KR102571382B1 - Marker composition for detecting Lumpy skin disease virus and uses thereof - Google Patents

Abstract

The present invention relates to a marker composition for detecting Lumpy skin disease virus and its use, and since the marker composition of the present invention can detect Lumpy skin disease virus quickly and accurately, introduction can be effectively prevented.

Description

Marker composition for detecting Lumpy skin disease virus and uses thereof {Marker composition for detecting Lumpy skin disease virus and uses thereof}

The present invention relates to a marker composition for detecting Lumpyskin disease virus and its use.

Lumpy skin disease, a compound word of Lumpy (lump) and skin (skin), is a non-zootic disease that infects cattle and water buffalo but is not contagious to humans. . Lumpy skin disease is caused by infection with Lympy skin disease virus, a poxvirus, and it proliferates in epithelial cells located in the skin and mucous membranes of cattle. The transmission of Lumpyskin disease is mainly caused by blood-sucking insects such as flies (stial flies, Stomoxys calcitrans, etc.), mosquitoes ( Culex species, Aedes species, etc.), mites ( Ixodid species, etc.), and economic damage is caused when it occurs. Because of its size, it is designated as a first-class livestock infectious disease under the 'Livestock Contagious Disease Prevention Act', and there have been no cases in Korea yet.

Infection with Lumpyskin's disease results in the formation of numerous small necrotic or ulcerative nodules (nodules) that cover the entire body, leaving permanent scars on the skin. In addition, nodular lesions occur on the mucous membranes of the digestive tract, such as the oral cavity and intestinal mucosa, which rapidly deteriorates the state of health of the cow and lasts for several months in a severely emaciated state, resulting in a great blow to carcass (meat) production. Infertility of bulls, etc. may occur. Korean beef ( Bos taurus ) and beef cattle (mostly Holstein bulls), which account for most of Korea's meat cattle, are classified as highly susceptible species to Lumpyskin disease. Younger calves are more susceptible to infection and can develop severe symptoms.

Lumpyskin disease has been considered endemic to Africa for a considerable period of time since it was first discovered in Zambia, Africa in 1929. However, it first broke out of Africa in 1989 and started in Israel. After spreading throughout the Middle East (2012), it spread to Southeastern Europe (Greece, Bulgaria, Romania, etc., 2015) located in the Balkans through Turkey (2013). In addition, it was reported in September 2019 not only in Russia (2015), India, and Bangladesh, but also in Xinjiang, China, which borders Kazakhstan, and gradually moved eastward. As an outbreak was reported in the Russian Far East in September 2017, the risk of domestic inflow has increased. In addition, occurrences have been reported in Nepal (July 2020), Vietnam (November 2020), Myanmar (November 2020), Hong Kong (November 2020), and Sri Lanka (January 2021). The incidence of Lumpyskin's disease is predicted to become wider. To date, most outbreak countries are blocking the spread through vaccine policies. International organizations such as the World Health Organization (WHO) and the Food and Agriculture Organization (FAO) are also emphasizing early detection and prompt vaccination to prevent the spread of bovine lumpiskin disease. The Ministry of Agriculture, Food and Rural Affairs is preparing emergency action guidelines (SOPs), including measures for each outbreak situation, epidemiological investigation, and vaccination tips, by organizing a council of related experts as the possibility of domestic inflow of bovine lumpiskin disease increases.

International organizations such as FAO and World Organization for Animal Health (OIE), as well as the European Union Food Safety Authority (EFSA), which has experienced outbreaks in Eastern Europe, recognizes and reports the index case of Lumpyskin disease immediately on the spot for early detection We are emphasizing that what we do is the most important thing. To this end, cattle farmers and all stakeholders involved in related fields (veterinarians, slaughterhouse workers, etc.) should be well aware of the clinical symptoms of Lumpiskin disease, and immediately report to the competent livestock quarantine agency when suspected. Therefore, it is necessary to develop technology for early diagnosis of Lumpyskin's disease in order to prevent and manage Lumpyskin's disease.

On the other hand, Korea Patent Registration No. 1562460 discloses 'a composition and method for diagnosing Johne's disease containing a Johne's disease-specific marker', a livestock infectious disease, but the present invention's marker composition for detecting Lumpiskin's disease virus and its use are described there is no bar

The present invention was derived from the above needs, and the present inventors used the nucleotide sequence of the G-protein-coupled chemokine receptor ( GPCR ) gene of Lumpy skin disease virus to prepare primer sets and probes And, the present invention was completed by confirming that the prepared primer set and probe had excellent specificity and sensitivity to the Lumpyskin disease virus.

