome and tsutsugamosis.

One embodiment of the present application is (a) obtaining genomic DNA containing Orientia tsutsugamushi from a biological sample containing Orientia tsutsugamushi, and SFTS virus containing SFTS virus from a biological sample containing SFTS virus. obtaining an RNA transcriptome; (b) using the nucleic acid obtained in step (a) as a template and amplifying the target sequence by performing an amplification reaction with the primer and probe sets; and (c) detecting the amplification product obtained in step (b); It provides a test method for simultaneous detection of severe febrile thrombocytopenia syndrome and tsutsugamushi comprising a.

The primer and probe set for simultaneous detection of severe febrile thrombocytopenia syndrome and tsutsugamushi according to the present application has the advantage of being able to rapidly and accurately detect SFTS virus and Orientia tsutsugamushi at the same time.

The test using the primer and probe set for simultaneous detection of severe febrile thrombocytopenia syndrome and tsutsugamushi according to the present application does not cross-detect the SFTS virus and Orientia tsutsugamushi, but has the advantage of being able to distinguish and detect at the same time.

In addition, the test method for simultaneous detection of severe febrile thrombocytopenia syndrome and tsutsugamushi according to the present application uses a composition including the primer and probe set to achieve high specificity through real time reverse transcription polymerase chain reaction (real time RT-PCR). It has the advantage of being able to perform quantitative analysis with high sensitivity. And, if the test method according to an embodiment of the present application is used, there are advantages of high reliability and quick and easy clinical diagnosis.

Hereinafter, the present application will be described in more detail.

The following specific structural or functional descriptions are only exemplified to describe embodiments according to the concept of the present application, and the embodiments according to the concept of the present application may be implemented in various forms, and It should not be construed as limiting.

Since the embodiment according to the concept of the present application may have various changes and may have various forms, specific embodiments will be described in detail herein. However, this is not intended to limit the embodiments according to the concept of the present application to a specific disclosed form, and should be understood to include all modifications, equivalents, and substitutes included in the spirit and scope of the present application.

The terms used herein are used only to describe specific embodiments and are not intended to limit the present application. The singular expression includes the plural expression unless the context clearly dictates otherwise.

Unless defined otherwise, all terms used herein, including technical or scientific terms, have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Terms such as those defined in a commonly used dictionary should be interpreted as having a meaning consistent with the meaning in the context of the related art, and are not to be interpreted in an ideal or excessively formal meaning unless explicitly defined in the present specification. .

One embodiment of the present application is a first primer and probe set comprising a primer set of SEQ ID NO: 1 to 2 and a probe of SEQ ID NO: 3; and a second primer and probe set comprising a primer set of SEQ ID NOs: 7 to 8 and a probe of SEQ ID NO: 9; It provides a primer and probe set for simultaneous detection of severe fever with Thrombocytopenia Syndrome (SFTS) and tsutsugamushi (Orientia tsutsugamushi) comprising a.

In the present application, the term "primer" refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be amplified, and may serve as a starting point for synthesis of a primer extension product. The primer is capable of initiating DNA synthesis in the presence of four different nucleoside triphosphates and reagents for polymerization (ie, DNA polymerase or reverse transcriptase) in an appropriate buffer and temperature. The primer of the present invention may be a primer that specifically amplifies a specific region of the SFTS virus and Tsutsugamushi bacteria.

The primers may also incorporate additional features that do not change the basic properties. That is, the nucleic acid sequence can be modified using a number of means known in the art. Examples of such modifications include methylation, encapsulation, substitution of a nucleotide with one or more homologues and uncharged linkages such as phosphonates, phosphotriesters, phosphoroamidates or carbamates or phosphorothioates or phosphorodithioates. Modification of nucleotides into charged linkages such as In addition, the nucleic acid may include one or more of nucleases, toxins, antibodies, signal peptides, proteins such as poly L lysine, intercalating agents such as acridine or psoralen, chelating agents such as metals, radioactive metals, iron oxidizing metals, and alkylating agents. It may have additional covalently attached residues. In addition, the primer of the present invention may contain a nucleotide analogue, for example, phosphorothioate, alkyl phosphorothioate phosphorothioate or peptide nucleic acid, or an intercalating agent. ) may be included.

In the present application, the term “probe” refers to a nucleic acid fragment corresponding to several to hundreds of bases capable of specifically binding to DNA or RNA, and includes an oligonucleotide probe, a single stranded DNA probe, a double It may be prepared in the form of a double stranded DNA probe or an RNA probe.