In order to solve the above problems, the present invention provides a marker composition for detecting Lumpy skin disease virus, comprising an oligonucleotide primer set of SEQ ID NOs: 1 and 2 and an oligonucleotide probe of SEQ ID NO: 3.

In addition, the present invention is the marker composition; And reagents for carrying out the amplification reaction; it provides a kit for detecting Lumpiskin's disease virus, including.

In addition, the present invention comprises the steps of isolating genomic DNA from a sample of an individual suspected of Lumpyskin's disease; Amplifying a target sequence by performing an amplification reaction using the genomic DNA isolated in the above step as a template and using the marker composition according to the present invention; And detecting the product of the amplification step; it provides a method for detecting Lumpiskin's disease virus, including.

Since the Lumpyskin's disease virus can be rapidly and accurately detected using the marker composition of the present invention, the introduction of the Lumpyskin's disease virus into Korea will be effectively prevented.

1 is a result of comparing the GPCR gene nucleotide sequence of the LSDV synthesized in the present invention with its original nucleotide sequence (NCBI GenBank accession No. OL977078.1).
Figure 2 is a result of comparing the β-actin gene sequence of bos taurus synthesized in the present invention with its original sequence (NCBI Gene ID: 280979).
Figure 3 is the result of performing real-time PCR using the GPCR gene-specific primer set (SEQ ID NOs: 1 and 2) and probe (SEQ ID NO: 3) of the LSDV produced in the present invention, (A) is a copy of DNA This is the result of using 6 templates that diluted the copy number by 1/10 from 100,000 copies to 1 copy, and (B) reduced the mass of DNA by 1/10 from 100 pg (picogram) to 0.1 fg (femtogram). Results using 7 diluted templates, (C) is for the negative control group (No template control; LSDV-NTC), BtACTb DNA treatment group (LSDV-BtACTb), and E. coli DH5α DNA treatment group (LSDV-DH5α) This is the result.
Figure 4 is the result of real-time PCR using the bovine β-actin (SEQ ID NO: 4 and 5) specific primer set (SEQ ID NO: 4 and 5) and probe (SEQ ID NO: 6) prepared in the present invention, (A) This is the result of using 6 templates diluted by 1/10 from 100,000 copies to 1 copy of DNA copy number, and (B) shows the DNA mass from 100 pg (picogram) to 0.1 fg (femtogram). This is the result using 7 templates diluted with /10.

In order to achieve the object of the present invention, the present invention provides a marker composition for detecting Lumpy skin disease virus, comprising an oligonucleotide primer set of SEQ ID NOs: 1 and 2 and an oligonucleotide probe of SEQ ID NO: 3 do.

The marker composition of the present invention can specifically amplify the G-protein-coupled chemokine receptor ( GPCR ) gene (NCBI GanBank accession No. OL977078.1) of the Lumpyskin disease virus.

The marker composition of the present invention may further include a bovine β-actin-specific internal control primer set and a probe, preferably oligonucleotide primer sets of SEQ ID NOs: 4 and 5 and oligonucleotides of SEQ ID NO: 6 It may further include a probe, but is not limited thereto.

In the marker composition of the present invention, the primers are 17 or more, 18 or more, 19 or more, 20 or more, 21 or more in the sequences of SEQ ID NOs: 1, 2, 4 and 5, depending on the sequence length of each primer. oligonucleotides consisting of segments of contiguous nucleotides. For example, a primer of SEQ ID NO: 1 (25 oligonucleotides) may include oligonucleotides consisting of segments of at least 21, at least 22, at least 23, at least 24 contiguous nucleotides within the sequence of SEQ ID NO: 1 . In addition, the primers may also include added, deleted or substituted sequences of the nucleotide sequences of SEQ ID NOs: 1, 2, 4 and 5. The oligonucleotide primers of SEQ ID NOs: 1 and 4 of the present invention are forward primers, and the oligonucleotide primers of SEQ ID NOs: 2 and 5 are reverse primers.

In the present invention, the term "primer" refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and can serve as a starting point for synthesis of a primer extension product. The length and sequence of the primers should allow for the synthesis of extension products to begin. The specific length and sequence of the primer will depend on the complexity of the DNA or RNA target required, as well as the conditions of use of the primer, such as temperature and ionic strength.

In this specification, oligonucleotides used as primers may also include nucleotide analogs, such as phosphorothioates, alkylphosphorothioates, or peptide nucleic acids, or Intercalating agents may be included.