The probe can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. These probes can be modified using many means known in the art as long as they exhibit an effect capable of detecting SFTS virus and Tsutsugamushi. Examples of such modifications include methylation, encapsulation, substitution of one or more homologues of natural nucleotides, and modifications between nucleotides, such as uncharged linkages (eg, methylphosphonates, phosphotriesters, phosphoroamidates). , carbamates, etc.) or charged linkages (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids may contain one or more additional covalently linked residues, such as proteins (eg, nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalators (eg, acridine). , proralene, etc.), chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.) and alkylating agents.

In addition, the probe sequence of the present invention can be modified using a label capable of directly or indirectly providing a detectable signal. The probe may contain a label that can be detected using spectroscopic, photochemical, biochemical, immunochemical or chemical means. Useful labels include proteins for which 32P, fluorescent dyes, electron-dense reagents, enzymes (commonly used in ELISAs), biotin or haptens and antisera or monoclonal antibodies are available, at the 5' and 3' ends, respectively. It includes a fluorescent material and a quencher, and when a plurality of probes are included, the fluorescent material included at the 5' end of each probe may be the same.

The fluorescent material is 6-FAM (6-carboxyfluorescein), 5-FAM (5-carboxyfluorescein), hexachloro-6-carboxyfluorescein (Hexachloro-6-carboxyfluorescein), tetrachloro-6-carboxyfluorescein (Tetrachloro) -6-carboxyfluorescein), HEX (2',4',5',7'-tetrachloro-6-carboxy-4,7-dichlorofluorescein), Fluorescein chlorotriazinyl, Rhodamine green ), Rhodamine red, Tetramethylrhodamine, FITC (Fluorescein isothiocyanate), Oregon green, Alexa fluor, JOE (6-Carboxy-4',5') -Dichloro-2',7'-Dimethoxyfluorescein), ROX(6-Carboxyl-X-Rhodamine), TET(Tetrachloro-Fluorescein), TRITC(Tertramethylrodamine isothiocyanate), TAMRA(6-carboxytetramethyl-rhodamine), NED(N-( 1-Naphthyl) ethylenediamine), Texas red (Texas red), Cy3 (Cyanine-3) and Cy5 (Cyanine-5) may be any one or more selected from the group consisting of.

The quencher is BHQ1 (Black hole quencher 1), BHQ2 (Black hole quencher 2), BHQ3 (Black hole quencher 3), TAMRA (6-carboxytetramethyl-rhodamine), NFQ (Nonfluorescent quencher), Dabcyl, Eclipse, It may be at least one selected from the group consisting of Deep Dark Quencher (DDQ), Blackberry Quencher, and Iowa black.

In one embodiment of the present application, the first primer and probe set may complementarily bind to the S segment (S segment) of the SFTS virus.

The first primer and probe set may complementarily bind to a conserved region in the entire gene sequence of the SFTS virus.

In one embodiment of the present application, the second primer and probe set may complementarily bind to the htrA gene of Orientia tsutsugamushi.

The second primer and probe set can complementarily bind to the nucleotide sequence of the htr A gene among the entire gene sequence of Orientia tsutsugamushi, and the htr A gene is an envelope-related protease, DegP having dual functions as a chaperone and a protease. It may be a protein.

In one embodiment of the present application, the primer and probe set may be a primer and probe set for real time reverse transcription polymerase chain reaction (real time RT-PCR).

In the present application, the term “RT-PCR” is an abbreviation of reverse transcription polymerase chain reaction, a type of polymerase chain reaction (PCR) that amplifies DNA, and is a complementary It is an experimental technique for amplifying DNA (cDNA). A general experimental technique that replicates and amplifies a specific part of DNA several times is called 'polymerase chain reaction' (PCR). Polymerase chain reaction is a technology that can amplify a specific genetic material desired for detection by 200,000 to 500,000 times in a short time from a trace amount of DNA isolated from blood or cells. On the other hand, the 'reverse transcription polymerase chain reaction' is a technique used to measure the expression level of an actual gene through mRNA rather than DNA, and artificially complementary DNA (complementary DNA) using reverse transcriptase from mRNA. , cDNA) is synthesized, and from this complementary DNA, the polymerase chain reaction (PCR) step is performed.