The probes composed of the nucleotide sequences of SEQ ID NOs: 3 and 6 may be labeled with a fluorescent dye at the 5' end and labeled with a quencher at the 3' end, and the fluorescent dye is HEX, FAM, Texas Red ( Texas Red), fluorescein, fluorescein chlorotriazinyl, rhodamine green, rhodamine red, tetramethylrhodamine, FITC, Oregon Green (Oregon green), Alexa Fluor, JOE, ROX, NED, VIC, TET, TRITC, TAMRA, Q670, cyanine-based dyes or thiadicarbocyanine, etc., preferably It may be HEX or FAM, but is not limited thereto, and the matting agent may be selected from conventional matting agents known in the art.

In the present invention, the term "probe" refers to a single-stranded oligonucleotide sequence complementary to a nucleic acid strand to be copied, and can complementarily bind to and hybridize to a nucleotide sequence of a gene specifically amplified by the primer set. Preferably, the oligonucleotide probe of SEQ ID NO: 3 can bind to the nucleotide sequence of the GPCR gene specifically amplified by the oligonucleotide primer sets of SEQ ID NOs: 1 and 2, and the oligonucleotide primer set of SEQ ID NOs: 4 and 5 The oligonucleotide probe of SEQ ID NO: 6 can bind to the nucleotide sequence of the β-actin (antin) coding gene specifically amplified by The probe may be manufactured in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, or an RNA probe. Selection of suitable probes and hybridization conditions can be modified based on those known in the art.

The present invention also provides primer sets of SEQ ID NOs: 1 and 2 and a probe of SEQ ID NO: 3; And reagents for carrying out the amplification reaction; it provides a kit for detecting Lumpiskin's disease virus, including.

In the kit of the present invention, the marker composition is as described above.

In the kit of the present invention, reagents for performing the amplification reaction may include DNA polymerase, dNTPs, and buffers, but are not limited thereto.

The kit for detecting the Lumpyskin disease virus of the present invention may further include a user guide describing optimal reaction performance conditions. The guide is a printout explaining how to use the kit, eg, how to prepare the PCR buffer, and the reaction conditions to be presented. The guide includes a brochure in the form of a pamphlet or leaflet, a label affixed to the kit, and instructions on the surface of the package containing the kit. In addition, the guide includes information disclosed or provided through electronic media such as the Internet.

The kit of the present invention may include an internal control primer set and a probe, and preferably may further include an oligonucleotide primer set of SEQ ID NOs: 4 and 5 and an oligonucleotide probe of SEQ ID NO: 6, but is not limited thereto. .

The present invention also

Isolating genomic DNA from a sample of an individual suspected of Lumpyskin's disease;

Amplifying a target sequence by performing an amplification reaction using the genomic DNA isolated in the above step as a template and using the primer sets of SEQ ID NOs: 1 and 2 and the probe of SEQ ID NO: 3; and

It provides a method for detecting Lumpy skin disease virus, including; detecting the product of the amplification step.

The method of the present invention includes the step of isolating genomic DNA from a sample of an individual suspected of Lumpyskin's disease. The subject suspected of Lumpyskin's disease may be an individual (eg, cow, etc.) infected with a virus causing Lumpyskin's disease, and the sample includes, but is not limited to, samples such as blood, various bodily fluids, isolated tissues, and isolated cells it is not going to be A method for obtaining bodily fluids, tissues, and biopsies from an individual may use a conventional method known in the art, and a method for extracting genomic DNA from a sample of the individual may use various commercially supplied kits or extraction reagents. can be performed

A target sequence may be amplified by performing an amplification reaction using the isolated genomic DNA as a template and using a primer set and a probe according to an embodiment of the present invention. Methods for amplifying a target nucleic acid include polymerase chain reaction (PCR), ligase chain reaction, nucleic acid sequence-based amplification, transcription-based amplification system, Strand displacement amplification or amplification via Qβ replicase or any other suitable method for amplifying nucleic acid molecules known in the art. Among these, PCR is a method of amplifying a target nucleic acid from a pair of primers that specifically bind to the target nucleic acid using a polymerase. Such PCR methods are well known in the art, and commercially available kits may be used.

The real-time PCR of the present invention monitors the reaction result in real time by using a probe in which a primer set and a fluorescent substance are chemically bonded. This probe binds to the complementary sequence in the nucleic acid of the sample like two primers during the polymerase chain reaction process, and the binding site is slightly away from the primer. The probe of the present invention has a structure in which a reporter and a quencher are attached to both ends, and when the reporter and the quencher are present in close proximity, the fluorescence of the reporter is not detected by canceling the fluorescence, but the amplification proceeds According to this, the fluorescence of the reporter is detected when the reporter is removed from the quencher. Therefore, the fluorescence intensity gradually increases as the amplification cycle increases.

Detection of the amplification product according to the present invention may be performed through fluorescence measurement, gel electrophoresis, capillary electrophoresis, DNA chip, radioactivity measurement, or phosphorescence measurement, but is not limited thereto.

Hereinafter, the present invention will be described in detail by examples. However, the following examples are only to illustrate the present invention, and the content of the present invention is not limited to the following examples.

Materials and Methods

1. Gene synthesis

The entire sequence of LSDV GPCR gene 1,146 bp (NCBI GenBank accession No. OL977078.1) and the entire sequence of β-actin 1,951 bp (NCBI Gene ID: 280979) of Bos taurus to be used as an internal control for the experiment are It was obtained through gene synthesis (Generay Biotech, China). The synthesized DNA clone was double-digested with restriction enzymes Eco RI and HindIII , electrophoresed, and the LSDV GPCR gene (hereinafter referred to as LSDV-GPCR) and bovine β-actin (hereinafter referred to as BtACTb) fragments were purified from an agarose gel. used in the experiment. DNA fragment purification from the agarose gel was performed using the Biomedic ^® Gel&PCR purification kit (Biomedic Co., Ltd., Korea) according to the manufacturer's instructions, and the purified DNA fragment was measured using a DeNovix DS-11+ Spectrophotometer (DeNovix, USA). Quantitative and qualitative analysis was performed using

2. Primer and Probe Design

Specific primer sets and probes for detecting LSDV-GPCR and BtACTb were prepared through a specificity test process using Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) (Table 1). To perform real-time PCR in the Taqman method, the probe was subjected to FAM or HEX modification with a 5'-fluorophore and BHQ1 modification with a 3'-quencher.

Primer set and probe information of the present invention Oilgo name Sequence information (5'-3') (SEQ ID NO) Amplicon qPCR-LSDV-F1 ATGTTACAACGCCTTCAACTTATGA (1) 159 bp qPCR-LSDV-R1 GTCCAAAACTTGTAGTATCCACACC (2) qPCR-LSDV-internal1 FAM-TGAAGTGAGCATAGTCGATATCCCACA-BHQ1 (3) qPCR-BtACTb-F1 CTTTCTTCTCTGAGCTGAGTCTCC (4) 128 bp qPCR-BtACTb-R1 CCTACACCCACAGCACTTTATG (5) qPCR-BtACTb-internal1 HEX-CCCCAGCTGGAATCTTTTTCTGGTGT-BHQ1 (6)

3. Sensitivity analysis

To measure the detection sensitivity of the primer sets and probes designed to amplify LSDV-GPCR and BtACTb, DNA fragments were diluted by 1/10 for each copy number and concentration, and then real-time PCR was performed using this as a template. measured. DNA copy number was calculated according to the following formula.

Copy number=[(X ng)×(6.022×10 ²³ molecules/mole)]/[(N×660 g/mole)×(1×10 ⁹ ng/g)]

X, DNA amount (ng); N, DNA length (nt)

4. Real-time PCR

The composition of the PCR reaction solution was 1 μl of DNA (LSDV-GPCR DNA or bovine DNA), 2 μl of primer set (forward and reverse, 10 μM stock each), 0.4 μl of probe (10 μM stock) (primer set of LSDV-GPCR or BtACTb and Probe), 10 μl of 2x TOPreal ^TM Probe qPCR PreMIX (Enzynomics, Korea) and 6.6 μl of distilled water were mixed to make a total PCR reaction mixture of 20 μl.

The LSDV-GPCR DNA is the entire sequence of the LSDV GPCR gene, and was used after synthesizing the sequence of NCBI GenBank Accession: OL977078.1 at Generay biotechnology (http://www.generay.com.cn/, China). In addition, the bovine DNA is the entire sequence of the β-actin gene, and the sequence of NCBI Gene ID: 280979 was synthesized by Generay biotechnology and used.

The PCR process was pre-denaturation at 95° C. for 10 minutes; The process of denaturation at 95°C for 10 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 1 minute was repeated a total of 55 to 65 times. Real-time PCR was performed using a LightCycler ^® 480 II real-time PCR system (Roche Diagnostics GmbH, Germany), and all samples were performed by technical replicates 2-3 times for each condition.