PCR typically consists of three reaction steps. The first is the DNA denaturation step, which separates the two-stranded DNA into single-stranded DNA by applying a temperature, and the second is the primer binding step. Each of the primer pairs is bound to a complementary single-stranded template DNA, and the third step is to extend the primer by acting with a DNA polymerase in a state where four types of substrates (dNTPs) coexist in an extension reaction.

The PCR can use a conventional PCR reaction, preferably the most common conventional (Conventional) PCR, duplex (duplex) PCR and nested PCR in which two PCRs are performed simultaneously or consecutively, results in real time Expensive real-time PCR can be used to confirm , and most preferably, conventional PCR or real-time PCR can be used.

In the present application, the term “real-time polymerase chain reaction” refers to a method of amplifying DNA in real time based on a polymerase chain reaction and simultaneously measuring the amplified amount.

Since the real-time polymerase chain reaction can be confirmed by monitoring the increase in PCR amplification products in real time, there is no need to use an additional electrophoretic analysis method, and the existing PCR method for confirming the PCR amplification product at the end point is not required. Compared to that, PCR can be analyzed quickly and easily, and the risk of contamination is low. In addition, the real-time polymerase chain reaction amplification product detection method is specific to a target sequence and uses a probe to which a fluorescent dye is bound, and has high detection specificity, so even similar sequences can be distinguished and detected. can

In addition, when the real-time polymerase chain reaction is performed on DNA, it can be referred to as qPCR, and when the real-time polymerase chain reaction is performed on RNA instead of DNA, it can be referred to as RT-qPCR.

In addition, RT-PCR may be performed using a PCR reaction mixture (PCR premix) containing several components known in the art. The PCR reaction mixture may contain an appropriate amount of DNA polymerase, dNTP, PCR buffer, and water (dHO).

In addition, the PCR buffer solution may include tris-HCl (tris-HCl), MgCl2, KCl, and the like.

Real time reverse transcription polymerase chain reaction (RT-PCR) is an attractive option as a fast, sensitive and specific method for the detection of viruses in the early stages of infection. Standard RT-qPCR and quantitative RT-qPCR can provide a fast, specific and sensitive method for early detection of viruses.

In one embodiment of the present application, the real-time reverse transcription polymerase chain reaction may be performed under the following conditions. 1 cycle of reverse transcription reaction step at 45~55℃ for 3min~10min, preliminary denaturation step of 1 cycle at 85~97℃ for 5sec~1min at 85~97℃, denaturation step of 5sec~15sec at 85~97℃and 50~60 It may include a reaction step of performing annealing and extension steps of 10 to 30 seconds at °C for 45 cycles. The real-time reverse transcription polymerase chain reaction can be performed within a total of 60 minutes, specifically within 45 minutes, and more specifically within 35 minutes. It has the advantage of being able to detect quickly.

In one embodiment of the present application, the detection limit of the first primer and probe set may be 2 to 5 Copy number/ul, more specifically 2 to 4 Copy number/ul, even more specifically 2.4 It may be a copy number/ul. In the above range, the detection rate may be 90% to 100%. 5 Copy number/ul or more, the detection rate is 100%.

In the present application, the term "detection limit (Lod)" is the minimum detection concentration at which the presence or absence of an analyte can be checked after performing the analysis process, and by detecting in the above range, high sensitivity using the first primer and probe set of the present application SFTS virus can be detected.

In one embodiment of the present application, the detection limit of the second primer and probe set may be 10 to 16 Copy number/ul, more specifically 12 to 15 Copy number/ul, and even more specifically 14.5 Copy It can be number/ul. In the above range, the detection rate may be 90% to 100%. If more than 15 Copy number/ul, the detection rate is 100%.

By detecting in the above range, Orientia tsutsugamushi can be detected with high sensitivity using the second primer and probe set of the present application.

One embodiment of the present application provides a composition for simultaneous detection of severe fever with thrombocytopenia syndrome and tsutsugamushi, including the primer and probe set.

In one embodiment of the present application, the composition, PCR premix; a mixed solution of the primer and probe set; and Internal positive control (IPC); may include.

In the present application, the term “PCR premix” refers to ready-to-use reagents that can be directly subjected to PCR reaction by putting a DNA sample to be analyzed as a reaction mixture prepared in advance before the PCR reaction.

The PCR premix may be a dNTPs (dATP, dCTP, dGTP, dTTP) mixture, magnesium chloride (MgCl2), a master mix further comprising a DNA polymerase or a buffer solution (Master Mix).

One embodiment of the present application provides a kit for simultaneous detection of severe fever with thrombocytopenia syndrome and tsutsugamushi, comprising the composition.

The kit is not limited to a specific form, and may be implemented in various forms. In one embodiment, the kit may include lyophilized primers contained in a container such as a disposable PCR tube. Each primer pair may be all mixed and contained in a PCR tube, or each primer pair may be individually contained in each PCR tube. For example, the kit may include a disposable PCR tube containing the primers and probes of SEQ ID NOs: 1 to 3 in the form of a freeze-dried powder and a disposable PCR tube containing the primers and the probe of SEQ ID NOs: 7 to 9 in the form of a freeze-dried powder. have.

In the detection kit, a reaction mixture including the primer and probe, reverse transcriptase, polymerase, and buffer may be contained in a liquid form in a container such as a PCR tube. It can be stored frozen and used after thawing if necessary. Since the detection kit does not require a separate process other than adding a sample, it has the advantage of increasing the convenience and properties of detection.

One embodiment of the present application is (a) obtaining genomic DNA containing Orientia tsutsugamushi from a biological sample containing Orientia tsutsugamushi, and RNA containing SFTS virus from a biological sample containing SFTS virus obtaining a transcriptome; (b) using the nucleic acid obtained in step (a) as a template and amplifying the target sequence by performing an amplification reaction with the primer and probe sets; and (c) detecting the amplification product obtained in step (b); It provides a test method for simultaneous detection of severe febrile thrombocytopenia syndrome and tsutsugamushi, comprising a.

As used herein, the term “biological sample” may be a body fluid or tissue sample collected from a test subject suspected of having severe febrile thrombocytopenia and tsutsugamushi. The test target may be a body fluid or tissue sample collected from animals including humans, wild animals, livestock, companion animals, and the like. The body fluid may be blood, serum, plasma, lymph, bone marrow fluid, saliva, milk, urine, feces, eye fluid, semen, brain extract, spinal fluid, joint fluid, ascites, amniotic fluid, or tissue fluid, but is not limited thereto. . In addition, the test target may be a mite or an insect, and the mite may be a small small tick or a hair mite.

The biological sample may be diluted before instillation into the sample pad of the kit for simultaneous detection of severe fever with thrombocytopenia syndrome and tsutsugamushi of the present application or used without dilution.

Hereinafter, the present application will be described in more detail through Preparation Examples, Examples, Comparative Examples and Experimental Examples. These examples are only for illustrating the present application, and it will be apparent to those of ordinary skill in the art that the scope of the present application is not to be construed as being limited by these examples.

< manufacturing example 1> target genetic selection and primer and probe making

Primers and probes capable of simultaneously detecting SFTS virus and Tsutsugamushi bacteria were prepared, and their sequences are shown in Table 1 below. In order to select a primer capable of simultaneously detecting the SFTS virus and Tsutsugamushi bacteria as shown in Table 1 below, the performance of a plurality of primer sequences was evaluated experimentally, and then the primer sequences showing the performance having a remarkable effect were selected.

The primer and probe sequences in Table 1 below allow simultaneous detection of SFTS virus and Tsutsugamushi bacteria in a single reaction within a short time under the same conditions, have excellent sensitivity, and no cross-reaction on target genes. In addition, the primer and probe sequences were included in the sample and there was no interference reaction with interfering substances that could affect the detection result, showed reproducible results, and showed storage stability for 365 days. A reporter Cys or FAM (6-carboxyfluorescein) was bound to the 5' end of the probe, and a quencher BHQ (black hole quencher) 1 or 2 was bound to the 3' end.