Example 1. Gene synthesis

The entire sequence of GPCR (1,146 bp) and the entire sequence of BtACTb (1,951 bp) of the synthesized LSDV were re-tested through sequencing raw data (chromatogram) confirmation and restriction enzyme digestion pattern analysis, and after aligning with the original sequence to test for errors, the experiment was performed. was used (Figs. 1 and 2). The original sequence information of the LSDV GPCR gene is NCBI GenBank accession No. OL977078.1, and the original sequence information of BtACTb is NCBI Gene ID: 280979.

Example 2. Specificity and sensitivity analysis of the marker composition of the present invention

To measure DNA detection sensitivity of the primer set of the present invention, purified LSDV-GPCR and BtACTb were diluted based on copy number or mass. Six templates diluted by 1/10 from 100,000 copies to 1 copy were used for copy number, and 7 templates diluted by 1/10 from 100 pg (picogram) to 0.1 fg (femtogram) were used for the mass standard.

As a result of sensitivity measurement through real-time PCR, in the case of the LSDV-GPCR primer set, fluorescence amplification curves were confirmed at 1 × 10 ³ copies or more (FIG. 3A) and 1 fg (= 0.001 pg) or more (FIG. 3B). Since 1 fg is about 8×10 ² copies when calculated considering the size of LSDV-GPCR, the LSDV-GPCR primer set prepared in the present invention has a detection limit of 8×10 ² copies/reaction. In addition, as a result of real-time PCR using the negative control group (No template control, NTC; FIG. 3C) and BtACTb DNA or E. coli DH5α DNA as templates, it was confirmed that no fluorescence amplification curve was observed in all experimental groups. Through this, the specificity of the LSDV GPCR gene-specific primer set of the present invention was confirmed.

In addition, as a result of real-time PCR using the BtACTb primer set, fluorescence amplification curves were confirmed at 1×10 ² copies or more (FIG. 4A) and 1 fg or more (FIG. 4B). When calculated considering the BtACTb size, 1 fg is about 5×10 ² copies, so the BtACTb primer set prepared in the present invention has a detection limit of 5×10 ² copies/reaction.

The average of the Cp values according to each experimental condition is shown in Table 2 below, and the Cp value is about 40.5 to 46.9 (maximum Cp value measured) under the detection limit condition of the present invention and the maximum Cp value measured by the equipment used is Considering that it is around 50, the detection sensitivity of the primer set prepared in the present invention will be higher than the above-mentioned value.

Mean Cp value measurement result Primer
set template Mean Cp
value Primer
set template Mean Cp
value LSDV-GPCRs LSDV-100,000 copies 34.33 BtACTb BtACTb-100,000 copies 27.88 LSDV-10,000 copies 39.89 BtACTb-10,000 copies 33.80 LSDV-1,000 copies 46.37 BtACTb-1,000 copies 38.35 LSDV-100 copies n.d. BtACTb-100 copies 44.29 LSDV-10 copies n.d. BtACTb-10 copies n.d. LSDV-1 copy n.d. BtACTb-1 copy n.d. LSDV-100pg 22.00 BtACTb-100pg 18.64 LSDV-10pg 26.03 BtACTb-10pg 23.29 LSDV-1pg 33.94 BtACTb-1pg 28.67 LSDV-0.1pg 39.51 BtACTb-0.1pg 33.50 LSDV-0.01pg 43.11 BtACTb-0.01pg 36.94 LSDV-0.001pg 46.91 BtACTb-0.001pg 40.52 LSDV-0.1fg n.d. BtACTb-0.1fg n.d.

Claims (6)

oligonucleotide primer sets of SEQ ID NOs: 1 and 2 and oligonucleotide probes of SEQ ID NO: 3; And an internal control primer set of SEQ ID NOs: 4 and 5 and an oligonucleotide probe of SEQ ID NO: 6; a marker composition for detecting Lumpy skin disease virus, including a. delete The marker composition of claim 1; And a reagent for carrying out the amplification reaction; containing, Lumpy skin disease virus (Lumpy skin disease virus) detection kit. The kit according to claim 3, wherein reagents for performing the amplification reaction include DNA polymerase, dNTPs, and a buffer. Isolating genomic DNA from a sample of an individual suspected of Lumpyskin's disease;
Amplifying a target sequence by performing an amplification reaction using the genomic DNA isolated in the step as a template and using the marker composition of claim 1; and
Detecting the product of the amplification step; including, a method for detecting Lumpy skin disease virus. The method according to claim 5, wherein the detection of the amplification product is performed by fluorescence measurement, DNA chip, gel electrophoresis, radioactivity measurement or phosphorescence measurement.