Pathogen name target
gene primer and
probe designation 5' end base sequence (5' - 3') 3' end Length
(bp) Tm
(℃) Severe Fever with Thrombocytopenia Syndrome (SFTS) Segment S
Example 1 SFTS-F - GGGTCCCTGAAGGAGTTGTAAA
(SEQ ID NO: 1) - 22 58.4 SFTS-R - TGCCTTCACCAAGACTATCAATGT
(SEQ ID NO: 2) - 24 57.3 SFTS-P Cy5 TTCTGTCTTGCTGGCTCCGCGC
(SEQ ID NO: 3) BHQ2 22 67.5 Orientia tsutsugamushi HtrA

(SET 1)
Comparative Example 1 OT-N225F - GCTGTATCTTCAACTATGCTTAATTC
(SEQ ID NO: 4) - 26 60 OT-N256R - ACCACAAGGCTTTGATCATTA
(SEQ ID NO: 5) - 21 59 OT-N257P FAM TTGTTGCTCACTATCCTCACCTT
(SEQ ID NO: 6) FAM 23 65 HtrA

(SET 2)
Example 1 OT-N258F - GGTTTAAGAGGAACAGTAACAAATG
(SEQ ID NO: 7) - 25 60 OT-N259R - CTACCCATATGAAYAGCAGCATTAG
(SEQ ID NO: 8) - 25 60 OT-N260P FAM ATCAGTTACTATGCCGTTACCCATATCT (SEQ ID NO: 9) FAM 28 68 HtrA

(SET 3)
Comparative Example 2 OT-N261F - ACTTCAGCTAATAATAATGGRTTATTTG
(SEQ ID NO: 10) - 28 60 OT-N262R - GTCTTAGCCCCATTTTTAAACCATA
(SEQ ID NO: 11) - 25 61 OT-N263P FAM CCTTGAAGTTTCGCCTAACTCTTCTTGG (SEQ ID NO: 12) FAM 28 70

(F; forward primer, R; reverse primer, P; probe, Tm; melting temperature)

< Experimental example 1> Real-time reverse transcription Sensitivity evaluation of the polymerase chain reaction

To evaluate the analytical sensitivity of real-time reverse transcription polymerase chain reaction (real-time RT-PCR) using primers and probe sets represented by a total of 12 nucleotide sequences prepared in Preparation Example 1, the genome of Orientia tsutsugamushi ( Genomic) DNA was used to confirm the limit of detection (LoD). The experiment was performed in accordance with the 'Guideline for In Vitro Diagnostic Medical Device Approval Review' of the Ministry of Food and Drug Safety, and the minimum detection limit was calculated as the lowest concentration showing a 95% detection rate using standard substances as defined in the guidelines.

Specifically, 3ul of the biological sample 2x master mix (Master mix) 5ul, 1 ul of a mixed solution including the first and second primers and probe sets and 1 ul of an internal positive control to check whether PCR was well performed (Internal positive control) ( After mixing with Table 2) (Table 3), a real-time reverse transcription polymerase chain reaction (real-time RT-PCR) was performed using the PCR apparatus of the present application under the reaction conditions shown in Table 4 below. The average (average), standard deviation (SD), coefficient of variation (CV), and detection rate of the measured Ct (cycle threshold) values were measured by performing repeated experiments 24 times under the same conditions, 95 The % positive interval was verified with a probit regression model using a statistical program (IBM SPSS Statistics, IBM).

Pathogen name target
gene primer and Probe name 5' end base sequence (5' - 3') 3' end length (bp) Tm
((℃) Internal positive control SSIIb SSIIb-F - CCAGTGCGGTGAAGCCAGAG
(SEQ ID NO: 13) - 20 63.4 SSIIb-R GCCAGGTTCATTATCCTCCCTGTCATA
(SEQ ID NO: 14) 27 65.0 SSIIb-P HEX CACTCGCCGCCGCATCTGTAGCC
(SEQ ID NO: 15) BHQ1 23 69.6

In order to confirm that the synthesized primers can specifically detect SFTS virus and Tsutsugamushi bacteria, PCR was performed using the primers and probe sets in Table 1, respectively. The composition of the PCR reaction mixture was as shown in Table 3. PCR conditions, as shown in Table 4, perform 1 cycle of reverse transcription step at 50° C. for 5 minutes, perform 1 cycle of preliminary denaturation step at 95° C. for 8 seconds, denaturation step at 95° C. for 9 seconds, and at 56° C. A PCR cycle consisting of annealing and extension steps for 13 seconds was performed for 45 cycles.

SFTS virus/ Tsutsugamushi bacteria Detection reagent composition Dose per 1 reaction PCR premix (2X rt-Master mix) 5 μl Primer and probe mixture 1 μl IPC (Internal positive control) DNA 1 μl biological sample 3 μl full capacity 10 μl

RT- PCR reaction step Temperature time number of cycles Reverse-transcription 50 ℃ 5 minutes One Pre-denaturation 95 ℃ 8 seconds One Denaturation 95 ℃ 9 seconds 45 Annealing and extension 56 ℃ 13 seconds total reaction time About 35 minutes or less

The PCR screening efficiency for the genomic DNA of Tsutsugamushi bacteria represented by each primer and probe set of the present application is shown in Table 5 below.

copies/
ul Set 1( comparative example One) Set 2( Example One) Set 3( comparative example 2) SFTS OT IPC SFTS OT IPC SFTS OT IPC 100000 19.51 19.43 22.92 19.19 17.14 22.87 19.44 16.51 22.78 10000 21.61 22.53 23.04 22.19 22.83 22.90 22.03 22.76 22.88 1000 25.00 26.21 22.81 24.80 26.16 23.02 24.44 27.37 22.81 100 27.30 29.34 22.83 27.41 30.16 23.06 27.66 28.61 22.65 10 32.37 N/A 22.92 30.12 33.34 22.97 29.80 N/A 22.87

As a result, the primer and probe set of Example 1 can detect up to 10 copies/ul of Tsutsugamushi with a detection rate of 100%, but the primer and probe sets of Comparative Examples 1 and 2 are DNA 10 copies/ul. Since Tsutsugamushi was not detected, it was confirmed that the reactivity and sensitivity of Example 1 were higher.

The analytical sensitivities of real time reverse transcription polymerase chain reaction (real time RT-PCR) using a composition including a primer and a probe set for detecting SFTS virus of SEQ ID NOs: 1 to 3 of the present application are shown in Table 6 below. The SFTS was 100% when it was 2.4 copies/ul, so it could be confirmed that the detection limit was 2.4 copies/ul.

density
copies/ul 333.3 111.1 37.00 12.3 4.1 1.4 SFTS One 27.85 29.91 31.33 32.96 35.36 N/A 2 27.74 29.21 31.24 32.62 35.95 35.46 3 27.47 29.20 31.11 33.19 32.91 33.90 4 27.62 28.89 30.72 32.68 34.67 36.13 5 27.83 29.84 30.78 33.47 34.66 34.42 6 27.80 29.62 32.18 33.10 34.42 36.10 7 27.90 30.49 31.25 32.98 34.56 34.52 8 28.08 29.59 30.86 32.79 35.49 36.20 9 27.68 29.54 31.03 33.09 34.72 N/A 10 28.00 29.44 30.85 32.22 34.16 38.92 11 28.03 29.30 30.84 32.42 33.32 35.52 12 28.02 29.72 30.63 32.57 34.99 N/A 13 26.68 28.04 30.24 32.43 33.53 34.97 14 26.81 28.37 30.13 32 32.76 35.46 15 25.98 28.61 30.16 31.83 34.65 33.24 16 25.62 28.36 30.38 31.98 34.68 33.46 17 27.14 28.67 30.60 32.27 33.13 36.26 18 27.32 28.74 30.29 32.41 33.44 34.72 19 27.09 28.51 30.75 32.52 33.36 34.80 20 27.04 28.72 31.12 31.49 33.57 36.12 21 27.94 29.60 30.84 32.23 33.78 N/A 22 27.90 29.79 30.97 32.91 33.24 N/A 23 28.08 29.71 30.65 32.09 34.12 35.04 24 28.13 29.21 30.88 32.11 34.10 35.96 Average 27.49 29.21 30.83 32.52 34.15 35.33 Standard Deviation 0.67 0.61 0.45 0.48 0.86 1.27 CV% 2.44% 2.08% 1.45% 1.49% 2.51% 3.60% detection rate ( % ) 100% 100% 100% 100% 100% 79%

(CV: ratio of mean to standard deviation)

In addition, the analytical sensitivities of real-time reverse transcription polymerase chain reaction (real-time RT-PCR) using a composition including a primer and a probe set for detecting Tsutsugamushi bacteria of SEQ ID NOs: 7 to 9 of the present application are shown in Table 7 below. Tsutsugamushi was 100% when it was 14.5 copies/ul, so it could be confirmed that the detection limit was 14.5 copies/ul.

density
copies/ul 1000 333.3 111.1 37 12.3 4.1 Tsutsugamushi One 26.54 27.41 29.03 30.34 31.10 34.39 2 26.43 27.53 28.58 30.12 32.08 N/A 3 25.32 26.49 27.79 30.64 30.52 32.91 4 25.72 26.48 27.63 27.93 31.90 34.30 5 25.18 26.77 27.60 29.56 32.34 34.14 6 24.87 26.27 27.83 29.54 33.00 N/A 7 26.42 27.36 29.13 29.86 31.31 34.58 8 26.26 27.23 29.24 29.69 31.66 34.78 9 25.40 26.12 28.01 29.70 30.97 35.22 10 25.32 26.07 27.87 29.11 31.06 34.08 11 26.03 27.13 28.25 31.03 32.06 34.06 12 26.29 27.40 28.73 29.88 30.66 N/A 13 25.38 26.53 28.05 29.87 30.82 35.76 14 25.29 26.66 28.10 30.79 33.94 34.52 15 25.15 26.31 27.69 29.71 32.45 N/A 16 25.37 26.66 28.15 31.6 32.54 35 17 25.82 27.06 28.51 31.46 N/A N/A 18 26.13 27.05 28.93 31.62 33.06 N/A 19 26.56 27.42 28.58 30.11 N/A N/A 20 26.43 27.32 29.01 31.16 32.58 35.74 21 26.11 27.65 29.31 31.04 31.79 N/A 22 26.09 27.18 28.85 29.94 32.58 34.19 23 25.46 26.90 28.73 30.03 31.86 34.58 24 25.48 26.78 28.05 30.06 30.41 N/A Average 25.79 26.91 28.40 30.20 31.85 34.55 Standard Deviation 0.52 0.47 0.55 0.86 0.93 0.71 CV% 2.02% 1.75% 1.93% 2.83% 2.91% 2.06% detection rate ( % ) 100% 100% 100% 100% 92% 63%

< Experimental example 2> Assess the analytical specificity of real-time polymerase chain reaction

Analytical specificity of real-time PCR using the primer and probe set of Example 1 was analyzed, and cross-reaction by other strains was confirmed. To evaluate the specificity of the test method for each pathogen, genes extracted from 29 pathogens or human blood were used.

As a result of the test, it was confirmed that Example 1 specifically amplifies only the genes of the SFTS virus and Tsutsugamushi because it did not show a reaction in all other pathogens except for the SFTS virus and Tsutsugamushi. Table 8 shows a list of pathogens used for cross-reaction evaluation and cross-reaction Ct values. In the case of SFTS virus and Tsutsugamushi, the cross-reactivity evaluation of the test method confirmed the specificity of this test method by confirming the reaction only in the nucleic acids of SFTS virus and Tsutsugamushi. The primer and probe set of Example 1 did not amplify pathogen genes and transcripts other than SFTS virus and Tsutsugamushi. From this, it can be seen that the primer and probe sets of the present application do not exhibit cross-reaction between SFTS virus and pathogens other than Tsutsugamushi.

No. strain FAM( OT ) Cy5 ( SFTS ) IPC One Streptococcus pneumoniae N/A N/A 20.94 2 Staphylococcus aureus N/A N/A 20.58 3 Enterohemorrhagic Escherichia coli N/A N/A 20.75 4 Salmonella enterica N/A N/A 20.56 5 Pseudomonas aeruginosa N/A N/A 20.58 6 Bacillus cereus N/A N/A 20.37 7 Shigella sonnei N/A N/A 20.34 8 Mycoplasma pneumoniae N/A N/A 20.40 9 Chlamydophila pneumoniae N/A N/A 20.69 10 Haemophilus influenzae N/A N/A 20.58 11 Legionella pneumophila N/A N/A 20.52 12 Candida albicans N/A N/A 20.42 13 Bordetella pertussis N/A N/A 20.59 14 Mycobacterium tuberculosis N/A N/A 20.40 15 Adenovirus 3 N/A N/A 20.34 16 Influenza A H1 N/A N/A 20.23 17 Influenza A H3 N/A N/A 20.04 18 Influenza A H1N1 N/A N/A 20.24 19 Influenza B N/A N/A 20.16 20 Metapneumovirus N/A N/A 20.33 21 Rhinovirus N/A N/A 20.23 22 Respiratory syncytial virus A N/A N/A 20.24 23 Coronavirus NL63 N/A N/A 20.24 24 Coronavirus 229E N/A N/A 20.15 25 Coronavirus HKU-1 N/A N/A 20.23 26 Parainfluenza virus 1 N/A N/A 20.18 27 Parainfluenza virus 2 N/A N/A 20.28 28 Parainfluenza virus 3 N/A N/A 20.19 29 Multi OT/SFTS PC 22.55 25.29 20.14 30 negative control N/A N/A 20.08

<110> MiCo BioMed Co., Ltd. <120> PRIMER AND PROBE SETS FOR SIMULTANEOUS DETECTING SEVERE FEVER WITH THROMBOCYTOPENIA SYNDROME AND ORIENTIA TSUTSUGAMUSHI <130> 19P1101 <160> 15 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 1 gggtccctga aggagttgta aa 22 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 2 tgccttcacc aagactatca atgt 24 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> probe <400> 3 ttctgtcttg ctggctccgc gc 22 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 4 gctgtatctt caactatgct taattc 26 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 5 accacaaggc tttgatcatt a 21 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe <400> 6 ttgttgctca ctatcctcac ctt 23 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 7 ggtttaagag gaacagtaac aaatg 25 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 8 ctacccatat gaayagcagc attag 25 <210> 9 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> probe <400> 9 atcagttact atgccgttac ccatatct 28 <210> 10 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 10 acttcagcta ataataatgg rttatttg 28 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 11 gtcttagccc catttttaaa ccata 25 <210> 12 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> probe <400> 12 ccttgaagtt tcgcctaact cttcttgg 28 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 13 ccagtgcggt gaagccagag 20 <210> 14 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 14 gccaggttca ttatcctccc tgtcata 27 <210> 15 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe <400> 15 cactcgccgc cgcatctgta gcc 23

Claims (11)

a first primer and probe set comprising a primer set of SEQ ID NOs: 1 to 2 and a probe of SEQ ID NO: 3; and
a second primer and probe set comprising a primer set of SEQ ID NOs: 7 to 8 and a probe of SEQ ID NO: 9;
A primer and probe set for simultaneous detection of Severe Fever with Thrombocytopenia Syndrome (SFTS) and Orientia Tsutsugamushi (OT) comprising a.
The method according to claim 1,
The first primer and probe set is a set of primers and probes for simultaneous detection of severe fever with thrombocytopenia syndrome and tsutsugamushi, characterized in that it complementarily binds to the S segment (S segment) of the SFTS virus.
The method according to claim 1,
The second primer and probe set is a primer and probe set for simultaneous detection of severe fever with thrombocytopenia syndrome and Tsutsugamushi, characterized in that it complementarily binds to the htrA gene of Orientia tsutsugamushi.
The method according to claim 1,
The primer and probe set is a primer and probe set for simultaneous detection of severe fever with thrombocytopenia syndrome and tsutsugamushi, characterized in that it is a primer and probe set for real-time reverse transcription polymerase chain reaction (RT-PCR).
The method according to claim 1,
A primer and probe set for simultaneous detection of severe fever with thrombocytopenia syndrome and tsutsugamushi, characterized in that the detection limit of the first primer and probe set is 2 to 5 Copy number/ul.
The method according to claim 1,
A primer and probe set for simultaneous detection of severe fever with thrombocytopenia syndrome and tsutsugamushi, characterized in that the detection limit of the second primer and probe set is 10 to 16 Copy number/ul.
A composition for simultaneous detection of severe fever with thrombocytopenia syndrome and tsutsugamushi, comprising the primer and probe set of any one of claims 1 to 6.
8. The method of claim 7,
The composition is
PCR premix;
a mixed solution of the primer and probe set; and
Internal positive control (IPC); of
A composition for simultaneous detection of severe fever with thrombocytopenia syndrome and tsutsugamushi, comprising:
A kit for simultaneous detection of severe fever with thrombocytopenia syndrome and tsutsugamushi comprising the composition according to claim 7.
(a) obtaining genomic DNA containing Orientia tsutsugamushi from a biological sample containing Orientia tsutsugamushi;
obtaining an RNA transcriptome containing the SFTS virus from a biological sample containing the SFTS virus;
(b) amplifying the target sequence by using the nucleic acid obtained in step (a) as a template and performing an amplification reaction with the primer and probe sets of any one of claims 1 to 6; and
(c) detecting the amplification product obtained in step (b);
A test method for simultaneous detection of severe fever with thrombocytopenia syndrome and tsutsugamushi comprising a.
11. The method of claim 10,
The biological sample is a test method for simultaneous detection of severe fever with thrombocytopenia syndrome and tsutsugamushi, characterized in that the test target blood or mites.